a quantitative targeted proteomics approach to validate...
Post on 17-Jul-2020
1 Views
Preview:
TRANSCRIPT
Nature Methods
A quantitative targeted proteomics approach to validate predicted microRNA targets in C. elegans Marko Jovanovic, Lukas Reiter, Paola Picotti, Vinzenz Lange, Erica Bogan, Benjamin A Hurschler, Cherie Blenkiron, Nicolas J Lehrbach, Xavier C Ding, Manuel Weiss, Sabine P Schrimpf, Eric A Miska, Helge Grosshans, Ruedi Aebersold & Michael O Hengartner Supplementary Figure 1 ICAT quantifications are suitable for SRM measurements
Supplementary Figure 2 Splice variant-specific regulation of the let-7 miRNA target let-526/lss-4
Supplementary Figure 3 Genes displaying positive protein changes in let-7(n2853) mutant worms are enriched in let-7 suppressors
Supplementary Figure 4 Normalization of the light ICAT labeled extract (let-7(n2853)) to the heavy ICAT labeled extract (wild type) for all three biological replicate samples
Supplementary Table 2 Relative protein abundance of all let-7 candidates
Supplementary Table 3 29 candidate proteins are regulated in let-7(n2853) mutants
Supplementary Table 4 Suppression of let-7(n2853) lethality – regulated candidates
Supplementary Table 5 Suppression of let-7(n2853) lethality – not regulated candidates
Supplementary Table 6 Relative mRNA levels of all candidates
Supplementary Table 7 Relative protein abundance of predicted miR-58 targets and random candidates
Supplementary Table 10 RT-qPCR primers
Supplementary Table 11 RNAi clones
Supplementary Table 12 Luciferase expression clones
Supplementary Results 1 Exact protein quantification in C. elegans using targeted proteomics
Supplementary Results 2 LET-526 shows a splice-variant specific response to let-7
Supplementary Discussion Limits of the targeted proteomics approach Note: Supplementary Tables 1, 8 and 9 are available on the Nature Methods website.
Nature Methods: doi: 10.1038/nmeth.1504
1
Supplementary Figure 1: ICAT quantifications are suitable for SRM measurements
A wild-type protein extract was split in half and one half was labeled with the light ICAT reagent, the
other half with the heavy ICAT reagent. The labeled extracts were pooled, trypsinized and processed
further for MS analysis. The measurements were done in the SRM mode on the 4000 Q-Trap. A total
of 11 peptides, representing five proteins (2 to 3 peptides per protein), were measured in a single run
(45 minutes). (a) List of the measured peptides (heavy and light form), their respective peak areas and
the ratio (light to heavy) of the corresponding peak areas. Ideally a ratio of 1 is expected. (b)
LC-SRM chromatogram. The inset shows a zoom-in on four peptide pairs. (c) Calculated average
ratio and the corresponding standard deviation.
Nature Methods: doi: 10.1038/nmeth.1504
2
Supplementary Figure 2: Splice variant-specific regulation of the let-7 miRNA target
let-526/lss-4
(a) Genomic structure of the let-526 (C01G8.9) locus. The two gene models, let-526a and let-526b
are depicted. Black boxes represent coding exonic sequences and grey boxes the untranslated regions
(5’UTR and 3’UTR). EST evidence was used to map the 3’UTR to LET-526b mRNA as shown. The
two peptides that were quantified are indicated in red. Peptide LIEFCEHNGEPLTMVPQVSK is
unambiguous and specific for LET-526a only, while peptide VPEATDSSIPCPVSPR is ambiguous
and cannot distinguish between LET-526a and LET-526b. (b) Representative LC-SRM
chromatograms showing the SRM measurements of the two peptides from let-7(n2853) and wild-type
extracts. Each peptide was measured using two transitions. For transition 1, the red and grey lines
correspond to the signal intensities in let-7(n2853) extracts and wild-type extracts, respectively. For
transition 2, let-7(n2853) intensity is depicted in blue and wild-type in green. The fold change ratios
(let-7(n2853) versus wild-type) averaged over all SRM measurements and over all biological
replicates for each peptide and the corresponding standard deviations are shown within the respective
chromatograms. (c) let-526a and let-526a,b mRNA distributions, determined by RT-qPCR, across
polysomal profiles of L4 stage wild-type and ain-2(RNAi); ain-1(ku322) mutant worms. The
let-526a,b RT-qPCR primers detect both splice variants, whereas the let-526a RT-qPCR primers are
specific to the let-526a isoform. The dotted black line indicates the boundary between monosomes
and polysomes. Representative polysome profiles of wild-type and ain-2(RNAi); ain-1(ku322) mutant
worms are shown above. Polysomal profiling experiments were performed in triplicate. The error bars
depict the standard error of the mean.
Nature Methods: doi: 10.1038/nmeth.1504
3
Supplementary Figure 3: Genes displaying positive protein changes in let-7(n2853)
mutant worms are enriched in let-7 suppressors
let-7(n2853) animals grown at 25°C die at the adult stage due to vulval bursting. Knock-down of
some known targets has been shown to rescue this lethality to different degrees1.
(a) The 19 genes that showed positive protein changes were knocked-down by RNAi to determine if
they suppress the let-7(n2853) lethal phenotype. Less than 5% of the let-7(n2853) animals treated
with control RNAi (vector RNAi or ZK617.1 (unc-22) RNAi) survived as adults. Two genes could
not be scored, as their RNAi inactivation led to either lethality or larval arrest. The remaining 17
candidates are represented by the grey bars, and the positive controls (F11A1.3 (daf-12), C12C8.3
(lin-41) and C18D1.1 (die-1) RNAi) are depicted as the black bars. Only survival rates above 5% are
shown. (b) As a control, 29 candidates that did not show a significant protein change in the
let-7(n2853) mutant animals in our targeted proteomics assay were tested as in (a), including the same
positive and negative controls. Again, 5/29 genes could not be scored due to lethality or larval arrest.
(c) The “regulated” candidates are significantly enriched in let-7(n2853) suppressors compared to the
“not regulated” group. The P-value of enrichment (Fisher’s Exact Test) was calculated for different
survival cutoffs. The table lists the number of suppressors for each group (“regulated” and “not
regulated”) at the listed cutoffs and the corresponding P-values.
All the experiments were performed at 25°C and in triplicate. The error bars depict the standard error
of the mean. The candidate marked by the asterisk (*) showed suppression in two out of three
replicate experiments and was regarded as positive as the average survival rate over all three
replicates was above the threshold.
Nature Methods: doi: 10.1038/nmeth.1504
4
Supplementary Figure 4: Normalization of the light ICAT labeled extract (let-7(n2853))
to the heavy ICAT labeled extract (wild type) for all three biological replicate samples
To normalize the two extracts to each other, the 11 standard peptides (see Supplementary Fig. 1)
were measured in the light and heavy labeled version (SRM mode) and the ratio (light to heavy) over
all 11 peptides calculated for each biological replicate. Subsequent quantifications for each biological
replicate were corrected by their respective normalization value. The normalization values for all
biological replicates and the LC-SRM chromatograms of the respective SRM measurements are
shown. All the measurements were done with non-fractionated samples.
Nature Methods: doi: 10.1038/nmeth.1504
5
Supplementary Table 2: Relative protein abundance of all let-7 candidates
Gene CGCmean log2 ratio
(let-7(n2853) / wt)
log2 ratio
replicate 1
log2 ratio
replicate 2
log2 ratio
replicate 3
replicates
quantifiedP -value Known Predicted Experiment Literature Neutral Control
C42D8.2 vit-2 -3.7 -4.3 -4.3 -2.6 3 < 0.001 - - - - - YES
F18A1.2 lin-26 -3.9 -3.3 -5.4 -4.2 3 < 0.001 - YES - - - -
Y65B4BL.5 - 0.4 0.4 NA 0.3 2 < 0.001 - YES - - - -
Y47G6A.10 spg-7 0.3 0.5 0.1 0.2 3 < 0.001 - - YES - - -
Y22D7AL.5 hsp-60 0.2 0.2 0.0 0.2 3 < 0.001 - - YES - - -
C14C10.5 - 2.0 2.0 1.6 2.3 3 < 0.001 - YES - - - -
K07H8.6a vit-6 -4.5 -4.1 -5.7 -3.8 3 < 0.001 - YES - - - YES
F35G12.8 smc-4 -5.5 -5.0 -5.2 -6.2 3 < 0.001 - - YES - - -
F41E6.4a smk-1 -3.7 -3.3 -3.2 -4.7 3 < 0.001 - YES - - - -
C56E6.1 abcx-1 3.4 5.6 2.4 3.1 3 < 0.001 - YES - - - -
K12H4.8 dcr-1 -3.0 -2.5 -2.3 -4.0 3 < 0.001 - - - YES - -
F23H11.4a - -4.5 -6.0 -3.5 -3.8 3 < 0.001 - YES - - - -
Y48A6C.4 - 2.8 2.7 NA 2.9 2 < 0.001 - YES - - - -
C47B2.5 eif-6 0.4 0.4 0.3 0.5 3 < 0.001 - - YES - - -
W01F3.3 mlt-11 0.4 0.3 0.4 0.8 3 < 0.001 - YES - - - -
ZC168.4 cyb-1 -2.8 NA -2.8 -2.9 2 < 0.001 - YES - - - -
K09D9.1 - 1.5 1.3 1.7 NA 2 0.0024 - YES - - - -
T19A6.2a ngp-1 1.9 2.4 0.8 2.0 3 0.0028 - - YES - - -
R31.1 sma-1 0.3 0.4 0.2 0.2 3 0.0031 - - YES - - -
F53A9.10a tnt-2 0.2 0.2 0.4 0.1 3 0.0033 - - - - YES -
T21E12.4 dhc-1 0.2 0.2 0.1 0.3 3 0.0036 - - YES - - -
W06A7.3a ret-1 -0.2 -0.2 -0.1 -0.3 3 0.0045 - YES - - - -
F46H5.3a - 0.3 0.4 0.3 0.1 3 0.0045 - - - - YES -
F46B6.7 ztf-7 0.1 0.2 0.0 0.2 3 0.0047 - YES - - - -
C01G8.9a let-526 0.9 0.8 1.0 0.9 3 0.0049 YES YES YES - - -
ZK180.4 - -1.2 -1.2 -2.2 -0.7 3 0.0067 - YES - - - -
T22B11.5 - 0.2 0.2 0.0 0.3 3 0.0071 - YES - - - -
F46E10.8 ubh-1 1.4 1.2 NA 1.7 2 0.0082 - YES - - - -
F56A3.4 spd-5 0.7 0.9 0.2 1.0 3 0.0093 - - YES - - -
LLC1.3 - 0.2 0.2 0.1 0.3 3 0.0103 - - - - YES -
K03H1.4 ttr-2 -0.1 -0.2 -0.1 0.0 3 0.0117 - - YES - - -
F49E10.5 ctbp-1 0.7 0.8 0.6 NA 2 0.0148 - YES - - - -
Y105C5B.28 gln-3 0.4 0.4 NA 0.5 2 0.0153 - - - - YES -
B0464.7 baf-1 0.3 0.4 0.2 0.2 3 0.0163 - YES - - - -
Y49A3A.2 vha-13 0.1 0.1 0.1 0.1 3 0.0196 - - - - YES -
F25H2.10 rpa-0 -0.2 -0.2 -0.1 -0.2 3 0.0206 - - - - YES -
E04F6.3 maoc-1 0.2 0.2 -0.2 0.5 3 0.0213 - - YES - - -
R06C7.10 let-75 -0.2 -0.2 -0.3 -0.2 3 0.0229 - - - - YES -
T08B2.10 rps-17 0.2 0.1 0.3 0.2 3 0.0241 - - - - YES -
T23D8.4 eif-3.C 0.9 1.1 0.8 0.9 3 0.0244 - - YES - - -
B0041.4 rpl-4 0.2 0.2 0.2 0.1 3 0.0247 - - - - YES -
K02B12.7 - -0.3 -0.3 -0.3 -0.2 3 0.0277 - - YES - - -
Y37A1B.5 - 0.2 0.2 0.1 0.4 3 0.0282 - YES - - - -
B0412.4 rps-29 -0.1 -0.2 -0.1 0.0 3 0.0369 - YES - - - -
F26F12.7 let-418 -0.5 -0.3 -0.7 -0.5 3 0.0416 - YES - - - -
F48E3.3 - 0.1 0.0 0.0 0.2 3 0.0419 - YES - - - -
Y48G1A.5 xpo-2 -0.2 -0.1 -0.4 -0.2 3 0.0427 - - YES - - -
F48E8.5 paa-1 -0.1 0.0 -0.1 -0.3 3 0.0434 - YES - - - -
C01G5.6 - 0.1 0.1 0.0 0.2 3 0.0446 - - YES - - -
C34E10.6 atp-2 0.2 0.3 0.0 0.2 3 0.0489 - - - - YES -
F56H11.4 elo-1 0.3 0.5 0.4 0.0 3 0.0494 - - YES - - -
W08F4.8 - 0.2 0.2 0.0 0.4 3 0.0543 - - YES - - -
F35H10.10 - 0.3 0.2 0.2 0.4 3 0.0572 - YES YES - - -
K11D9.2a sca-1 0.1 0.1 0.0 0.2 3 0.0573 - YES - - - -
C53B7.1 rig-3 -0.9 -0.5 -0.3 -2.1 3 0.0580 - YES - - - -
Y47G6A.22 - 0.3 0.4 0.1 0.4 3 0.0622 - - YES - - -
Y110A7A.14 pas-3 0.1 0.2 -0.1 0.1 3 0.0644 - YES - - - -
K08D12.1 pbs-1 0.2 0.2 0.0 0.3 3 0.0680 - - YES - - -
C47E12.5 uba-1 0.1 0.1 0.2 0.0 3 0.0697 - YES - - - -
F29G9.4 - 0.4 NA 0.4 0.3 2 0.0699 - YES - - - -
Y55F3AR.3 cct-8 0.1 0.2 0.0 0.1 3 0.0757 - - - - YES -
F25H2.5 - -0.1 -0.1 -0.1 0.1 3 0.0770 - - - - YES -
B0365.3 eat-6 0.1 0.2 0.0 0.2 3 0.0784 - - - - YES -
T10B5.5a cct-7 0.1 0.2 0.1 0.0 3 0.0810 - - - - YES -
C38C3.5c unc-60 0.5 0.2 0.7 0.9 3 0.0815 - YES YES - - -
K10C3.3 zig-1 -0.2 -0.1 -0.4 0.0 3 0.0819 - YES YES - - -
F40F4.6 - 0.1 0.3 0.1 0.0 3 0.0845 - - - - YES -
F20B6.2 vha-12 0.1 0.1 0.0 0.2 3 0.0913 - - - - YES -
F02A9.4a - -0.1 0.0 -0.1 -0.2 3 0.0939 - YES - - - -
K04D7.1 rack-1 0.1 0.2 0.0 0.1 3 0.0994 - - YES - - -
C56G2.1a - 0.6 0.3 0.9 0.6 3 0.1171 - YES - - - -
Y40B10A.1 lbp-9 -0.1 -0.1 -0.2 -0.1 3 0.1203 - - YES - - -
C36B1.3 rpb-3 0.1 0.1 0.1 0.1 3 0.1211 - - YES - - -
Y110A7A.18 ppw-2 4.1 NA NA 4.1 1 0.1221 - - YES - - -
F41D9.3a wrk-1 -0.2 -0.1 -0.4 -0.2 3 0.1230 - YES - - - -
Y37E3.8a - 0.1 0.2 0.3 -0.1 3 0.1241 - - - - YES -
T02E1.7 - 0.2 0.3 0.2 0.1 3 0.1247 - YES - - - -
T22D1.3a - 0.2 0.6 0.1 0.0 3 0.1252 - - YES - - -
F25H5.4 eft-2 -0.2 -0.2 -0.1 -0.2 3 0.1274 - - - - YES -
ZK673.2 - 0.2 0.2 0.0 0.4 3 0.1314 - - YES - - -
R07G3.1 cdc-42 0.1 0.1 0.1 0.2 3 0.1318 - - YES - - -
M117.2 par-5 -0.1 -0.1 0.4 -0.4 3 0.1394 - - YES - - -
K12G11.3 sodh-1 -0.2 -0.2 -0.3 0.0 3 0.1422 - - YES - - -
F57C2.5 - 2.0 2.0 NA NA 1 0.1466 - - YES - - -
Y51H4A.3 rho-1 0.2 0.2 NA 0.2 2 0.1594 - - - - YES -
Y73B6BL.18 smg-3 -2.0 NA NA -2.0 1 0.1600 - YES - - - -
R11A5.4a - 0.1 0.0 0.1 0.1 3 0.1693 - - - - YES -
C18A11.7a dim-1 -0.1 -0.1 -0.2 0.0 3 0.1740 - - - - YES -
M18.5 ddb-1 0.2 0.2 0.1 0.4 3 0.1748 - YES - - - -
C38C3.5a unc-60 0.2 0.2 0.0 0.3 3 0.1778 - YES YES - - -
C53D5.6 imb-3 0.1 0.2 0.0 0.0 3 0.1848 - YES - - - -
F11C3.3 unc-54 -0.1 -0.2 0.1 -0.2 3 0.1905 - - - - YES -
F32H2.5 fasn-1 0.1 -0.1 0.4 0.2 3 0.1929 - - - - YES -
Y37E3.17a - 0.2 0.4 0.2 -0.1 3 0.1992 - - - - YES -
F14B4.3 - 0.1 0.2 0.0 0.1 3 0.2014 - - YES - - -
C05D11.11a mel-32 0.1 0.2 0.2 0.0 3 0.2136 - - - - YES -
Y48B6A.12 - 0.2 0.6 0.0 0.1 3 0.2233 - YES - - - -
T25C8.2 act-5 -0.1 -0.2 -0.1 -0.1 3 0.2285 - - - - YES -
K07C5.4 - -0.1 0.0 0.0 -0.2 3 0.2408 - - YES - - -
Nature Methods: doi: 10.1038/nmeth.1504
6
Gene CGCmean log2 ratio
(let-7(n2853) / wt)
log2 ratio
replicate 1
log2 ratio
replicate 2
log2 ratio
replicate 3
replicates
quantifiedP -value Known Predicted Experiment Literature Neutral Control
Y113G7B.23 psa-1 0.1 0.2 0.0 0.2 3 0.2463 - YES - - - -
ZK829.4 - 0.1 0.1 0.1 0.1 3 0.2713 - - - - YES -
C35D10.16 arx-6 0.2 NA NA 0.2 1 0.2784 - - - - YES -
F45E12.5a - -0.2 -0.2 -0.5 0.1 3 0.2856 - - YES - - -
Y39B6A.20 asp-1 0.0 0.0 -0.1 0.2 3 0.2923 - - - - YES -
ZK1307.6 fzr-1 -1.9 NA NA -1.9 1 0.2955 - - YES - - -
C41D11.2 eif-3.H 0.1 0.2 0.2 -0.2 3 0.3033 - - YES - - -
F36H1.2 tag-144 -0.2 0.2 -0.1 -0.5 3 0.3074 - - YES - - -
F35G2.2 - -0.1 0.0 -0.1 -0.2 3 0.3106 - YES - - - -
Y54E10A.3 - -0.1 -0.2 -0.1 0.3 3 0.3300 - - YES - - -
C09H10.2 rpl-41 0.1 0.1 -0.1 0.2 3 0.3371 - - YES - - -
Y48B6A.1 - -0.1 0.2 -0.4 -0.3 3 0.3438 - - YES - - -
F38A3.1 col-81 -2.8 NA NA -2.8 1 0.3576 - - YES - - -
F35C5.8 clec-65 0.1 -0.1 0.3 0.3 3 0.3689 - YES - - - -
B0393.1 rps-0 0.0 0.1 0.1 -0.1 3 0.3698 - - - - YES -
Y63D3A.6a dnj-29 -0.1 0.2 -0.1 -0.2 3 0.3872 - YES - - - -
W07G4.3 - -0.1 -0.1 -0.3 0.1 3 0.4058 - YES - - - -
K08F11.3 cif-1 -0.1 0.2 -0.2 -0.1 3 0.4248 - YES - - - -
C23F12.1a fl--1 -0.1 0.0 -0.5 0.1 3 0.4488 - YES - - - -
C05G5.4 - -0.1 -0.2 0.0 NA 2 0.4602 - YES - - - -
R10E4.2a tag-310 -0.2 -0.3 -0.1 -0.4 3 0.4939 - YES - - - -
Y54E10A.9a vbh-1 0.0 0.0 0.0 -0.1 3 0.5009 - YES - - - -
Y54E10BR.6 rpb-7 0.1 0.1 NA NA 1 0.5053 - - YES - - -
F13H6.3 - -0.1 -0.1 0.0 -0.1 3 0.5055 - - YES - - -
Y65B4A.8 - 0.1 0.4 0.0 -0.1 3 0.5160 - YES - - - -
K04G2.1 iftb-1 0.1 0.4 0.0 -0.2 3 0.5233 - - YES - - -
C37C3.6a ppn-1 -0.1 0.0 -0.2 0.1 3 0.5327 - - - - YES -
W01B11.3 nol-5 0.0 0.1 0.1 -0.2 3 0.5368 - - YES - - -
T21B10.7 cct-2 0.1 0.1 NA 0.0 2 0.5402 - - - - YES -
Y41D4A.5 - 0.2 NA 0.1 0.3 2 0.5566 - YES - - - -
C41C4.8 cdc-48.2 0.1 0.2 -0.2 0.1 3 0.5702 - - YES - - -
Y39B6A.2 pph-5 0.0 0.0 -0.3 0.1 3 0.5713 - YES - - - -
Y106G6H.2a pab-1 0.1 0.0 0.3 -0.3 3 0.5722 - - YES - - -
W08E12.7 - 0.0 -0.1 0.0 0.1 3 0.6023 - YES - - - -
C36E8.5 tbb-2 0.0 0.0 -0.2 0.1 3 0.6049 - - YES - - -
F20D12.1 - 0.0 0.0 0.1 -0.2 3 0.6208 - - YES - - -
Y17G7B.7 tpi-1 0.0 0.0 0.1 -0.3 3 0.6401 - YES - - - -
F26D10.3 hsp-1 0.0 0.1 -0.1 0.1 3 0.6422 - - - - YES -
F36A4.7 ama-1 0.0 0.2 0.0 -0.1 3 0.6438 - YES YES - - -
Y71F9AM.5 nxt-1 0.0 -0.1 0.1 0.0 3 0.6569 - - YES - - -
F32D1.10 mcm-7 -0.6 -0.5 0.6 -1.3 3 0.6789 - - YES - - -
T03F1.8 - 0.0 0.2 -0.3 0.0 3 0.6832 - YES - - - -
Y73B6BL.6 sqd-1 0.0 0.2 0.0 0.0 3 0.6878 - YES - - - -
T18D3.4 myo-2 0.0 0.0 -0.2 0.2 3 0.7134 - - - - YES -
F08F3.4 - 0.0 0.0 0.0 0.1 3 0.7164 - YES - - - -
F58D5.1 hrp-2 -0.1 0.3 -0.2 -0.3 3 0.7265 - YES - - - -
F20D12.5 exc-9 -0.1 NA -0.4 0.2 2 0.7349 - YES - - - -
T07D3.7a alg-2 0.0 0.0 NA 0.0 2 0.7388 - - - YES - -
F40F11.1 rps-11 0.0 -0.1 0.0 0.1 3 0.7565 - - - - YES -
B0491.7 - 0.0 0.0 0.4 -0.5 3 0.7706 - YES - - - -
T05E11.1 rps-5 0.0 0.0 0.1 -0.1 3 0.7741 - - - - YES -
T02C5.3 igcm-3 0.0 0.0 -0.3 0.1 3 0.7850 - YES - - - -
T05F1.3 rps-19 0.0 0.1 NA 0.0 2 0.8272 - - - - YES -
R07E5.14 rnp-4 0.0 0.2 -0.4 0.0 3 0.8608 - YES - - - -
T26C12.1 - 0.0 -0.1 -0.2 0.2 3 0.8754 - YES - - - -
C30C11.4 - 0.0 0.2 0.0 0.0 3 0.8843 - YES - - - -
F54A3.3 cct-3 0.0 0.3 0.0 -0.1 3 0.9024 - YES - - - -
F53A2.7 - 0.0 0.2 -0.1 0.0 3 0.9035 - - - - YES -
F57B10.3a - 0.0 0.1 -0.2 0.1 3 0.9330 - - - - YES -
C09D1.1a unc-89 0.0 0.0 -0.1 0.1 3 0.9690 - - YES - - -
C06A1.1 cdc-48.1 0.0 -0.1 -0.3 0.3 3 0.9888 - - YES - - -
Y53C12A.4 mop-25.2 0.0 -0.2 0.4 0.2 3 0.9962 - - YES - - -
F25F2.2 cdh-4 0.0 NA NA NA 0 NA - YES - - - -
B0395.3 - 0.0 NA NA NA 0 NA - YES - - - -
F13D11.2 hbl-1 0.0 NA NA NA 0 NA YES YES YES - - -
R01B10.1a cpi-2 0.0 NA NA NA 0 NA - YES - - - -
C41C4.6 ulp-4 0.0 NA NA NA 0 NA - YES - - - -
F55A3.1 marc-6 0.0 NA NA NA 0 NA - YES - - - -
F13H6.1 - 0.0 NA NA NA 0 NA - YES - - - -
C29E6.5 nhr-43 1.1 1.1 NA NA 1 NA - YES - - - -
M28.5 - 2.8 2.8 NA NA 1 NA - YES - - - -
Y69A2AR.18a - 0.0 NA NA NA 0 NA - - - - YES -
T09B4.8 - 3.7 3.7 NA NA 1 NA - - - - YES -
F39H11.3 cdk-8 0.0 NA NA NA 0 NA - - - YES - -
Y97E10AR.4 - 0.0 NA NA NA 0 NA - - YES - - -
Y48G1A.4 - 0.0 NA NA NA 0 NA - - YES - - -
F32G8.6 cat-4 0.0 NA NA NA 0 NA - - YES - - -
C55A6.5 sdz-8 0.0 NA NA NA 0 NA - - YES - - -
F32D1.5 - 0.0 NA NA NA 0 NA - - YES - - -
W02D9.1 pri-2 0.0 NA NA NA 0 NA - - YES - - -
K02E2.4 ins-35 0.0 NA NA NA 0 NA - - YES - - -
T05H10.5a ufd-2 2.1 NA NA 2.1 1 NA - - YES - - -
Quantification data for the 181 proteins analyzed in our targeted proteomics approach. The table lists
the gene name, the CGC synonym (if available), the mean log2 ratio of the protein (let-7(n2853) / wt;
averaged over all measurements), the log2 ratio of the protein (let-7(n2853) / wt) in each biological
replicate, the number of biological replicates (maximum = 3) where the protein could be quantified by
at least one peptide, the P-value for the protein change, and their group affiliation from the candidate
list (see Supplementary Table 1).
Genes that have an “NA” ( = ”Not Available”) listed in the P-value column have less than three
independent quantification measurements (transition ratios) and were regarded as “not successfully
quantified” (red font).
Nature Methods: doi: 10.1038/nmeth.1504
7
Supplementary Table 3: 29 candidate proteins are regulated in let-7(n2853) mutants
Gene CGCmean log2 ratio
(let-7(n2853) / wt)P -value Known Predicted Experiment Literature Neutral Control
C42D8.2 vit-2 -3.7 < 0.001 - - - - - YES
F18A1.2 lin-26 -3.9 < 0.001 - YES - - - -
Y65B4BL.5 - 0.4 < 0.001 - YES - - - -
Y47G6A.10 spg-7 0.3 < 0.001 - - YES - - -
Y22D7AL.5 hsp-60 0.2 < 0.001 - - YES - - -
C14C10.5 - 2.0 < 0.001 - YES - - - -
K07H8.6a vit-6 -4.5 < 0.001 - YES - - - YES
F35G12.8 smc-4 -5.5 < 0.001 - - YES - - -
F41E6.4a smk-1 -3.7 < 0.001 - YES - - - -
C56E6.1 abcx-1 3.4 < 0.001 - YES - - - -
K12H4.8 dcr-1 -3.0 < 0.001 - - - YES - -
F23H11.4a - -4.5 < 0.001 - YES - - - -
Y48A6C.4 - 2.8 < 0.001 - YES - - - -
C47B2.5 eif-6 0.4 < 0.001 - - YES - - -
W01F3.3 mlt-11 0.4 < 0.001 - YES - - - -
ZC168.4 cyb-1 -2.8 < 0.001 - YES - - - -
K09D9.1 - 1.5 0.0024 - YES - - - -
T19A6.2a ngp-1 1.9 0.0028 - - YES - - -
R31.1 sma-1 0.3 0.0031 - - YES - - -
F53A9.10a tnt-2 0.2 0.0033 - - - - YES -
T21E12.4 dhc-1 0.2 0.0036 - - YES - - -
W06A7.3a ret-1 -0.2 0.0045 - YES - - - -
F46H5.3a - 0.3 0.0045 - - - - YES -
F46B6.7 ztf-7 0.1 0.0047 - YES - - - -
C01G8.9a let-526 0.9 0.0049 YES YES YES - - -
ZK180.4 - -1.2 0.0067 - YES - - - -
T22B11.5 - 0.2 0.0071 - YES - - - -
F46E10.8 ubh-1 1.4 0.0082 - YES - - - -
F56A3.4 spd-5 0.7 0.0093 - - YES - - -
Proteins that made our P < 0.01 cut-off were regarded as regulated on the protein level in let-7(n2853)
mutants compared to wild-type worms. The table lists the gene name, the CGC synonym (if
available), the mean log2 ratio of the protein (let-7(n2853) / wt; averaged over all measurements), the
P-value for the protein change, and their group affiliation from the candidate list (see Supplementary
Table 1).
Nature Methods: doi: 10.1038/nmeth.1504
8
Supplementary Table 4: Suppression of let-7(n2853) lethality – regulated candidates
RNAi cloneFraction Survivors
(Alive / Total)
Standard Error of
the Mean
Positive
Control
Negative
Control
partial let-7(n2853)
suppressor
F41E6.4a < 0.05 NA - - -
C01G8.9a 0.56 0.07 - - YES
C14C10.5 < 0.05 NA - - -
Y48A6C.4 0.05 0.01 - - -
F35G12.8 0.84 0.04 - - YES
T22B11.5 0.21 0.02 - - YES
W06A7.3a < 0.05 NA - - -
F46H5.3a < 0.05 NA - - -
C56E6.1 0.51 0.09 - - YES
F46E10.8 < 0.05 NA - - -
F53A9.10a < 0.05 NA - - -
T19A6.2a 0.42 0.06 - - YES
K09D9.1 < 0.05 NA - - -
ZC168.4 < 0.05 NA - - -
F23H11.4a < 0.05 NA - - -
F56A3.4 0.58 0.13 - - YES
R31.1 < 0.05 NA - - -
Y47G6A.10 0.41 0.29 - - YES
Y65B4BL.5 < 0.05 NA - - -
C47B2.5 0.58 0.14 - - YES
Y22D7AL.5 0.62 0.07 - - YES
F46B6.7 0.29 0.00 - - YES
K12H4.8 < 0.05 NA - - -
F11A1.3 0.70 0.02 YES - YES
C12C8.3 0.63 0.04 YES - YES
C18D1.1 0.20 0.06 YES - YES
ZK617.1 < 0.05 NA - YES -
vector < 0.05 NA - YES -
The 29 genes that showed significant protein changes (P < 0.01, see Supplementary Table 3) in our
targeted proteomics assay were knocked-down by RNAi to see whether they suppressed the lethal
let-7(n2853) vulval bursting phenotype. 23 out of the 29 genes tested reached the adult stage and
could be scored for suppression of lethality. Three independent replicate experiments were performed
at 25°C. Only values above 5% survival are shown.
Y47G6A.10 showed suppression in two out of three replicate experiments and was regarded a
positive suppressor because the average survival rate over all three replicates was above the threshold
set.
Less than 5% of the let-7(n2853) worms treated with negative control RNAi (vector RNAi or
ZK617.1 (unc-22) RNAi) survived as adults. Positive controls (F11A1.3 (daf-12), C12C8.3 (lin-41)
and C18D1.1 (die-1) RNAi) were included. “NA” = ”Not Available”.
Nature Methods: doi: 10.1038/nmeth.1504
9
Supplementary Table 5: Suppression of let-7(n2853) lethality – not regulated candidates
RNAi cloneFraction Survivors
(Alive / Total)
Standard Error of the
Mean
Positive
Control
Negative
Control
partial let-7(n2853)
suppressorF20D12.5 < 0.05 NA - - -
F58D5.1 0.39 0.04 - - YES
T02C5.3 < 0.05 NA - - -
B0491.7 < 0.05 NA - - -
Y39B6A.2 < 0.05 NA - - -
T03F1.8 < 0.05 NA - - -
T26C12.1 < 0.05 NA - - -
Y17G7B.7 < 0.05 NA - - -
R07E5.14 0.12 0.04 - - -
C30C11.4 0.22 0.02 - - YES
W08E12.7 < 0.05 NA - - -
C37C3.6a < 0.05 NA - - -
F57B10.3a < 0.05 NA - - -
F53A2.7 < 0.05 NA - - -
Y39B6A.20 < 0.05 NA - - -
R11A5.4a < 0.05 NA - - -
ZK829.4 < 0.05 NA - - -
C05D11.11a < 0.05 NA - - -
F13H6.3 < 0.05 NA - - -
F20D12.1 < 0.05 NA - - -
C09D1.1a < 0.05 NA - - -
C06A1.1 < 0.05 NA - - -
Y53C12A.4 < 0.05 NA - - -
W01B11.3 0.38 0.03 - - YES
F11A1.3 0.60 0.03 YES - YES
C12C8.3 0.81 0.04 YES - YES
C18D1.1 0.15 0.02 YES - -
ZK617.1 < 0.05 NA - YES -
vector < 0.05 NA - YES -
29 genes that did not show significant protein changes by targeted proteomics were knocked-down by
RNAi to determine whether they suppressed the lethal let-7(n2853) vulval bursting phenotype. 24 out
of the 29 genes tested reached the adult stage and could be scored for suppression of lethality. Three
independent replicate experiments were performed at 25°C. Only values above 5% survivors are
shown.
Less than 5% of the let-7(n2853) worms treated with negative control RNAi (vector RNAi or
ZK617.1 (unc-22) RNAi) survived as adults. Positive controls (F11A1.3 (daf-12), C12C8.3 (lin-41)
and C18D1.1 (die-1) RNAi) were included. “NA” = ”Not Available”.
Nature Methods: doi: 10.1038/nmeth.1504
10
Supplementary Table 6: Relative mRNA levels of all candidates
GENEAVG mRNA log2 ratio
(let-7(n2853) / wt)
mRNA log2 ratio
replicate 1
mRNA log2 ratio
replicate 2
mRNA log2 ratio
replicate 3
K07H8.6a -6.7 -6.5 -8.1 -5.4
F38A3.1 -6.6 -6.9 -6.4 -6.6
C42D8.2 -5.2 -5.3 -6.1 -4.3
F32D1.10 -0.4 -0.3 -0.2 -0.6
W01F3.3 -0.4 0.1 -1.3 0.1
T07D3.7a -0.2 0.2 -0.6 NA
Y65B4BL.5 -0.2 0.0 0.2 -0.8
C23F12.1a -0.2 -0.2 -0.3 -0.1
K12G11.3 -0.2 0.2 -0.8 0.1
ZK1307.6 -0.1 0.2 -0.1 -0.4
ZK829.4 -0.1 -0.8 0.3 0.1
Y48G1A.5 -0.1 -0.1 0.3 -0.4
R06C7.10 -0.1 0.0 -0.4 0.2
F35G12.8 -0.1 -0.1 0.0 -0.2
C14C10.5 -0.1 0.1 -0.1 -0.2
M117.2 -0.1 0.2 0.1 -0.4
T02C5.3 0.0 0.5 -1.0 0.4
Y110A7A.18 0.0 -0.1 0.3 -0.3
C56E6.1 0.0 -0.5 -0.7 1.1
C53B7.1 0.0 -0.1 -0.4 0.4
Y113G7B.23 0.0 0.5 -0.5 -0.1
C01G8.9a 0.0 0.4 0.2 -0.7
ZC168.4 0.0 -0.1 0.1 0.0
C47E12.5 0.0 0.0 0.2 -0.1
C05G5.4 0.0 0.0 -0.2 0.2
F41E6.4a 0.0 0.0 0.0 0.1
F53A9.10a 0.0 0.2 -0.1 0.0
Y63D3A.6a 0.0 0.2 0.0 -0.2
F36A4.7 0.0 0.2 0.0 -0.1
R31.1 0.0 0.6 -0.9 0.4
Y49A3A.2 0.1 0.1 0.2 -0.2
C53D5.6 0.1 0.2 0.3 -0.4
T18D3.4 0.1 -0.1 -0.1 0.4
F56H11.4 0.1 -0.2 0.0 0.5
C35D10.16 0.1 0.1 0.0 0.1
C47B2.5 0.1 0.0 0.2 0.0
F57C2.5 0.1 0.0 0.2 0.1
R11A5.4a 0.1 0.3 -0.3 0.3
Y48B6A.12 0.1 0.3 0.0 0.0
C34E10.6 0.1 0.4 0.0 -0.1
K08D12.1 0.1 0.2 0.3 -0.2
F58D5.1 0.1 0.5 -0.1 -0.1
W01B11.3 0.1 0.2 0.2 -0.1
C38C3.5a 0.1 0.2 0.2 -0.1
Y53C12A.4 0.1 0.1 0.1 0.1
C06A1.1 0.1 0.1 0.3 0.0
C05D11.11a 0.1 0.0 0.3 0.0
F35C5.8 0.1 0.1 -0.1 0.4
F11C3.3 0.1 0.0 -0.2 0.6
W08F4.8 0.1 0.1 0.3 0.0
ZK180.4 0.1 0.0 0.2 0.2
C38C3.5c 0.1 0.2 0.1 0.1
T22B11.5 0.1 0.2 0.0 0.1
R07G3.1 0.1 0.3 0.2 0.0
F56A3.4 0.1 0.1 0.2 0.2
F02A9.4a 0.2 0.1 0.1 0.3
R07E5.14 0.2 0.2 -0.1 0.4
Y73B6BL.18 0.2 0.3 0.2 0.0
F20D12.1 0.2 0.1 0.5 0.0
Y48B6A.1 0.2 0.4 0.2 -0.1
F45E12.5a 0.2 0.2 0.0 0.3
T21E12.4 0.2 0.3 0.2 0.0
F48E8.5 0.2 0.1 0.4 0.0
Y54E10A.3 0.2 0.0 0.2 0.3
ZK673.2 0.2 0.3 -0.2 0.4
M18.5 0.2 0.3 0.2 0.1
C18A11.7a 0.2 0.0 -0.1 0.7
F46H5.3a 0.2 0.3 0.2 0.1
C41C4.8 0.2 0.3 0.2 0.0
C01G5.6 0.2 -0.1 0.4 0.3
C30C11.4 0.2 0.3 0.3 0.0
F26F12.7 0.2 0.4 0.2 0.0
Y48A6C.4 0.2 0.1 0.3 0.2
F36H1.2 0.2 0.2 0.2 0.2
B0365.3 0.2 0.2 0.4 0.1
F46B6.7 0.2 0.4 0.0 0.2
C37C3.6a 0.2 0.3 0.0 0.3
F25H5.4 0.2 0.5 0.3 -0.2
Y40B10A.1 0.2 0.0 0.1 0.4
F35H10.10 0.2 -0.1 0.1 0.6
F40F4.6 0.2 0.4 0.1 0.2
K07C5.4 0.2 -0.1 0.5 0.2
W08E12.7 0.2 0.3 0.2 0.1
T05E11.1 0.2 0.3 0.2 0.2
Nature Methods: doi: 10.1038/nmeth.1504
11
GENEAVG mRNA log2 ratio
(let-7(n2853) / wt)
mRNA log2 ratio
replicate 1
mRNA log2 ratio
replicate 2
mRNA log2 ratio
replicate 3
LLC1.3 0.2 0.3 0.1 0.2
Y110A7A.14 0.2 0.0 0.4 0.3
C36E8.5 0.2 0.3 0.3 0.0
K12H4.8 0.2 0.5 0.2 0.0
F14B4.3 0.2 0.1 0.2 0.3
B0412.4 0.2 0.3 0.2 0.2
T23D8.4 0.2 0.2 0.2 0.4
Y39B6A.20 0.2 0.4 0.1 0.2
F46E10.8 0.2 0.2 0.3 0.3
Y41D4A.5 0.3 0.3 0.3 0.1
K08F11.3 0.3 0.3 0.3 0.2
F57B10.3a 0.3 0.2 0.2 0.4
F25H2.10 0.3 0.2 0.3 0.2
F23H11.4a 0.3 0.2 0.4 0.2
T05F1.3 0.3 0.3 0.3 0.3
T19A6.2a 0.3 0.4 0.1 0.3
B0464.7 0.3 0.2 0.0 0.7
Y37E3.17a 0.3 0.5 0.3 0.0
Y47G6A.22 0.3 0.1 0.2 0.6
Y47G6A.10 0.3 0.5 0.4 0.0
B0491.7 0.3 0.3 0.0 0.6
F40F11.1 0.3 0.2 0.5 0.2
T26C12.1 0.3 0.3 0.1 0.5
F20B6.2 0.3 0.2 0.6 0.0
Y17G7B.7 0.3 0.2 0.3 0.4
B0041.4 0.3 0.4 0.6 -0.1
K02B12.7 0.3 0.1 0.1 0.7
C41D11.2 0.3 0.5 0.3 0.2
T03F1.8 0.3 0.3 0.1 0.6
W07G4.3 0.3 0.5 0.2 0.3
T22D1.3a 0.3 0.3 0.2 0.4
C36B1.3 0.3 0.1 0.2 0.7
Y37E3.8a 0.3 0.3 0.4 0.3
F53A2.7 0.3 0.2 0.2 0.7
F25H2.5 0.3 0.2 0.5 0.4
C09D1.1a 0.4 NA NA 0.4
T08B2.10 0.4 0.3 0.1 0.7
T21B10.7 0.4 0.6 0.3 0.2
Y54E10A.9a 0.4 0.7 0.1 0.4
B0393.1 0.4 0.4 0.4 0.3
Y37A1B.5 0.4 0.5 -0.1 0.7
F35G2.2 0.4 0.2 0.2 0.8
C09H10.2 0.4 0.5 0.1 0.5
Y39B6A.2 0.4 0.4 0.4 0.4
Y22D7AL.5 0.4 0.4 0.6 0.3
K11D9.2a 0.4 0.4 0.3 0.5
T25C8.2 0.4 -0.1 1.0 0.4
Y65B4A.8 0.4 0.5 0.5 0.3
F26D10.3 0.4 0.3 0.4 0.6
Y73B6BL.6 0.4 0.6 0.3 0.4
Y71F9AM.5 0.5 0.5 0.1 0.8
F08F3.4 0.5 0.2 0.2 1.0
C56G2.1a 0.5 0.6 0.6 0.2
K10C3.3 0.5 0.4 0.1 0.9
F48E3.3 0.5 0.4 0.3 0.7
K04D7.1 0.5 0.3 0.6 0.5
F20D12.5 0.5 0.8 -0.1 0.8
Y55F3AR.3 0.5 0.7 0.8 0.0
F54A3.3 0.5 0.6 0.5 0.5
F29G9.4 0.5 0.5 0.4 0.7
Y105C5B.28 0.5 0.7 0.3 0.7
F49E10.5 0.5 0.5 -0.3 1.4
Y51H4A.3 0.6 0.7 0.6 0.3
T02E1.7 0.6 0.6 0.2 1.0
K03H1.4 0.6 0.5 0.7 0.5
F13H6.3 0.6 0.7 0.1 1.1
F32H2.5 0.7 0.8 0.6 0.6
T10B5.5a 0.7 0.6 0.0 1.5
E04F6.3 0.9 1.0 -0.2 1.8
K09D9.1 2.2 2.1 2.9 1.6
F18A1.2 NA NA NA NA
F41D9.3a NA NA NA NA
K04G2.1 NA NA NA NA
R10E4.2a NA NA NA NA
W06A7.3a NA NA NA NA
Y106G6H.2a NA NA NA NA
Y54E10BR.6 NA NA NA NA
C12C8.3 (lin-41) 0.5 0.7 0.5 0.2
F11A1.3a (daf-12) 1.6 1.7 1.8 1.3
The relative mRNA levels (let-7(n2853) / wt) for all the 161 genes that could be quantified on the
protein level (see Supplementary Table 2) and for two positive control genes, the known let-7
targets C12C8.3 (lin-41) and F11A1.3a (daf-12), were determined via RT-qPCR. The table lists the
gene name, the average log2 ratio of the mRNA (let-7(n2853) / wt; averaged over all measurements)
and the log2 ratio of the mRNA (let-7(n2853) / wt) for each biological replicate. Out of the 161 genes
tested, the mRNA levels for 5 genes could not be determined in a single biological replicate. The two
positive control genes are listed at the end of the table in bold.
Nature Methods: doi: 10.1038/nmeth.1504
12
Supplementary Table 7: Relative protein abundance of predicted miR-58 targets and
random candidates
Gene CGCMean log2_Ratio
(mir-58(n4640 ) / wt)STDEV log2 Ratio P -value Replicates quantified Group
C30B5.7 - -1.91 2.42 0.1068 2 TargetScan
C44H4.2 sym-5 -0.52 NA NA 1 TargetScan
F55C5.4 - -0.11 NA NA 1 TargetScan
F37A4.8 isw-1 -0.10 NA NA 1 TargetScan
B0348.6a ife-3 -0.09 0.07 0.0062 4 TargetScan
F30H5.1 unc-45 -0.07 0.50 0.3553 3 TargetScan
C33A11.1 - -0.04 NA NA 1 TargetScan
F13D12.6 - 0.07 0.20 0.1351 4 TargetScan
Y39A1B.3 dpy-28 0.16 1.68 0.4218 4 TargetScan
C56G2.1a - 0.20 0.33 0.1193 3 TargetScan
M28.8 - 0.23 0.83 0.3809 2 TargetScan
F18A1.5 rpa-1 0.25 0.23 0.0218 2 TargetScan
R11A8.5 - 0.26 0.06 0.0530 2 TargetScan
F47B7.2a - 0.28 0.08 0.0650 2 TargetScan
C26E6.2 flh-2 0.30 0.05 0.0338 2 TargetScan
F27C1.2a - 0.34 0.39 0.0912 3 TargetScan
F56D3.1 - 0.34 0.29 0.0281 3 TargetScan
F40F8.5 - 0.36 NA NA 1 TargetScan
ZK616.4 - 0.38 0.30 0.0245 3 TargetScan
F58E6.10 unc-42 0.39 NA NA 1 TargetScan
ZK418.9a - 0.40 0.45 0.0578 3 TargetScan
Y54E10BR.6 rpb-7 0.40 NA NA 1 TargetScan
M04B2.3 gfl-1 0.54 NA NA 1 TargetScan
Y48B6A.14 hmg-1.1 0.60 0.16 0.0588 2 TargetScan
Y42A5A.1 - 0.69 NA NA 1 TargetScan
ZK632.13 lin-52 0.87 1.43 0.2736 2 TargetScan
C46F11.4 - 0.92 NA NA 1 TargetScan
F54C9.6 bcs-1 -0.35 0.57 0.1999 3 random
F28A12.4 - -0.33 0.37 0.0018 4 random
R12E2.11 - -0.32 0.48 0.0214 4 random
F13G3.10 - -0.24 0.34 0.2515 2 random
F54D11.1 pmt-2 -0.16 0.19 0.0003 4 random
R10E11.8 vha-1 -0.11 0.41 0.3823 2 random
C48B4.8 - -0.09 1.78 0.4694 2 random
Y69E1A.2 - -0.07 0.40 0.2650 4 random
F35G12.2 - -0.06 0.25 0.2841 4 random
C55A6.9 - -0.06 NA NA 1 random
F32D1.5 - -0.01 0.23 0.4084 4 random
F39H2.3 - 0.00 0.46 0.4982 3 random
D1007.6 rps-10 0.01 0.19 0.4491 4 random
F57B10.10 dad-1 0.06 NA NA 1 random
F46B6.3a smg-4 0.06 0.24 0.2963 4 random
Y66H1A.4 - 0.07 0.39 0.2531 4 random
Y47G6A.8 crn-1 0.12 0.70 0.3991 2 random
F17C8.3 - 0.14 0.24 0.0648 3 random
F33A8.3 cey-1 0.16 0.48 0.2292 4 random
F45H10.2 - 0.17 0.03 NA 1 random
T10E10.2 col-167 0.18 0.19 0.1255 2 random
K01G5.4 ran-1 0.18 0.26 0.0115 4 random
C32E8.3 - 0.27 0.54 0.0953 4 random
F56H11.4 elo-1 0.45 0.38 0.0506 4 random
Quantification data for the 51 proteins analyzed in our targeted proteomics approach. The table lists
the gene name, the CGC synonym (if available), the mean log2 ratio of the protein (mir-58(n4640) /
wt; averaged over all measurements), the Standard-deviation of the log2 ratio of the protein
(mir-58(n4640) / wt), the number of biological replicates (maximum = 4) where the protein could be
quantified by at least one peptide, the P-value for the protein change (one sample Student’s t-test (one
sided)), and their group affiliation from the candidate list. “NA” = “Not Available”.
Nature Methods: doi: 10.1038/nmeth.1504
13
Supplementary Table 10: RT-qPCR primers
Gene Left primer Right primer
C42D8.2 ttcatctgaggagacctacgatt tccttgatttgtgtcttctcgac
F18A1.2 ccttgtgcgatcatatgcttt ttgtcgaatccatgcgttac
Y65B4BL.5 ggtcacctattcgggaaatg cttcaggtaggcgctgatg
Y47G6A.10 caaaggaaataagggagaggataa caactgaaacggcaatttgtt
Y22D7AL.5 ggagtcgctgtgctcaagat catcggtgacacggtcct
C14C10.5 gcgaccagtacgtacagtgaga tgtgtttataggagtatggatgttcg
K07H8.6a ccaagagaacaccattccaaa ctcctcttgatttttctcaatgc
F35G12.8 atcaaaggacccggaagaag gatggcagttgcaatgagaa
F41E6.4a tccgactcctacggtcaagt gagggaactgcgtcagga
C56E6.1 caatgcaacaatattttgagacaa tgtcatgtgtaacaaggtcaaca
K12H4.8 acgaaagcaattatatgacaaaaaga tccaattcgaatgcatagatga
F23H11.4a aacttgatgcgccattgttt tcggattgtgattcagttgc
Y48A6C.4 actggcgccaattatttca cgatcagcttcacaccttga
C47B2.5 gtaccaaacgccacgactg aagacgctcgtcaactctgc
W01F3.3 cctgccacccattcaagt gcggctctcactggtttc
ZC168.4 aatgctgtatcggtcatttgc caagcttcccctgtttgaag
K09D9.1 gggatgagcttcatgagtgg tcaacgagatgatcctccaa
T19A6.2a cgtctgatgtcgttgttcaag cgacgtgtcgacaacgagt
R31.1 gttcgcggcaagctactc ttgcgatacccttctaccttg
F53A9.10a tctgacgaagaggaagtgcttt ctcggccagggactcttc
T21E12.4 agactttgtcgccaagaatga gttctcaacggtaaggaagtcaa
W06A7.3a gatgcatggatcgatttcaa gaaaaaggcgagcaagaaca
F46H5.3a gaccccctgatccaggac ctctccgaggtcggtgttt
F46B6.7 tctgacgaagaagaggaagacaa gtttcatcggcatcgagatt
C01G8.9a agctccgggaggtagtgg tccacctggtgctccatt
ZK180.4 catatgtgcaccggaaagg gcacatgaacacttccatcg
T22B11.5 ttttgtgggctcaagaggag agtgagttgatgcgtggttg
F46E10.8 ttcatttgtttcgtcggaaag agttggaccgatttcacgag
F56A3.4 gtcccaccagttggaacatc tcgagtagggctcgtgtaatg
LLC1.3 gtttgccatccacatccaa aaaatgtgagagagagagatttagacg
K03H1.4 gcaaggacggaattacacca cgatgactccagcatcatagg
F49E10.5 aaacattccggctagatttcc ccggctcttctttgagtacg
Y105C5B.28 tgtgcgagacctatgacaaca ctccatcacctccttgcatc
B0464.7 cgatgcaggcttcgataaag tctttcagccattcgataaaca
F25H2.10 cgtcaagccatgagaggac caacaacttctcaagggatgg
E04F6.3 gagccatgcgagttctcatatt aacgtagcacaaatcttctttcg
R06C7.10 cgctcgaacacgagaagg aatcgtatgggcgggatt
T08B2.10 tcagaaacaagatcgctgga tgtagttgtctctgcgctcac
T23D8.4 tctcagaacttatttgctcacatactc agttcctcttggatgatcattttact
B0041.4 acgctgtttcctcagctattg aagtgggacctcagcgact
K02B12.7 cagggaactcgtctcttggt ccgaatccttgatatttgctg
Y37A1B.5 ttttagaattcatcctgttgaggag aagagcccatccacttacttttt
B0412.4 ctctcacccacgcaagttc ggataagtccgtggtgtcca
F26F12.7 tggaagttcatttccgtatgc cgagacgtaacggattcttca
F48E3.3 cgtgttgaaaaacgtgaagg tttctttgctgctcaccaagt
Y48G1A.5 caatttgctagccgatgtca ctcgatcggaggctgaag
F48E8.5 tgttcaattcatgccacttctt tcgcggattgagaacaca
C01G5.6 tgtttttggaagcgaaaagaa ttgtgacggcaatcatatcttc
C34E10.6 cttccagcagcttccatcc cttggcagagaccttggtg
F56H11.4 accattgccaacaaaggaat tggtgtcaacaagttcgaaaa
W08F4.8 gcacgtcgaggatcaataaga gagtctcgaagaaagtgctcatc
F35H10.10 tcatactgatctattcgaaaaagacg tgaacgatttgaagaagaagatgt
K11D9.2a agatatcttgctgtcggaacct cagtgagtgagctggtagtaggtg
C53B7.1 cgaaaatgggacgactacttg ggatttgcctcattggaaga
Y47G6A.22 ctccgaatggagttcgtgtt gtacgatgcaggttggtcac
Y110A7A.14 gctgccagctatcgtaacagt ccgaacggtctctttcctc
C47E12.5 cgtgattaatgactaccatccttg ccggaggatattcgttttctc
F29G9.4 cggctgggagaaaacctaa cgacgtttcagcctcttatca
Y55F3AR.3 cgctgataacggtgttaaggt tggaggtacatgtctccgaac
F25H2.5 caaggcccatcttgaggtt acgtcaagtccttgccaga
B0365.3 ctcaaaccagccaggaaaag gaagcaatacggacgagagc
T10B5.5a ggtattgagggcaaggatca ttcagcacgtcgagagcat
C38C3.5c ccaccacaaaccaacaacaa aagatcgtaggcgttcttgc
K10C3.3 cccgaaaccagttgtcaaa ttgaaactgattgactgagagca
F40F4.6 tcattcaagtggagggtgtg cgggggtagtagttgttactgg
F20B6.2 tctattgcccgtggacaga cggcaatctcgttatgagg
F02A9.4a tcaacttgctggatacgagatg aaacacgaccagaaactattcca
K04D7.1 gtccatcaagctgtggaaca atcggtgtggcaatcatca
C56G2.1a tgaggatgagaagacgcaga tttgtcgatcgatggtttttc
Y40B10A.1 gctgacggtcgtgatgtg cgagctttccgttctcaatg
C36B1.3 caatttatccgaatgttgaggaa gcctccttttcagtgctgtc
Y110A7A.18 agggcgtaatttgtggaatg ggtccagtaacctcgggaat
F41D9.3a ccatgctgggaagtacaactg tttcacccatggcttttca
Y37E3.8a gaggcaaatccccagtca ggctttaacgatgagtggagtc
T02E1.7 gccaagagatgagcacgag catcaagttcaagcagacacg
T22D1.3a gtaccccaatttccgatacg gctccttgagtttcttctgtgaa
F25H5.4 cgtttcactgacactcgtaagg cgagctcgaagaaaagagaga
ZK673.2 gaagcacggatcagttggag tgtgatgcacttgttttgctt
R07G3.1 tcagcgttgacgcagaag ttgtggtgggtcgagagc
M117.2 gccgccatgaagaaagtg gcaacagagagaaggttacgc
K12G11.3 ctggatggcaacttggagac aattcgcagttgaggcagtt
F57C2.5 ggacggcctcttggaatc caggatttgtgtggagattgg
Y51H4A.3 aggacggaattcgtgaggta caaaatcatgcacttgctcttc
Y73B6BL.18 gccgaacaacaaccgaat cgcaagttcgacttcatacg
Nature Methods: doi: 10.1038/nmeth.1504
14
Gene Left primer Right primer
R11A5.4a tggacatgttccgattctca atgaaacgttgcaccttgg
C18A11.7a tcgacagagagtgaagaccttg gaagtgtggggcctttcc
M18.5 gctgctgattcttcggtttt tctccgaggttgtcgtttg
C38C3.5a ccaacaacaacatctcaaaatga gagcttttggaaagatgtctgc
C53D5.6 cccagacttcaatatcttcaacaa cctccgattccgtggtatt
F11C3.3 cggcgtttttcttgctaaa cacatcggtgtatgattgaagc
F32H2.5 agtcatgctaactggtctcttcaa cgaagtttcttcttggcttgtact
Y37E3.17a tcagaaaatatgtgaaccgtgatt aggagcgtcgttttgcatac
F14B4.3 tcaaggaaggacttcattttgac atgccattccacgagtgatt
C05D11.11a ccagccaatttcgcagtc gagctggggtgaagaatcc
Y48B6A.12 gggaatcacgaaaaatgctg cgtgttgatgtggagagacg
T25C8.2 tcaacatttggctccaagc gatcctccgatccagacg
K07C5.4 gtgccttgaagaccagatcc ttggttccagcttttccaat
Y113G7B.23 cagcagcagaggggatatg tgaccatatggctgctggtat
ZK829.4 tcctacggacgtcttacattca gacggccttggagagagatt
C35D10.16 cgcaacactccaaccatatc tttcgatgtttgaacttccactt
F45E12.5a tggtggccacaaccagat tgataatgacatcagtttcgtttg
Y39B6A.20 caaccagttgacggaatcct cattggtgggacgacctg
ZK1307.6 ttatggagtgccacaacgag ccaactgccaaaagatctcc
C41D11.2 tgttcagtctgacgcagaaaa cattggaattgttggatcacc
F36H1.2 tggattccttccagcttcag tccagatcattaatattatcgtcgaat
Y54E10A.3 aatgtcggtggaggagatgt ggcgactcttttgaattcgtt
C09H10.2 gacaaaccaagccaatcttca tccgagctcgaagtgtttg
Y48B6A.1 cgttcccgactactcttgct tccagatacggacggttcc
F38A3.1 tcgctttcgttggtatctcc gcagaagtcaacctcggagt
F35C5.8 tcagccaaacgatagatcacc aacacaagcgttgcgagtt
B0393.1 ggagttccatgcaacaacaa cacggagaatgaggatctcg
Y63D3A.6a cgacgagaaggccatcaa cgatccggatggtgaatct
W07G4.3 caacggcggagaaagaaa tgaatccttcactgcgaaca
K08F11.3 tgtcgcttgctgaagagaag tcacaaattcttcgagggtctc
C23F12.1a cgcagtgaagagacaatgct cgatgatggtgcgtaggac
C05G5.4 gcaaattgccaacaatgcta ttttcaggttgttgtaagtgctg
R10E4.2a cccaaagatcaataaaactatcaaga ttgttgctggggagcttg
Y54E10A.9a cggtttcaacaacaatggag caaagttgatgccactgtcg
Y54E10BR.6 gtgcgcttacgcttcgtat ggtttcgttcaggtttggac
F13H6.3 agactggtggatttgagcaga tgggtgtgaacacattcagtg
Y65B4A.8 gaaagctatggagattgtgaagaag tccggcttcgattagtgc
K04G2.1 cgaagctgattgttgtcaatttag tgttttgcttgaagtacaaaacct
C37C3.6a cttcagccggaattgacg catttcgtgacaaagttggtg
W01B11.3 atcaagggtctttgtgaccag gcgatttttgaggtagtcgaa
T21B10.7 cagctgctaaggttcttgttga tttctcggcttctttgagga
Y41D4A.5 ctccgctaccggctacact ttaccactagtgagacacgatgc
C41C4.8 cgaaaagatggagctgattga tgattttcccattgcgaatc
Y39B6A.2 caatggctattgaggattcgta gcaacacgaattccttggtta
Y106G6H.2a gacgatccgacaccaaaact tctgattttggcctggttg
W08E12.7 ctccgatgtcaacaaagtgc aactcccatctttgccttga
C36E8.5 cggtgatttgaaccatcttgt gagatcggcattgagctgtc
F20D12.1 aactacacagcagatattccaagagat aacgtccattccaattacgaag
Y17G7B.7 ccggacacaccaaggatg ggttcgtaggcgatcacaat
F26D10.3 gaccattgaggacgagaagc cttcaagatctcgtcgcactt
F36A4.7 acgtcgcctacctacactcc tacgttggcgatgttgga
Y71F9AM.5 tggccggagctgtaactg gaagcggtcgcttttcac
F32D1.10 caattatgcagtctggcttcc ttgggttgtcgtcaagattgt
T03F1.8 cagagcaagaggaaccgaaa actttgtcgaagagcgttgg
Y73B6BL.6 tggagagggctgtaaattgg tgctggctttacctcgaca
T18D3.4 gctccagaagaagcaactcg tggacggttctgtacttgctaa
F08F3.4 attcccgggtattatctcagc gcgtcgtagaaaatttggattg
F58D5.1 tgaagtcacaattggacagagaa tggaatgtgtccgacgtaga
F20D12.5 atcaaggacaaactggacagg tgttgcggatagaatgagga
T07D3.7a tggtcgatagggatcatgg tcgagtcgggatgaacct
F40F11.1 ttacgagaagagacataagaacgtg caaggtctcctgggtggata
B0491.7 tgaagacatcactgtcaaaggatt tgcttgtgtaggcttctagatgaa
T05E11.1 aactggggatctgaaaacgtc accattttccgaagagagca
T02C5.3 gttaattggaaaccaaggatacaga tgccactttgttggcaca
R07E5.14 tacgcactggtggagtacga tcgttgctctgatcaatagctt
T26C12.1 aagtgccaatgttccagagc cgacgttgtcgtagcgagt
C30C11.4 cgtgaagaaagtttcagattgc cgcgtcgttgaacatcag
F54A3.3 ggccggtgtcagagagatt ttcccttaacaacttgactatcctc
F53A2.7 catattgtgcacgagcttcac aattaaactttttcgaagagaattgc
F57B10.3a tggagagacttccgatgagg ggcttcaagaattcgtctgttt
C09D1.1a ccagaaggaaatagctcagca cattgtgatggttgttgttgc
C06A1.1 ggccaaaaacactgttggat gcgaatagccagcttacacg
Y53C12A.4 aattctcatcactcttcttcttgga ttcacggagcatcgaacc
F43C1.2 ggaagttcatgggcaacttt agtgcagaggcgaccatc
T03F1.3 gctgttccaaccattcagc tggtttcaaggtgtacttgtcttg
T20B12.2 gtaatgggaccaaactcgattc tgcatttgcattgaagaacc
Y49A3A.2 CTCTCCAAATACTCCAACTCTGATG GGAAGTGGTGACACCTTCGACCTCC
K08D12.1 CCCGATCACCGATAATATGGTTGTG GGTAGATTGTCACTGGCTTGTTCTC
F35G2.2 CACACAGTTCCAACTCTCAAAGAAG CTTCAAAGTGTCTTCAGTTGGAGG
T05F1.3 CGATCCAGATTGGTTCTACACCCG GTTTCCTCCGTAGACCTTCTTGAAG
C12C8.3 (lin-41 ) tgagcttcagcagttgatgg ttgctgtgcttgttgtggtt
F11A1.3a (daf-12 ) tccaaacagcgatgacgac cctgatccatgatacccattc
All the genes and the corresponding primers that were used to quantify the relative mRNA levels in
let-7(n2853) animals with respect to wild-type animals are listed. The “Roche Universal Probe
Library” was used for the design of most primer pairs (lower case letters). Primers listed in capitals
were self designed. The primers for the two positive control genes (lin-41 and daf-12) are listed at the
end of the table in bold. The primers for the internal control genes that were used for
normalization (F11C3.3, T03F1.3, F43C1.2, T20B12.2, F36A4.7) are also listed.
Nature Methods: doi: 10.1038/nmeth.1504
15
Supplementary Table 11: RNAi clones
RNAi clone RNAi library Regulated Not regulated Controls
F41E6.4a ORFome library YES - -
C01G8.9a ORFome library YES - -
C14C10.5 Ahringer library YES - -
Y48A6C.4 ORFome library YES - -
F35G12.8 Ahringer library YES - -
T22B11.5 ORFome library YES - -
W06A7.3a Ahringer library YES - -
F46H5.3a Ahringer library YES - -
C56E6.1 Ahringer library YES - -
F46E10.8 Ahringer library YES - -
F53A9.10a Ahringer library YES - -
T19A6.2a Ahringer library YES - -
K09D9.1 Ahringer library YES - -
ZC168.4 ORFome library YES - -
F23H11.4a Ahringer library YES - -
F56A3.4 Ahringer library YES - -
R31.1 Ahringer library YES - -
Y47G6A.10 ORFome library YES - -
Y65B4BL.5 ORFome library YES - -
C47B2.5 Ahringer library YES - -
Y22D7AL.5 ORFome library YES - -
F46B6.7 ORFome library YES - -
K12H4.8 Ahringer library YES - -
F20D12.5 ORFome library - YES -
F58D5.1 ORFome library - YES -
T02C5.3 Ahringer library - YES -
B0491.7 Ahringer library - YES -
Y39B6A.2 ORFome library - YES -
T03F1.8 Ahringer library - YES -
T26C12.1 Ahringer library - YES -
Y17G7B.7 Ahringer library - YES -
R07E5.14 Ahringer library - YES -
C30C11.4 ORFome library - YES -
W08E12.7 ORFome library - YES -
C37C3.6a Ahringer library - YES -
F57B10.3a Ahringer library - YES -
F53A2.7 ORFome library - YES -
Y39B6A.20 Ahringer library - YES -
R11A5.4a Ahringer library - YES -
ZK829.4 ORFome library - YES -
C05D11.11a Ahringer library - YES -
F13H6.3 Ahringer library - YES -
F20D12.1 Ahringer library - YES -
C09D1.1a ORFome library - YES -
C06A1.1 Ahringer library - YES -
Y53C12A.4 ORFome library - YES -
W01B11.3 Ahringer library - YES -
F11A1.3 Ahringer library - - YES
C12C8.3 Ahringer library - - YES
C18D1.1 Ahringer library - - YES
ZK617.1 Ahringer library - - YES
Vector Ahringer library - - YES
The 47 genes (“regulated candidates” and “not regulated candidates”; see Supplementary Table 4
and 5, respectively) and the control genes (3 positive and 2 negative controls, see Supplementary
Table 4) that were knocked-down by RNAi and analyzed for suppression of the let-7(n2853) lethal
vulval bursting phenotype are listed. The RNAi clones were either taken from the “Ahringer
library”2,3
or the “ORFome library”4.
Nature Methods: doi: 10.1038/nmeth.1504
16
Supplementary Table 12: Luciferase expression clones
Genelength of cloned 3'UTR
(basepairs)Primer Forward Primer Reverse
entry clones
(pDONR221)
expression clones
(pEM393)
F46B6.7 565 aaaaagcaggctTTTGACATAACTACCTCATCTCAGCTCGC agaaagctgggtCTGCCTAAATCATTTTACCATGAG pMJ002 pMJ008
C12C8.3 1149 aaaaagcaggctACACTTTCTTCTTGCTCTTTACCC agaaagctgggtTTTATTCCAATTATGTTATCAGC pMJ003 pMJ009
F11A1.3a 1393 aaaaagcaggctACCTACTAGAAATCATCTACCAAACG agaaagctgggtGATTTCAAATTTATATTCATTAGTTTTGAC pMJ004 pMJ010
F13D11.2 1379 aaaaagcaggctTGAGGACGTCCTCGTTAAGGAAACACTTCC agaaagctgggtTATTGGAGTTTTTATAAATTGATAAATTGAC pMJ005 pMJ011
T04C12.6 194 aaaaagcaggctATGCACAACTTCGTCAACTTGCACAAAC agaaagctgggtATCAATTTTTAAATTTTTATTCACACCCGC pMJ006 pMJ012
F36A4.7 381 aaaaagcaggctGATTTTTCCCGTTTTTTTGGGCAATTTTCGC agaaagctgggtTCGTTTATTGATTCAAATAATGATTCTGTGG pMJ007 pMJ013
The 3’UTRs of the listed genes were cloned into the destination vector pEM393 to generate the
corresponding expression vectors. The table lists the length of the 3’UTR, the primers used for the
amplification of the 3’UTR (capitals denote the 3’UTR specific sequence and lowercase letters the
attB specific sites), the identifier of the resulting entry clones (pDONR221 (Invitrogen) was used as
the donor vector) and the identifier of the resulting expression clones (pEM393 was used as the
destination vector).
Nature Methods: doi: 10.1038/nmeth.1504
17
Supplementary Results 1: Exact protein quantification in C. elegans using targeted
proteomics
To test if a targeted proteomics approach is suitable for C. elegans whole animal extracts, we
tested SRM for mass spectrometry (MS) measurements in combination with ICAT sample
labeling for relative quantification. We prepared a 1:1 mixture of heavy and light
ICAT-labeled extracts from a mixed stage population of wild-type C. elegans animals,
selected 5 proteins of different abundance classes based on our C. elegans proteome atlas5
and measured their abundance ratios. We measured at least two PTPs per protein and the
mean value for the light:heavy ratios of all the measured peptides was 0.97 (expected ratio 1),
with a relative standard deviation of 15.5 % (Supplementary Fig. 1). Moreover, the ratio of
different PTPs for the same protein were all in good agreement, independent of absolute
signal intensity. This experiment showed that our setup is suitable for the quantification of
proteins of interest in a complex whole animal extract generated from C. elegans.
Nature Methods: doi: 10.1038/nmeth.1504
18
Supplementary Results 2: LET-526 shows a splice-variant specific response to let-7
Previous studies had identified eight let-7 miRNA targets6,7
. We could quantify one of these
in our assay, namely C01G8.9, also known as lss-4 or let-526Ref.1
. As expected, we observed
significant upregulation of LET-526 protein levels in let-7(n2853) mutants (Supplementary
Table 3). However, we noticed that the two measured peptides matching to this protein
showed a strong discrepancy in the strength of regulation. Interestingly, this discrepancy
correlated with the known alternative splicing pattern of LET-526. Whereas the peptide
specific for the LET-526a splice form showed a strong, 3.1-fold change, the peptide matching
to a region common to both splice-isoforms displayed only a weak 1.2-fold upregulation in
let-7(n2853) mutant animals (Supplementary Fig. 2a and b).
To verify this splice-variant specific response through an independent experimental
approach, we determined the extent of polyribosome association of the LET-526a and
LET-526b mRNAs in staged L4 wild-type and ain-2(RNAi); ain-1(ku322) double mutant
animals. The GW182 proteins AIN-1 and AIN-2 are required for miRNA function8,9,10
.
Known miRNA targets display a shift towards the highly translated polysomal fractions in
ain-2(RNAi); ain-1(ku322) mutants relative to wild-type animals due to the lack of miRNA
mediated translational repression8. We found a strong shift of the let-526a mRNA towards
the polyribosome fractions upon AIN-1/AIN-2 depletion (P = 0.03, one-sided Student’s
t-test). By contrast, probes detecting both splice variants failed to detect a statistically
significant shift (P = 0.17, one-sided Student’s t-test; Supplementary Fig. 2c). Taken
together, our results suggest that the let-526a mRNA responds much more strongly to let-7
activity than the let-526b isoform.
The different response of the two splice-variants to let-7 misexpression is intriguing because
based on EST data, both splice variants have the same 3’UTR and would therefore be
expected to contain the same predicted let-7 binding sites1. However, there are three potential
seed sites within the let-526a mRNA isoform specific ORF, which could account for the
strong differences. Alternatively the b isoform could be resistant to let-7-mediated repression
or is, perhaps, simply expressed in a different set of tissues than let-7. Further experiments
will be required to test these hypotheses.
Nature Methods: doi: 10.1038/nmeth.1504
19
Supplementary Discussion: Limits of the targeted proteomics approach
Despite the clear value of our targeted proteomics approach, several challenges remain. First,
although we achieved high sensitivity, we were still not able to quantify a substantial fraction
of the proteins we had in our final target list. In the let-7 related measurements we could
quantify only approximately 50 % of all the proteins we had on our final target list, which
corresponds to about 20 % of the initial unfiltered list. The same was true for the miR-58
related experiments. Several factors might contribute to this moderate overall success rate.
For example, many of the proteins that we could not measure are probably not expressed at
the late L4 stage. Indeed, in a parallel microarray experiment in which we compared total
mRNA levels of mir-58(n4640) mutants with wild-type animals, we could only detect 66 out
of the total 118 predicted targets (data not shown), showing that we in fact quantified about
40 % of the proteins that are actually detectable on the mRNA level. For other proteins, our
current protocol might not be sensitive enough and further improvements on this front are
certainly possible. As we showed above, the use of an automated data processing tool plus
the application of chemically synthesized peptides allowed us to reach the same sensitivity in
unfractionated complex samples (miR-58 related measurements) as previously in fractionated
samples (let-7 related measurements). Combining those two strategies – chemically
synthesized peptides and fractionation – could potentially boost the sensitivity by an order of
magnitude, as has previously been shown in yeast11
.
Second, the applicability of our targeted proteomics method to whole organ or whole animals
is particularly challenging, as the miRNA of interest might be of low abundance or have a
highly restricted expression pattern. Although we could successfully validate predicted
targets for let-7 and miR-58 using whole worm extracts, both are among the more highly
expressed miRNAs12
. We expect that all miRNAs that are expressed at a similar level at
some stage in development should be within easy reach of our method. However, this
corresponds to only about 20 % of all the miRNAs in C. elegans12
. Even if abundantly
expressed, miRNAs that show a restricted expression pattern such as let-7Ref.13
present an
additional level of difficulty, as changes in protein levels of targets that are co-expressed with
let-7 in only a few cells of the animal might be masked by the stable expression of the protein
in the rest of the animal, where let-7 is not present. Indeed, it is for example very likely that
ztf-7 is regulated by let-7 only in a subset of tissues where it is expressed. For miRNAs with
very limited expression patterns, enrichment of the cells expressing the miRNA of interest
might be necessary. Unfortunately, while cell enrichment has been done successfully for
mRNA profiling14
, it is challenging to obtain sufficient material from sorted C. elegans to
Nature Methods: doi: 10.1038/nmeth.1504
20
perform proteomic analyses. We conclude that our methods functions best in situations where
sufficient material can be readily obtained, or where the sample is homogenous (e.g., cell
lines), and expect that the method described here will be even more powerful in such
systems.
Finally, a biological limitation of this targeted proteomics approach is that we are unable to
distinguish primary from secondary targets. Additional experiments will thus invariably be
necessary to establish which hits are direct targets, as we did for ztf-7.
Nature Methods: doi: 10.1038/nmeth.1504
21
References (Supplementary Information)
1. Grosshans, H., Johnson, T., Reinert, K., Gerstein, M. & Slack, F. The Temporal
Patterning MicroRNA Regulates Several Transcription Factors at the Larval to Adult
Transition in. Developmental Cell 8, 321–330 (2005).
2. Fraser, A.G. et al. Functional genomic analysis of C. elegans chromosome I by
systematic RNA interference. Nature 408, 325-30 (2000).
3. Kamath, R.S. et al. Systematic functional analysis of the Caenorhabditis elegans genome
using RNAi. Nature 421, 231-7 (2003).
4. Rual, J. et al. Toward improving Caenorhabditis elegans phenome mapping with an
ORFeome-based RNAi library. Genome Res 14, 2162-8 (2004).
5. Schrimpf, S.P. et al. Comparative Functional Analysis of the Caenorhabditis elegans and
Drosophila melanogaster Proteomes. PLoS Biol 7, e48 (2009).
6. Papadopoulos, G.L., Reczko, M., Simossis, V.A., Sethupathy, P. & Hatzigeorgiou, A.G.
The database of experimentally supported targets: a functional update of TarBase.
Nucleic Acids Res 37, D155-8 (2009).
7. Xiao, F. et al. miRecords: an integrated resource for microRNA-target interactions.
Nucleic Acids Res 37, D105-10 (2009).
8. Ding, X.C. & Grosshans, H. Repression of C. elegans microRNA targets at the initiation
level of translation requires GW182 proteins. EMBO J 28, 213-22 (2009).
9. Ding, L., Spencer, A., Morita, K. & Han, M. The Developmental Timing Regulator AIN-
1 Interacts with miRISCs and May Target the Argonaute Protein ALG-1 to Cytoplasmic
P Bodies in. Molecular Cell 19, 437–447 (2005).
10. Zhang, L. et al. Systematic Identification of C. elegans miRISC Proteins, miRNAs, and
mRNA Targets by Their Interactions with GW182 Proteins AIN-1 and AIN-2. Molecular
Cell 28, 598–613 (2007).
11. Picotti, P., Bodenmiller, B., Mueller, L.N., Domon, B. & Aebersold, R. Full dynamic
range proteome analysis of S. cerevisiae by targeted proteomics. Cell 138, 795-806
(2009).
12. Kato, M., de Lencastre, A., Pincus, Z. & Slack, F.J. Dynamic expression of small non-
coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during
Caenorhabditis elegans development. Genome Biol 10, R54 (2009).
13. Johnson, S.M., Lin, S.Y. & Slack, F.J. The time of appearance of the C. elegans let-7
microRNA is transcriptionally controlled utilizing a temporal regulatory element in its
promoter. Dev Biol 259, 364-79 (2003).
14. Clark, A.M. et al. The microRNA miR-124 controls gene expression in the sensory
nervous system of Caenorhabditis elegans. Nucleic Acids Res 38, 3780-3793 (2010).
Nature Methods: doi: 10.1038/nmeth.1504
top related