aplikasi mikrobiologi dalam kehidupan - rara · pdf file13/1/2014 · yields...

45
BIOTECHNOLOGY MOLECULAR TECHNIQUE FOR IDENTIFICATION AND GENETICS ENGINER

Upload: ngokhanh

Post on 23-Feb-2018

220 views

Category:

Documents


2 download

TRANSCRIPT

Page 1: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

BIOTECHNOLOGY

MOLECULAR TECHNIQUE FOR IDENTIFICATION AND GENETICS ENGINER

Page 2: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Bioteknologi Adalah teknologi merekayasa pertumbuhan dan metabolisme sel hidup, baik dari mikroba, tumbuhan, hewan maupun manusia untuk produksi komoditi barang maupun jasa yang bermanfaat bagi manusia.

HORMON INSULIN

HORMON PERTUMBUHAN

Review

Page 3: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Introduction to PCRThe Polymerase Chain Reaction

Photo courtesy of Fisher Scientific

Page 4: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

DefinitionPolymerase Chain Reaction (PCR): A procedure to amplify a specific DNA region

Yields millions of copies of the target region, Eksponensial amplification.

Makes enough DNA for further molecular work Is the first step in preparing DNA for :

Sequencing Restriction digestion Bacterial cloning

Diagram by Andy Vierstraete 1999

Page 5: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

PCR

Exponential increase of the number of copies during PCR

Page 6: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

TEKNIK-TEKNIK MOLEKULER UNTUK DIAGNOSTIK dan IDENTIFIKASI

Penggunaan teknik molekuler Untuk keperluan :1.Karakterisasi dan identifikasi Mikroba: – Keragaman genetik – Hubungan filogeni/kekerabatan2. Diagnosis: deteksi dini/cepat dari patogen/Penyakit.3. Rekayasa Genetika, (ClONING, TRANSGENIK

ORGANISM)

Page 7: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Keunggulan teknik molekuler: • Akurasi tinggi: sensitifitas dan spesifisitas • Cepat • Dapat mendeteksi keseluruhan mikroba: Viable

but not (yet) culturable.

Page 8: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

PCR (POLYMERASE CHAIN REACTION) BASED METHODS KARRY MULLIS (1982)

Teknik Molekuler berkembang setelah ditemukannya PCR (Polymerase chain Reaction) oleh karry mullis (1982) dimana dengan sebuah alat yang dinamakan ‘’Thermal Cycler” Proses sintesis protein/Amplifikasi (pemanjangan) DNA dapat dilakukan secara invitro (diluar sel).

Page 9: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,
Page 10: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

PCR ,thermal cycler multi-block system

Page 11: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Tahapan teknik molekuler: A. Ekstraksi DNA Produk DNA Genom B. PCR 1. Denaturasi, (94–96°C) pemutusan ikatan hidrogen pada

DNA Genom sehingga DNA menjadi Utas Tunggal .

2. Annealing,(45-60°C), penempelan PrimerTm = 4 (G+C) + 2 (A+T). Annealing Temperature.

3. Ekstension (70-72°C), pemanjangan DNA Target

C. Elektroforesis (Visualisasi )- Identifkasi Produk PCR

Page 12: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

1. Ekstraksi DNA

Page 13: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

2. PCR

The different steps of PCR

PCR

DNA sequencing

Microarrays

Mass-spec

Page 14: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Roles of PCR Reagents

GoTaq® PCR Mix Taq polymerase

Enzyme that extends growing DNA strand complementary to DNA template

MgCl2

Provides ions needed for enzyme reaction

dNTP’s Nucleotides (Adenine, Cytosine, Guanine, Thymine)

building blocks for new DNA strands

Buffer Maintains optimal pH for enzyme

ddH2O

Page 15: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Roles of PCR Reagents

Primers Anneal to single-stranded DNA template

Provide initiation site for extension of new DNA

Forward primer Anneals to DNA anti-sense strand

Reverse primer Anneals to DNA sense strand

DNA template In this case, the product of our DNA extraction

Page 16: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Quick QuizWhich of the following reagents is NOT in a master

mix?

A. MgCl2

B. Template DNAC. ddH2OD. dNTPs

Page 17: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

PCR (Polymerase Chain Reaction)

Bahan Jumlah (µl)

Primer:

Forward

Reverse

1

1

dNTP 2,5

10 x Buffer Ex Taq 2,5

Taq DNA Polymerase 0,2

Steril Destilation Water (SDW) 18,5

Pembuatan Premix

Pair-ID Forwad Primer Reverse PrimerProd Len.

TmDiff.FPPos.RPPos.

2 GATGGTCAGTGCCTCTCA CCCAGTTGTATAGCGGTA 518 286

586

Primer

Page 18: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Primer design

General notes on primer design in PCR

Perhaps the most critical parameter for successful PCR is the design of primers

Primer selectionCritical variables are: - primer length - melting temperature (Tm) - specificity - complementary primer sequences - G/C content- 3’-end sequence

Primer length

- specificity and the temperature of annealing are atleast partly dependent on primer length

- oligonucleotides between 20 and 30 (50) bases are highly sequence specific- primer length is proportional to annealing efficiency: in general, the longer theprimer, the more inefficient the annealing

- the primers should not be too short as specificity decreases

Page 19: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Contoh Desain Primer

Page 20: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

gatggatcatgaataaaactattacgttacttagtgcattattactaccactaagttttgctcacgctgccgagccaacattgtctccagagatggtcagtgcctctcaagtaagaagcgcgcaagcgaaacaaacttacacttatgtccgctgctggtaccgcaccagttattcaaaagatgaacctgcgaccgattgggaatgggcagaaaatccagacggcagttacttcacgcttgatggctactggtggagttcggtttctttcaagaacatgttctacacagacacaccgcaaagtgttatcaagcaacgttgtgagcaaactctggacctagcaaatgaaaacgctgacatcaccttctttgcagccgataaccgtttctcctacaaccatactatctggagcaacgaccctgtcatgcagccagaccaaatcaacaaggtcgtagcattgggtgacagcttgtctgatacaggcaacatctttaatgcatcacaatggcgattcccgaatccaaatagctggttcttgggacacttctcaaacggttttgtgtggactgagtacattgctcaagcgaaaaacttaccgctatacaactgggctgtgggtggcgcggcaggcgaaaaccaatacatcgctctgactggtgtaggtgagcaagtttcctcttacttggcatatgcgaaattagcgaaaaactacaagcctgctaataccctgtttacccttgagtttggtctaaatgacttcatgaactacaaccgtagcgtgccagaagtgaaatcagactacgcggaagccttgattaaactgaccgatgcaggtgcgaagaacttgttgttgatgacactaccagatgcaacacgtgcaccacagtttacctactcgactcaagaagaaatcaacaagatccgcgcgaagatcgtggaaatgaatgagttcatcaaagcacaagcggcgtattacactgcacaaggctacaacgttaccttgtacgatacgcatgcactgtttgaaagcttaacagcaaatccagagcaacacggttttgtaaacgcgagccaagcttgccaagacatcaaccgctcttcatcggtagattacctataccatcactcattgcgttctgagtgtgcgtcttctggctctgataagtttgtattctgggacgtaacacacccgaccacagcaaacaccactacgtggcagaaaaaatgctagaaagtacgaatcaattgtcaaaccatcctttctaa

Sekuen Gen Hemo

Sumber ; (Yuhana et al, 2009)

Forwards

Reverse

Page 21: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Good Primer Design

Length (17-28bp) GC content 50-60% GC Clamp Tm’s between 55-80 Avoid simple sequences – e.g. strings of G’s Avoid primer self complementary

e.g. hairpins, homodimers, heterodimers

Page 22: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Setting PCR Program

Tahapan Suhu(0C)

Waktu

Pre-Denaturasi 94 2 menit

Denaturasi 94 1 menit

Annealing 50 1 menit

Elongation 72 1 menit

Final Elongation 72 2 menit

35 siklus

Page 23: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Considerations

Contamination can easily lead to erroneous results

Avoid contaminating with DNA or PCR product…

DNA stocks, PCR reagents Gloves, tips, pipetters, benches

Carefully measure reagent quantities

Use appropriate cycling conditions

Page 24: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

PCR Animation--3D

“ Short Video PCR”

Page 25: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

3. Elektroforesis

Page 26: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,
Page 27: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Visualisasi Produk PCR (Elektroforesis)

Gel agarosa 0,7% (0,21 gr

agarose+30 ml TBE)

Dipanaskan sampai bening dan diamkan

hingga hangat

Dituang ke ke dalam chamber yang sudah

dipasang sisir

Dimasukkan ke bak

elektroforesis

3 µl produk PCR + 4 µl

loading dye

Dimasukkan ke sumur dalam gel

1 µl marker + 4µl

Loading dye

Running (200 Volt, 70 mA)

hingga ¾ bagian dari lebar gel

Diletakkan di atas

ultraviolet illuminator

Pengambilan gambar

Page 28: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,
Page 29: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

DNA Sequencing

The separation of the sequencing fragments

To measure the sizes of the fragments, each of the four reactions would be loaded into a separate well on a gel, and the fragments would be separated by gel electrophoresis

Page 30: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Elektroforesis

Page 31: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Quick QuizIf you forgot to add one of your primers your

resultant gel will probably have

A. No bandsB. A smearC. A band of the wrong sizeD. Many bands

Page 32: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Dolly adalah hewan hasil kloning pertama

Teknik Kloning Dolly

Sel telur dari domba donor I diambil, lalu dikeluarkan intinya (yang dipakai hanya sel yang tanpa inti)

Sel dari kelenjar ambing domba donor II diambil DNAnya saja (sel dibuang, hanya inti yang dipakai)

Sel dari domba I dan II digabungkan (dengan arus listrik), kemudian terjadi pembelahan sel (embrio)

Sel yang telah membelah tsb ditanam pada uterus domba betina lain, yang selanjutnya beranak Dolly

Sepanjang hidupnya Dolly tlh melahirkan 2x, disuntik mati krn radang paru-paru dan arthritis pd umur 6,5 thn.

Profil Dolly

Review.

Page 33: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Kloning Pada Manusia?

Page 34: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Kloning Untuk Menghasilkan Sel Sebagai Terapi?

Tujuan jangka panjangriset kloning antara lain adalah di-hasilkannya protein yang dibutuhkan manusia, sbg terapi dgn menciptakan berbagai sel dan organ kompatibel yang siapdi-transplantasikan ke tubuh manusia.

Contoh membuat sel untuk melawan kanker

Page 35: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Cloning Genes

Page 36: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,
Page 37: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Agrobacterium tumefaciens Agrobacterium tumefaciens,

penyebab penyakit crown gall, pada tanaman.

Mekanisme : parasit pada jaringan tanaman, melibatkan integrasi sebagian DNA bakteri pada tanaman inang yang menyebabkan tumor dan mengubah metabolisme tanaman.

Page 38: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Agrobacterium tumefaciens A. tumefaciens digunakan

sebagai agen kontrol biologi dan sebagai alat untuk enginering gen pada tanaman.

Page 39: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Plasmid Ti Hanya sel yang mengandung plasmid spesifik

(plasmid Ti) yang dapat menyebabkan penyakit. A. tumefaciens strains yang tidak mempunyai plasmid tumbuh sebagai rizosphere – inhabiting bacteria tanpa menyebabkan penyakit.

Bakteri dapat menstimulasi inang untuk memperbanyak dan membelah diri sel secara cepat dan tidak normal. Hal ini karena bakteri tersebut dapat menyisipkan sebagian DNA nya ke dalam kromosom DNA inang yang menyebabkan overproduksi dari cytokinins dan auxins.

Page 40: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Cytokinin dan auksin merupakan plant growth regulators, dan opines yang memberikan nutrient bagi patogen.

Jaringan inang akan terus membesar dan akan membentuk tumor di batang atau akar.

Page 41: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Plasmid Ti

Page 42: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

GMO(Genetically Modified Organism)

Page 43: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Ice Plus Protein (Ice Nucleation active Protein)

Page 44: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

The methods used by molecular biologists to study DNA have been developed through adaptation of the chemical reactions and biological processes that occur naturally in cells

Many of the enzymes that copy DNA, make RNA from DNA, and synthesize proteins from an RNA template were first characterized in bacteria. This basic research has become fundamental to our understanding of the function of cells and have led to immense practical applications for studying a gene and its corresponding protein.

As science advances, so do the number of tools available that are applicable to the study of molecular genetics.

PCRDNA sequencing

Microarrays

Mass-spec

The new biology lab

Laboratory Tools and Techniques

Page 45: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,

Terimakasih Semoga Bermanfaat