[CANCER RESEARCH 60, 922–928, February 15, 2000]

A Novel SMAD4 Gene Mutation in Seminoma Germ Cell Tumors1

Mourad Bouras, Eric Tabone, Jacques Bertholon, Pascal Sommer, Raymonde Bouvier, Jean-Pierre Droz, andMohamed Benahmed2

Institut National de la Sante et de la Recherche Medicale U407, Faculte´ de Medecine Lyon-Sud, 69621 Oullins Cedex [M. Bo., J. B., M. Be., R. B.]; Centre Leon Berard [E. T.,J-P. D.] and Institut de Biologie et de Chimie des Proteines [P. S.], 69007 Lyon Cedex 07; and Hopital Edouard Herriot, 69373 Lyon Cedex [R. B.], France

ABSTRACT

Transforming growth factor (TGF)- b is known as an antiproliferativefactor in the majority of mammalian cells, including stem germ cells. Lackof TGF-b-induced growth inhibition has been associated with disruptionsof TGF-b receptors and SMADs. In the present study, we performed amutational analysis of the TGF-b signaling system, including TGF-breceptor type I and type II and SMADs (SMAD1–SMAD7), in 20 semi-noma germ cell tumors. Using reverse transcription-PCR, single-strandconformational polymorphism, and sequencing analysis, the COOH-terminal domain of SMAD4 was found to be mutated: a single thyminewas inserted between nt 1521 and 1522 in 2 of 20 tumors analyzed. Thisaddition of a thymine creates a frameshift and a new stop signal at codon492, which leads to premature termination of the encoded protein. Such amutation potentially abrogates signaling from TGF-b as well as the otherTGF-b family members, including activin and bone morphogenetic pro-tein, which all use theSMAD pathway. Immunohistological analysis con-firmed the loss of expression of SMAD4 protein in the seminoma tissueswith the insertional mutation. To our knowledge, this is the first descrip-tion of a novel SMAD4 insertional mutation in seminoma testicular germcell tumors. This mutational inactivation of SMAD4/COOH-terminal do-main may cause TGF-b unresponsiveness. It could thus provide a basis forunderstanding the potential role of the TGF-b system in germ cell tumor-igenesis.

INTRODUCTION

The TGF-b3 family of growth factors regulates different biologicalprocesses including proliferation, differentiation, development, andextracellular matrix production (1). This family represents a largenumber of peptides including TGF-bs, activin/inhibin, AMH, andBMP (1, 2).

The members of the TGF-b superfamily transduce signals throughtwo different types of serine/threonine protein kinase receptors,known as type I and type II receptors (2). In the TGF-b receptorsystem, ligand binds to the TbR-II, which has a constitutively activekinase. TbR-I is then recruited into the TGF-b/TbR-II complex andphosphorylated mainly at the glycine/serine-rich domain, which re-sults in the activation of TbR-I kinase (3). The TbR-I kinase trans-duces intracellular signals by activation of various proteins, includingSMAD proteins. The signal is transferred to the SMAD proteinthrough the receptor kinase-mediated phosphorylation of pathway-specific SMADs. For example, SMAD1, SMAD5, and SMAD8 arephosphorylated by the BMP receptors, whereas SMAD2 and SMAD3are phosphorylated by activin/TGF-b receptors (1). The signal is then

propagated primarily through protein-protein interactions betweenSMAD proteins, which are homo-oligomeric, and betweenSMADsand transcription factors. Specifically, the phosphorylatedSMAD: (a)hetero-oligomerizes with the ubiquitous SMAD4 [phosphorylation ofpathway-restrictedSMADs occurs at the COOH-terminal Ser-Ser-X-Ser motif (4, 5)]; (b) translocates into the nucleus (6, 7); and (c)activates the transcription of various target genes.SMAD proteinshave been shown to interact with DNA-binding proteins, such aswinged-helix transcription factors,Xenopus, and human FAST1 andmouse FAST2 (8, 9), and also to bind directly to specific DNAsequences (10–12).

The SMAD proteins consist of two conserved domains: (a) theNH2-terminal MH1 domain; and (b) the COOH-terminal MH2 do-main. These two domains are linked by a region of variable length andamino acid sequence. The MH2 domain is a functional domain thathas transactivation activity when fused to the Gal4-DNA bindingdomain (13). The MH2 domain also plays critical roles in its inter-action with type I receptors (14), homo- and hetero-oligomerizationbetween SMAD proteins (15, 16), interaction with a transcriptionfactor,FAST1(17), and association with transcriptional co-activators,p300/CREB-binding protein (18, 19). The MH1 domain exhibitssequence-specific DNA binding activity and negatively regulates thefunctions of the MH2 domain (20). However, it has been shown thatthe MH1 domain has an intrinsic function in signal transduction,i.e.,direct binding to specific DNA sequences. SMAD3 and SMAD4 havealso been shown to bind to specific DNA sequences through theirMH1 domains (10–12, 21).

The SMAD4gene was discovered by virtue of its mutational inac-tivation in a large fraction of pancreatic cancers (22) and has beenfound to be mutated in a subset of colorectal cancers (23). TheSMAD4gene is homologous to theDrosophila Mad gene, which isknown to be required for signaling by the TGF-b family memberdecapentaplegic (dpp; Ref. 24). Based on this homology, it wassuggested that the driving force for SMAD4 inactivation is the abro-gation of TGF-b signaling (22). This is an attractive hypothesisbecause many cancers seem to be unresponsive to TGF-b, the proto-type growth-inhibitory polypeptide (25).

In the present study, we examined 20 seminoma germ cell tumorsfor the TGF-b transducing system components including TGFb-RI,TGFb-RII, and SMAD (SMAD1–SMAD7) genes. Our data indicatethat two patients (10%) have the same 1-bp insertion between nt 1521and 1522 of CTD/SMAD4tumor suppressor gene. No mutation wasdetected for the other TGF-b components studied.

MATERIALS AND METHODS

Patients and Samples.Twenty seminoma testicular germ cell tumors wereobtained from Dr. R. Bouvier (Department of Pathology, Edouard HerriotHospital, Lyon, France). The samples were examined histologically by thedepartment of pathology for the presence of tumor cells (the proportion oftumor cells was.70%).

Adjacent normal (nontumoral) testes tissue was also taken from 5 of the 20patients. The patients included in this study met the following criteria: stageI-IIC disease for which complete clinical, histological, and biological infor-mation was available.

Received 8/12/99; accepted 12/16/99.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby markedadvertisementin accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Institut National de la Sante et de la Recherche Medicale and by theLigue Contre le Cancer, Comite´ Departemental de l’Ain, du Rhone. M. Bo. is a recipientof a grant from the Ligue Contre le Cancer, Comite´ Departementale de l’Ain, France.

2 To whom requests for reprints should be addressed, at the Institut National de laSante et de la Recherche Medicale U407, Faculte´ de Medecine Lyon-Sud, BP 12, 69621Oullins Cedex, Lyon, France. Phone: 33-4-78-86-31-17; Fax: 33-4-78-86-31-16; E-mail:benahmed@lsgrisn1.univ-lyon1.fr.

3 The abbreviations used are: TGF, transforming growth factor; CTD, COOH-terminaldomain; RT, reverse transcription; SSCP, single-strand conformational polymorphism;BMP, bone morphogenetic protein; AMH, anti-mullerian hormone; TbR, TGF-b receptor;MH, Mad homology; dNTP, deoxynucleotide triphosphate; nt, nucleotide(s).

922

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

Total RNA from four nontumoral testicular tissues was also obtained fromPr. M. Devonec (Department of Urology, Center Hospitalier Lyon-Sud, Lyon,France). The nontumoral testicular tissues were from patients with prostaticcarcinoma.

RNA Extraction. Total RNA was extracted from samples by using theacid-phenol guanidinium method (26). The integrity of the RNA samples wasdetermined by electrophoresis through denaturing agarose gels and by stainingwith ethidium bromide. The 18S and 28S RNA bands were visualized underUV light. The yield of RNA was quantified spectrophotometrically.

cDNA Synthesis.RT was performed in a final volume of 20ml containing13 reverse transcriptase buffer [1 mM each dNTP, 5 mM MgCl2, 50 mM KCl,and 10 mM Tris-HCl (pH 8.3)], 20 units of RNase inhibitor, 50 units ofMoloney murine leukemia virus RT kit (Life Technologies, Inc.), 2.5mM

random hexamers, and 0.5mg of total RNA. The samples were incubated at37°C for 1 h, and RT was inactivated by heating at 99°C for 5 min and coolingat 4°C for 5 min.

Primers and RT-PCR Conditions. Details of the oligonucleotide primersets, sizes of the PCR products, and PCR annealing temperatures for all sevenSMAD genes used in the present study are summarized in Table 1. Primerswere chosen with the aid of the DNA Star (Lasergene, London, UnitedKingdom) computer program.SMAD1,SMAD5, andSMAD6were amplifiedas one fragment, whereasSMAD2,SMAD3,SMAD4, andSMAD7were splitinto two fragments (A and B) for amplification.

TbR-I and TbR-II details of the primer sets were available, respectively(27, 28).

The PCR reaction was carried out in a final volume of 25ml containing 1ml of the RT reaction mix, composed of 10mM each primer, 200mM eachdNTP, 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1 unit ofAmpliTaq DNA polymerase (Promega, Madison, WI).

The PCR procedure comprised the following: (a) initial denaturation at95°C for 5 min; (b) 40 cycles of 0.5 min at 95°C, 1 min at 50–55°C, and 1.5min at 72°C; and (c) a final extension step of 10 min at 72°C. Aliquots of thereaction were analyzed by electrophoresis on 1.5% agarose gels.

RT-PCR-SSCP Analysis.PCR was performed in a 10-ml final volumeincluding 0.5ml of the RT reaction mix, composed of 10mM each of theprimers, 200mM dNTP, 1.5 mM MgCl2, 1.5 mCi of [a-33P]dATP (2.500Ci/mmol; Amersham, Buckinghamshire, United Kingdom), 10 mM Tris-HCl(pH 8.3), 50 mM KCl, 0.1% Triton X-100, and 2 units of Taq DNA polymerase(Promega). The33P-labeled PCR products were heated for 3 min at 95°C with20 ml of formamide denaturing dye mixture (95% formamide, 20 mM EDTA,0.05% xylene cyanol, and 0.05% bromphenol blue) and then applied (3–5ml)to 6% polyacrylamide gel (Acrylamide for Mutation Detection; Sigma-Al-drich, St. Louis, MO) containing 45 mM Tris-borate (pH 8.3) and 4 mM EDTA.Electrophoresis was performed at 6 W for 14 h. The gel was dried on 3 MMpaper and exposed to X-ray film for 1 day. Samples exhibiting band shifts werereassayed using separate PCR products to verify that the shifts were not due toa Taq-induced error.

Direct Sequencing.For sequencing of PCR products, a small piece of thegel corresponding to the abnormal band detected by SSCP analysis was cut out,immersed in 100ml of water, and heated at 100°C for 15 min. The centrifuged

water was extracted, subjected to 35 cycles of PCR, and purified with WizardPCR Preps DNA Purification System (Promega). The purified DNA fragmentswere sequenced using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branch-burg, NJ). The same 59and 39 side primers used for RT-PCR-SSCP wereapplied. The products were electrophoresed on a 6% polyacrylamide gelcontaining 8M urea. All mutations were checked by sequencing two differentPCR products in separate experiments.

Immunohistochemistry. Paraffin sections of Bouin-fixed tumors were cutonto silanized slides. The samples were deparaffinized, rehydrated, incubatedin antigen retrieval solution (pH 6 citrate buffer), and heated in a microwaveoven for 15 min. They remained in the hot solution for more than 20 min.Slides were washed in PBS, endogenous peroxidases were quenched in 3%H2O2 for 15 min, and nonspecific binding was blocked with a protein solution(CSA system; DAKO, Copenhagen, Denmark) for 15 min. TheSMAD4primary antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA), whichhave been validated previously in an antibody supershift electrophoretic mo-bility shift assay (28), were diluted in the antibody diluent [(DAKO); 1:600H-552 rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc., cataloguenumber sc-7154), 1:600 N-16 goat polyclonal antibody (Santa Cruz Biotech-nology, Inc., catalogue number sc-1908) and 1:800 C-20 goat polyclonalantibody (Santa Cruz Biotechnology, Inc., catalogue number sc-1909)] andincubated for 2 h at room temperature. After washing, secondary antibodieswere applied according to the specificity of the primary antibody:LSAB 1 prediluted secondary antibody (DAKO) for H-552 antibody and1:800 rabbit antigoat immunoglobulins (DAKO) for N-16 and C-20 antibodies.A catalyzed amplification of the signal (CSA system; DAKO) was performedas recommended by the manufacturer for the rest of the procedure with thefollowing modification: 3-amino-9-ethylcarbazole (Biomeda, Foster City, CA)that gives a red signal was used as peroxidase chromogen. Sections werebriefly counterstained with Harris hematoxylin and mounted in aqueousmounting medium (Biomeda).

RESULTS

Presence of Abnormal cDNA in SMAD4/CTD Revealed byRT-PCR-SSCP. Twenty seminoma testicular germ cell tumorsamples were assessed for mutations in TGF-b receptors andSMAD(SMAD1–SMAD7) genes. Primers flanking theSMADs CTDwere used to generate PCR products of different sizes (Table 1). Todetect the presence of mutations, electrophoresis was performedunder optimal running conditions that yielded the most dramaticmobility shift for mutants when compared to the wild-type cDNAboth in TbR-I and -II and in SMAD genes. To compare themutational status between normal (nontumoral) and seminomasamples, total RNA was isolated from both normal (nontumoral)and tumor surgical tissues and then reverse-transcribed to generatefirst-strand cDNAs. From each tumor sample, two overlappingRT-PCR fragments covering all exons of TbR-I and -II and the

Table 1 Oligonucleotide primers used to amplify SMAD gene segments analyzed by RT-PCR-SSCP and sequencing

Oligonucleotidenamea

SequenceProduct

size (bp)dAnnealing

temperature (°C)eSenseb Antisensec

SMAD1 GGCGGCATATTGGAAAAGGAGTT GAGGGGGCCGTGCAGATGTAT 353 53SMAD2(A) TAGGTGGGGAAGTTTTTGCTGATG CGTCTGCCTTCGGTATTCTG 269 53SMAD2(B) GTGAAAGGGTGGGGAGCAGAATAC ATAGGGGGACCACAACACCAATG 235 53SMAD3(A) GGAGGGCAGGCTTGGGGAAAATG GGGGAGGGTGCCGGTGGTGTAATA283 59SMAD3(B) TAAGTGAGCAGAACAGGTAGTATT CTCCCTCCCTCCCCATCCCAAGTC 286 50SMAD4(A) AAGGTGAAGGTGATGTTTG GAGCTATTCCACCTACTGAT 264 53SMAD4(B) TGGCCCAGGATCAGTAGGTG TAAGGGCCCCAACGGTAAA 274 53SMAD5 TGGCCGGATTTGCAGAGTCAT TAGGCAGGAGGAGGCGTATCAGC 395 50SMAD6 CCCCCGGCTACTCCATCAAGGTGT GTCCGTGGGGGCTGTGTCTCTGG 297 55SMAD7(A) GTGGGGAGGCTCTACTGTGTC GTCGAAAGCCTTGATGGAGAAACC 294 55SMAD7(B) ACCGCAGCAGTTACCCCATCTT GGCTACCGGCTGTTGAA 283 55

a Name of primer sequences for amplification of eachSMAD. SMAD2, SMAD3, SMAD4, andSMAD7were split into two fragments (A and B) for amplification.b Sense primer sequence (59–39).c Antisense primer sequence (59–39).d Size of PCR product obtained.e Annealing temperature optimized for eachSMADsequence.

923

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

CTD region of eachSMADwere analyzed, and SSCP analysis wasperformed. A typical analysis is shown in Fig. 1. The characteristicdouble-band representing the two complementary cDNA strands ofSMAD4 was observed in each of the tumors examined with theexception of that from patient 7, where there was a marked mo-bility shift of the PCR products. It is worth noting that the PCRsignal of the remaining wild-type allele in patient 7 was detectable,suggesting the presence of the normal allele; consequently, thispatient is heterozygous forSMAD4mutation.

Under comparable experimental conditions, we detected no muta-tion for the otherSMADsand TbR-I and -II genes in the 20 semino-mas studied.

Sequencing Analysis and Identification of the Insertional Mu-tation at SMAD4/CTD. To investigate the genetic alteration respon-sible for the allelic shift in theSMAD4/CTD gene, a PCR-amplifiedfragment encompassing this region was examined for all tumor sam-ples including that from patient 7 (positive case for SSCP analysis)and subjected to sequence analysis. Of the 20 cDNAs examined, twodisplayed the same disparity from the wild-type nt sequence: cDNAfrom patients 6 and 7 was positive for the insertional mutation. Asshown in Fig. 2, the modification inSMAD4/CTD sequence involvesthe insertion of 1 bp between nt 1521 and 1522, resulting in themodification of the protein reading frame from codon 465 and thetruncation of the protein at codon 492, which causes the loss of theL3-loop region (Fig. 3).

The sequence analysis of TbR-I, TbR-II, and SMADs (SMAD1,SMAD2,SMAD3,SMAD5,SMAD6, andSMAD7) detected no muta-tions in any of the sequences studied.

Expression of SMAD4 Protein by Immunohistochemistry.TheSMAD4 gene product was examined immunohistochemically inseminoma testicular germ cell tumors that appeared to be negativeor positive for the insertional mutation. Nonmutated testiculartissues showed strong positive staining for the whole molecule(H-552) as well as for the NH2- and COOH-terminal regions ofSMAD4 protein (positive controls). They were strongly stained byeither the antibody directed against the NH2 terminus (N-16) or theantibody directed against the whole molecule (H-552) or by theantibody directed against the COOH terminus (examples are shownin Fig. 4, A–C).

The N-16 antibody directed against the NH2 terminus of SMAD4protein as well as the H-552 directed against the whole molecule alsostrongly stained tumor cells with mutatedSMAD4, whereas tumorcells with mutatedSMAD4(patients 6 and 7), were mostly negativewith the antibody directed against COOH-terminus of SMAD4 pro-tein. Only very rare cells were positive with the C-20 antibody (Fig.4, D–F).

DISCUSSION

Several members of TGF-b family are involved in gonadal devel-opment: (a) TGF-bs; (b) inhibins; (c) activins; (d) AMH; and (e)BMP-8b. These proteins play either a stimulatory role or an inhibitoryrole in the division, differentiation, and apoptosis of gonadal cells. Inaddition, work with transgenic mice has demonstrated that two TGF-bfamily members, inhibin and AMH, act as gonadal tumor suppressors(1, 2, 29).

TGF-b is well known for its antiproliferative activity in the major-ity of mammalian cells, and loss of TGF-b responsiveness has beendocumented to be associated with aggressive neoplasms (30). It hastherefore been suggested that loss of the activity of a TGF-b signalingpathway component, such as SMAD4, would be selected for theclonal evolution of neoplasms. Furthermore, a recent report (31) haslinked SMAD4 to other pathways including the stress-activated pro-tein kinase/c-Jun NH2-terminal kinase cascade, implicating SMAD4in both the control of cell cycle arrest and apoptosis. This suggests thata SMAD4-dependent malignancy may also arise after disruption ofthese key regulatory mechanisms.

The screening ofSMAD genes in seminoma testicular germ celltumors by RT-PCR-SSCP analysis revealed aSMAD4 insertionalmutation in one patient. We performed direct sequencing ofSMAD4in the remaining 19 samples from patients with normal SSCP bandpatterns. All normal (nontumoral) and seminoma patient samples weresequenced forSMAD4mutations to test the reliability of the SSCPanalysis. The data obtained showed the presence, in another sample,of a mutation similar to that detected by the SSCP approach. Both ofthese cases were found to carry an insertional mutation (T insertionbetween nt 1521 and 1522) in a highly conserved residue at codon 465within the MH2 region of the SMAD4 protein. This insertion causesa frameshift that creates a new stop codon, producing a truncatedprotein at codon 492 (nt 1785–1787 of the wild-type sequence), withloss of critical regions for normal function, such as the L3-loopregion. All of the other tumors analyzed showed the sequence ofwild-type CTD-SMAD4gene. In support of the functional significanceof the loop/helix region, mutations inDrosophilaandCaenorhabditiselegansin this region produce null or severe developmental pheno-types (32). These mutations map to Gly508 (Drosophila Mad, C.elegans sma-2), Gly510 (sma-3), and Glu520 (Mad) of the L3-loop inthe loop/helix region. Thus, the location of conserved, solvent-exposed residues and the location of mutations derived from tumors orfrom DrosophilaandC. elegansgenetic screens together indicate thatthe loop/helix region and the three-helix bundle are critical for medi-ating SMAD activity. All four of the tumorigenic mutations that areimportant at the trimer interface (Asp351, Arg361, Val370, and Asp537)disrupt homo-oligomerization of the SMAD4/CTD and the full-lengthSMAD4 (33). G508S had no effect on homo-oligomerization. This

Fig. 1. SSCP analysis of theSMAD4gene segment. SSCP analysis was performed onreverse-transcribed RNAs from seminoma testicular germ cell tumors using primersflanking the COOH-terminalSMAD4gene (primer sense position, nt 1303–1321; primerantisense position, nt 1547–1566). Altered mobility in PCR-amplified single-strandedDNAs corresponding to nt insertion (nt 1521 Ins T) is indicated byarrows.Lanes 4and5 correspond to the normal (nontumoral) testis tissue, andLanes 6–9correspond toseminoma testicular germ cell tumors.

Fig. 2. Characterization of the mutant CTD/SMAD4gene. nt sequence analysis flank-ing codon 465 showing wild-type and mutantSMAD4(Cases 6and 7) sequences. Theinsertion of 1 bp at codon 465 in the mutant strand ofSMAD4is indicated byarrows.

924

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

mutation maps to the L3-loop, which is the only portion of theloop/helix region that is not involved in the trimer interface. Both thetumor-derived trimer interface and the L3-loop mutants abolishedhetero-oligomerization between the CTDs of SMAD4 and SMAD2.Because the L3-loop developmental mutation, which does notsignificantly affect homo-oligomerization, disrupts hetero-oligomerformation, the L3-loop may participate in hetero-oligomerization. Inaddition, mutations preventing homo-oligomerization also disrupthetero-oligomerization, indicating that the former is a prerequisite forthe latter. Although several models of hetero-oligomerization couldexplain our results, the one that appears to be most relevant from astructural perspective is the formation of a heterohexamer betweenSMAD4 and SMAD2 trimers. The trimer structure resembles a disc,with the L3-loops forming undulations on the face of the disc. Twodiscs could fit together face to face through their L3 loops, whichcould explain why L3-loop mutations disrupt hetero-oligomerization.Heterohexamer formation would depend on homotrimer formationand would thus explain how tumorigenic mutations that disrupt homo-oligomerization can prevent the formation of a functional hetero-oligomeric complex and interfere with signal transduction.

SSCP analysis has been used successfully to detect single-basechanges in diverse previous studies (34, 35), and we readily detectedthe same single-base insertion in one patient in the present study.

Accordingly, the efficiency of the SSCP approach in detecting theSMAD4gene mutation was limited to only one of the two patientswith the mutation. However, it remains possible that RT-PCR-SSCPanalysis using RNAs from microdissected tumor specimen rather thanfrom the macroscopic specimen used in our study might yield highermutation frequencies ofSMADgenes. It may also be worth examiningnoncodon regions ofSMAD4and the methylation status of this gene.With regard to our present finding, to our knowledge, this is the firstreport that associates theSMAD4gene mutation with the seminomatesticular germ cell tumor. Considering the mutation rates of othertumor suppressor genes, this result suggests that theSMAD4 geneplays an important role in the development of testicular tumors. Sucha mutation ofSMAD4may affect not only the activity of TGF-b butalso that of the other members of the peptide family, including activinand BMP. Indeed, the signaling pathway analysis of activin, BMP,and TGF-b signaling in different systems (Xenopusembryos andmammalian cells) in diverse studies showed that all of the responsestested depend on interactions between SMAD4 and one of the otherSMADs.

The TGF-b signaling network is disrupted in other tumors bymutations inSMAD4 and also inSMAD2. SMAD4 was originallyidentified as a candidate tumor suppressor gene in chromosome 18q21that was somatically deleted or mutated in half of all human pancre-

Fig. 3. Segment of the human wild-type and mutated forms of theCOOH-terminalSMAD4gene structure.A, schematic representationof a segment of wild-type COOH-terminalSMAD4; the L3-loopsequence isunderlined.B, schematic representation of a segment ofthe COOH-terminalSMAD4 sequence after insertional mutation.The nt inserted is indicated by thearrow at codon 465.

925

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

atic carcinomas examined (21). BiallelicSMAD4 inactivation alsooccurs in a significant proportion of colorectal tumors (36).SMAD4israrely mutated in breast (37), ovarian (37), head and neck (38),prostatic (36), esophageal and gastric cancers (39). In the mouse,SMAD4 inactivation causes intestinal tumors in accordance with in-activation of another tumor suppressor gene, adenomatosis polyposis

coli (40). The loss of TGF-b responsiveness in colon cancer maytherefore be due to mutations in TbR-II, SMAD2, or SMAD4. Inter-estingly, the predominance ofSMAD4mutations in pancreatic cancer,together with the low frequency of mutations in TbR-II in thesetumors (41), raises the possibility that loss of SMAD4 function mightbe selected during tumorigenesis for resistance to an endogenous

Fig. 4. Immunohistochemistry of SMAD4 protein in samples 6 and 7 (mutatedSMAD4) and in two nonmutated samples (positive controls). As observed in all tested seminoma,nonmutated tumor cells were strongly stained with C-20 antibody, but the surrounding inflammatory cells were not (A). On the contrary, tumors sharing insertional mutation ofSMAD4were almost negative for staining with the C-20 antibody (D). Higher magnifications show that only rare, isolated cells were stained by the C-20 antibody (E andF) in tumors sharinginsertional mutation, whereas nonmutated tumor cells were strongly positive for C-20 staining (BandC). A andD, 3130; B, C, E, andF, 3530).

926

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

factor other than TGF-b itself. It is therefore significant that a numberof mutations have been identified within theSMAD4 gene itself,strongly supporting a causal link between loss of function and theoccurrence of malignancy. These findings raise the possibility thatSMAD4acts as a global tumor suppressor gene. However,SMAD4loss has been found to be relatively rare in a range of other tumortypes.

SMAD2 is also located at 18q21 and is also the target for inacti-vating mutations in colon cancer (42). The prevalence ofSMAD2mutations in other neoplasms is not well characterized to date, al-though there is evidence to suggest thatSMAD2may be mutated in asubset of leukemias and lymphomas (43) and also in lung carcinomas(approximately 4%; Ref. 34). Disruption of theSMAD2gene duringdevelopment results in a complete loss of embryonic germ layertissues (44), confirming thatSMAD2, likeSMAD4, plays an essentialrole in development. However, based on our data,SMAD2alterationsdo not appear to be associated with seminomas. Interestingly, thereare at least two reports indicating an alteration in chromosome 18: (a)by using comparative genomic hybridization, losses within the entiregenome represented 43% of the total number of alterations oftenaffecting chromosomes and chromosome arm 4, 5, 11, 13q, andparticularly 18q (where theSMAD4gene is located; Ref. 45); and (b)by using cytogenetic analysis in a series of four testicular tumors, ithas been shown that chromosome 18 was underrepresented in all thesetumors (46).

In summary, a technical approach comprising RT-PCR-SSCP, se-quencing, and immunohistochemistry was used to perform mutationalanalysis of the TGF-b signaling components TGFb-RI, TGFb-RII,and SMAD1–SMAD7. The only component of the TGF-b signalingsystem that was found to be affected in seminomas isSMAD4. Indeed,a novel mutation (insertional mutation) in theSMAD4 gene wasdetected in 10% of the 20 seminomas examined. No mutation wasfound in the otherSMADs or in the TbR-I and -II genes. The size ofthe subject cohort used in this study was too small to permit anymeaningful analysis of the relationship between theSMAD4 genemutation, protein expression, patient survival, and clinical character-istics.

ACKNOWLEDGMENTS

We thank Dr. J. L. Requin (Ligue Contre le Cancer, Comite´ Departementalde l’Ain, France) for constant support during the course of this study. We thankDrs. G. Quach (INSERM U329, Lyon, France) and S. Krantic (INSERMU407, Lyon, France) for critical reading of the manuscript.

REFERENCES

1. Massague, J. TGF-b signal transduction. Annu. Rev. Biochem.,67: 753–791, 1998.2. Derynck, R., and Feng, X-H. TGF-b receptor signaling. Biochim. Biophys. Acta,

1333: F105–F150, 1997.3. Wrana, J-L., Attisano, L., Wieser, R., Ventura, F., and Massague, J. Mechanism of

activation of the TGF-b receptor. Nature (Lond.),370: 341–347, 1994.4. Souchelnytskyi, S., Tamaki, K., Engstrom, U., Wernstedt, C., ten Dijke, P., and

Heldin, C. H. Phosphorylation of Ser465 and Ser467 in the C-terminus ofSMAD2mediates interaction withSMAD4and is required for transforming growth factor-bsignaling. J. Biol. Chem.,272: 28107–28115, 1997.

5. Abdollah, S., Macias-Silva, M., Tsukazaki T, Hayashi, H., Attisano, L., and WranaJ. L. TbRI phosphorylation ofSMAD2on Ser465 and Ser467 is required forSMAD2-SMAD4complex formation and signaling. J. Biol. Chem.,272: 27678–27685, 1997.

6. Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O’Connor, M. B., Attisano,L., and Wrana, J. L. MADR1, a MAD-related protein that functions in BMP2signaling pathways. Cell,85: 489–500, 1996.

7. Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and Massague´,J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature(Lond.), 381: 620–623, 1996.

8. Zhou, S., Zawel, L., Lengauer, C., Kinzler, K. W., and Vogelstein, B. Characteriza-tion of human FAST-1, a TGF-b and activin signal transducer. Mol. Cell,2: 121–127,1998.

9. Labbe, E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L.SMAD2andSMAD3positively and negatively regulate TGFb-dependent transcription through theforkhead DNA-binding protein FAST-2. Mol. Cell,2: 109–120, 1998.

10. Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., andKern, S. E. HumanSMAD3andSMAD4are sequence specific transcription activators.Mol. Cell, 1: 611–617, 1998.

11 Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. M. Directbinding of SMAD3andSMAD4to critical TGFb-inducible elements in the promoterof human plasminogen activator inhibitor-type1 gene. EMBO J.,17: 3091–3100,1998.

12. Jonk, L. J. C., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. Identification andfunctional characterization of aSMADbinding element (SBE) in the Jun B promoterthat acts as a transforming growth factor-b, activin, and bone morphogenetic protein-inducible enhancer. J. Biol. Chem.,273: 21145–21152, 1998.

13. Meersseman, G., Verschueren, K., Nelles, L., Blumenstock, C., Kraft, H., Wuytens,G., Remacle, J., Kozak, C. A., Tylzanowski, P., Niehrs, C., and Huylebroeck, D. TheC-terminal domain of Mad-like signal transducers is sufficient for biological activityin the Xenopusembryo and transcriptional activation. Mech. Dev.,61: 127–140,1997.

14. Lo, R. S., Chen, Y-G., Shi, Y., Pavletich, N. P., and Massague, J. The L3 loop: astructural motif determining specific interactions betweenSMADproteins and TGFbreceptors. EMBO J.,17: 996–1005, 1998.

15. Wu, R-Y., Zhang, Y., Feng, X-H., and Derynck, R. Heteromeric and homomericinteractions correlate with signaling activity and functional cooperativity ofSMAD3andSMAD4/DPC4. Mol. Cell. Biol.,17: 2521–2528, 1997.

16. Zhang, Y., Musci, T., and Derynck, R. The tumor suppressorSMAD4/DPC4as acentral mediator ofSMAD function. Curr. Biol.,7: 270–276, 1997.

17. Liu, F., Pouponnot, C., and Massague, J. Dual role of theSMAD4/DPC4tumorsuppressor in TGFb-inducible transcriptional complexes. Genes Dev.,11: 3157–3167, 1997.

18. Topper, J. N., Dichiara, M. R., Brown, J. D., Williams, A. J., Falb, D., Collins, T., andGimbrone, M. A., Jr. CREB binding protein is a required coactivator forSMAD-dependent, transforming growth factorb transcriptional responses in epithelial cells.Proc. Natl. Acad. Sci. USA,95: 9506–9511, 1998.

19. Nishihara, A., Hanai, J., Okamoto, N., Yanagisawa, J., Kato, S., Miyazono, K., andKawabata, M. Role of p300, a transcriptional coactivator, in signalling of TGFb.Genes Cells,3: 613–623, 1998.

20. Kretzschmar, M., and Massague´, J. SMADs: mediators and regulators of TGF-bsignaling. Curr. Opin. Genet. Dev.,8: 103–111, 1998.

21. Song, C-Z., Siok, T. E., and Gelehrter, T. D.SMAD4/DPC4and SMAD3mediatetransforming growth factor-b (TGF-b) signaling through direct binding to a novelTGF-b-responsive element in the human plasminogen activator inhibitor-1 promoter.J. Biol. Chem.,273: 29287–29290, 1998.

22. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T.,Rozemblum, E., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern,S. E. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1.Science (Washington DC),271: 350–353, 1996.

23. Thiagalingam, S., Lengauer, C., Leach, F. S., Schutte, M., Hahn, S. A., Overhauser,J., Wilson, J. K. V., Markowitz, S., Hamilton, S. R., Kern, S. E., Kinzler, K. W., andVogelstein, B. Evaluation of candidate tumor suppressor genes on chromosome 18 incolorectal cancers. Nat. Genet.,13: 343–346, 1996.

24. Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart W. M.Genetic characterization and cloning of mothers against dpp, a gene required fordecapentaplegic function inDrosophila melanogaster. Genetics,139: 1347–1358,1995.

25. Fynan, T. M., and Reiss, M. Resistance to inhibition of cell growth by transforminggrowth factorb and its role in oncogenesis. Crit. Rev. Oncog.,4: 493–540, 1993.

26. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by guanidiniumthiocyanate-phenol-chloroform extraction. Anal. Biochem.,162: 156–159, 1987.

27. Chen, T., Carter, D., Garringue-Antar, L., and Reiss, M. Transforming growth factorb type I receptor kinase mutant associated with metastatic breast cancer. Cancer Res.,58: 4805–4810, 1998.

28. Takenoshita, S., Tani, M., Nagashima, M., Hagiwara, K., Bennett, P. W., Yokota, J.,and Harris, C. C. Mutation analysis of coding sequences of the entire transforminggrowth factorb type II receptor gene in sporadic human colon cancer using genomicDNA and intron primers. Oncogene,14: 1255–1258, 1997.

29. Josso, N., and di Clemente, N. TGF-b family members and gonadal development.Trends Endocrinol. Metab.,10: 216–222, 1999.

30. Polyak, K. Negative regulation of cell growth by TGFb. Biochim. Biophys. Acta,1242: 185–199, 1996.

31. Atfi, A., Buisine, M., Mazars, A., and Gespach, C. Induction of apoptosis bySMAD4,a transcriptional factor regulated by transforming growth factor-b through stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling pathway.J. Biol. Chem.,272: 24731–24734, 1997.

32. Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C-Y., Baird, S. E., andPadgett, R. W.Caenorhabditis elegansgenesSma-2,Sma-3, andSma-4define aconserved family of transforming growth factorb pathway components. Proc. Natl.Acad. Sci. USA,93: 790–794, 1996.

33. Shi, Y., Hata, A., Lo, R. S., Massague, J., and Pavletich, N. P. A structural basis formutational inactivation of the tumor suppressorSMAD4. Nature (Lond.),388: 87–93,1997.

34. Uchida, K., Nagatake, M., Osada, H., Yatabe, Y., Kondo, M., Mitsudomi, T., Masuda,A., Takahashi, T., and Takahashi, T. Somaticin vivo alterations of theJV18-1geneat 18q21 in human lung cancers. Cancer Res.,56: 5583–5585, 1996.

35. Satoshi, T., Aikou, O., Misato, S., Takaomi, Y., Hideo, S., Seiji, I., Tomoaki, Y.,Yasuyuki, O., Kazunori, O., and Tadao, T. Allelic imbalance in chromosome band

927

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

18q21 andSMAD4mutations in ovarian cancers. Genes Chromosomes Cancer,24:264–271, 1999.

36. MacGrogan, D., Pegram, M., Slamon, D., and Bookstein, R. Comparative mutationalanalysis ofDPC4 (SMAD4) in prostatic and colorectal carcinoma. Oncogene,15:1111–1114, 1997.

37. Schutte, M., Hruban, R. H., Hedrick, L., Cho, K. R., Nadasdy, G. M., Weinstein,C. L., Bosa, G. S., Isaacs, W. B., Cairns, P., Nawroz, H., Sidransky, D., Casero, R. A.,Jr., Meltzer, P. S., Hahn, S. A., and Kern, S. E.DPC4 gene in various tumor types.Cancer Res.,56: 2527–2530, 1996.

38. Kim, S. K., Fan, Y., Papadimitrakopoulo, V., Clayman, G., Hittelman, W. N., Hong,W. K., Lotan, R., and Mao, L.DPC4, a candidate tumor suppressor gene is alteredinfrequently in head and neck squamous cell carcinoma. Cancer Res.,56: 2519–2521,1996.

39. Lei, J. Y., Zou, T. T., Shi, Y. Q., Zhou, X. L., Smolinski, K. N., Yin, J., Souza, R.,Appel, R., Wang, S., Cynes, K., Chan, O., Abraham, J. M., and Meltzer S. J.InfrequentDPC4 gene mutation in esophageal cancer, gastric cancer, and ulcerativecolitis-associated neoplasms. Oncogene,13: 2459–2462, 1996.

40. Takaku, K., Oshima, M., Miyoshi, H., Matsui, M., Seldin, M. F., and Taketo, M. M.Intestinal tumorigenesis in compound mutant mice of bothDPC4 (SMAD4) and Apcgenes. Cell,92: 645–656, 1998.

41. Vincent, F., Hagiwara, K., Ke, Y., Stoner, G. D., Demetrick, D. J., and Benett, W. P.Mutation analyses of the transforming growth factor-b type II receptor in sporadichuman cancers of the pancreas, liver, and breast. Biochem. Biophys. Res. Commun.,223: 561–564, 1996.

42. Riggins, G. J., Thiagalingam, S., Rozenblum, E., Weinstein, C. L., Kern, S. E.,Hamilton, S. R., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B.Mad related genes in the human. Nat. Genet.,13: 347–349, 1996.

43. Ikezoe, T., Takeuchi, S., Kamioka, M., Daibata, M., Kubonishi, I., Taguchi, H., andMiyoshi, I. Analysis of theSMAD2gene in haematological malignancies. Leukemia,12: 94–95, 1998.

44. Waldrip, W. R., Bikoff, E. K., Hoodless, P. A., Wrana, J. L., and Robertson, R. J.SMAD2signaling in extraembryonic tissues determines anterior-posterior polarity ofthe early mouse embryo. Cell,92: 797–808, 1998.

45. Parrington, J. M., West, L. F., and Heyderman, E. Chromosome analysis of parallelshort-term cultures from four testicular germ-cell tumors. Cancer Genet. Cytogenet.,75: 90–102, 1994.

46. Ottesen, A. M., Kirchhoff, M., De-Meyts, E. R., Maahr, J., Gerdes, T., Rose, H.,Lundsteen, C., Petersen, P. M., Philip, J., and Skakkebaek, N. E. Detection ofchromosomal aberrations in seminomatous germ cell tumors using comparativegenomic hybridization. Genes Chromosomes Cancer,20: 412–418, 1997.

928

SMAD4 GENE MUTATION IN SEMINOMA

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

2000;60:922-928. Cancer Res   Mourad Bouras, Eric Tabone, Jacques Bertholon, et al.   Tumors

Gene Mutation in Seminoma Germ CellSMAD4A Novel

  Updated version

  http://cancerres.aacrjournals.org/content/60/4/922

Access the most recent version of this article at:

   

   

  Cited articles

  http://cancerres.aacrjournals.org/content/60/4/922.full#ref-list-1

This article cites 46 articles, 17 of which you can access for free at:

  Citing articles

  http://cancerres.aacrjournals.org/content/60/4/922.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/60/4/922To request permission to re-use all or part of this article, use this link

Research. on March 18, 2020. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from