Archives of Oral Biology 73 (2017) 121–128

Human dental follicle cells express embryonic, mesenchymal andneural stem cells markers

Rodrigo Lopes de Limaa,*,1, Rosenilde Carvalho de Holanda Afonsob, Vivaldo Moura Netob,Ana Maria Bolognesea, Marcos Fabio Henriques dos Santosb,Margareth Maria Gomes de Souzaa

aDepartment of Orthodontics, Faculty of Dentistry, Federal University of Rio de Janeiro, Rio de Janeiro, Brazilb Laboratory of Cellular Morphogenesis, Institute of Biomedical Sciences, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil

A R T I C L E I N F O

Article history:Received 26 February 2015Received in revised form 21 September 2016Accepted 6 October 2016

Keywords:Dental stem cellsHuman dental follicleMesenchymal stem cellsNeural stem cellsRegenerative medicine

A B S T R A C T

Objective: This study was conducted to identify and characterize dental follicle stem cells (DFSCs) byanalyzing expression of embryonic, mesenchymal and neural stem cells surface markers. Design Dentalfollicle cells (DFCs) were evaluated by immunocytochemistry using embryonic stem cells markers (OCT4and SOX2), mesenchmal stem cells (MSCs) markers (Notch1, active Notch1, STRO, CD44, HLA-ABC, CD90),neural stem cells markers (Nestin and b-III-tubulin), neural crest stem cells (NCSCs) markers (p75 andHNK1) and a glial cells marker (GFAP). RT-PCR was performed to identify the expression of OCT4 andNANOG in DFCs and dental follicle tissue.Results: Immunocytochemistry and RT-PCR analysis revealed that a significant proportion of the DFCsevaluated expressed human embryonic stem cells marker OCT4 (75%) whereas NANOG was weaklyexpressed. A considerable amount of MSCs (90%) expressed Notch1, STRO, CD44 and HLA-ABC. However,they were weakly positive for CD90. Moreover, it was possible to demonstrate that dental follicle containsa significant proportion of neural stem/progenitors cells, expressing b-III-tubulin (90%) and nestin (70%).Interestingly, immunocytochemistry showed DFCs positive for p75 (50%), HNK1 (<10%) and a smallproportion (<20%) of GFAP-positive cells. This is the first study reporting the presence of NCSCs and glial-like cells in the dental follicle.Conclusions: The results of the present study suggest the occurrence of heterogeneous populations ofstem cells, particularly neural stem/progenitor cells, in the dental follicle, Therefore, the human dentalfollicle might be a promising source of adult stem cells for regenerative purposes.

ã 2016 Elsevier Ltd. All rights reserved.

Contents lists available at ScienceDirect

Archives of Oral Biology

journa l homepage: www.e lsev ier .com/ locate /aob

1. Introduction

Mesenchymal stem cells were first identified in aspirates ofadult bone marrow. Initially, clonogenic clusters of adherentfibroblastic colony-forming units with the potential to undergoextensive proliferation in vitro and to differentiate into differentmesenchymal cell lineages were developed (Friedenstein, Pia-tetzky-Shapiro, & Petrakova, 1966). Since then, bone marrow hadbeen the most utilized source of MSCs. Nevertheless, there was aneed to isolate MSCs from accessible tissues with minimal surgicaltrauma.

* Corresponding author at: Department of Orthodontics, Faculty of Dentistry,Federal University of Rio de Janeiro, Street Professor Rodolpho Paulo Rocco, 325, Ilhado Fundão, Rio de Janeiro, Brazil.

E-mail address: rolopeslima@gmail.com (R.L.d. Lima).1 http://www.odontologia.ufrj.br/ortodontia/eng/index.html.

http://dx.doi.org/10.1016/j.archoralbio.2016.10.0030003-9969/ã 2016 Elsevier Ltd. All rights reserved.

The dental follicle is a loose ectomesenchymally derivedconnective tissue surrounding the enamel organ and dentalpapilla of the developing tooth germ. It coordinates the tootheruption and harbours progenitor cells for the periodontium (TenCate, 1997). Dental follicle represents an appealing source of stem/progenitor cells owing to the fact that it is an expendable tissuethat can be removed with minimal morbidity (Ikeda et al., 2006).Through tissue engineering, those stem cells could be exploited togenerate more cellular material for tissue repair than could begenerated in situ, during the lifetime of an organism (Gronthos,Mankani, Brahim, Robey, & Shi, 2000). This feature confers greatpotential for the application of such tissue in cell therapy (Ikedaet al., 2006).

Dental follicle cells have multipotential mesenchymal precur-sor cell properties after differentiating toward multiple mesen-chymal-derived cell types, such as cementoblasts, chondrocytes,adipocytes (Kémoun et al., 2007) and osteoblasts (Morsczeck et al.,

122 R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128

2005). Recent studies have demonstrated that dental follicle cellscan differentiate into neural-like cells, when cultured in a neuralinductor medium (Völlner, Ernst, Driemel, & Morsczeck, 2009).Nonetheless, the immunophenotype as well as the capacity ofneural differentiation of DFSCs has not been extensively explored.Hence, the aim of this study is to characterize DFSCs by analyzingthe expression of various cell surface markers used to identifyputative embryonic, mesenchymal and neural stem cells.

2. Materials and methods

2.1. Individuals and sample

Six individuals aged between 14 and 16 years were selected tovolunteer in the study, according to the following inclusioncriteria: a- healthy subjects, with good oral health condition,referred for third molar extraction due to orthodontic reasons andb- presence of impacted third molars with roots in the initialcalcification phase, between stages six and seven of toothdevelopment, observed on panoramic radiographs (Nolla, 1960).

The sample included 16 fresh human dental follicles. The regionof interest in the dental follicle comprised the part that surroundedthe developing roots. Each dental follicle was carefully separatedfrom the roots with aid of a sterile forceps and a scalpel and thenwashed in phosphate buffered saline (PBS) to remove blood. Thetissue remained immersed in solution of chlorhexidine gluconate0.12% during one minute for bacterial decontamination, and thenwas washed again in PBS. This study was approved by the EthicsCommittee on Human Research of the University HospitalClementino Fraga Filho of Federal University of Rio de Janeiro(protocol number: 06225113.6.0000.5257) and was conductedaccording to ethical principles for research involving humansubjects of the World Medical Association (Declaration ofHelsinki).

2.2. Histological analysis

The follicular tissue was fixed in 4% solution of paraformalde-hyde/0,1 M PBS at 4 �C for 48 h. Then, the tissue was dehydrated inascending series of ethanol and embedded in paraffin. Serialsections of 5 mm were cut in different planes and stained withhematoxylin-eosin (HE) and Gomori trichrome for tissue charac-terization. Staining with periodic acid-Schiff (PAS) was performedto identify glycoproteins in the extracellular matrix.

Table 1Primary antibodies used in immunocytochemistry experiments.

Primary antibodies Antigen

Anti-Active Notch1 Active Notch1 receptor

Anti-CD44 CD44 (HCAM-1)

Anti-CD90 CD90 (Thy-1)

Anti-Fibronectin Fibronectin

Anti-GFAP Glial fibrillary acidic protein

Anti-HLA-ABC Human leukocyte antigen-ABC

Anti-HNK1 Human natural killer-1

Anti-Nestin Nestin

Anti-Nocht1 Notch1 receptor

Anti-OCT4 Octamer-binding transcription factor 4

Anti-p75 Low-affinity nerve growth factor receptor or p75 neurotrophAnti-Phalloidin Phalloidin

Anti-SOX2 Sex determining region Y (SRY)

Anti-STRO1 STRO1 receptor

Anti-Vimentin Vimentin

Anti-a-SMA a-smooth muscle actin

Anti-b-III-tubulin b-III-tubulin

2.3. Cell culture experiments

The follicular tissue was cut into small fragments with the aid ofsterile scissors and forceps. Then, tissue fragments were enzymat-ically digested in a solution containing 0.1 U/ml collagenase type II(Sigma-Aldrich) at 37 �C for one hour. Inactivation of collagenasewas performed with 1 ml Dulbecco’s Modified Eagle’s Medium(DMEM, Gibco) supplemented with Nutrient Mixture F-12 (DMEM/F12) supplemented with 10% heat-inactivated fetal bovine serum(FBS, Invitrogen Life Technologies). This solution was centrifugedat 1500 rpm for 5 min. The supernatant was discarded and thepellet was resuspended in 1 ml DMEM/F12 with 10% FBS. Mincedand digested tissues of dental follicle explants were seeded intoT25 flasks in DMEM/F12, 20% FBS, 100 mm L-ascorbic acidphosphate (Sigma-Aldrich), antibiotics/antimycotic (a/a; 100 U/ml penicillin, 0,1 mg/ml streptomycin; Invitrogen Life Technolo-gies), 2 mM L-glutamine (Invitrogen Life Technologies) at 37 �C in5% CO2 in a humidified atmosphere. After single cells have attachedto the plastic surface, non-adherent cells were removed bychanging the medium every 2 days. Plastic adherent cells werepropagated until they reached approximately 80% of confluence.During this period, dental follicle cells were examined by phase-contrast microscopy and cells from passages 1 to 5 were used for allexperiments. Early passages were used because seems thatasymmetric dividing progenitor cells ratify after passaging(Morsczeck et al., 2005; Sherley, 2002).

2.4. Immunocytochemistry experiments

Cells were fixed with 4% paraformaldehyde pH 7,4 for 30 min atroom temperature and permeabilized with 0.2% Triton X-100(Reagan) in PBS for 5 min. For blocking, cells were treated with 5%bovine serum albumin (BSA, Gibco) in PBS for 1 h. Cells wereincubated with primary antibodies (Table 1) overnight at 4 �C andthen with specific secondary antibodies conjugated to Alexa Fluor488, 546 or 647 (Invitrogen) for 2 h. Nuclear counterstaining wasperformed with 4’,6’-diamidino-2-phenylindole dihydrochloridehydrate (DAPI) at 0,25 mg/ml (Sigma-Alderich) for 5 min. Fornegative controls, primary antibodies were omitted and onlysecondary antibodies were used. Epifluorescence observation andphotodocumentation were accomplished using Leica confocalmicroscope. The proportion of stained cells relative to unstainedwas expressed in percentage. Fluorescence intensity of markerswas classified as low, moderate or high according to Leica

Classification Species Sources Dilution

Polyclonal rabbit Abcam 1:500Monoclonal mouse BD-Pharmingen 1:100Monoclonal mouse BD-Pharmingen 1:200Polyclonal rabbit Sigma 1:200Polyclonal rabbit DAKO 1:500Monoclonal mouse BD-Pharmingen 1:200Monoclonal hybridoma Laboratory It is not fixedMonoclonal mouse Chemicon 1:100Monoclonal mouse Santa Cruz 1:50Monoclonal mouse Millipore 1:100

in receptor Monoclonal mouse Millipore 1:500Monoclonal mouse Abcam 1:200Polyclonal rabbit Millipore 1:100Monoclonal mouse Invitrogen 1:200Monoclonal mouse DAKO 1:200Monoclonal mouse DAKO 1:100Monoclonal mouse Promega 1:1000

R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128 123

Application Suite Advanced Fluorescence software (LAS-AF 2.2). Toinfer the percentage of stained cells and fluorescence intensity wasused photomicrographs at the same magnification. All experi-ments were performed in triplicate and at different times.

2.5. Reverse transcription (RT)-PCR

Total RNA was isolated from 2 g of tissue and 2 �105 dentalfollicle cells at passage 1–5 using trizol (Invitrogen). cDNAs weresynthesized from 1 mg of total RNA in 20 ml reaction containing10� reaction buffer, 1 mmol/l of dinitrophenolphosphate (dNTP)mixture, 1 U/ml RNase inhibitor, 0,25 U/ml reverse transcriptase(Invitrogen). Amplification was performed in a polymerase chainreaction (PCR) thermocycler Veriti (Applied Biosystems) followingthe reaction profile of: initial denaturation at 95 �C for 3 min, 35cycles of denaturation at 95 �C for 30 s, annealing at 65 �C for 58 s(amplification of the target gene), extension at 72 �C for 30 s andfinal extension at 72 �C for 10 min. The following human primerswere used for each specific cDNA amplification: OCT4 (forward: 50

GACAGGGGGAGGGGAGGAGCTAGG 30, reverse: 50 CTTCCCTCCAAC-CAGTTGCCCCAAAC 30), NANOG (forward: 50 CAGCCCCGATTCTTC-CACCAGTCC 30, reverse: 50 CGGAAGATTCCCAGTCGGGTTCACC 30)and GAPDH (forward: 50 AACGGATTTGGTCGTATTG 30, reverse: 50

GGAAGATGGTGATGGGATT 30). 10 ml of each sample was applied tocolumn of agarose gel and horizontal electrophoresis wasperformed at a current of 100 mA for 45 min. PCR products werephotographed under ultraviolet light transilluminator coupled toimage analyzer system (L-Pix photo documentation HE – LoccusBiotechnology).

3. Results

3.1. Histological analysis and cellular morphology

Histological analysis confirmed that the dental follicle consistsof a connective tissue, rich in collagen fibers, covered by thin layerof dental epithelium (Fig. 1a and b). PAS staining showed

Fig. 1. Photomicrograph of human dental follicle showing in (A) follicular tissue exhibitistroma rich in collagen fibers, Gomori trichrome (20�); in (C) is demonstrated extracedental follicle cells with 5 days (D) and 22 days (E) in culture.

extracellular matrix rich in glycoproteins (Fig. 1c). At the onsetof the cellular culture, DFCs at passage 1 were typical mesenchy-mal cells with spindle-like morphology (fibroblast-like) (Fig. 1d).After 17 days of culture, DFCs reached approximately 90% ofconfluence, suggesting a high rate of cellular proliferation (Fig. 1e).

3.2. Immunocytochemistry analysis

Immunocytochemistry evaluation demonstrated that a greatproportion (about 75%) of DFCs express moderately transcriptionfactors OCT4 and weakly SOX2 (Fig. 2a and b). Both OCT4 and SOX2are expressed by human embryonic stem cells and are essential forthe establishment and maintenance of undifferentiated pluripo-tent stem cells. DFCs also exhibited extensive expression of MSCsmarkers. Notch1 was highly expressed in approximately 90% ofcells in culture while active Notch1, a notch1 receptor, was stronglyexpressed in both nucleus and cytoplasm of approximately 95% ofcells (Table 2, Fig. 2c and d). More than 90% of the cultured cellswere positive for STRO1 and highly positive for CD44 (Fig. 2e and f),HLA-ABC and vimentin (Fig. 3a and b). On the other hand, most ofDFCs weakly expressed CD90 (Fig. 3c). Around 70% of DFCsexpressed nestin (Fig. 3d), a neural progenitor cells marker. Inaddition, more than 90% of cells were strongly positive for b-III-tubulin (Table 2), an early neuronal marker. Interestingly, a smallproportion of cells (<20%) was positive for GFAP (Fig. 3e and f). Inaddition, p75 neurotrophin receptor (p75) was identified in 50% offollicular cells, while a small group of cells (<10%) expressedhuman natural killer-1 (HNK-1) (Fig. 4a and b). Recently studieshave characterized HNK-1 and p75 as specific NCSCs markers.Nevertheless, according to the current literature, this is the firsttime the expression of p75 and HNK1 in DFCs is reported. Elevatedproportion (roughly 80%) of a-SMA-positive cells displayed spreadmorphology with actin stress fibers, similar to the morphology ofneural crest-derived myofibroblasts. Overall, DFCs exhibited well-developed cytoskeleton due to the wide conjugation of actin F withphalloidin, and extracellular matrix rich in fibronectin (Fig. 4c–e).The immunocytochemistry analysis is illustrated in Figs. 2–4. As

ng thin layer of dental epithelium covering the stroma, HE (10�); in (B) is observedllular matrix rich in glycoproteins, PAS (20�). Phase contrast microscopy showing

Fig. 2. Immunocytochemistry of the DFCs observed by confocal microscopy. The DFCs exhibiting positive staining for: (A) OCT4, (B) SOX2, (C) Notch1, (D) Active Notch1, (E)STRO and (F) CD44. Inserts: negative control.

Table 2Percentage of cells stained and fluorescence Intensity of dental follicle cells.

Markers Percentage of cells stained Intensity

Active Notch1 95% +++CD44 >90% +++CD90 60% +Fibronectin — +++GFAP <20% ++HLA-ABC >90% +++HNK1 <10% ++Nestin 70% +++Nocht1 90% ++OCT4 75% ++p75 50% ++Phalloidin >90% +++SOX2 75% +STRO1 >90% ++Vimentin >90% +++a-SMA 80% +++b-III-tubulin >90% +++

+: low intensity, ++: moderate intensity, +++: high intensity.

124 R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128

previously described, to photomicrographs at the same magnifi-cation were used to infer the percentage of satined cells andfluorescence intensity (imagens not displayed).

3.3. Reverse transcriptase (RT)-PCR

Confirming the immunocytochemistry results, RT-PCR demon-strated that the follicular tissue expresses embryonic stem cellsgenes, such as OCT4 and NANOG. DFCs displayed a weakexpression of NANOG, whereas OCT4 was substantially expressed

(Fig. 5). NANOG expression was more pronounced in the folliculartissue than in DFCs, unlike the expression of OCT4 that was similarin both samples.

4. Discussion

The aim of the current study was to propagate undifferentiatedcells of human dental follicle and characterize the expression ofembryonic, mesenchymal and neural stem cells markers byimmunocytochemistry and RT-PCR. The dental follicle is acondensed ectomesenchymal tissue that limits the dental papillaand encapsulates the enamel organ. During the odontogenesis,each tooth has its own follicle (Nanci, 2013). Thus, all teeth indevelopment that need to be extracted are potential sources ofdental follicles (Nanci, 2013; Olteanu et al., 2015). The dentalfollicle, a tissue considered to be neural crest-derived ectomesen-chymal cells, contains mesenchymal progenitor cells for theperiodontium (Morsczeck et al., 2005). The neural crest comprisesa highly pluripotent cell population that migrates towards the firstarch to participate in teeth development. Neural crest cells candifferentiate into ectodermal and mesodermal cell types (LeDouarin, Creuzet, Couly, & Dupin, 2004).

In our experiments using human dental follicle cells cultures,we identified, by immunocytochemistry, a high proportion of cells(around 75%) that expressed OCT4 and SOX2 in the nucleus andcytoplasm. RT-PCR analysis confirmed OCT4 expression in dentalfollicle tissue and cells of all passages. Recently, studies related thatOCT4, SOX2 and NANOG are weakly expressed in the nucleus ofboth fresh and cryopreserved dental follicles (Park et al., 2014)while a study reported that DFSCs are negative for OCT4(Ponnaiyan, 2014). These transcription factors are expressed by

Fig. 3. Immunocytochemistry of the DFCs observed by confocal microscopy. The DFCs exhibiting positive staining for: (A) HLA-ABC, (B) Vimentin, (C) CD90, (D) Nestin, (E)b-III-tubulin and (F) GFAP.

R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128 125

human embryonic stem cells and are essential for the establish-ment and maintenance of undifferentiated pluripotent stem cells(Okumura-Nakanishi, Saito, Niwa, & Ishikawa, 2005; Rizzino,2009). The significance of OCT4 and SOX2 expression in a largeproportion of cells is unclear. It should be noted in this respect thatonly a small proportion of amniotic stem cells was positive forOCT4 (Jiang et al., 2002). The lack of OCT4 expression in some cellscould be explained by contamination with non-stem cells.Nonetheless, during normal development, OCT4 is expressed ina mosaic pattern in the population of cells that otherwise haveequal differentiation potential (Kirchhof et al., 2000). In general,adult stem cells are more restricted in their capacity ofdifferentiation when compared with embryonic stem cells, whichcan form tumors when implanted in vivo. (Hynes, Menicanin,Gronthos, & Bartold, 2012). Although approximately 75% of DFSCsexpress OCT4, these cells are not of originally embryonic cells.Therefore, they have a limited ability to differentiate. More in vivoexperimental studies are still necessary to define strict differenti-ation protocols and to provide and in depth evaluation regardingthe behavior of DFSCs, before advancing to the clinical phase. RT-PCR also revealed that DFCs exhibit weak NANOG expression. Asexpected, NANOG, a pluripotent cell marker, became down-regulated the following passages.

Immunocytochemistry demonstrated that DFCs express strong-ly Notch1, a transmembrane protein important in various cell fatedecisions during development, and Notch1 receptor. Constitutivelyactive Notch1 reduced the number of the G1 phase cells andaccelerated the S phase transition in DFSCs, promoting the G1/Stransition (Borghese et al., 2010). G1 phase is a particularlyimportant part of the cell cycle and determines whether a cellremains in the proliferative state or executes other cell fate

decisions. Therefore, a shortened G1 phase and an accelerated S-phase transition induced by Notch1 activation may diminish theability of DFSCs to differentiate, promoting their self-renewalcapacity and proliferation (Chen et al., 2013). We identified largeproportions of CD44 and STRO1 positive cells (approximately 90%).STRO1 a cell surface protein, characteristic of mesenchymalprogenitor cells (Simmons, Gronthos, Zannettino, Ohta, & Graves,1994), is often used as a marker of dental stem cells (Ulmer,Winkel, Kohorst, & Stiesch, 2010). STRO1 is one the early surfacemarkers of MSCs (Sonoyama, Gronthos, & Shi, 2007) and isnecessary for the maintenance of a pool of undifferentiated cells(Miura et al., 2003; Seo et al., 2004). Despite STRO1 is widelyexpressed by mesenchymal stem/progenitors cells present in thedental follicle (Guo et al., 2012; Guo et al., 2013; Kémoun et al.,2007), a study reported weaker STRO1 expression in human dentalfollicle cells than in human bone marrow mesenchymal stem cells(BMMSCs) (Aonuma et al., 2012). However, one of the factors thatcan lead to decreased of STRO1 expression is increasing passages(Sonoyama et al., 2007). We observed that most of DFCs werestrongly positive for CD44, a mesenchymal stem/progenitor cellsmarker. It has been reported that CD44 is equally expressed byDFSCs, BMMSCs and MSCs from skin (Park et al., 2012) while astudy showed that CD44 expression was higher in DFSCs thanBMMSCs (Jeon et al., 2011). In the present study, 90% of culturedDFCs were positive for HLA-ABC, a mesenchymal stem cellsmarker, that has been identified in periodontal ligament (Kawa-nabe et al., 2010) and dental pulp (Yazid, Gnanasegaran,Kunasekaran, Govindasamy, & Musa, 2014) cells. To our knowl-edge, this is the first study demonstrating HLA-ABC positive DFCs.Most of DFCs exhibited low expression of CD90. CD90, CD73 andCD105 constitute a minimal phenotypic pattern for the

Fig. 5. RT-PCR analyses of mRNAs in dental follicle tissue and DFCs at different passages. Genes: GAPDH: glyceraldehyde-3-phosphat-dehydrogenase, OCT4: octamer-bindingtranscription factor 4 and NANOG. C: control, p: passage, T: dental follicle tissue.

Fig. 4. Immunocytochemistry of the DFCs observed by confocal microscopy. The DFCs exhibiting positive staining for: (A) p75, (B) HNK1, (C) a-smooth muscle actin, (D)Phalloidin and Active Notch1, and (E) fibronectin.

126 R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128

identification of MSCs. The variability in the expression of adultMSCs surface markers could be due to different stages during cellproliferation and cultures (Mafi, Hindocha, Mafi, Griffin, & Khan,2011).

Immunocytochemistry reveled that DFCs (roughly 70%),express nestin a neural progenitor cells marker, and b-III-tubulin(about 90%), an early neuronal marker, as previously describe

(Morsczeck et al., 2005; Völlner et al., 2009). It has been reportedthat DFCs are able to differentiate into neurosphere-like cellclusters when cultured in neurogenic induction medium (Völlneret al., 2009). More recently, it has been demonstrated that DFCscombined with treated dentin matrix differentiate into neuron-like cells (positive for b-III-tubulin and nestin) and are able toregenerate dentin-pulp complex (Jiao et al., 2014). These findings

R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128 127

suggest that there are neural stem/progenitor cells in the dentalfollicle at different stages of development. Thus, the humandental follicle can be a promising source of neural stem cells inregenerative therapy. Interestingly, we observed for the first timea small proportion of human DFCs positive for GFAP (approxi-mately 20%). Previously, a study did not detect GFAP in humanDFCs (Völlner et al., 2009) while other identified weak GFAPexpression in murine DFCs after neural differentiation induction(Ernst, Saugspier, Felthaus, Driemel, & Morsczeck, 2009).Conversely, a previous study isolated neural progenitor cellsderived from periodontal ligament and differentiated them into aglia-like cell with a high expression of GFAP (Widera et al., 2007).Despite the conflicting results, we believe that the dental folliclecells when subjected to specific stimulus can differentiate intoglial-like cells, and therefore, may be a useful tool in tissueengineering field. Moreover, our experiments identified for thefirst time that DFCs express moderately p75 (about 50%) andHNK1 (>10%). This suggests the existence of cells with character-istics of undifferentiated neural crest cells in human dentalfollicle. It has been reported, that a small population (>10%) ofhuman periodontal ligament cells express p75 and HNK1. Thosemarkers have been used to identify NCSCs from human adulttissue (Hara et al., 2014) and human periodontal ligament (Couraet al., 2008; Pelaez, Huang, & Cheung, 2013). Neural crest cellsrepresent a good model in stem cell biology they cells migratewidely and contribute to the formation of diverse tissues duringorganogenesis. During odontogenesis, neural crest cells migrateto the dental follicle and it seems that some of them remainundifferentiated within that tissue.

The present study demonstrated that human dental follicle is atissue that contains heterogeneous populations of stem cells,which are derived from mesoderm and ectoderm. Embryonic stemcells, mesenchymal, neural progenitor cells and NCSCs wereidentified. Considering that a large portion of the generalpopulation has impacted third molars, the dental follicle couldbe easily obtained by extraction of impacted teeth. Therefore, theregenerative potentiality of dental stem cells, including DFSCs, hasbeen explored (Rezai-Rad et al., 2015). Moreover, the multipledifferentiation potential of DFSCs has demonstrated by experi-mental studies (Handa et al., 2002; Morsczeck et al., 2005; Völlneret al., 2009). Particularly, the strong osteogenic ability of thosecells, makes them an attractive type of adult stem cell to repairbone defects or bone loss associated with periodontal disease(Rezai-Rad et al., 2015). Furthermore, the neurogenic potential ofsome follicular cells indicates that they may be useful for treatingneurodegenerative diseases based in cell therapy (Völlner et al.,2009). Further in vivo studies will be necessary to evaluate theregeneration potential of those cells and their possible clinicalapplication.

Conflict of interest

Nothing to declare.

Sources of funding

CAPES, FAPERJ and CNPq.

Ethical approval

This study was approved by the Ethics Committee on HumanResearch of the University Hospital Clementino Fraga Filho ofFederal University of Rio de Janeiro (protocol number:06225113.6.0000.5257) and was conducted according to ethicalprinciples for research involving human subjects of the WorldMedical Association (Declaration of Helsinki).

Authors’ contributions

All authors materially participated in the research or articlepreparation. Below all authors will be listed and the contribution ofeach of them in the study will be specified.

Rodrigo Lopes de Lima participated in the conception of theidea, study design drafting of the article, acquisition of data,analysis and interpretation of data, and final approval of the article.

Rosenilde Carvalho de Holanda Afonso participated in criticalreview of the article, data acquisition and final approval of thearticle.

Vivaldo Moura Neto participated in the design of the study,critical review of the article and final approval of the article.

Ana Maria Bolognese participated in the design of the study,critical review of the article and final approval of the article.

Marcos Fabio Henriques dos Santos participated in criticalreview of the article, data acquisition and final approval of thearticle.

Margareth Maria Gomes de Souza participated in the concep-tion of the idea, study design drafting of the article, analysis andinterpretation of data, critical review of the article and finalapproval of the article.

Acknowledgements

The authors gratefully acknowledge the volunteers for partici-pating in this research, maxillofacial surgeons Dr. Albertino Junior,Dr. Marcelo Galindo and Professor Dr. Paulo José Medeiros, andFabio Jorge da Silva for technical assistance. This work wassupported by Coordination for the Improvement of Higher Level –

or Education – Personnel (CAPES, Brazil), Research SupportFoundation of the State of Rio de Janeiro (FAPERJ, Brazil) andNational Council for Scientific and Technological Development(CNPq, Brazil).

References

Aonuma, H., Ogura, N., Takahashi, K., Fujimoto, Y., Iwai, S., Hashimoto, H., et al.(2012). Characteristics and osteogenic differentiation of stem/progenitor cells inthe human dental follicle analyzed by gene expression profiling. Cell and TissueResearch, 350(November 2), 317–331.

Borghese, L., Dolezalova, D., Opitz, T., Haupt, S., Leinhaas, A., Steinfarz, B., et al.(2010). Inhibition of notch signaling in human embryonic stem cell–derivedneural stem cells delays G1/S phase transition and accelerates neuronaldifferentiation in vitro and in vivo. Stem Cells, 28(5), 955–964.

Chen, X., Zhang, T., Shi, J., Xu, P., Gu, Z., Sandham, A., et al. (2013). Notch1 signalingregulates the proliferation and self-renewal of human dental follicle cells bymodulating the G1/S phase transition and telomerase activity. PLoS One, 8(7), 1–10.

Coura, G. S., Garcez, R. C., De Aguiar, C. B. N. M., Alvarez-Silva, M., Magini, R. S., &Trentin, A. G. (2008). Human periodontal ligament: A niche of neural crest stemcells. Journal of Periodontal Research, 43(5), 531–536.

Ernst, W., Saugspier, M., Felthaus, O., Driemel, O., & Morsczeck, C. (2009).Comparison of murine dental follicle precursor and retinal progenitor cells afterneural differentiation in vitro. Cell Biology International, 33(7), 758–764.

Friedenstein, A. J., Piatetzky-Shapiro, I. I., & Petrakova, K. V. (1966). Osteogenesis intransplants of bone marrow cells. Journal of Embryology & ExperimentalMorphology, 16(3), 381–390.

Gronthos, S., Mankani, M., Brahim, J., Robey, P. G., & Shi, S. (2000). Postnatal humandental pulp stem cells (DPSCs) in vitro and in vivo. Proceedings of the NationalAcademy of Sciences, 97(December 25), 13625–13630.

Guo, W., Chen, L., Gong, K., Ding, B., Duan, Y., & Jin, Y. (2012). Heterogeneous dentalfollicle cells and the regeneration of complex periodontal tissues. TissueEngineering Part A, 18(5–6), 459–470.

Guo, S., Guo, W., Ding, Y., Gong, J., Zou, Q., Xie, D., et al. (2013). Comparative study ofhuman dental follicle cell sheets and periodontal ligament cell sheets forperiodontal tissue regeneration. Cell Transplantation, 22(6), 1061–1073.

Handa, K., Saito, M., Tsunoda, A., Yamauchi, M., Hattori, S., Sato, S., et al. (2002).Progenitor cells from dental follicle are able to form cementum matrix in vivo.Connective Tissue Research, 43(January 2–3), 406–408.

Hara, S., Hayashi, R., Soma, T., Kageyama, T., Duncan, T., Tsujikawa, M., et al. (2014).Identification and potential application of human corneal endothelialprogenitor cells. Stem Cells and Development, 23(18) .

Hynes, K., Menicanin, D., Gronthos, S., & Bartold, P. M. (2012). Clinical utility of stemcells for periodontal regeneration. Periodontology 2000, 59(1), 203–227.

128 R.L. Lima et al. / Archives of Oral Biology 73 (2017) 121–128

Ikeda, E., Hirose, M., Kotobuki, N., Shimaoka, H., Tadokoro, M., Maeda, M., et al.(2006). Osteogenic differentiation of human dental papilla mesenchymal cells.Biochemical and Biophysical Research Communications, 342(4), 1257–1262.

Jeon, B.-G., Kang, E.-J., Kumar, B. M., Maeng, G.-H., Ock, S.-A., Kwack, D.-O., et al.(2011). Comparative analysis of telomere length, telomerase and reversetranscriptase activity in human dental stem cells. Cell Transplantation, 20(11–12), 1693–1705.

Jiang, Y., Jahagirdar, B. N., Reinhardt, R. L., Schwartz, R. E., Keene, C. D., Ortiz-Gonzalez, X. R., et al. (2002). Pluripotency of mesenchymal stem cells derivedfrom adult marrow. Nature, 418(6893), 41–49. http://dx.doi.org/10.1038/nature00870.

Jiao, L., Xie, L., Yang, B., Yu, M., Jiang, Z., Feng, L., et al. (2014). Cryopreserved dentinmatrix as a scaffold material for dentin-pulp tissue regeneration. Biomaterials,35(18), 4929–4939.

Kémoun, P., Laurencin-Dalicieux, S., Rue, J., Farges, J.-C., Gennero, I., Conte-Auriol, F.,et al. (2007). Human dental follicle cells acquire cementoblast features understimulation by BMP-2/-7 and enamel matrix derivatives (EMD) in vitro. Cell andTissue Research, 329(August 2), 283–294.

Kawanabe, N., Murata, S., Murakami, K., Ishihara, Y., Hayano, S., Kurosaka, H., et al.(2010). Isolation of multipotent stem cells in human periodontal ligament usingstage-specific embryonic antigen-4. Differentiation, 79(2), 74–83.

Kirchhof, N., Carnwath, J. W., Lemme, E., Anastassiadis, K., Schöler, H., & Niemann, H.(2000). Expression pattern of oct-4 in preimplantation embryos of differentspecies. Biology of Reproduction, 63(December 6), 1698–1705.

Le Douarin, N. M., Creuzet, S., Couly, G., & Dupin, E. (2004). Neural crest cell plasticityand its limits. Development, 131(October 19), 4637–4650.

Mafi, P., Hindocha, S., Mafi, R., Griffin, M., & Khan, W. S. (2011). Adult mesenchymalstem cells and cell surface characterization – A systematic review of theliterature. The Open Orthopaedics Journal, 5(Suppl. 2), 253–260.

Miura, M., Gronthos, S., Zhao, M., Lu, B., Fisher, L. W., Robey, P. G., et al. (2003). SHED:Stem cells from human exfoliated deciduous teeth. Proceedings of the NationalAcademy of Sciences, 100(May 10), 5807–5812.

Morsczeck, C., Götz, W., Schierholz, J., Zeilhofer, F., Kühn, U., Möhl, C., et al. (2005).Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth.Matrix Biology, 24(2), 155–165.

Nanci, A. (2013). Ten cate’s oral histology: Development, structure, and function, 8th ed.St. Louis: Mosby.

Nolla, C. M. (1960). The development of the permanent teeth. Journal of Destistry forChildren, 27, 254–263.

Okumura-Nakanishi, S., Saito, M., Niwa, H., & Ishikawa, F. (2005). Oct-3/4 and sox2regulate oct-3/4 gene in embryonic stem cells. Journal of Biological Chemistry,280(February 7), 5307–5317.

Olteanu, D., Filip, A., Socaci, C., Biris, A. R., Filip, X., Coros, M., et al. (2015).Cytotoxicity assessment of graphene-based nanomaterials on human dentalfollicle stem cells. Colloids and Surfaces B: Biointerfaces, 136, 791–798.

Park, B.-W., Kang, E.-J., Byun, J.-H., Son, M.-G., Kim, H.-J., Hah, Y.-S., et al. (2012). Invitro and in vivo osteogenesis of human mesenchymal stem cells derived fromskin, bone marrow and dental follicle tissues. Differentiation, 83(5), 249–259.

Park, B.-W., Jang, S.-J., Byun, J.-H., Kang, Y.-H., Choi, M.-J., Park, W.-U., et al. (2014).Cryopreservation of human dental follicle tissue for use as a resource ofautologous mesenchymal stem cells. Journal of Tissue Engineering andRegenerative Medicine. http://dx.doi.org/10.1002/term.1945.

Pelaez, D., Huang, C., & Cheung, H. (2013). Isolation of pluripotent neural crest-derived stem cells from adult human tissues by connexin-43 enrichment. StemCells and Development, 22(21), 2906–2914.

Ponnaiyan, D. (2014). Do dental stem cells depict distinct characteristics –Establishing their phenotypic fingerprint. Dental Research Journal (Isfahan), 11(2), 163–172.

Rezai-Rad, M., Bova, J. F., Orooji, M., Pepping, J., Qureshi, A., Del Piero, F., et al. (2015).Evaluation of bone regeneration potential of dental follicle stem cells fortreatment of craniofacial defects. Cytotherapy, 17(11), 1572–1581.

Rizzino, A. (2009). Sox2 and Oct-3/4: A versatile pair of master regulators thatorchestrate the self-renewal and pluripotency of embryonic stem cells. WileyInterdisciplinary Reviews: Systems Biology and Medicine, 1(2), 228–236.

Seo, B.-M., Miura, M., Gronthos, S., Mark Bartold, P., Batouli, S., Brahim, J., et al.(2004). Investigation of multipotent postnatal stem cells from humanperiodontal ligament. The Lancet, 364(9429), 149–155.

Sherley, J. L. (2002). Asymmetric cell kinetics genes: The key to expansion of adultstem cells in culture. Stem Cells, 20(6), 561–572.

Simmons, P., Gronthos, S., Zannettino, A., Ohta, S., & Graves, S. (1994). Isolation,characterization and functional activity of human marrow stromal progenitorsin hemopoiesis. Progress in Clinical and Biological Research, 389, 271–280.

Sonoyama, W. Y. T., Gronthos, S., & Shi, S. (2007). Multipotent stem cells in dentalpulp. In R. Freshney, G. Stacey, & J. Auerbach (Eds.), Culture of human stem cells(pp. 368Wiley-Interscience.

Ten Cate, A. R. (1997). The development of the periodontium – A largelyectomesenchymally derived unit. Periodontology 2000, 13(1), 9–19.

Ulmer, F., Winkel, A., Kohorst, P., & Stiesch, M. (2010). Stem cells – Prospects indentistry. Schweiz Monatsschr Zahnmed, 120(10), 860–883.

Völlner, F., Ernst, W., Driemel, O., & Morsczeck, C. (2009). A two-step strategy forneuronal differentiation in vitro of human dental follicle cells. Differentiation, 77(5), 433–441.

Widera, D., Grimm, W., Moebius, J., Mikenberg, I., Piechaczek, C., Gassmann, G., et al.(2007). Highly efficient neural differentiation of human somatic stem cells,isolated by minimally invasive periodontal surgery. Stem Cells and Development,16(3), 447–460.

Yazid, F., Gnanasegaran, N., Kunasekaran, W., Govindasamy, V., & Musa, S. (2014).Comparison of immunodulatory properties of dental pulp stem cells derivedfrom healthy and inflamed teeth. Clinical Oral Investigations, 18(9), 1–10.