all-trans retinoic acid induces differentiation of ducts ... · koji fujimoto, and masayuki imamura...

All-Trans Retinoic Acid Induces Differentiation of Ductsand Endocrine Cells by Mesenchymal/EpithelialInteractions in Embryonic PancreasSidhartha Singh Tulachan, Ryuichiro Doi, Yoshiya Kawaguchi, Shoichiro Tsuji, Sanae Nakajima,

Toshihiko Masui, Masayuki Koizumi, Eiji Toyoda, Tomohiko Mori, Daisuke Ito, Kazuhiro Kami,

Koji Fujimoto, and Masayuki Imamura

Retinoids during the embryonic period act as a mesen-chymal inducer in many organs, including kidney, lung,central nervous system, and gut. Retinoic acid (RA)demonstrates insulinotropic effects in adult pancreas,but only a limited study has elucidated its role inpancreatic organogenesis. In this study, we have ana-lyzed the existence of RA-signaling machinery in embry-onic pancreas and evaluated its role using in vitro tissueculture experiments. Here we show the presence ofendogenous retinaldehyde dehydrogenase 2 (RALDH2),the most effective RA-synthesizing enzyme, RA-bindingproteins, and RA receptors (RARs) in embryonic pan-creatic tissue. RALDH2 is expressed exclusively in themesenchyme. Exogenously added all-trans-retinoic acid(atRA) in tissue culture experiments stimulated differ-entiation of endocrine and duct cells and promotedapoptotic cell death of acinar tissue. Furthermore, wedemonstrate that atRA upregulates the PDX-1 expres-sion. Taken together, our data suggest that atRA-mediated mesenchymal/epithelial interactions play animportant role in determining the cell fate of epithelialcells via regulation of the PDX-1 gene, leading to theproper formation of the endocrine versus exocrine com-ponent during pancreatic organogenesis. Diabetes 52:76–84, 2003

Several studies have pointed to the role of mesen-chymal/epithelial interactions in pancreatic de-velopment and suggested the importance ofdiffusible mesenchyme-derived factors (1–3).

However, efforts to purify these mesenchymal factorsshowed very limited success, leading researchers today tofocus on a candidate approach for describing these fac-tors. It is generally believed that long-lasting cross-talkbetween the endoderm and the mesoderm progressivelycommits cells to a specific fate during endoderm develop-

ment (4,5). Development of the dorsal pancreas is tightlycontrolled by signals derived from notochord in the earlystages (6). In later stages, mesenchyme-derived factorscontrol proliferation and differentiation of the pancreaticprogenitor cells and determine the proportion of endo-crine versus exocrine tissue (7,8). The implication ofsignals from mesenchyme in the control development ofexocrine tissue is well documented, but in the develop-ment of endocrine tissue, it is still highly contentious (9).Understanding such underlying developmental processesand characterizing the factors necessary for pancreaticendocrine cell proliferation and differentiation can openthe door to devise new therapeutic strategies against theincurable disease diabetes.

Vitamin A (retinol) is an essential component of diet andis important during early embryonic development (10).All-trans retinoic acid (atRA), one of the most active andphysiological members of the retinoid family, has a widespectrum of biological activities, such as cell growth,differentiation, and morphogenesis, and also acts as animportant signaling molecule for mesenchymal/epithelialinteractions in the development of kidney, lung, centralnervous system, and gut (11–14). Considering the role ofretinoids as an insulinotropic factor (15,16) or its defi-ciency related to the cause of type 1 diabetes (17,18), wehypothesized that RA plays an important role in endocrinecell differentiation during pancreas development. To con-firm the presence of atRA and to establish its role inendocrine pancreas development and differentiation, we1) analyzed endogenous expressions of RA synthesizingenzyme, RA receptors (RAR), and binding protein inpancreatic rudiments at various stages of developmentusing RT-PCR and immunohistochemistry and 2) culturedembryonic day (e) 11.5 pancreatic rudiments in differentconcentration of exogenous atRA and evaluated its role bymicroscopic phenotype, immunohistochemical analysis,and electron microscopy.

Our results show that at e11.5, atRA is endogenouslyand exclusively present in pancreatic mesenchyme, evi-dent by mRNA and protein expression of retinaldehydedehydrogenase 2 (RALDH2) enzyme. This endogenousatRA may act in autocrine and/or paracrine fashion, asRARs are present in both epithelia and mesenchyme. Ourin vitro model demonstrates that, in the presence ofexogenous atRA, pancreatic rudiments differentiate intoducts and endocrine cells and inhibit acini. Furthermore,

From the Department of Surgery and Surgical Basic Science, Graduate Schoolof Medicine, Kyoto University, Kyoto, Japan.

Address correspondence and reprint requests to Ryuichiro Doi, MD, De-partment of Surgery and Surgical Basic Science, Graduate School of Medicine,Kyoto University, 54 Shogoin, Kawara cho, Sakyoku, Kyoto 606-8507, Japan.E-mail: [email protected].

Received for publication 8 June 2002 and accepted in revised form 23September 2002.

atRA, all-trans retinoic acid; COUP-TF II, chicken ovalbumin upstreampromoter transcription factor II; CRABP II, cellular retinoic acid bindingprotein II; PE, pancreatic epithelia only; PEM, pancreatic epithelia withmesenchyme; RALDH2, retinaldehyde dehydrogenase 2; RA, retinoic acid;RAR, retinoic acid receptor; RARE, retinoic acid responsive element.

76 DIABETES, VOL. 52, JANUARY 2003

atRA upregulates PDX-1, an important transcription factorin pancreatic development. These data suggest the impor-tant roles of atRA in determining the cell fate of pancreaticprogenitor cells, leading the proper formation of endo-crine versus exocrine pancreas during organogenesis.

RESEARCH DESIGN AND METHODS

Embryonic tissue procurement. All animal experiments were performed inaccordance with the guideline for animal experiments of Kyoto University.Male and female ICR mice were mated overnight. The presence of a vaginalplug the next morning was indicative of pregnancy, and noon of that day wasdesignated as day 0.5. Dorsal embryonic pancreata were harvested on e11.5,e12.5, e14.5, e16.5, and e18.5 using microdissection techniques as describedpreviously (19). Two types of tissue were procured from e11.5 rudiments forin vitro culture, epithelia only (PE) and epithelia with mesenchyme (PEM).Tissue culture. E11.5 rudiments (PE or PEM) were grown under variousculture conditions in 0.4-�m Millipore filter inserts containing 150 �l collagenI gel (Vitrogen; Cohesion, Palo Alto, CA) or basement-rich gel (Matrigel;Collaborative Research, Bedford, MA) and placed in a standard 24-well plateunder sterile conditions. Each well was filled with 500 �l Dulbecco’s modifiedEagle’s medium F-12 (Gibco BRL, Grand Island, NY) containing 10% fetalbovine serum and 1% antibiotic/antimycotic solution (10,000 units/ml penicil-lin G, 10,000 �g/ml streptomycin sulfate, and 20 �g/ml amphotericin B [GibcoBRL]). Three different final concentrations (1, 10, and 100 �mol/l) of atRA(Sigma, St. Louis, MO) were supplemented later in the media and replacedevery 48 h. Control tissues were cultured in collagen I or Matrigel with mediaalone or media with DMSO (the diluent for atRA). In addition, in a differentseries, the same three concentrations of atRA were added only on the 6th dayof culture and harvested after 24 h. All of the tissues were cultured in 5% CO2

at 37°C for 4–7 days.Immunohistochemistry. Harvested tissues were fixed in 4% paraformalde-hyde for 4 h then cryoprotected overnight in 30% sucrose, embedded in TissueTek OCT compound, frozen in liquid nitrogen, and cut into 6-�m sectionsusing Microm HM 505E cryostat. Most of the sections were pretreated withperoxidase blocking reagent (Dako, Carpinteria, CA) to minimize nonspecificbinding to endogenous peroxidase enzymes. Primary antibodies to the follow-ing antigens were used at the indicated dilution: insulin (guinea pig anti-swine;Dako) 1:700, glucagon (rabbit anti-human; Dako) 1:600, cytokeratin MNF 116(mouse anti-human; Dako) ready to use, carbonic anhydrase II (anti-human;The Binding Site, Birmingham, U.K.) 1:500, �-amylase (rabbit anti-human;Sigma) 1:200; PDX-1 (gift from Prof. C.V.E. Wright, Vanderbilt UniversityMedical School, Nashville, TN) 1:1,200, RALDH2 (gift from Dr. Peter McCaf-fery, University of Massachusetts Medical Center, Worcester, MA) 1:2000, Bax(P-19; Santa Cruz Biotech, Santa Cruz, CA) 1:100, Bcl-2 (N-19; Santa CruzBiotech) 1:100, Bcl-xL (H-62; Santa Cruz Biotech) 1:100, and anti-singlestranded DNA (rabbit anti-human; Dako, Kyoto, Japan) 1:100. Primary anti-bodies were incubated at room temperature for 30 min for insulin/glucagon/cytokeratin/Bax/Bcl-2/Bcl-xL/ssDNA, 1 h for CAII/PDX-1, and overnight at 4°Cfor �-amylase and RALDH2. For secondary antibodies, ready-to-use Envisionperoxidase system (Dako) for insulin/glucagons/PDX-1/Bax/Bcl-2/Bcl-xL/ssDNA, biotin-labeled donkey anti-sheep (Chemicon International, Temecula,CA) for CA II, ready-to-use Labeled Streptavidin Biotin (LSAB2) kit (Dako) forcytokeratin, and FITC/Cy3 conjugated goat anti-rabbit (Jackson ImmunoRe-search Lab, West Grove, PA) for �-amylase/RALDH2/PDX-1 were used.Immunoperoxidase was detected by DAB kit (Dako) or AEC (Sigma), alkalinephosphatase by New Fuchsin (Dako) substrate chromogen system, andfluorescently labeled samples were imaged by using a fluorescent microscope.For PDX-1:insulin double staining, sections were first stained with PDX-1using Envision peroxidase system visualized by DAB (brown precipitate),then briefly treated with 0.2 mol/l HCl at room temperature, and insulinstaining was performed using LSAB2 alkaline phosphatase system and visu-alized by New Fuchsin substrate chromogen (red precipitate).Bromo-deoxyuridine incorporation. For determining the number of cellsundergoing proliferation in cultured rudiments, a final concentration of 100�mol/l bromo-deoxyuridine (BrdU; Sigma) was added 12 h before fixation in10% formaldehyde. The proliferating cells were demonstrated by anti-BrdU(mouse monoclonal; Dako) staining. For BrdU:insulin/glucagon double stain-ing, slides were treated with 1 mol/l HCl at 37°C for 30 min, primary antibodymixture was incubated for 1 h at room temperature, then the mixture offluorescent secondary antibodies (goat anti-rabbit FITC/goat anti-mouseCy3)was applied and visualized under a fluorescent WIB filter Olympus micro-scope. Cy3 was seen as yellowish red, and FITC was seen as light green.Quantitative analysis. The protocol used by Miralles et al. (7) was pursuedto quantify PDX-1 and endocrine cells. In brief, serial 6-�m sections were cutand collected in glass slides. One of two consecutive sections was analyzed (to

avoid counting the same cell twice) by immunohistochemistry for the givenantigen. Only immunoreactive cells with visible nucleus were counted. Thesum of �- and �-cells was regarded as total endocrine cells. For ducts/acini/BrdU-positive cells, three positive samples per rudiment were randomlyselected and analyzed by point counting using Densitograph software versionfor Macintosh. The results were obtained by quantifying at least four pancre-atic rudiments in each category. These were compared and analyzed byANOVA, and P � 0.05 was considered statistically significant.Electron microscopy. Tissues were fixed in modified Karnovsky’s fixative(2% paraformaldehyde, 1.5% glutaraldehyde in 0.1 mol/l cacodylate buffer [pH7.4]) for 1–4 h, postfixed in 1% osmium tetroxide for 1 h, dehydrated in gradedethanol, and embedded in Epoxy. Thick sections were cut 0.5–1 �m andstained in toluidine blue. Thin sections were overlaid in copper grid, stainedby uranyl acetate and lead citrate, and viewed with a Hitachi electronmicroscope.RT-PCR. RNA was extracted from pooled e11.5 epithelia and mesenchymeseparately, e12.5 PEM, e14.5 PEM, e16.5 PEM, and e18.5 PEM using the SVTotal RNA isolation kit (Promega, Madison, WI), and cDNA was preparedfrom 1 �g RNA by using RT and random hexamer (Advantage RT-for-PCR kit;Clontech, Palo Alto, CA) according to the manufacturer’s instructions. PCRwas carried out with a mixture consisting of 100 ng cDNA, 20 pmol each offorward and reverse primers, 2 mmol/l dNTP mix, 10� PCR buffer (100 mmol/lTris-HCl [pH 8.8], 500 �mol/l KCl, 0.8% NP40) with 15 mmol/l MgCl2, andrecombinant Taq DNA polymerase (MBI fermentas, Vilnius, Lithuania). �-Ac-tin was used as internal control, cDNA prepared without RT was used asnegative control, and adult mouse liver for RARs (RAR�, RAR�, and RAR�)and chicken ovalbumin upstream promotor transcription factor (COUP-TF II),adult mouse testis for RALDH2, and e13.5 liver for cellular retinoic acidbinding protein II (CRABP II) were used as positive control samples. PCRreactions were performed as follows: 1 cycle of 94°C for 5 min; then 40 cyclesof 94°C for 30 s, annealing temperature (AT) for 30 s, 72°C for 30 s; and finally1 cycle of 72°C for 7 min. Products of amplification were separated on 2%agarose gel and photographed after ethidium bromide staining. Each positiveresult was confirmed by repeating at least three times. We selected primersusing published criteria (20), and AT for each primer set was calculated usingconventional formulas. Primer sequences used are listed as forward thenreverse 5� to 3�. �-actin primers 5�GGCATCGTGATGGACTCCG3� and 5�GCT-GGAAGGTGGACAGCG3� amplify a product of 612 bp; RAR� primers 5�CAGT-TCCGAAGAGATAGTACC3� and 5�TACACCATGTTCTTCTGGATTGC3� amplifya product of 167 bp; RAR� primers 5�TCGAGACACAGAGTACCAGC3� and5�GAAAAAGCCCTTGCACCCCT3� amplify product of 155 bp; RAR� primers5�GCCTCCTCGGGTCTACAAG3� and 5�ATGATACAGTTTTTGTCGCGG3� am-plify a product of 155 bp RXR�; primers 5�TCAACTCCACAGTGTCGCTC3�and 5�TAAACCCCATAGTGCTTGCC3� amplify a product of 174 bp; RALDH2primers 5�TTGCAGATGCTGACTTGGAC3� and 5�TCTGAGGACCCTGCTCA-GTT3� amplify a product of 200 bp; CRABP II primers 5�TGATGAGGAA-GATCGCTGTG3� and 5�TTCCACTCTCCCATTTCACC3� amplify a product of191 bp; COUP-TF II primers 5�GTGGAGAAGCTCAAGGCACTG3� and 5�CGT-GCGGAGGGAAGGGAGA3� amplify a product of 221 bp; and PDX-1 primers5�CCTTGATATCGCTGCCACCATGAACAG3�and 5�CTGCGCTCGAGTGTAG-GCAGTACG3� amplify a product of 484 bp.

RESULTS

Endogenous expression of retinoids in pancreatic

rudiments. We analyzed the mRNA and protein expres-sions implicated in retinoid metabolism. The expression ofRA synthesizing enzyme RALDH2 mRNA was detectedexclusively in mesenchyme at e11.5 (Fig. 1 I). This alsoheld true at the posttranscription level, but the expressionlevel was very low compared with that in the mesenchymeof stomach at e11.5 and 13.5 (Fig. 1 IIC and F). TheRALDH2 mRNA was also expressed in PEM rudimentsthroughout the rest of the developmental period (Fig. 1 I).The expression of mRNAs coding for RARs were analyzednext in e11.5 rudiments. RAR� was expressed in epithelia,with very low expression in mesenchyme; RAR� wasexpressed only in the mesenchyme; and RAR� expressionwas not detected at all. The RA binding protein CRABP IIwas detected only in mesenchyme, and strong expressionof RARs suppressor receptor COUP-TF II was seen inmesenchyme with very low expression in epithelia (Fig. 1I). PDX-1 was used as a pancreatic epithelia marker in

S.S. TULUCHAN AND ASSOCIATES

DIABETES, VOL. 52, JANUARY 2003 77

both RT-PCR and immunohistochemistry, demonstrating agood separation of epithelium and mesenchyme in theseprocedures (Fig. 1 I and IIB and E).Culture in three-dimensional gel systems and exoge-

nous atRA treatment. First, e11.5 PE rudiments werecultured in a three-dimensional gel system of collagen I ormatrigel as controls. PE did not survive in collagen I gelbut developed into cystic ductal structures when culturedin matrigel (Fig. 2A, C, and E). When exposed to exoge-nous atRA, the rudiments survived but failed to show overtdifferentiation in collagen I gel, but those cultured inmatrigel showed very early duct differentiation with in-crease in endocrine cells (Fig. 2B, D, and F). The increasein endocrine cells was quantitative and statistically signif-icant (P � 0.05; Fig. 5A).

PEM control rudiments underwent various morpholog-ical changes redolent of normal development in vivo whencultured in these two gel systems. They showed active cellproliferation as shown by BrdU staining (Fig. 4G). At day4 of culture, endocrine cells were present as solitary cells,PDX-1 expression was seen both in acinar and endocrinecells, and acinar cells began to appear. By day 7, endocrinecells began to coalesce (Fig. 3D and G), acinar differenti-ation became more pronounced (Fig. 4D), and PDX-1expression was seen almost only in insulin-producing cells(Fig. 3J). Ductal differentiation was seen more in matrigelspecimen, probably owing to the presence of insolublebasement membrane components (e.g., laminin, type IVcollagen, and heparan sulfate proteoglycans). These ob-servations are analogous to the findings described in theprevious experiment (19).

PEM rudiments treated with exogenous atRA showedincrease in the expression of PDX-1 and the number of

endocrine cells in a dose-dependent manner (Fig. 3E, F, H,I, K, and L). PDX-1 expression was detected in the ductsand endocrine cells at day 4 but almost only in insulin-producing cells after 7 days of culture (Fig. 3K and L).Most of the differentiated endocrine cells were in isletorientation (i.e., spheroidal in shape with insulin-produc-ing cells occupying the center), few were seen as isolatedsolitary in or emerging from the ducts and coexpressedwith PDX-1 (Figs. 3L and 6E and F). The maximumnumbers of endocrine cells were seen at the 10 �mol/lconcentration of atRA, and the proportion was more thandouble the control rudiments. The differences were signif-icant at the 95% confidence level with P � 0.0001. How-ever, no significant differences were found between theproportions of endocrine cells in rudiments cultured in thematrigel or collagen I gel system treated with exogenousatRA (Fig. 5B). Similarly, the pervasiveness of cysticstructures increased commensurately with increasingdoses of atRA (Figs. 3B and C and 5D). These cysticstructures were confirmed to be ducts by cytokeratin andCA II staining (Fig. 6A and B). On the contrary, acinardifferentiation became sparse in rudiments treated withincreasing doses and completely arrested at a higher (100�mol/l) dose of atRA as validated by �-amylase staining(Figs. 4C and F and 5D). At 100 �mol/l, BrdU-positiveproliferating cells were seen mainly in ducts, protodiffer-entiated endocrine cells, and a few fully differentiatedendocrine cells (Fig. 4J–L).Electron microscopy of atRA-treated pancreas. Thecontrols showed mostly acinar components, identified bypyramidal epithelial cells containing a large number ofsecretory granules compatible with zymogen granules inthe apical cytoplasm, and crowded with closely spaced

FIG. 1. Endogenous expression of retinoids inpancreatic rudiment. I: RT-PCR analysis of en-zymes, binding proteins, receptors, and repres-sors involved for atRA metabolism in embryonicpancreas. The expression of internal control�-actin is shown on the top. RA synthesizingenzyme RALDH2 is expressed exclusively inmesenchyme at e11.5 and in the whole pancreasin the rest of the developmental period. In e11.5pancreatic rudiments, the expression pattern ofRAR� shows high expression in epithelia withvery low expression in mesenchyme, RAR� inmesenchyme only, and RAR � with no expres-sion; CRABP II is expressed only in mesenchyme;and repressor of retinoid receptors COUP-TF IIshow stronger expression in mesenchyme com-pared with epithelia. Exclusive expression ofRALDH2 and CRABP II enzymes in e11.5 mesen-chyme suggests that RA synthesis takes place inmesenchyme, and the expression pattern ofRARs and COUP-TF II suggests that endogenousRA acts predominantly through paracrine ac-tions. II: Endogenous expression of RALDH2protein. A, B, and C: E11.5. D, E, and F: E13.5embryonic pancreas. Schematic representationsof PDX-1 in gray and RALDH2 in green (A andD), PDX-1 staining (B and E), and RALDH2staining (C and F). Serial sections show thatRALDH2 expression is seen exclusively in mes-enchyme at these stages, but the level of expres-sion is poor compared with mesenchyme ofstomach. Note that PDX-1 is used as a pancreaticepithelia marker. M, 100-bp marker; C, positivecontrol; m, mesenchyme; e, epithelium and nu-merical denote corresponding embryonic days;Pe, pancreatic epithelia; Pm, pancreatic mesen-chyme; SE, stomach epithelia; Sm, stomach mes-enchyme. Magnification �200 in B and C and�100 in E and F.

PANCREATIC DIFFERENTIATION BY RETINOIC ACID


parallel cisternae of granular endoplasmic reticulum in thebasal region. However, in rudiments treated with atRA,large numbers of duct cells were prevalent and wereidentified by their typical simple epithelium, uniformity incellular and nuclear size, and more condensed nuclearchromatin. The cytoplasm was scanty with poorly devel-oped cytoplasmic organelles. The apical surface projectedshort microvilli, and lateral surfaces of neighboring ductcells exhibited more interdigitations (Fig. 6C). The endo-crine cells were identified by size and shape of endocrinegranules and were different from acini or duct cells. A fewof the duct cells also exhibited some endocrine granules intheir cytoplasm. The ultrastructure findings were com-pared with previously published articles (21,22) and werecompatible with the immunohistochemical findings shownabove.atRA pulse treatment showed overexpression of pro-

apoptotic protein and PDX-1 in acinar cells. Analysisof cultured pancreas with atRA added on day 6 of cultureshowed profound dysmorphogenesis of acinar compo-nents (Fig. 7E). These cells demonstrated overexpressionof proapoptotic protein Bax in their cytoplasm (Fig. 7G)with increase in ssDNA-positive nuclear fragmentations(Fig. 7H). However, the endocrine cells were almost freefrom the apoptotic effects of atRA. There was almost no

expression of antiapoptotic protein Bcl-2 or Bcl-xL inatRA-treated rudiments (data not shown), and no obvioussigns of Bax or ssDNA expression were noted in thecontrols (Fig. 7C and D). Many PDX-1 overexpressingacinar cells as well as endocrine cells with preislet mor-phology were seen in atRA-treated samples (Fig. 7F). Thequantitative study demonstrated the significant increase inthe number of PDX-1–positive cells (Fig. 7).

DISCUSSION

RA has been well acknowledged as a signaling moleculefor mesenchymal/epithelial interactions of various organs(11–14), and here we have demonstrated its role in thedevelopment of pancreas, especially in differentiation ofducts and endocrine cells. Our study focuses on e11.5pancreatic rudiments when the local mesenchyme is welldeveloped and yet can be separated mechanically fromepithelium. This gives a good ground to explore the type ofsignaling molecules involved in the interaction betweenthese two surfaces.

Mesenchymal interaction could be due to secretion ofinducing or transforming factors, production of extracel-lular matrix, and information exchanged through cell-to-cell contact during development. The ability of exogenous

FIG. 2. Early duct differentiationand induction of endocrine cellsin atRA-treated PE. A, C, and E:Control. B, D, and F: atRAtreated (1 �mol/l). A–D: Matrigelpictures. E and F: Insulin stain-ing. When e11.5 PE are culturedin matrigel with 1 �mol/l atRA,they show early duct differentia-tion (A and B at day 3 and C andD at day 7) with induction ofendocrine cells compared withthe controls (compare between E

and F). Magnification �100 in E

and F.



atRA to induce differentiation in both PE and PEM and itsexclusive endogenous expression in mesenchyme sug-gests that it is one of the candidates of mesenchymalfactors for endocrine differentiation. This hypothesis sup-

ports the permissive effect of mesenchyme on the devel-opment of the endocrine pancreas (23).Endogenous expression of retinoids suggest impor-

tance during pancreatic development. RA is synthe-

FIG. 3. Induction of endocrine cells in atRA-treatedPEM. E11.5 PEM were cultured in either collagen Igel (A–C and G–L) or matrigel (D–F). At day 7 ofculture controls (A, D, G, and J) or atRA-treated 10�mol/l (B, E, H, and K) and 100 �mol/l (C, F, I, andL). Hematoxylin and eosin staining (A–C); insulin(D–I); PDX-1:insulin double staining (J–L). Note theproliferation of cystic structures and induction ofendocrine cells (in both gel systems) with increasingdose of atRA. Insulin cells are PDX-1 positive. Mag-nification �100.

FIG. 4. Decrease of acini and BrdU-positive prolif-erating cells in atRA-treated PEM. A, D, and G:controls. B, E, and H: 10 �mol/l (C, F, and I–L) and100 �mol/l atRA-treated rudiments at day 4 (A–C)and at day 7 (D–L). Amylase staining (A–F), BrdUstaining (G–I), and insulin:BrdU double staining(J–L). Note the inhibition of acinar componentswith increasing dose of atRA. At 100 �mol/l concen-tration, acinar differentiation was completely ar-rested (C and F). Some of the ductal structures inatRA-treated rudiments exhibited positive amylasestaining (white arrow heads). Therefore, the acino-ductal transdifferentiation may be the most likelycause of ductal induction. BrdU staining shows thatthe active proliferating cells are present in bothcontrol and atRA-treated rudiments. However, at ahigher dose of atRA, the proliferative cells areconfined mostly to ductal and endocrine compart-ment. J–L: Insulin:BrdU double staining shows ac-tive proliferating cells mostly in ducts (whitearrow) and endocrine cells at protodifferentiated(green arrow head) or fully differentiated (greenarrow) stage. Magnification �100 in A–I, �200 in J,and �400 in K and L.



sized from retinaldehyde mostly by NAD-dependentdehydrogenase (24). Among the three dehydrogenases,RALDH2 exhibits the greatest substrate specificity, and itsdistribution provides the most accurate guide to the local-ization of atRA in the embryonic tissues (25,26). Our highlysensitive RT-PCR and immunohistochemistry results showthat RALDH2 is expressed solely in the mesenchyme ate11.5 (Fig. 1 I and IIC and F) and in whole pancreasthroughout the rest of the developmental period. Thisresult is similar to the findings that RALDH2 is widelyexpressed in mesenchyme in developing gut including theforegut (27,28).

The expression of CRABP II in mesenchyme also illus-trates the dominant role of mesenchyme in retinoid me-tabolism; in addition, its expression contributes to thesynthesis of RA because it has been shown to be associ-ated with cells that synthesize RA (29,30). CRABPs mayhave some role in development of islets because they are

localized in adult islets (31), and transgenic mice overex-pressing CRABP I die prematurely as a result of tumororiginating from islet of Langerhans (32).

Retinoid signaling is transduced by two families ofnuclear receptors, RAR (�, �, and �) and RXR (�, �, and �)isoforms. All-trans form is the natural ligand for the RAR,and 9-cis form is the natural ligand for RXR, although thelatter binds to both receptor families (26). A previousarticle by Kadison et al. (33) showed that at e12.5, RAR�expression is seen only in mesenchyme and RAR�/RAR�in epithelia by Western blot analysis, but our highlysensitive RT-PCR results at e11.5 show few differences.Here we have tried to be meticulous by using absoluteepithelial marker PDX-1 and appropriate positive controlsto derive our conclusions. Therefore, these discrepanciescould be due either to the method and time of analysis orto the quality of samples. The expression of RARs in bothepithelia and mesenchyme raises the possibility that en-

FIG. 5. A: Quantitative analysis of endocrine cells in PE rudiments shows statistically significant induction of endocrine cells by exogenous atRAtreatment. White bar, insulin; black bar, glucagon. B: Significant dose effect of atRA was seen in PEM rudiments as well, with maximum numberof endocrine cells found at 10 �mol/l concentration. No significant differences were found between the proportions of endocrine cells inrudiments treated with exogenous atRA in the two gel systems. Black circle, matrigel; white circle, collagen I gel. C: Quantitative analysis ofBrdU-positive cells shows a significant drop in proliferating cell numbers in atRA-treated samples. However, this decrease was seen only in acinarcell components. D: Quantitative analysis of acinar and duct cells shows a significant drop in acini population, whereas there is a significantinduction of duct cells when treated with atRA, in a dose-dependent manner. At 100 �mol/l concentration, acini differentiation is completelyinhibited. White circle, acini; black circle, ducts. All of the atRA-treated samples show statistically significant P < 0.05.



dogenous atRA acts in both an autocrine and a paracrinemanner through these receptors. However, the strongexpression of RAR repressor COUP-TF II in mesenchymesuggests that endogenous RA primarily prefers paracrineaction because most of the autocrine actions may berepressed by these orphan receptors in mesenchyme (34).Induction of endocrine and ductal differentiation but

inhibition of acini by atRA. Our ex vivo observationsdemonstrated the endogenous presence of retinoids. Howdoes this RA affect the pancreatic development anddifferentiation? To discern the answer, we cultured undif-ferentiated e11.5 pancreatic rudiments at different concen-tration of exogenous atRA. The results obtained uponatRA administration in the three-dimensional organ cul-ture system strongly suggest that it plays an active role inthe development of pancreas. Besides the regressive effecton acinar differentiation, both quantitative and significantaugmentation of endocrine cells at the posttranscriptionallevel was appreciated. The increase in differentiation ofductal structures (confirmed by cytokeratin/CAII stainingand electron microscopy) is also important because theyare necessary for branching morphogenesis and for originof endocrine cells. In our model, endocrine cells are seento originate from newly differentiated ducts, which wasvalidated by double staining of insulin and BrdU/PDX-1(Fig. 6D–F). This finding resembles and supports the invivo and in vitro model of endocrine pancreas develop-ment (35,36). Kadison et al. (33) showed that exogenousatRA and 9-cis RA have completely different ontogeniceffects during pancreas differentiation. However, few com-parative studies between RA isomers have shown 9-cis tobe almost 10 times more potent than the all-trans form

(37,38). Our results also suggest that atRA has a similartype of ontogenic effects as 9-cis RA at a higher dose.Pancreatic lineage selection by atRA. With sharpchanges in the fate of pancreas cultured under the influ-ence of exogenous atRA, we tried to seek the mechanismsunderlying the inhibition of acinar cells and induction ofducts or endocrine cells. Our results indicate that upregu-lation of PDX-1 by atRA plays the central role on thesephenotypic selections. The possible underlying mecha-nism for inhibition of acini is via apoptosis. The PEMrudiments pulse treated with atRA 24 h before harvestingshowed dysmorphogenesis of acinar cells and overexpres-sion of the proapoptosis protein Bax in their cytoplasmwith increase in anti-ssDNA positive DNA fragmentedcells. The demonstration of apoptosis in these cells couldbe due to the direct effect of atRA itself or the upregulationof PDX-1, because persistent upregulation of PDX-1 de-stroys the acini population by fatty infiltration and apopto-sis (39).

Acinoductal transdifferentiation is the most likely causeof ductal induction in atRA-treated rudiments (40). Thishypothesis is supported by some amylase-positive ducts inatRA-treated rudiments and duct cells exhibiting increasein PDX-1 expression.

The mechanism for induction of endocrine cells may bedue either to stimulating the expression of insulin mRNAlevels probably by binding to the RARE located upstreamof the insulin gene enhancer (41) or to the induction inendocrine transcription factors by atRA. RA has beenimplicated in foregut A-P patterning through expression ofhomeobox genes (42,43). The homeobox gene PDX-1 playsa critical role in development of pancreas (44,45). Recent

FIG. 6. Cystic ductal structures are origin of endocrine cells. The cystic structures induced by atRA are identified as ducts, validated bycytokeratin staining (A), carbonic anhydrase staining (B), and electron microscopy (C). Note the ultrastructure morphology of the ducts: simpleepithelium with uniform cellular and nuclear size, scanty cytoplasm with poorly developed organelles, and apical surface projecting shortmicrovilli. In our model, the origin of endocrine cells seems to be from these duct systems as insulin-positive cells are seen in the ducts (D; whitearrow, Insulin:BrdU double staining) or seen as emerging from the ducts (E and F; black arrow heads, insulin:PDX-1 double staining).Magnification: �100 in A, �200 in B and D, �400 in E and F, �8,000 in C, �100 in inset B, and � 2,000 in inset C.



studies show that atRA induces the XIHbox-8 gene inXenopus (46,47), the amphibian homologue of PDX-1. Inour model, the effect of atRA on induction of endocrinecells seems to be partially mediated by the upregulation ofPDX-1 gene. There is a growing list of experiments indifferent organs, cell lines, and stem cells, where the roleof RA is as an inducer of pancreatic endocrine transcrip-tion factors. The role of Pax-6 in RA signaling of thedeveloping eye (48), Xlim-1 (Xenopus equivalent to humanLim-1) mRNA induction by RA (49), and upregulation ofNeuro D on exposure of RA (50) are a few of theseexamples. However, more studies are needed to clarify thedetailed relationship between RA and these endocrinetranscription factors during pancreas development.

In conclusion, the overall findings demonstrate thatatRA is an important signaling molecule in the develop-ment of the embryonic pancreas and plays a great role indifferentiation of endocrine and ductal cells, predomi-nantly through paracrine actions and upregulation ofPDX-1 gene. Understanding the full picture of the devel-opmental process of the endocrine pancreas is still incom-plete, but we believe that identification of signalingmolecules, information on their proliferative or inductive

signals, and elucidating their roles with transcription fac-tors will certainly unravel the greater details in the future.

ACKNOWLEDGMENTS

This study was supported in part by a grant from theMinistry of Education of Japan.

We extend our deep appreciation to Dr. Yoichi Tani(Dako, Japan) for expert opinion in immunohistochemicaltechniques and Michiharu Kurino (Laboratory of Pathol-ogy, Kyoto University Hospital) for technical assistancewith electron microscopy. We also thank Prof. C.V. Wrightand Dr. Peter McCaffery for generously providing theantibodies.

REFERENCES

1. Golosow N, Grobstein C: Epitheliomesenchymal interaction in pancreaticmorphogenesis. Dev Biol 4:242–255, 1962

2. Fell PE, Grobstein C: The influence of extra-epithelial factors on thegrowth of embryonic mouse pancreatic epithelium. Exp Cell Res 53:301–304, 1968

3. Kallman F, Grobstein C: Fine structure of differentiating mouse pancreaticexocrine cells in transfilter culture. J Cell Biol 20:399–413, 1968

4. Wells JM, Melton DA: Vertebrate endoderm development. Annu Rev Cell

Dev Biol 1:393–410, 1999

FIG. 7. atRA pulse treatment in PEM rudiments. To discern the mechanism by which atRA selects endocrine/ductal differentiation over acini, wepulse-treated PEM rudiments with different concentrations of atRA on day 6 of culture or 24 h before harvesting and analyzed byimmunohistochemistry and quantitative analysis. Upregulation of PDX-1 gene by atRA seems to be the key factor for these phenotypic selections.Controls (A–D) and 100 �mol/l pulse-treated rudiments (E–H). Pulse-treated rudiments show dysmorphogenesis of acinar cells with amylase-positive ductal cells (E; white arrow). These acinar cells also show the overexpression of proapoptotic protein Bax in their cytoplasm (G) withincrease in ssDNA-positive nuclear fragmented cells (H; black arrows). Similarly, overexpression of PDX-1 gene was seen in the acini (whitearrows, compare with the control) with endocrine cells in preislet morphology (F; dashed white lines). Quantitative analysis shows significantdose-dependent increase of PDX-1 cells, both in acini and in endocrine cells (P < 0.5).White circle, PDX-1–positive endocrine cells; black circle,PDX-1–positive acini. Magnification �100 in A and E; �200 in B and F; and �400 in C, D, G, and H).



5. Grapin-Botton A, Melton DA: Endoderm development: from patterning toorganogenesis. Trends Genet 16:124–130, 2000

6. Kim SK, Hebrok M, Melton DA: Notochord to endoderm signaling isrequired for pancreas development. Development 124:4243–4252, 1997

7. Miralles F, Czernichow P, Scharfmann R: Follistatin regulates the relativeproportions of endocrine versus exocrine tissue during pancreatic devel-opment. Development 125:1017–1024, 1998

8. Miralles F, Czernichow P, Ozaki K, Itoh N, Scharfmann R: Signalingthrough fibroblast growth factor receptor 2b plays a key role in thedevelopment of the exocrine pancreas. Proc Natl Acad Sci U S A

96:6267–6272, 19999. Scharfmann R: Control of early development of the pancreas in rodents

and humans: implications of signals from the mesenchyme. Diabetologia

43:1083–1092, 200010. Eichel G: A vital role for vitamin A. Nat Genet 21:346–347, 199911. Batourina E, Gim S, Bello N, Shy M, Clagett-Dame M, Srinivas S, Costantini

F, Mendelsohn C: Vitamin A controls epithelial/mesenchymal interactionsthrough Ret expression. Nat Genet 27:74–78, 2001

12. Malpel S, Mendelsohn C, Cardoso WV: Regulation of retinoic acid signalingduring lung morphogenesis. Development 127:3057–3067, 2000

13. LaMantia AS, Bhasin N, Rhodes K, Heemskerk J: Mesenchymal/epithelialinduction mediates olfactory pathway formation. Neuron 28:411–425, 2000

14. Plateroti M, Rreund JN, Leberquier C, Kedinger M: Mesenchyme mediatedeffects of retinoic acid during rat intestinal development. J Cell Sci

110:1227–1238, 199715. Cabera-Vallandares G, German MS, Matschinsky FM, Wang J, Fernandez-

Mejia C: Effect of retinoic acid on glucokinase activity and gene expressionand on insulin secretion in primary cultures of pancreatic islets. Endocri-

nology 140:3091–3096, 199916. Chertow BS, Blaner WS, Baranetsky NG, Sivitz WI, Cordle MB, Thompson

D, Meda P: Effects of vitamin A deficiency and repletion on rat insulinsecretion in vivo and in vitro from isolated islets. J Clin Invest 79:163–169,1987

17. Basu TK, Basualdo C: Vitamin A homeostasis and diabetes mellitus.Nutrition 13:804–806, 1997

18. Figueroa DJ, Hess JF, Ky B, Brown SD, Sandig V, Hermanowski-Vosatka A,Twells RC, Todd JA, Austin CP: Expression of the type I diabetes-associated gene LRP5 in macrophages, vitamin A system cells, and theIslets of Langerhans suggests multiple potential roles in diabetes. J His-

tochem Cytochem 48:1357–1368, 200019. Gittes GK, Galante PE, Hanahan D, Rutter WJ, Debase HT: Lineage-specific

morphogenesis in the developing pancreas: role of mesenchymal factors.Development 122:439–447, 1996

20. Ulven SM, Gundersen TE, Weedon MS, Landaas VO, Sakhi AK, Fromm SH,Geronimo BA, Moskaug JO, Blomhoff R: Identification of endogenousretinoids, enzymes, binding proteins, and receptors during early postim-plantation development in mouse: important role of retinal dehydrogenasetype 2 in synthesis of all-trans-retinoic acid. Dev Biol 220:379–391, 2000

21. Like AA, Orci L: Embryogenesis of the human pancreatic islets: a light andelectron microscopic study. Diabetes 21:511–534, 1972

22. Kodama T: A light and electron microscopic study on the pancreatic ductalsystem. Acta Pathol Jpn 33:297–321, 1983

23. Dudek RW, Lawrence IE Jr, Hill RS, Johnson RC: Induction of isletcytodifferentiation by fetal mesenchyme in adult pancreatic ductal epithe-lium. Diabetes 40:1041–1048, 1991

24. Moss JB, Xavier-Neto J, Shapiro MD, Nayeem SM, McCaffery P, Drager UC,Rosenthal N: Dynamic patterns of retinoic acid synthesis and response inthe developing mammalian heart. Dev Biol 199:55–71, 1998

25. Horton C, Maden M: Endogenous distribution of retinoids during normaldevelopment and teratogenesis in the mouse embryo. Dev Dyn 202:312–323, 1995

26. Ross SA, McCaffery PJ, Drager UC, De Luca LM: Retinoids in embryonaldevelopment. Physiol Rev 80:1021–1054, 2000

27. Berggren K, McCaffery P, Drager U, Forehand CJ: Differential distributionof retinoic acid synthesis in the chicken embryo as determined byimmunolocalization of the retinoic acid synthetic enzyme, RALDH-2. Dev

Biol 210:288–304, 199928. Niederreither K, Fraulob V, Garnier JM, Chambon P, Dolle P: Differential

expression of retinoic acid-synthesizing (RALDH) enzymes during fetaldevelopment and organ differentiation in the mouse. Mech Dev 110:165–171, 2002

29. Zheng WL, Bucco RA, Schmitt MC, Wardlaw SA, Ong DE: Localization of

cellular retinoic acid-binding protein (CRABP) II and CRABP in developingrat testis. Endocrinology 137:5028–5035, 1996

30. Bucco RA, Zheng WL, Davis JT, Sierra-Rivera E, Osteen KG, ChaudharyAK, Ong DE: Cellular retinoic acid-binding protein II presence in ratuterine epithelial cells correlates with their synthesis of retinoic acid.Biochemistry 36:4009–4014, 1997

31. Kato M, Kato K, Blaner WS, Chertow BS, Goodman DS: Plasma and cellularretinoid-binding proteins and transthyretin (prealbumin) are all localizedin the islets of Langerhans in the rat. Proc Natl Acad Sci U S A

82:2488–2492, 198532. Perez-Castro AV, Tran VT, Nguyen-Huu MC: Defective lens fiber differen-

tiation and pancreatic tumorigenesis caused by ectopic expression of thecellular retinoic acid-binding protein I. Development 119:363–375, 1993

33. Kadison A, Kim J, Maldonado T, Crisera C, Prasadan K, Manna P, PreuettB, Hembree M, Longaker M, Gittes G: Retinoid signaling directs secondarylineage selection in pancreatic organogenesis. J Pediatr Surg 36:1150–1156, 2001

34. Cooney AJ, Leng X, Tsai SY, O’Malley BW, Tsai MJ: Multiple mechanismsof chicken ovalbumin upstream promoter transcription factor-dependentrepression of transactivation by the vitamin D, thyroid hormone, andretinoic acid receptors. J Biol Chem 268:4152–4160, 1993

35. Teitelman G, Lee JK: Cell lineage analysis of pancreatic islet development:glucagon and insulin cells arise from catecholaminergic precursorspresent in the pancreatic duct. Dev Biol 121:454–466, 1987

36. Bouwens L, Wang RN, De Blay E, Pipeleers DG, Kloppel G: Cytokeratins asmarkers of ductal cell differentiation and islet neogenesis in the neonatalrat pancreas. Diabetes 43:1279–1283, 1994

37. Han G, Chang B, Connor MJ, Sidell N: Enhanced potency of 9-cis versusall-trans-retinoic acid to induce the differentiation of human neuroblas-toma cells. Differentiation 59:61–69, 1995

38. Wan YJ, Pan T, Wang L, Locker J, Wu TC: 9-cis-retinoic acid is moreeffective than all-trans-retinoic acid in upregulating expression of thealpha-fetoprotein gene. J Mol Endocrinol 14:101–108, 1995

39. Heller RS, Stoffers DA, Bock T, Svenstrup K, Jensen J, Horn T, Miller CP,Habener JF, Madsen OD, Serup P: Improved glucose tolerance and acinardysmorphogenesis by targeted expression of transcription factor PDX-1 tothe exocrine pancreas. Diabetes 50:1553–1561, 2001

40. Rooman I, Heremans Y, Heimberg H, Bouwens L: Modulation of ratpancreatic acinoductal transdifferentiation and expression of PDX-1 invitro. Diabetologia 43:907–914, 2000

41. Clark AR, Wilson ME, London NJ, James RF, Docherty K: Identificationand characterization of a functional retinoic acid/thyroid hormone-response element upstream of the human insulin gene enhancer. Biochem

J 309:863–870, 199542. Packer AI, Crotty DA, Elwell VA, Wolgemuth DJ: Expression of the murine

Hoxa4 gene requires both autoregulation and a conserved retinoic acidresponse element. Development 125:1991–1998, 1998

43. Huang D, Chen SW, Langston AW, Gudas LJ: A conserved retinoic acidresponsive element in the murine Hoxb-1 gene is required for expressionin the developing gut. Development 125:3235–3246, 1998

44. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, HoganBL, Wright CV: PDX-1 is required for pancreatic outgrowth and differen-tiation of the rostral duodenum. Development 122:983–995, 1996

45. Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CV, TeitelmanG: Expression of murine STF-1, a putative insulin gene transcription factor,in beta cells of pancreas, duodenal epithelium and pancreatic exocrine andendocrine progenitors during ontogeny. Development 121:11–18, 1995

46. Moriya N, Komazaki S, Asashima M: In vitro organogenesis of pancreas inXenopus laevis dorsal lips treated with retinoic acid. Dev Growth Differ

42:175–185, 200047. Moriya N, Komazaki S, Takahashi S, Yokota C, Asashima M: In vitro

pancreas formation from Xenopus ectoderm treated with activin andretinoic acid. Dev Growth Differ 42:593–602, 2000

48. Enwright JF 3rd, Grainger RM: Altered retinoid signaling in the heads ofsmall eye mouse embryos. Dev Biol 221:10–22, 2000

49. Taira M, Jamrich M, Good PJ, Dawid IB: The LIM domain-containinghomeo box gene Xlim-1 is expressed specifically in the organizer region ofXenopus gastrula embryos. Genes Dev 6:356–366, 1992

50. Takahashi J, Palmer TD, Gage FH: Retinoic acid and neurotrophinscollaborate to regulate neurogenesis in adult-derived neural stem cellcultures. J Neurobiol 38:65–81, 1999



all-trans retinoic acid induces differentiation of ducts ... · koji fujimoto, and masayuki imamura...

Documents