16-biodna,trans.ppt

1. DNA, RNA structure

2. DNA replication

3. Transcription, translation

Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

DNA and RNA are polymers of nucleotidesDNA is a nucleic acid, made of long chains of nucleotidesFigure 10.2ANucleotidePhosphate groupNitrogenous baseSugarPolynucleotideSugar-phosphate backboneDNA nucleotidePhosphate groupNitrogenous base (A, G, C, or T)Thymine (T)Sugar (deoxyribose)


DNA has four kinds of bases, A, T, C, and GFigure 10.2BPyrimidinesThymine (T)Cytosine (C)PurinesAdenine (A)Guanine (G)


RNA is also a nucleic aciddifferent sugarU instead of TSingle strand, usuallyFigure 10.2C, DPhosphate groupNitrogenous base (A, G, C, or U)Uracil (U)Sugar (ribose)


DNA is a double-stranded helixJames Watson and Francis Crick worked out the three-dimensional structure of DNA, based on work by Rosalind FranklinFigure 10.3A, B


Hydrogen bonds between bases hold the strands together: A and T, C and GFigure 10.3DRibbon modelPartial chemical structureComputer modelHydrogen bond


Untwisting and replication of DNA each strand is a template for a new strandFigure 10.4BhelicaseDNA polymerase


DNA replication begins at many specific sitesHow can entire chromosomes be replicated during S phase?Figure 10.5AParental strandOrigin of replicationBubbleTwo daughter DNA moleculesDaughter strand


Each strand of the double helix is oriented in the opposite directionFigure 10.5B5 end3 end3 end5 endPPPPPPPP


DNA polymerase works in only one direction5 endPPParental DNAFigure 10.5CDNA polymerase molecule533535Daughter strand synthesized continuouslyDaughter strand synthesized in piecesDNA ligaseOverall direction of replication53Telomere sequences are lost with each replication.Cancer, agingtelomeres


The DNA is transcribed into RNA, which is translated into the polypeptideFigure 10.6ADNARNAProteinTRANSCRIPTIONTRANSLATIONThe information constituting an organisms genotype is carried in its sequence of bases


Transcription produces genetic messages in the form of mRNAFigure 10.9ARNA polymeraseRNA nucleotideDirection of transcriptionNewly made RNATemplate strand of DNA


In transcription, DNA helix unzipsRNA nucleotides line up along one strand of DNA, following the base-pairing rulessingle-stranded messenger RNA peels away and DNA strands rejoinRNA polymeraseDNA of genePromoterDNATerminatorDNAInitiationElongationTerminationArea shown in Figure 10.9AGrowing RNARNA polymeraseCompleted RNAFigure 10.9B


RNA transcripts of DNA


Eukaryotic RNA is processed before leaving the nucleusNoncoding segments, introns, are spliced outA cap and a tail are added to the endsFigure 10.10DNARNA transcript with cap and tailmRNAExonIntronIntronExonExonTranscription Addition of cap and tailIntrons removedExons spliced togetherCoding sequenceNUCLEUSCYTOPLASMTailCap


Translation of nucleic acids into amino acidsThe words of the DNA language are triplets of bases called codonsThe codons in a gene specify the amino acid sequence of a polypeptide


Figure 10.7DNA moleculeGene 1Gene 2Gene 3DNA strandTRANSCRIPTIONRNAPolypeptideTRANSLATIONCodonAmino acid

UCAGUCAGGACUGACUGACUGACUUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGpheleuleuilemet (start)valUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGserprothralaUAUUACUAAUAGCAUCACCAACAGAAUAACAAGAAAGAUGACGAAGAGtyrstopstophisglnasnlysaspgluUGUUGCUGAUGGCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGcysstoptrpargserargglyFirst BaseThird BaseSecond BaseVirtually all organisms share the same genetic code unity of life


An exercise in translating the genetic codeFigure 10.8BStart codonRNATranscribed strandStop codonTranslationTranscriptionDNAPolypeptide


Transfer RNA molecules serve as interpreters during translationIn the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptideThe process is aided by transfer RNAsFigure 10.11AHydrogen bondAmino acid attachment siteRNA polynucleotide chainAnticodon


Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the otherFigure 10.11B, CAnticodonAmino acid attachment site


Ribosomes build polypeptidesFigure 10.12A-CCodonstRNAmoleculesmRNAGrowing polypeptideLarge subunitSmall subunitmRNAmRNA binding siteP siteA sitePAGrowing polypeptidetRNANext amino acid to be added to polypeptide


An initiation codon marks the start of an mRNA messageFigure 10.13AEndStart of genetic messageAUG = methionine


mRNA, a specific tRNA, and the ribosome subunits assemble during initiationFigure 10.13B1Initiator tRNAmRNAStart codonSmall ribosomal subunit2P siteLarge ribosomal subunitA site


ElongationThe mRNA moves a codon at a time relative to the ribosomeA tRNA pairs with each codon, adding an amino acid to the growing polypeptideA STOP codon causes the mRNA-ribosome complex to fall apart


Figure 10.141Codon recognitionAmino acidAnticodonA siteP sitePolypeptide2Peptide bond formation3TranslocationNew peptide bondmRNA movementmRNAStop codon

baRed object = ?What molecules are present in this photo?

Table 14.2Types of RNAType of RNAFunctions inFunctionMessenger RNA(mRNA)Nucleus, migratesto ribosomesin cytoplasmCarries DNA sequenceinformation to ribosomesTransfer RNA(tRNA)CytoplasmProvides linkage between mRNAand amino acids;transfers aminoacids to ribosomesRibosomal RNA(rRNA)CytoplasmStructural component of ribosomes


Review: The flow of genetic information in the cell is DNARNAproteinThe sequence of codons in DNA spells out the primary structure of a polypeptidePolypeptides form proteins that cells and organisms use


Mutations can change the meaning of genesMutations are changes in the DNA base sequencecaused by errors in DNA replication or by mutagenschange of a single DNA nucleotide causes sickle-cell disease


Figure 10.16ANormal hemoglobin DNAmRNANormal hemoglobinGluMutant hemoglobin DNAmRNASickle-cell hemoglobinVal


Types of mutationsFigure 10.16BmRNANORMAL GENEBASE SUBSTITUTIONBASE DELETIONProteinMetLysPheGlyAlaMetLysPheSerAlaMetLysLeuAlaHisMissing


Figure 8.23A, BDeletionDuplicationInversionHomologous chromosomesReciprocal translocationNonhomologous chromosomesChromosomal changes can be large or small


Summary of transcription and translationFigure 10.151Stage mRNA is transcribed from a DNA template.AnticodonDNAmRNARNA polymeraseTRANSLATIONEnzymeAmino acidtRNAInitiatortRNALarge ribosomal subunitSmall ribosomal subunitmRNAStart Codon2Stage Each amino acid attaches to its proper tRNA with the help of a specific enzyme and ATP.3Stage Initiation of polypeptide synthesisThe mRNA, the first tRNA, and the ribosomal subunits come together.TRANSCRIPTION


Figure 10.15 (continued)4Stage ElongationGrowingpolypeptideCodons5Stage TerminationmRNANew peptide bond formingStop CodonThe ribosome recognizes a stop codon. The poly-peptide is terminated and released.A succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome, one codon at a time.Polypeptide

50 bases per sec in mammals, 500 bases per sec in bacteria. About a dozen enz needed for DNA replication.only about 1 mistake per billion. Proofreading and repairs are done by DNA polymerase, DNA ligase. Based on yeast studies, mistakes are made about 1 per 100,000 bases. So, for human cells, that could create 1/100,000 X 6 billion bp = 6000 mistakes per replication cycle. But, editing mechanisms, including DNA plmase, fix most errors. Typically, about 3 errors per replication. (= per cell division).

Figure: 14-07

Title:The genetic code dictionary.

Caption:If we know what a given mRNA codon is, how can we find out what amino acid it codes for? This dictionary of the genetic code offers a way. In Figure 14.5, you saw that the codon CGU coded for the amino acid arginine (arg). Looking that up here, C is the first base (go to the C row along the first base line), G is the second base (go to the G column under the second base line) and U is the third (go to the codon parallel with the U in the third base line).

Figure: 14-12

Title:Mass production.

Caption:a. An mRNA transcript can be translated by many ribosomes at once, resulting in the production of many copies of the same protein. b. A micrograph of this process in operation. The figure shows two mRNA strands with ribosomes spaced along their length. In the upper strand, translation is underway and polypeptides can be seen emerging from the ribosomes.

Figure: Table 14.2

Title:Types of RNA.

Caption:Types of RNA.

16-biodna,trans.ppt

Documents