BIOLOGY 204/205 Advanced Genetics LaboratoryTABLE OF CONTENTS

Introduction and Pipetting (First Day of Class)…………………………….. p. 2-11MODULE 1: Recombinant DNA……………………………………………………. p. 129MODULE 2: Gene Expression…………….…………..……………………………. p. 263Appendix A: Solutions Guide……………..……………………………..………... p. 363Appendix B: Sterile Technique…………………………………………..……….. p. 452 Appendix C: Spread Plate Technique………………………………..………... p. 452Appendix D: Pipettor Use……………………..…………………………..……...... p. 463Appendix E: GST Plasmid Map……………………………...……….………..... p. 485Appendix F: DNA/Protein Markers…………………………………..……...... p. 4946Appendix G: Streak Plate Method …………………..………………..…....... p. 5047Appendix H: PCR Reagents and Conditions for 1.17………….………… p. 5148Appendix I: Southern Blot Setup.…………………………………….……….… p. 5249Appendix J: Protein Gel Setup.…………………………………………..…….… p. 530Appendix K: Protein Gel Running Setup……………………………..….….. p. 541Appendix L: Pierce Protein Assay Practice Run………………………….. p. 552Appendix M: Pierce Protein Assay for Module 2……………………..... p. 563Appendix N: Excel Graphing Instruction………………………………….... p. 574Appendix O: RPM to G-force Conversions……………………………….... p. 585

1

Biology 204/205 Advanced Genetics Laboratory --- Introduction ---

Biology 204 is a four credit course. You will complete experiment Modules 1 & 2, develop a hypothesis and specific aims for a research projects, make a class presentation during the fall semester for Bio 204, and write a laboratory report.

The emphasis of Bio 204 is on experimental design, techniques, data gathering and analysis. Work at the bench is given priority over work in a lecture setting. The modules are designed to approach real situations in ongoing research projects. Therefore, the modules are not necessarily designed to be finished in three hours. A few labs will run long, taking 5-6 hours to finish. A few labs will be relatively short. Students are expected to return to lab outside of the scheduled class time, usually at their own convenience, to perform short manipulations. Sometimes an experiment does not work and it has to be repeated. Coming to class well prepared and following directions carefully will cut down on potential mistakes!

Module 1 Recombinant DNA/Bacterial TransformationThis module gives you some of the experience you would receive if you were to sub-clone a gene as a part of your research. That is, once you transform a bacterial line with the plasmid that you isolate, you will need to demonstrate that you have made the transfer of the correct gene.Goals:

1. To purify a plasmid and transform E. coli with the plasmid.2. To demonstrate that the transformants carry the plasmid by characterizing the

transformants’ phenotypes. 3. Analyzing the size of the DNA plasmid in a cracking gel. 4. Hybridization with the original plasmid in a Southern blot.5. Amplify the gene inserted into the plasmid by PCR.6. Sequence part of the plasmid.

Module 2 Gene ExpressionThis module allows you to determine if a cell is expressing a gene of interest, GST. You will run the bacterial lysate on gels, stain with Coomassie blue to look for a protein of the correct size and perform a Western blot to determine whether the protein of interest was expressed.Goals:

1. Confirm, using PCR, that the plasmid from the transformed bacteria (from module 1) has the GST gene.

2. Show that bacteria with the gene for GST in the expression plasmid are expressing GST using gel electrophoresis of the bacterial lysate.

3. Show that GST is expressed by the bacteria using a Western blot of the lysate.

2

GradingYour grade will be based on the following components, each with approximately equal weight. Each of these class components is further discussed in detail in the pages to follow:

1. Performance in laboratory 2. Discussion of experiments in class3. Notebook (these will be checked weekly) 4. Laboratory report

50% of this grade is the rough draft, 50% for the final report5. Mini-Grant writing exercise

Be sure to hand in the different components on time, i.e. Selecting a question, hypothesis and major references, etc. (See schedule, late penalties apply).

The mini-Grant is very important as it is directly related to the presentation. 6. Evaluation of Presentation of Hypothesis and Specific Aims

Quality of presentation and the slides:a. Spoken Explanationsb. Coordination between pair members (if applicable)c. Hypothesis and specific aimsd. Methods and approach to test hypothesis (for proposal exams)

Slides for Presentation must be submitted by 2pm on the assigned date. 10% will be deducted from grade for late Presentations.

*Note*: 10% will be deducted from grade per day for late assignments (i.e. – each day it is late, another 10% is deducted).GradingYour grade will be based on the following components, each with approximately equal weight:

[1.] Performance in laboratory (see details below)[2.] Discussion of experiments in class[3.] Notebook (these will be checked weekly) [4.] Laboratory report (see below)

50% of this grade is the rough draft, 50% for the final report[5.] Hypothesis and Specific Aims for a research project[6.] Evaluation of Presentation of Hypothesis and Specific Aims

Quality of presentation and the slides:[a.] Spoken Explanations[b.] Coordination between pair members (if applicable)[c.] Hypothesis and specific aims[d.] Methods and approach to test hypothesis (for proposal exams)

Slides for Presentation must be submitted by 2pm on the assigned date. 10% will be deducted from grade for late Presentations.

3

*Note*: 10% will be deducted from grade per day for late assignments (i.e. – each day it is late, another 10% is deducted).

Performance in Laboratory Guidelines1. Accuracy and quality of results.2. Lab Citizenship includes:

a. Arriving on time and staying until work is complete.b. Coming in willingly outside class hours when necessary.c. Following the safety rules, cleaning up, labeling properly, putting materials away,

etc.3. Working well and cooperatively with lab partner(s)4. Reading the lab manual in advance and arriving prepared for the day’s methods

a. Working efficientlyb. Following through

5. Attitude and willingness to participate in experiments

*Note*: It is important to read over the procedures in the laboratory manual before coming to class. Be prepared to start work ONLY after an introduction by the instructor or TA. Check the laboratory calendar so that you know when each module will occur.

Laboratory Notebook Guidelines Bound notebook; no loose-leaf Record in blue or black ink – you may not photocopy/print and paste in the lab manual Number all pages Date all entries Name, course number and email address should be on front cover Reserve 3 pages at the beginning for the table of contents; keep up to date Mistakes should be crossed out with a single line through the entry then initialed Do not skip pages, do not rip pages out Unused portions of a page should have a diagonal line drawn through the blank portion Each experiment should begin on a new page All data, calculations and graphs should be entered directly into the notebook Neat, orderly, complete

Your notebook should provide enough detail so that another Advanced Genetics student could pick it up and repeat your procedure by following your entries. You should include all of the following information:

o What was done and whyo Who suggested it/who did it and when it was done

4

o What results were obtained o What conclusions were drawn

Laboratory Report GuidelinesYou will be asked to write a formal report of one of the results from one of the lab modules. You will prepare this report as you would prepare a manuscript for publication, with introduction, methods, results, and discussion sections. To aid in your preparation of this report, you should go to the library early in the semester and find a short article from Genetics from the last 5 years (download a pdf version or photocopy from a paper journal, the library has both formats). The format in Genetics is appropriate for your report. Below is a description of the content and length of each section.

The report in its entirety should not exceed 10 pages in length. It should be printed double-spaced, with no less than 1-inch margins. The abstract and methods section may be single spaced. It must be in 12-point size in a common font. Each section, except the introduction, should be started by its section name in bold type. At the head of the report, you should provide a title that indicates which exercise you are writing about and your name. Whenever possible, you should strive to write succinctly and in the active voice. Please include page numbers.

Abstract: 250 words summarizing the experiment (single spaced).

Introduction: The introduction provides an overview of what the report is about, including why the exercise was done (the goal of the exercise) and an explicit statement of the hypothesis or hypotheses being tested. Background information about the biology underlying the exercise should be included in the introduction. Recommended length: 1.5 pages, double-spaced.

Methods: The methods section must be detailed enough to allow the reader to repeat the exercise. You do not need to repeat the detailed description of the protocols in the laboratory manual, but you should refer to the methods in the manual (Format: Laboratory manual Page x-y) at the appropriate points. Recommended length: 3 pages, can be single spaced.

Results: The results section reports upon what happened during the exercise. You must include images of the final gels and provide in tabular form other measurements and data you collected. Each figure should have a number (Figure X.), a brief descriptive caption, and each table should have a title (Table X.). However, it is not sufficient to simply insert these figures and tables. You must interpret your results in the text of the section, with references to the appropriate figure or table (Format: Fig. 1, Table 2A). Recommended length: 2 pages, double spaced. Figures and Tables should be inserted in the text.

Discussion: In the discussion, you should briefly re-introduce the main goal or hypothesis presented in the introduction, then describe how your results are related to the goal or

5

hypothesis. In subsequent paragraphs, you should discuss any failures to obtain results, and describe what you believe happened and what you would do differently to correct each problem. This is your opportunity to show how well you understand the molecular processes underlying the protocols! Recommended length: 2 pages, double spaced.

Grant Proposal Writing Guidelines

The grant proposal should be based upon a novel concept that could be explored in a small laboratory based on the following topic area:

2015 - MicrobiomeYou should read about this topic and develop a research question and hypotheses to test. This is the basis for your proposal.

A. Research Question: The question you chose should be novel, which means that no one else has worked on the exact same question before. You should be able to put your question and topic into a broader context. Meaning, that you should explain why this is this an interesting question/problem and what is the greater significance? Also, what has already been done with this topic and question in the past?

1. You should develop a testable hypothesis or hypotheses. This allows you to develop an experiment or a series of experiments that will result in data that lead you to clearly accept or reject your hypothesis over the course of an academic year (9 months).

2. The experiment(s) must utilize molecular genetic or traditional genetic techniques.

3. If you are currently working in a laboratory outside of this class, you MUST choose a topic and question that is independent of that laboratory. You are not to work on a topic that is related to your outside research.

6

4. You will be working individually, therefore you are encouraged to discuss your proposal and progress with your lab partner, other groups, and individuals outside of the lab.

5. Your final exam will be to present your proposal to the class in a Powerpoint presentation that will be no more than 10 minutes in length briefly describing and defending your proposal.

B. Model Organism: You should plan on using model organisms for your study. These organisms are readily available and are commonly used in molecular and traditional genetics. Organism examples would be: Drosophila, bacteria, yeast, Paramecium, Tetrahymena, Chlamydomonas, zebra fish, plants, sea grass, etc. Do not propose to use mammals like mice.

C. Grant Proposal Format: Below is the format that you must follow. All text must be single spaced. You must use 12 point font that is: Arial, Times New Roman, Book Antiqua, Calibri, or Garamond. Margins should all be 1”. Be sure to include all of the information within the guidelines below:

1. Cover Page – (Page 1) Available on the web page, link from “NIH Forms” – use “Page 1 – Face Page”. Provide the necessary information.

2. Summary/Relevance – (Page 2) Available on the web page, link from “NIH forms”- use “Form page 2 – Summary/Relevance.” This is your Project Summary, or abstract. It must not exceed 250 words describing the significance and include (briefly) background, question, hypotheses, and specific aims (see below). Also, the experimental approach you will use. Below the abstract is “Relevance”. Here, you should write one or two sentences explaining concisely the impact on the field, biomedical research, and human health.

3. Table of Contents – (Page 3) This page should contain the page number of each category, as it is the Table of Contents. Provide the title and page number of each section. Please be sure all page numbers are on the bottom right.

4. Biographical Sketch – (Page 4) Again, please use the template available through the web page, “NIH Forms” – “General Biosketch.” This contains the name of the Principle Investigator (PI), which is you! You should include your education history (high school, college, etc). Any previous relevant employment should be included and a brief description of your prior experiences. The prior experiences and employment are meant to allow the reviewer to recognize that you are capable of doing the research you are proposing.

5. Specific Aims – (Page 5) Limit = 1 page! Start this section with a short paragraph describing your topic area, your question, and the significance of your question to the field and biomedical research (similar to your abstract). Then state your hypotheses followed by the specific aims and the experiments that will help you achieve those aims. Remember, each specific aim should directly address/test a component of your hypothesis. Your reviewer should be able to understand your intentions. Also, if a specific aim turns out to fail to produce the results you predicted, it should not destroy your entire study. The goal of the specific aims is to organize the experiments that will be used to test the

7

hypotheses. Be sure to list the broad long-term goals of the research and present the proposed project’s relationship to these goals.

6. Research Plan – (Pages 6 - 15) The limit is 10 pages for this section. The research plan should contain sufficient information needed for the reviewer to evaluate your project without any other documentation. You should be specific and informative – avoid redundancies! Please include tables, graphs, figures, charts, etc. as you write. These must be part of your 10 page limit. A more detailed breakdown of how this section should be organized will follow. You should follow these general guidelines for organization of this section:

i. Discuss the background research that has already been done in the field and the significance of the work you are proposing.

ii. State your hypotheses and the experiments you will perform. These should be organized based on your specific aims (above).

1. Be sure to include the necessary controls.2. What statistical tests will you use to analyze your data?

iii. For each set of experiments, state what results you expect. How do your results shed light on your hypotheses? What are some difficulties your might encounter? Are there alternative methods you can use in case your first experimental approach does not work?

iv. You should include a time line to show you expect the experiments to flow over the nine months.

v. Images are helpful to explain complex topics. Feel free to use images from the internet, text books, articles, etc. Just be sure to include a citation.

7. Literature Cited – (Very end – no page limit) All references cited within the proposal must be listed alphabetically by first author at the end of the proposal. You should have many references. An example citation is shown here:

Citation in text: (Yano et al., 2013).Literature cited:

Yano, J., Rajendran, A., Valentine, M. S., Saha, M., Ballif, B. A., & Van Houten, J. L. (2013). Proteomic analysis of the cilia membrane of Paramecium tetraurelia. J Proteomics, 78, 113-122.

Works cited should include all authors, date of publication, the complete title of the article, the complete journal name (I will accept “J” in place of “Journal”, as shown above), volume, and page numbers. Do not cite websites! You may cite on-line publications, books, or journal articles, but not websites.

Organization of the Research Plan:a) Specific Aims: Clearly state your hypotheses and then list the Specific Aims of your

research that will test the hypotheses. The Specific Aims should organize the experiments that you will use to test the hypothesis. Be sure to list/include the long-term goals of the research and then present the proposed project’s relationship to these goals. This section should not exceed one page.

b) Background Information: Summarize the major research that has been done on this topic leading to your proposal. Critically evaluate existing knowledge, and specifically

8

identify gaps in the current knowledge. State where your research will fit in with what has been done previously. What new information does your research hope to discover? This section should not exceed two pages.

c) Research Design and Methods: Describe the overall research design and specific procedures to be used. Include how the data will be collected, analyzed and interpreted. For each set of experiments, discuss the potential difficulties and limitations of the proposed procedures. Include alternative approaches to achieve the aims. Provide a timeline for the project, not to exceed nine months. This section should not exceed six pages.

d) Possible results: In terms of the hypothesis/hypotheses you are proposing to test, state what the results are expected. Which possible results will cause you to accept your hypotheses/hypothesis? What possible results will cause you to reject your hypothesis/hypotheses? What are the limitations that may not allow you to have a clear answer? Are there alternate approaches in case your approach fails? This section should not exceed one page.

When you apply for a grant through the NIH (National Institutes of Health), the following criteria are used to evaluate grant proposals:

I. Significance to Biomedical Research.II. Innovation – what is new and has not been done before.

III. Investigators qualifications and research environment.IV. Research Design – this is the most important.

You can read more by going to the NIH website. These instructions were modified from the NIH guidelines for a PHS 398 application for the US Department of Health and Human Services Public Health Grant.

http://grants.nih.gov/grants/funding/phs398/phs398.html

Safety in the Laboratory

9

General Rules:1. Disinfect your bench top with a 10% bleach solution when you arrive and when you

finish lab each day.2. Wear gloves and avoid touching face and/or hair during an experiment. 3. Wash your hands before you leave lab.4. Do not eat, drink, smoke, chew gum or apply cosmetics while in lab.5. Dispose of all used materials as directed.6. Keep aisles clear – push in chairs.7. Wipe all spills immediately. Inform lab tech and/or TA if you spill ANYTHING.8. Dispose broken glass in the appropriate receptacle. Inform lab tech and/or TA that you

have broken glass.9. Wear long pants and closed-toed shoes.10. Tie back long hair.11. Avoid wearing baggy, loose clothing or accessories that can interfere with your

experiment and/or may catch on fire. 12. Extinguish burners as soon as you finish using them.13. All Chemical Safety and MSDS information is located in the binder on the back of the

door.14. If you are unsure about a procedure, Please ask. 15. Cell phones, tablets, iPads, etc are to be only used in the hallway. Please leave cell

phones outside the lab room. Points will be deducted for using cell phones and devices in the lab.

10

Laboratory Exercise for First Day of Lab: Pipetting

Background:1. Acquaint yourself with the various denominations of pipettors in an attempt to avoid

mistakes, particularly when working under time pressure. (See appendix D).

2. The height of the fluid in the glass pipettes is measured at the bottom of the meniscus while the pipette is being held vertically.

3. Never put a pipette back into a sterile container.

4. Do not handle the lower part of the pipette.

Serial Dilutions: Serial dilutions allow you to dilute a sample many fold by making a series of small dilutions.

Standard Dilution Steps: Unless special circumstances demand it, the following are the only dilution steps that are used (For convenience and error avoidance in performing the accompanying arithmetic): 10, 20, 50 and 100.

10X 1:10 0.1 ml/0.9 ml 100 µL/900 µL

20X 1:20 0.1 ml/1.9 ml 50 µL/950 µL

50X 1:50 0.1 ml/4.9 ml 20 µL/980 µL

100X 1:100 0.1 ml/9.9 ml 10 µL/99 0µL

Pipette ExercisesPipette Exercise #1Determine and record the pipettor(s) best suited for each of the measurements listed below.

Volume Pipettor(s) Volume Pipettor(s) Volume Pipettor(s)10 µL 25µL 0.0963 ml2 µL 0.015 ml 183 µL598.6 µL 0.200 ml 201.4 µL

Pipette Exercise #2Practice Pierce Protein AssayUse the chart provided (Appendix L) to develop a standard curve using BSA standards and to determine your unknown protein concentration. Perform the following procedure in duplicate!

11

(You will run two sets of protein assays and average the OD values to calculate the protein concentrations.)

1. Obtain unknown protein samples from your TA. 2. Add BSA and dH2O according to the directions in Appendix L.3. Make dye solution: Use Solutions A and B from the Pierce Protein Assay Kit. They should

be mixed 50:1…but make up only the amount you will need plus 2 ml extra. Mix the dye in a 50ml centrifuge tube.

4. Add 2ml of the dye to each one of your samples and standards.5. Incubate at 37C for 30 minutes. 6. Get OD values for standards and samples: TA will assist in the operation of the spec. 7. Place your standard into a clean cuvette.

To clean the cuvette, rinse with dH2O. Make sure to dry the outside of the cuvette with a Kimwipe. Handle the cuvette only on the frosted sides.

8. Read OD at 562nm. 9. Repeat for each standard and unknown sample, including duplicates.

If only using 1 cuvette, make sure to rinse with dH2O between each standard.10. Once the standards are complete, read your samples. If using only 1 cuvette, make sure

to rinse with dH2O between each sample.11. Find the average of the ODs for the standard and sample duplicates.12. Establish a standard curve using the OD values obtained with your BSA (Alb)

standards: graph Concentration (x-axis) vs. OD (y-axis) on the computers. Do not forget to label your axes. Insert a best fit line and using the line equation, calculate the unknown protein concentrations in your samples.

13. Use Excel to plot your data on a second chart (This is homework). Make sure to paste your Excel chart in your notebook properly labeled (See Appendix N for graphing help).

Pipette Exercise #3Using the p1000 and the p200 pipettors, perform the following:

Set the pipettor to its maximum volume. Using water at room temperature, carefully pipette the water onto a weigh boat that

you have tared (re-zeroed). Room temperature water has a density of approximately 1 gm/ml or 1 g/L.

Therefore, you can determine the accuracy of your pipetting, e.g., 1000 L of water will weigh 1gm. Repeat the pipetting until you feel that you are reasonably accurate. Then record the weights of five successive pipettings. Determine the mean and standard deviation associated with your measurements.

Complete the following conversions:1L =_______ml 0.001L =________ml10L =_______ml 0.11L =________ml100L =_______ml 0.01L =________ml1000L =_______ml 1L =________ml

12

Module 1 Recombinant DNA

Please refer to page 2 for introduction

**Note: The E.coli cell line used in this module is K12. The K12 bacteria cells are to be transformed with the GST plasmid.

1.0 Overnight (ON) Bacterial Culture (Done for you) 1. The lab tech will add 2.5 ml of cells previously grown ON to 125 ml LB amp medium (per

group).2. The cells will grow with shaking at 37C ON.

1.1 Isolation of Plasmid DNA HAZARDOUS CHEMICAL INFO: -Salt-Saturated Phenol (SS Phenol) is to be used only while wearing gloves under the hood. Dispose of all pipets and liquid waste containing SS Phenol in appropriate disposals. -Chloroform: Isoamyl Alcohol (24:1) (C:IA) is to be used only while wearing gloves under the hood. Dispose of all pipets and liquid waste containing C:IA in appropriate disposals.

1. Transfer 100ml of the overnight bacterial culture (Transformed E. coli) to a large, sterile, screw top centrifuge bottle and harvest the bacteria by centrifuging at 5000 rpm, 4°C for 10 minutes in the Beckman J2-21.

2. Decant the supernatant broth into the waste jar.3. Resuspend the bacterial pellet in 5ml of Solution I containing 5mg/ml lysozyme.4. Transfer to a 30ml polycarbonate screw top Oakridge centrifuge tube. Let stand at

room temperature for 5 minutes.5. Add 10ml of freshly made Solution II. Place the cap on the tube and mix the contents by

inverting the tube several times. Mix gently. Let stand on ice for 10 minutes.6. Add 8ml of ice-cold 5M potassium acetate (pH 4.8). Fill tubes only ¾ full (total 22 – 23

mls). Screw on the cap and mix by inverting. Let stand on ice for 30 minutes.7. Balance the tubes before centrifugation.8. Centrifuge in the Beckman J2-21; 15,000 rpm, 4°C for 20 minutes. The genomic DNA

and bacterial debris should form a tight pellet at the bottom of the tube. 9. Being very careful not to disturb the pellet, divide the supernatant in half using the 10ml

Pipet. Only take clear supernatant. Transfer all the supernatant to one 30ml glass screw top tube.

10. Add at least 1 mL of heat treated RNase A to each tube. Please use all of the RNase A provided.

11. Incubate at 37ºC for 10 minutes in Innova 4000 then invert 2 to 3 times. Incubate and additional 10 minutes in the Innova 4000.

12. In the chemical flow hood, add one volume of SS phenol using glass pipettes. (Note the yellow color which helps you identify the phenol phase in the next step.) Your tubes can

13

be no more than 2/3 full (total 12mls) including the addition of the phenol, so divide your original solution as necessary into 3 or 4 conical tubes, using glass pipettes. SAFETY NOTE: Phenol can cause severe burns to skin and damage clothing. Gloves, safety glasses, and a lab coat should be worn when working with phenol. All manipulations should be carried out in a fume hood. A glass receptacle is available exclusively for disposing of used phenol and chloroform.

13. Vortex the conical tube and contents with lids on for 1 minute; be sure the contents are thoroughly mixed. Make sure the tops of the conical tubes are screwed on tightly to ensure that no leaking will occur. Centrifuge for 1 minute at 2800 rpm using the Bench top Eppendorf Centrifuge 5702.

14. Transfer the non-colored upper, aqueous phase to a fresh conical tube. Do not take the interface which is denatured protein. In the hood, add 1 volume of chloroform: isoamyl alcohol (24:1) – the same amount as the phenol you added. Vortex 1 minute and centrifuge 1 minute at 2800 rpm.

15. Transfer the upper, aqueous layer to a fresh 30ml glass tube and add 2.5 volume of cold 95% ethanol, using glass pipettes. You need to calculate how much total liquid will be in each 30ml glass tube. The tube cannot be more than 2/3 full( total 20mls), so you may have to use more than one 30ml glass tube. Make your calculations before adding the ethanol!

16. Mix and allow it to precipitate in the -80o freezer overnight.Next Day (This will take you 1.0 to 1.5 hoursXXX amount of time to complete.– plan accordingly)

17. Balance your tubes along with their rubber sleeves.18. Recover the DNA by centrifuging the tube at 4°C in the Beckman J2-21 at 9500 rpm for

30 minutes. 19. Discard the supernatant into a waste container. The pellet will look like a whitish residue

on the side of the tube. 20. Resuspend the pellet with 1 ml 70% ethanol by pipetting up and down onto the sides of

the tube. Try to resuspend the entire pellet to increase your plasmid yield. Transfer the resuspension from the first tube to the next tube until all pellets are resuspended and pooled together. Transfer the solution into one sterile 1.5ml microfuge tube.

21. Microcentrifuge for 5 minutes at 14,000 rpm. Pipet out the ethanol; add 1ml more of 70% ethanol to wash the pellet and vortex for 30 seconds. Spin at 14,000 rpm for 5 minutes.

22. Discard the ethanol; dry the pellet using the SpeedVac in the basement. Give your sample to the TA/Lab tech to be properly dried for 15 – 20 minutes.

23. Dissolve the pellet in 0.3ml TE. Aliquot 100 L to each of 3 microcentrifuge tubes (properly labeled With Group, Content and date).

24. Store at -20°C.

1. 2 Agarose gel to confirm isolation of the plasmid HAZARDOUS CHEMICAL INFO:-Ethidium Bromide is an extremely toxic carcinogen. WEAR GLOVES when handling, and dispose of everything that has contacted EtBr in the appropriate solid waste container.

14

-UV light is very harmful if looked at directly. When viewing your gels on the UV light box be sure to wear a protective face mask, or place the shield on top of the box before turning on light.

1. Prepare 300ml 1X TAE from 5X TAE stock.2. Dissolve 0.35g agarose in 50ml 1X TAE buffer to make a 0.7% gel.3. Microwave on high for 1 minute.4. Swirl the flask and make sure all of the agarose is dissolved. If not, microwave until it is.

Remove flask with a hot mitt. 5. Place the running tray into the gel-casting tray. Add comb. 6. Cool agarose slightly; approximately 5 – 10 minutes, swirling occasionally. Before

pouring, swirl the agarose and slowly pour into the farthest corner from the comb in the gel casting set up. Try to avoid bubbles! If bubbles appear remove them with a pipette tip. Let cool until opaque (approximately 20 minutes).

7. While your gel is setting, thaw out one tube of your plasmid DNA on ice. Just before you are ready to load the gel, heat the λ Hind III marker for 7 minutes in the 65°C hot block then place on ice immediately.

8. Once your gel is set, remove it from the casting tray. Place it in the running tray, with the comb still set. Cover the gel with 1X TAE. Gently remove the comb. Removing the comb last will ensure that your wells do not collapse.

9. Mix 4µL of 6X DNA sample buffer with 20µL plasmid DNA on a piece of Parafilm.10. Be prepared to load the gel quickly—you do not want your DNA to diffuse into the

running buffer.11. Load 24µL of plasmid DNA sample and 20µL of λ Hind III marker in the wells; put the lid

on the box so that the DNA will run toward the red electrode. 12. Run the gel at 100V for ~1 hour.13. Stain the gel for approximately 15 minutes in ethidium bromide, and destain in water

for 5 minutes.14. Examine the gel on the UV light box. If the ladder is not visible or is faint, place the gel

back into the stain. When you feel that your gel is properly stained, take a picture to document your results.

15. Leave the gel in destain to be discarded later. 16. Rinse electrophoresis unit with RO water after use so the buffer does not dry on the

electrodes.

1.3 Grow an overnight broth culture of E. coli ( Done for you)

1.4 Transformation Three hours before class the tech will take 1 ml of an ON culture and inoculate 50 ml of fresh LB broth with it. It will shake at 37C for three hours. This will produce cells in exponential growth for you to transform.

1. Divide broth culture into 2 sterile 30ml screw top Oakridge centrifuge tubes; place tubes

15

in ice for 30 minutes. 2. Thaw out one tube of your plasmid DNA on ice.3. Centrifuge the cultures at 4°C in the Beckman J2-21 for 10 minutes at 5000 rpm; decant

the supernatant into the collection flask provided.4. Resuspend one pellet in 25 ml ice cold 50 mM CaCl2. Combine this resuspension

solution with the second bacterial pellet; place on ice for 20 minutes. Keep CaCl2 on ice while waiting.

5. Centrifuge the cell suspension at 4°C in the Beckman J2-21 for 10 minutes at 5000 rpm.6. Decant the supernatant and resuspend gently the pellet in 3ml ice-cold 50 mM CaCl2;

place on ice for 5 minutes.7. Dispense 2 aliquots of 0.3 ml cells in ice-cold 1.5ml microfuge tubes; add 0.2 ml of

transformation buffer to each tube. Save remaining competent cells at 4°C.8. Add 5 µL plasmid DNA to one tube. The second tube will not contain plasmid DNA and

will act as a control. Mix gently and leave on ice for 20 minutes. 9. Heat shock cells for 1 min in 42°C water bath.10. Plunge tubes into ice and let sit on ice for 5 minutes. 11. Add 0.7 ml LB to each tube and tap gently with finger.12. Shake at 37°C for 60 minutes in Innova 4000.

**NOTE: during this hour incubation your TA or Lab Tech will demonstrate proper spreading and streaking procedures for plating. It is very important that you understand sterile technique when working with bacteria so you don’t contaminate your samples.

13. Plate 0.05, 0.1, and 0.3 ml of the cells with plasmid DNA onto LB amp plates. Use the spread plate technique. Let the plates dry for 5 minutes right-side up before inverting and placing in the incubator.

14. Streak (Do not use the spread plate technique – See Appendix G) the contents of the “no DNA tube” on an LB amp plate and an LB plate. The LB amp plate will act as a negative control, while the LB plate will serve as a positive control.

15. Label plates appropriately with group number, date, type of bacteria, and any other important information, such as how much bacteria was plated.

16. Incubate the plates at 37°C overnight (upside down); be sure to remove, wrap in Parafilm and refrigerate the plates tomorrow!

Following Day: 1.5 Selecting for bacteria that carry the plasmid___1. Examine transformed and no DNA control plates. (There should be no colonies on the

“No DNA” LB amp plate).2. Choose 6 well isolated colonies from the transformed plates. Streak each colony on half

of an LB amp plate. 3. Choose 2 well isolated colonies from the control (non-transformed) plate provided.

Streak each colony on one half of an LB plate.4. Incubate the plates overnight at 37°C.5. Wrap the old plates in Parafilm and refrigerate.

16

1.6_Secondary selection of transformed bacteria_________________ 1. Transfer 4 well-isolated colonies from 4 different transformed streaks and 2 control

colonies into separate 1ml aliquots of sterile saline. Refrigerate the old plates.2. For the transformed bacteria, streak 1 loopful of saline/bacteria suspension onto ½ of

an LB amp plate. Do this for each of the 4 samples.3. For the control cells, streak 1 loopful of the saline/bacteria suspension onto ½ of an LB

plate. Be sure to label plates clearly!4. Incubate at 37°C overnight; remove and refrigerate the next day.5. Go to 1.16

1.7 Preparing bacteria for the cracking gel (day before 1.8) 1. Using a marker, draw a line down the center of a new LB amp plate. Make a template on

paper with 1.5 cm x 1.5 cm squares on each half. Place the plate over the template.2. Use a loop to cover the square with bacteria.3. Choose 2 LB amp plates from Day 1.6 that show the best growth. With the toothpick,

select one colony from the Day 1.6 plate and “fill in” the square on the agar on the plate. Repeat for the 2nd colony using a new toothpick.

4. Repeat the procedure for the control, but use a fresh LB plate.5. Incubate at 37°C overnight for at least 24 hrs, but less than 36 hrs. 6. Place old plates in 4o cold room.

1. 8 Next day: Cracking gel HAZARDOUS CHEMICAL INFO:-Ethidium Bromide is an extremely toxic carcinogen. WEAR GLOVES when handling, and dispose of everything that has contacted EtBr in the appropriate solid waste container.

1. Make 300ml 1X TAE.2. Prepare 0.7% agarose gel.3. Use a sterile toothpick to scrape bacteria from the plates prepared the day before. Add

bacteria from one square to 250µL of cracking buffer (Two squares for one tube of 250µL of cracking buffer). Do this for transformed and non-transformed cells (you should have a total of 2 microcentrifuge tubes). Vortex tubes to mix well.

4. Incubate at 37°C in the hot water bath for 25 minutes.5. Centrifuge for 15 minutes at 14,000 rpm.6. Use a toothpick to remove the bacterial debris from the bottom of each tube. (You

won’t be able to see a pellet, but when you pull it out, it will look like a blue glob).7. Load the gel slowly and carefully:

Lane 1: 20µL Hind III marker (Heat in 65C hot block for 7 minutes before loading) Lane 2: 20µL plasmid DNA solution (10µL plasmid DNA + 4µL 6X DNA sample buffer + 6µL 1X TAE)Lane 3: Transformed supernatant Lane 4: 50µL Cracking buffer only Lane 5: Non-transformed supernatant

17

Note: Load as much transformed and nontransformed supernatant as possible (A well-formed well can hold ~50 L).

8. Run the gel for 1 hour at 100 volts.9. Stain with ethidium bromide, destain, and photograph. Look for genomic DNA, plasmid

DNA and RNA.

1.9 Labeling DNA with Biotin -Salt-Saturated Phenol is to be used only wearing gloves under the hood. Dispose of all pipets and liquid waste containing SS Phenol in appropriate disposals. -Chloroform is to be used only wearing gloves under the hood. Dispose of all pipets and liquid waste containing chloroform in appropriate disposals.

Part A: Labeling Reaction1. Remove an aliquot of Plasmid DNA from the refrigerator and place on ice. 2. Add labeling reaction components to a 0.5ml tube (on ice) in the following order:

dH2O 128µLdNTP mix 28µL1X DNase I Buffer 19.9µLDNase I 0.1µLPlasmid DNA 4µLDNA Polymerase I 20µL

3. Mix well and centrifuge for 5 seconds at desktop minifuge.4. Allocate 50µL into four 0.5ml tubes.5. Incubate at 15°C for 2 hours in thermocycler.6. Add 5µL Stop Buffer to each tube and mix.7. Incubate tubes at 65°C for 5 minutes in thermocycler.

Part B: Purification of DNA probes1. Transfer liquid to consolidate solution from 4 tubes into one 1.5ml tube.2. Add 4µL 10% SDS to tube and mix.3. Add 110µL Chloroform and 110µL SS Phenol to an empty 1.5ml microcentrifuge

tube.4. Transfer DNA solution to chloroform phenol tube. Vortex 2 minutes and then

centrifuge for 2 minutes at 14,000 rpm.5. Collect the top layer of liquid and transfer to a fresh 1.5ml tube. Discard remaining

liquid into waste container.6. Add 220µL chloroform to tube. Vortex 2 minutes and then centrifuge for 2 minutes

at 14,000 rpm.7. Collect top liquid layer and transfer to a clean tube. Discard remaining liquid into

waste container. 8. Add 40µL 3M Sodium Acetate (pH 4.8) and 800µL cold 95% ethanol. Mix gently by

inverting tube.9. Store at -20°C ON (at least 6 hours)

The Next Day:

18

10. Centrifuge for 5 minutes at 14,000 rpm.11. Carefully remove the supernatant.12. Resuspend the pellet in 1ml cold 70% ethanol. Centrifuge for 5 minutes at 14,000

rpm. (1st Wash)13. Remove supernatant (ethanol). 14. Resuspend the pellet in 1ml cold 70% ethanol. Centrifuge for 5 minutes at 14,000

rpm. (2nd wash)15. Remove supernatant (ethanol). Let tube dry on lab bench for at least 1 hour. 16. Once dry, resuspend probe in 12µL TE buffer (properly labeled with group, content

and date) and store at -20° C.

1.10 Preparing for the Southern Blot (day before 1.11) 1. Using a marker, draw a line down the center of the underside of a fresh LB amp plate.

Draw two 1.5 cm x 1.5 cm squares on the underside of the plate, one on each half.2. Using a sterile toothpick, pick one isolated colony from the Day 1.6 LB amp transformed

plate. “Fill in” one square on the fresh LB amp plate with one colony. Repeat for the second square making sure to use a fresh toothpick.

3. Repeat steps one and two, this time using an LB plate and the Day 1.6 non-transformed cells.

4. Incubate both plates for at least 24 hours.

1. 11 Southern Blot HAZARDOUS CHEMICAL INFO:-Ethidium Bromide is an extremely toxic carcinogen. WEAR GLOVES when handling, and dispose of everything that has contacted EtBr in the appropriate solid waste container.

1. Run cracking gel (same as Day 1.8, except add 20ul of plasmid mixed with 4µl 6X DNA sample buffer to the plasmid lane). Do not forget control lane!

2. Stain with ethidium bromide, briefly destain, and examine the gel. 3. Make sure to destain the gel for approximately 5 minutes before denaturing.4. Photograph the gel before destaining completely—you will use this photograph later to

compare to the results of your southern blot.5. Denature gel in 0.5 M NaOH/0.8 M NaCl for 30 minutes, rocking. Decant the solution

and repeat.6. Rinse gel in dH2O for 1 minute.7. While the gel is rinsing, cut and hydrate the nitrocellulose filter for 3 minutes in dH2O,

then in 10X SSC until blot set-up is ready. Always wear gloves when handling the nitrocellulose. Always handle the filter with forceps, and only around the edges so as to not create blotches of background color.

8. Neutralize gel in 0.5 M Tris/1.5 M NaCl (pH 7.0) for 30 minutes, rocking. Decant the solution and repeat.

9. Rinse the gel in 10X SSC for 3 minutes, rocking.10. While the gel is neutralizing, prepare the Test Spot.

19

a. Take your Biotin labeled probe out of the freezer and let thaw on ice. b. Cut a piece of nitrocellulose approximately 1 cm x 1 cm. Make sure to cut

your test spot in a unique way so that you can identify it later. For example you can cut one or two small notches on the side of the square or cut off a corner.

c. Hydrate the test spot in dH2O for 3 minutes.d. Soak the nitrocellulose in 10X SSC until the probe is thawed. e. Remove the nitrocellulose from the SSC and place on a small Kimwipe.f. Add 2 µL of probe to the center of the square of nitrocellulose.g. Let dry on Kimwipe, then wrap in plastic wrap and store in the freezer

until 1.12.11. Assembling the Southern Blot: (Refer to Appendix I)

-First the wick (a long strip of paper towel will work) needs to be placed on the platform so that it can only touch the buffer on two sides.

-Place three pieces of Whatman 3M filter paper on top of wick. -The gel should be placed on top of the filter paper and the nitrocellulose on top

of that. **Make sure the nitrocellulose and the gel are lined up in the correct orientation so you can compare them later**

-Place three more pieces of Whatman 3M filter paper on top of the nitrocellulose.

-Roll the filter paper with a Pasteur pipette to remove any air bubbles. -A stack of cut paper towels at least 10 cm high should be assembled and placed

on top of the filter paper (All filter paper and paper towel should be cut to the size of the gel).

-Wrap the whole set up in plastic wrap to provide stability to the stack and minimize evaporation.

-Pressure should be applied to the top of the stack to enhance wicking overnight. (Your TA should demonstrate this and assist in the assembly)

12. Let Southern Blot transfer ON in 10X SSC.

1.12 Drying of Blot (Done for you )______________________________ 1. Disassemble the Southern blot and rinse the nitrocellulose in 5X SSC for 2 minutes.2. Dry on large Kimwipe.3. Bake nitrocellulose blot on a kimwipe and test spot wrapped in plastic in vacuum oven

at 80°C for 2 hours.4. Carefully place blot into hybridization bag and seal on all four sides. 5. Store blot and test spot in freezer.

1.13 Hybridization of the Southern Blot 1. Carefully unwrap your test spot. 2. Place your uniquely cut test spot in a small plastic tub containing all of the test spots

from the class. Your TA or lab tech will hydrate these in 2X SSC and then place them in prehybridization solution and return them to you tomorrow for 1.14.

20

3. Cut a corner of your hybridization bag. Using a serological pipette, add 50ml 2XSSC to the bag to hydrate your blot. Try to remove all the air bubbles and reseal the corner of the bag using the food sealer. The blot should be uniformly hydrated after several minutes.

4. While the blot hydrates, denature 200L of Herring sperm DNA (2mg/mL) in 100°C hot block for 10 minutes followed by plunging into ice water.

5. For prehybridization of the nitrocellulose blot, add the 200µL of freshly denatured Herring sperm to the prehybridization solution and mix.

6. Cut a corner of your bag and remove the 50ml 2XSSC. Pour in the prehybridization solution using a serological pipette. Reseal the corner making sure to push all of the air bubbles out of the bag. If there are still more air bubbles in the bag after you have resealed the corner, set the bag upright and push all the bubbles to the top of the bag. Reseal the bag across the top to trap the air bubbles away from the blot.

7. Incubate at 42°C while rocking for 2 hours. The volume of prehybridization solution used should be 20 to 100L per cm2 of the blot.

8. For hybridization, heat-denature 5L of the probe made on 1.9 and 200 L of Herring sperm DNA by placing in 100°C hot block for 10 minutes. While in the heat block, wrap tops of tubes in Parafilm to preserve the label in the next step.

9. Plunge into ethanol ice slurry for fast chilling, making sure not to erase all labels written in marker. Just before use, add to the hybridization solution.

10. Remove the prehybridization solution from the bag by cutting a corner and pouring off. Add the hybridization solution to the bag (20-100 L per cm2) and reseal using the same techniques described in step 6. The blot should be hybridized at 42°C overnight while rocking to achieve maximal sensitivity.

Following Day: 1.14 Detection of the DNA **All the washes in this section need to be completed while rocking.**

Decant and save the hybridization solution in an appropriate size tube. Store at 4C.1. Wash the blot & test spot with 100ml of 2X SSC/0.1% (w/v) SDS at room temperature

for 3 minutes. Decant the SSC and repeat.2. Wash the blot & test spot with 100ml of 0.2X SSC/0.1 % (w/v) SDS at room temperature

for 3 minutes. Decant the SSC and repeat.3. Wash the blot & test spot in 100ml of 0.16X SSC/0.1% (w/v) SDS at 50°C for 15 minutes.

Decant the SSC and repeat.4. Rinse the blot & test spot in 100ml of 2X SSC at room temperature for 1 minute.5. Dry on large Kimwipe and then wrap in plastic wrap and store in refrigerator.6. The hybridization mixture containing the biotin-labeled probe may be reused. Store the

mixture at 4C for several days or at -20C for longer periods. Placing the hybridization solution in a boiling water bath and cooling on ice just prior to use should denature the probe.

1. 15 Development of Blot HAZARDOUS CHEMICAL INFO:

21

-NBT/BCIP is highly toxic. WEAR GLOVES when handling and dispose of all liquid waste containing NBT/BCIP in the appropriate waste container.

1. Wash the blot and small test square in Buffer 1 at room temperature for 1 minute with sufficient buffer to cover. Decant Buffer 1 into the sink.

2. Incubate blot and test spot in Buffer 2 in a plastic container for 1 hour at 65°C, rocking, with sufficient buffer to cover. Then decant off.

3. Dry blots on Kimwipes4. Dry blots at 80oC for 15mins.5. Wash the blots in freshly made strep-avidin alkaline phosphatase (SA-AP) conjugate for

25 minutes at room temperature. 1µL SA-AP per 1mL Buffer 2. (Add only enough SA-AP conjugate to cover the blots (~10ml). Use gentle agitation and occasionally pipette SA-AP over the blots.)

6. Decant and save the SA-AP in a 15ml tube. Save for step #8.Wash the blot and test spot in Buffer 1 using 20 to 40-fold greater volume than employed in step 5. Gently agitate blot for 15 minutes in Buffer 1.(if you used 10 ml diluted SA-AP conjugate in step 1, wash with at least 200-400ml Buffer 1.) Decant Buffer 1 into the sink.

7. Wash the blots for 10 minutes in Buffer 3, rocking. Decant Buffer 3 into sink. 8. Add 1ml NBT/BCIP solution to the saved SA-AP. A blue color should develop overtime.

Wear gloves when working with NBT-BCIP. 9. Add 9 ml of NBT-BCIP solution to the blots. Allow the blots to develop for 15 minutes to

1 hour. (Do steps 8 and 9 at the same time and monitor the rate of color development. The tube of saved SA-AP acts as a positive control.) Agitate the Tupperware.

10. DNA bands will be most evident on only one side of the blot (check your notch for correct orientation). Check your blot every 2 minutes to ensure that over-development does not occur.

11. Once bands have developed, decant the NBT-BCIP solution in the appropriate waste container and wash the blot in TE. This will terminate the color development reaction. The TE can then be decanted into the sink.

12. Let the blots dry on a large Kimwipe. Then wrap in plastic wrap and label. The lab tech will photograph and distribute the blots for your notebooks.

13. Measure the photograph of the cracking gel, and compare the relative position of the plasmid band to the results of the blot. Interpret your results.

14. Record the development time with NBC/BCIP

1.16 Designing Primers

Using the nucleotide sequence provided, you will design gene specific primers to use in PCR. In order to exponentially amplify a unit product that includes all of the coding region for the GST gene, you should design two primers (Forward and Reverse). Each primer will be complementary to the plasmid DNA sequences immediately 5’ to and 3’ to the GST coding region. In this way, the entire GST sequence will be amplified. The Forward primer sequence can be taken directly from the 5’ 3’ nucleotide sequence provided. The Reverse primer

22

needs to be the reverse compliment of the sequence provided. This means that you should design the reverse primer from the sequence given to you (in the 5’3’ orientation). To obtain the reverse compliment, start at the 3’ end of the Reverse primer sequence. Now work backwards through the primer writing the complementary nucleotide sequence. This is your reverse primer in the 5’3’ direction. You can also do this by writing the 5’ 3’ sequence you want to use as a primer backward. Then you can write the complementary base pairs. Please make sure your final primers are written in the 5’3’ orientation when you submit them.

Rules for Designing Primers

1. The primers should be between 18-25 nucleotides in length with a TM of approximately 50-55oC.

2. TM= 2°C(A&T) + 4°C (G&C)3. Primers should start and end with G’s or C’s4. The nucleotide composition of the primer should be ~50% G/C and ~50% A/T. 5. Try to avoid long stretches of the same nucleotides (i.e. more than 4 of a particular

nucleotide in a row).6. Make sure to avoid large amounts of complimentarity between the Forward and

Reverse primer and between the 5’ and 3’ ends of each primer.

Example of Reverse primer design

1) 5’-GTCGTACGTACGGCGTCGTCC-3’ The sequence you want to use as a reverse primer.

2) 3’-CCTGCTGCGGCATGCATGCTG-5’ The sequence written backward, so now it is 3’5’.

3) 5’-GGACGACGCCGTACGTACGAC-3’ The complementary bases of the sequence above. This is your reverse complement strand.

Now you try:Here is a portion of the GST gene sequence that you want to use as a reverse primer

site. Design a primer that will amplify this sequence:

5’-GTCGTACGTACGGCGTCGTCC-3’

Please draw on the DNA diagram below where your forward and reverse primers will bind and which direction the Taq DNA polymerase will transcribe.

5’-------------------------------------------------------------------------------------------------------3’

23

3’-------------------------------------------------------------------------------------------------------5’

The glutathione S-transferase (GST) nucleotide sequence is shown below.

5’GTGGGGAAGGTGAGCGGATACAATTTCACACGGAAACAGTATT

CATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTG

GAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGC

GAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGT

TAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGG

TTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACG

GTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCT

ACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCA

TGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGT

GCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGA

TAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGG

TGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGGATCTCGTCGTGCATCTGTTGGATC

CCCGGGAATTCATCGTGACTGACTGACGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTG

ACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTC

AGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGGCG

GAGTGTATAATTCTTGAAAAACAAAAGGGCCTCGGGAAACGCCTATTTTTATAGGTTAATGGCATGAAA

ATAAATGGTTTTCTAAAACGTCAGGGGGGCACTTTTTCGGGGAAAAGGTGGCGCGGAAACCCCTTATTT

TGGTTTATTTTTTTTCTAAAAAAACATTTTCAAAATAATGTTATCCCCCCCCTCATGGAAAAAAAAAATAA

AACCCCCGGGGAAAAAAAAAGGGGCTTTTTCAAAAATAAAAAAAAATATTTTGTAAAAAAAAAAAAAG

GGGGGAGAGAA-3’

Using this information, design the primers to amplify the GST gene. Once you have designed the primers, write them in your notebook and inform your TA of their sequence via e-mail. The primers will then be made on a DNA synthesizer.

Day Before: Plate fresh transformed and non-transformed bacteria from old plates using the

streaking method (See Appendix G).

24

1. 17 PCR 1. Set up seven 0.5 ml PCR reaction tubes according to the PCR chart in Appendix H. Read

the chart carefully and make sure you add the correct amounts of reagents. PCR is a very sensitive reaction and adding the incorrect amounts of reagents may cause poor results. Appropriately label your tubes with your group color and tube number!

2. For Sample 4, pick up three individual colonies from your transformed plate with a sterile toothpick and place into a 0.5 ml microfuge tube filled with 50 µL of sterile dH2O. Do the same for Sample 5 using your non-transformed bacteria. Lyse the bacteria at 99°C for 5 min in the Thermocycler. Take 3µL of this bacterial solution and use it as your “template DNA”.

3. Before mixing the reactants, calculate how much water must be added to make a total of 25L (including the Taq Polymerase). This is necessary because the amount of template DNA that you add might differ from tube to tube.

4. If you add too much DNA, nonspecific amplification may occur—ask your TA how much DNA to add based on the approximate concentration of your plasmid samples.

5. Add all reactants, except the Taq, while the tubes are on ice.6. Lastly add the Taq polymerase.7. Once all reactants are added to the tubes, mix by flicking the tubes and spin them briefly

to bring all the liquid to the bottom of the tube. Note: Only spin tubes briefly (5 sec.), 0.5 ml tubes are thin-walled and can crack if microfuged for too long.

8. Keep the tubes on ice until the entire class is ready to load the thermocycler.9. The thermocycler will run for approximately 3hr. After the 3hr period is over, the

thermocycler will stay at a constant 4C until the tubes can be placed in the refrigerator by the lab technician or TA. This will ensure that the PCR products will not degrade.

1.18 Examining the PCR product HAZARDOUS CHEMICAL INFO:-Ethidium Bromide is an extremely toxic carcinogen. WEAR GLOVES when handling, and dispose of everything that has contacted EtBr in the appropriate solid waste container.

1.2. Make 300 ml 1X TAE.3. Prepare a 2% agarose gel. Note: The 2% agarose solution will solidify quickly! Pour

gel while still relatively hot. 4. Remove 20µL of PCR product from each tube; add to 4 µL of 6X sample buffer. Store the

remaining PCR product at 4°C. 5. Once your gel is set, remove the comb and place the gel in the running box. Cover the

gel with 1X TAE buffer. 6. Load your DNA samples and 10µL of 100bp ladder into the gel. 7. Run gel at 100 volts for 1.5 hours.8. Once the electrophoresis is complete, stain your gel for ~15 minutes in ethidium

bromide. WEAR GLOVES! Ethidium bromide is a mutagen and carcinogen.

25

9. Destain, examine, and photograph gel.

1.19 Searches of the sequence using BLAST ( B asic L ocal A lignment S earch T ool) The plasmid DNA has been sequenced. You will receive a printout of the results. You will analyze this information using a computer program called BLAST.

To access the program, go to http://www.ncbi.nlm.nih.gov/BLAST

BLAST1. Open the internet browser and go to http://www.ncbi.nlm.nih.gov/pubmed/

2. Scroll down the page and select BLAST from the popular searches menu.

3. Select nucleotide BLAST and copy the entire GST nucleotide GST sequence (provided to you via e-mail) into the query sequence box.

4. Make sure the database that is selected is nucleotide collection (nr/nt).

5. Click on the BLAST button at the bottom of the page and wait until the search is completed (results will be presented in a new tab).

26

Module 2Gene Expression

Introduction In the following series of experiments, you will not be using the transformed cells you created in Module 1. K12 cells do not perform as well in expression experiments, so BL21 cells will be used in Module 2. BL21 cells will be used to clearly express the GST protein. With these cells, you will induce the expression of the Glutathione-S-transferase (GST) and run an SDS-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis) to show that the protein was expressed. You will also perform a Western blot and use antibodies to confirm the presence of the GST protein.

2.1 SDS-PAGE prep - Pour Resolving Gel ______________________ HAZARDOUS CHEMICAL INFO:-Acrylamide is a neurotoxin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the acrylamide) in the appropriate waste container.-TEMED is highly toxic. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the TEMED) in the appropriate waste container. Do not inhale fumes.-Ammonium Persulfate is highly toxic upon contact with skin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the TEMED) in the appropriate waste container.

1. Obtain one 1.5mm spacer glass plate and one short glass plate; wipe with methanol and a Kimwipe until you hear a “squeaky” noise. Handle glass plates at edges. Wear gloves!

2. Assemble the gel casting apparatus (See diagram in Appendix J). Assemble on a flat surface and then clamp shut.

3. Insert the 1.5mm comb and use a Sharpie to draw a line across the glass 0.7 cm below the comb. Once the line is drawn, remove the comb.

4. Test to see if the apparatus is leak-proof. Squirt some water in between the glass plates and look for leaks. If leaks occur, a tighter seal must be achieved. Make sure to remove the water before pouring the gel. Use a Kimwipe or Whatman filter paper to remove water droplets from between the plates of glass.

Before you pour your gel, have the TA or lab tech check your apparatus!5. Prepare a 12% resolving gel in a 15 ml tube according to the following directions. DO

NOT ADD THE FRESHLY MADE AMMONIUM PERSULFATE UNTIL YOU ARE READY TO POUR THE GEL

Sterile dH2O 3.29 ml 4X Resolving Buffer pH 8.9 2.60 ml

30% Acrylamide stock 4.00 ml

27

TEMED 10 L Add Last: Fresh 10% Ammonium persulfate 100 L

6. Invert the solution twice to mix WELL. 7. Using a Serological pipette, quickly pour the gel by allowing the acrylamide solution to

run down along the side of the spacer. Add the acrylamide solution until it is just barely above your Sharpie line. Try to avoid making bubbles. This should be completed within 30 seconds.

8. Immediately overlay the acrylamide with dH2O. Do this by gently adding the dH2O with a glass Pasteur pipette. You will be able to see a distinct line between the dH2O and the resolving gel solution.

9. Allow the gel to polymerize for AT LEAST 45 minutes. (Any extra acrylamide mix in your tube will be a good gauge for polymerization. Make sure the cap is on.)

10. Wrap the gel/casting apparatus in a damp paper towel and then plastic wrap. Label appropriately. Store in the cold room.

2.2 Preparation of bacteria for SDS-PAGE (Done for you )_________ 1. Using a sterile toothpick, select one colony from a plate of freshly transformed

BL21+GST cells and add to 10ml of LB-amp broth. Shake tube at 37C ON. 2. Add one control (non-transformed) BL21 colony to 10ml LB broth. Shake tube at 37C

ON.

2.3 SDS-PAGE preparation and Pierce Protein Assay Four hours before class …inoculate bacterial cultures (Done for you):

1. Inoculate 2 tubes of 10ml of LB amp broth with 500L of transformed ON bacterial culture each.

2. Inoculate 2 tubes of 10ml of LB broth with 500L control (non-transformed) ON bacterial culture each.

3. Shake at 37C for 1 hour.4. To ONE of the LB amp cultures and ONE of the LB cultures, add 300L of 100mM IPTG

each. Label tubes to indicate the addition of IPTG. 5. Shake at 37C for an additional 3 hours.

Prepare the proteins for the gel and protein assay: 1. Obtain 2 ml of each type of culture (Transformed, Transformed + IPTG, Untransformed,

and Untransformed + IPTG). Split each culture into two 1.5 ml microcentrifuge tubes. You will have a total of 8 tubes (2 x Transformed -IPTG; 2 x Transformed +IPTG; 2 x Untransformed-IPTG; 2 x Untransformed +IPTG).

2. Spin all tubes in the microcentrifuge at 14,000 rpm for 1 minute.3. Decant the supernatant from each tube. 4. Resuspend each of the 8 pellets in 100L lysis buffer.5. Freeze 4 of the tubes (one of each sample type) at -80o C for backup samples. 6. Sonicate each of the remaining 4 samples in the cold room or on ice, 3 times at 10-

28

second intervals. Sonicating breaks open the cells by sound waves. EAR PROTECTION REQUIRED!When sonicating, avoid touching the sides of the tube with the tip of the sonicator. The sample may become frothy; try to keep the sample from coming out of the tube. Turn off the sonicator and rinse the tip with dH2O in between samples and wipe with a Kimwipe.

7. Record the approximate total volume of each sample.8. Keep protein on ice for protein assay.9. After setting up protein assay, freeze the remaining samples at -20C. Label

appropriately!

Pierce Protein Assay (See directions in Appendix M)Use the chart provided to develop a standard curve using BSA standards and to determine protein concentration. Perform the following procedure in duplicate! (You will run two sets of protein assays and average the OD values to calculate the protein concentrations.)

1. Dilute protein sample: Make 10X and 20X dilutions for each protein sample. For example, to make a 20X dilution, add 5L of your sample to 95L of sterile dH2O. For a 10X dilution add 10L of your sample to 90L of sterile dH2O.

2. Make dye solution: Use Solutions A and B from the Pierce Protein Assay Kit. They should be mixed 50:1…but make up only the amount you will need. Mix the dye in glass jar provided.

3. Add BSA and dH2O according to the directions in Appendix L.4. Add 2ml of the dye to each one of your samples and standards.5. Incubate at 37C for 30 minutes. 6. Get OD values for standards and samples: TA will assist in the operation of the spec. 7. Place your standard into a clean cuvette.

To clean the cuvette, rinse with dH2O. Make sure to dry the outside of the cuvette with a Kimwipe. Handle the cuvette only on the frosted sides.

8. Read OD at 562nm. 9. Repeat for each standard and sample, including duplicates.

If only using 1 cuvette, make sure to rinse with dH2O between each standard.10. Once the standards are complete, read your samples. You should blank the instrument

with dH2O and dye. If using only 1 cuvette, make sure to rinse with dH2O between each sample.

11. Find the average of each standard and sample duplicates.12. Establish a standard curve using the OD values obtained with your BSA standards:

graph Concentration (x-axis) vs. OD (y-axis) on graph paper. Using this graph, calculate the protein concentrations in your four samples.

13. Use Excel to plot your data on a second chart (This is homework). Make sure to paste your Excel chart in your notebook properly labeled.

29

2.4 SDS-PAGE HAZARDOUS CHEMICAL INFO:-Acrylamide is a neurotoxin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the acrylamide) in the appropriate waste container.-TEMED is highly toxic. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the TEMED) in the appropriate waste container. Do not inhale fumes.-Ammonium Persulfate is highly toxic upon contact with skin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the APS) in the appropriate waste container. -Coomassie Blue Stain and Coomassie Blue Destain are highly flammable and irritating to the skin. WEAR GLOVES when handling and dispose of in appropriate waste container.

1. Remove the resolving gel from the cold room and pour a 4% stacking gel. 2. Mix the following components in a 15 ml tube. 3. Sterile dH2O 6.10 ml

4X Stacking Buffer pH 6.8 2.50 ml 30% Acrylamide stock 1.30 ml TEMED 10 L

Last: Fresh 10% Ammonium persulfate 50 L

4. Before adding the ammonium persulfate, pour the dH2O off the resolving gel and dry with a Kimwipe.

5. Add the ammonium persulfate to your tube. Mix gently.6. Pour the stacking gel as you did the resolving gel all the way to the top of the small glass

plate. If it overflows when inserting the comb this is okay. Clean the comb thoroughly with ethanol before inserting.

7. Being careful to avoid making air bubbles, insert the clean comb until there is no air between the wells. This is VERY IMPORTANT; the stacking gel will not polymerize if the comb is not clean, or if there is air between the wells. Ask your lab tech to double check your set up.

8. Allow 45 minutes for the gel to polymerize. Thaw your protein samples on ice while waiting.

9. Once the gels are set, remove them from the casting stand and assemble in the gel box (See Appendex K). Note: Do not remove the comb yet.

10. Add 1X PAGE Running buffer to the upper chamber. The buffer level should be half way between the top of the big and small glass plates.

11. Add 1X PAGE Running buffer to the lower chamber until the appropriate level for the number of gels in the box is reached.

12. Carefully remove the comb.

30

Gel Set UpYour polyacrylamide gel will have 10 lanes. The first five lanes will contain a protein marker and your four protein samples. The last five lanes will contain the same set of protein samples in the same order. 20µl of each protein sample should be added per lane.

1. Calculate the volumes of sample, sample buffer, and water needed for each tube (make 60µl total so that even if some evaporates during boiling, there will still be 40µl left; 20µl per lane):

NOTE:-Each tube needs 60µg of protein total. Using the concentrations you calculated off of your standard curve, calculate how many microliters equals 60µg.-Each tube needs 1X SDS sample buffer. You are given 6X SDS sample buffer. Calculate how much 6X SDS sample buffer is needed so that the final concentration is 1X.-Before diluting 6X sample buffer, add 50µl of me to 500µl of 6X sample buffer in the fume hood.-Each tube needs a total volume of 60µl. Figure out how much water should be added to each so that the total volume is 60µl.

2. Add the calculated volumes of water, protein, and 6X SDS sample buffer to a 1.5ml tube, in that order. Make sure to mix sample buffer and protein samples before using! Place the remaining protein samples in the freezer.

3. Boil samples for 5 minutes right before you are ready to load. After boiling, keep samples on ice while loading gel.

4. Using gel loading tips, load your samples into the gel in the following order (load 20µl per lane): Lane 1, 6: Prestained protein marker Lanes 2, 7: TransformedLanes 3, 8: Transformed plus IPTG Lanes 4, 9: Control (non- transformed)Lanes 5, 10: Control (non- transformed) plus IPTG

5. Run the gel at a constant 100 Volts per Gel for approximately 1 ½ - 2 hours; until the dye runs off the bottom edge of the gel.

6. Remove gel carefully from the gel apparatus. Use a razor blade to cut the stacking gel portion away. Dispose of the stacking gel in the appropriate waste container.

7. Put the gel into a plastic container and cover with Coomassie Blue Stain. Rock gently overnight.

2.5 Dry Gel (Done for you) 1. Transfer gel to destain. Wash and discard destain in correct waste container. 2. Rinse gel with destain again and decant destain into correct waste container. 3. Submerge the gel in more destain and rock gently for 1 hour or until background of gel

is transparent. 4. Discard destain in appropriate waste container.

31

5. Rinse gel in dH2O. Discard into appropriate waste container.6. Submerge your gel in gel drying buffer and place back on the shaker ON.7. Photograph and appropriately dry gels using cellophane. 8. Make sure to observe and record gel appropriately.

2. 6 Pouring a Resolving Gel for SDS-PAGE and Western Blot _____ HAZARDOUS CHEMICAL INFO:-Acrylamide is a neurotoxin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the acrylamide) in the appropriate waste container.-TEMED is highly toxic. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the TEMED) in the appropriate waste container. Do not inhale fumes.-Ammonium Persulfate is highly toxic upon contact with skin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the APS) in the appropriate waste container.

1. Obtain one 1.5mm spacer glass plate and one short glass plate; wipe with methanol and a Kimwipe until you hear a “squeaky” noise. Handle glass plates at edges. Wear gloves!

2. Assemble the gel casting apparatus (See diagram in Appendix J). Assemble on a flat surface and then clamp shut.

3. Insert the 1.5mm comb and use a Sharpie to draw a line across the glass 0.7 cm below the comb. Once the line is drawn, remove the comb.

4. Test to see if the apparatus is leak-proof. Squirt some water in between the glass plates and look for leaks. If leaks occur, a tighter seal must be achieved. Make sure to remove the water before pouring the gel. Use a Kimwipe or Whatman filter paper to remove water droplets from between the plates of glass.

Before you pour your gel, have the TA or lab tech check your apparatus!5. Prepare a 12% resolving gel in a 15 ml tube according to the following directions. DO

NOT ADD THE FRESHLY MADE AMMONIUM PERSULFATE UNTIL YOU ARE READY TO POUR THE GEL

Sterile dH2O 3.29 ml 4X Resolving Buffer pH 8.9 2.60 ml

30% Acrylamide stock 4.00 ml TEMED 10 L Last: Fresh 10% Ammonium persulfate 100 L

6. Invert the solution twice to mix WELL. 7. Using a Serological pipette, quickly pour the gel by allowing the acrylamide solution to

run down along the side of the spacer. Add the acrylamide solution until it is just barely above your Sharpie line. Try to avoid making bubbles. This should be completed within 30 seconds.

8. Immediately overlay the acrylamide with dH2O. Do this by gently adding the dH2O with

32

a glass Pasteur pipette. You will be able to see a distinct line between the dH2O and the resolving gel solution.

9. Allow the gel to polymerize for AT LEAST 45 minutes (Any extra acrylamide mix in your tube will be a good gauge for polymerization. Make sure the cap is on).

10. Wrap the gel/casting apparatus in a damp paper towel and then plastic wrap. Label appropriately. Store in the cold room.

2. 7 SDS-PAGE gel and Western Blot HAZARDOUS CHEMICAL INFO: -Acrylamide is a neurotoxin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the acrylamide) in the appropriate waste container.-TEMED is highly toxic. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the TEMED) in the appropriate waste container. Do not inhale fumes.-Ammonium Persulfate is highly toxic upon contact with skin. WEAR GLOVES when handling, and dispose of all solid waste (pipets, gloves, or anything else that has come in contact with the APS) in the appropriate waste container. -Western Blot Transfer Buffer is flammable. Wear gloves and use caution when handling.

1. Remove the resolving gel from the cold room and pour a 4% stacking gel.2. Mix the following components in a 15ml tube (makes enough for 2 gels).

Sterile dH2O 6.10 ml 4X Stacking Buffer pH 6.8 2.50 ml 30% Acrylamide stock 1.30 ml TEMED 10 L Last: Fresh 10% Ammonium persulfate 50 L

3. Before adding the ammonium persulfate, pour the dH2O off the resolving gel and dry with a Kimwipe.

4. Add the ammonium persulfate to your tube. Mix gently.5. Pour the stacking gel as you did the resolving gel all the way to the top of the small glass

plate. If it overflows when inserting the comb this is okay. Clean the comb thoroughly with ethanol before inserting.

6. Being careful to avoid making air bubbles, insert the clean comb until there is no air between the wells. This is VERY IMPORTANT; the stacking gel will not polymerize if the comb is not clean, or if there is air between the wells. Ask your lab tech to double check your set up.

7. Allow 30 minutes for the gel to polymerize. Thaw your protein samples on ice while waiting.

8. Once the gels are set, remove them from the casting stand and assemble in the gel box (See Appendex K). Note: Do not remove the comb yet.

9. Add 1X PAGE Running buffer to the upper chamber. The buffer level should be half way

33

between the top of the big and small glass plate.10. Add 1X PAGE Running buffer to the lower chamber until the appropriate level for the

number of gels in the box is reached.11. Carefully remove the comb.

Gel Set Up:1. Calculate the volumes of sample, 6X SDS sample buffer (mix before using), and water

needed for each tube. This should be the same as in 2.3.2. Place the remaining protein samples in the freezer.3. Boil samples for 5 minutes right before you are ready to load. After boiling, keep

samples on ice while loading gel. 4. Using gel loading tips, load your samples into the gel in the following order (load 20µl

per lane): Lane 1, 6: Prestained protein marker Lanes 2, 7: TransformedLanes 3, 8: Transformed plus IPTG Lanes 4, 9: Control (non- transformed)Lanes 5, 10: Control (non- transformed) plus IPTG

5. Run the gel at 50mA for ~1 ½ hours and then set up Western blot.

Blotting ProcedureThe transfer will be accomplished using the Hoeffer Semi Dry Transfer Apparatus. This unit transfers proteins from a polyacrylamide gel to a nitrocellulose membrane by means of a low current and low voltage transfer.

1. Rinse the anode and cathode of the transfer apparatus with dH2O. Be careful not to get the leads or interlock housing wet.

2. Prepare the gel for transfer. Carefully cut away stacking gel with a razor blade. Measure the gel and record the dimensions.

3. Cut a hole in a Mylar mask 2 mm smaller than the gel. Center the mask on the anode of the transfer apparatus.

4. Cut six pieces of blotting paper and one piece of nitrocellulose membrane the same size as the gel. Measure and cut carefully; they must not be larger than the gel!

5. Soak the blotting paper in Western blot transfer buffer.6. Rinse the nitrocellulose membrane with dH2O, and then soak it in Western blot transfer

buffer for 5 minutes.7. Put one piece of the blotting paper over the opening in the Mylar mask. Roll a test tube

over the paper 3-4 times to push all air bubbles out. You will need to use moderate pressure to be effective.

8. Repeat this process adding two more blotting paper layers.9. Add the nitrocellulose paper to the stack and roll out the air bubbles.10. Add the gel. Do not roll. Be careful setting the gel on the stack. Try to line it up

correctly the first time as some proteins may stick to the membrane on contact and moving the gel around will affect the quality of your blot.

34

11. Add the last three strips of blotting paper, one at a time, carefully rolling out the bubbles each time.

**NOTE: If it is too hard to place the gel exactly on top of the nitrocellulose membrane, you can put the gel down first and then the nitrocellulose, but you need to remember to FLIP THE STACK after you have finished putting the filter paper on top so that the nitrocellulose is BELOW the gel.**12. Put the top on the transfer unit. Set a flask with 1L of water on top to add pressure.13. Connect the short safety interlock lead on the cover to the jack on the base. Plug the

leads into the power supply.14. Turn on the power (0.8 mA per cm2 of gel surface). Transfer for 1½ hour.15. Turn off the power supply. Disconnect the leads and safety interlock.16. Use forceps to remove the nitrocellulose membrane. Place it face up on a large

Kimwipe. Record the orientation of the lanes, and then wrap the nitrocellulose in plastic wrap and store at -20C. Blotting papers and gel can be thrown away.

2.8 Primary Antibody Blocking (day before 2.9) 1. Cut the nitrocellulose along the edge of the middle prestained marker so that both

halves of the nitrocellulose contain the visible protein marker. Wrap one half of the blot in Saran wrap, label, and place back into the freezer.

2. Submerge the other half of the blot in 25ml of blocking solution. Rock at room temperature for 1 hour.

3. Decant the blocking solution into the sink. 4. Wash the blot with 50ml 1X TBS for five minutes, rocking. Decant into sink. Repeat for

a total of three 5 minute washings. 5. Add the primary antibody (Anti-GST produced in rabbits diluted 1:5,000 in 10 ml of

solution containing TBS, 0.1% Tween-20, and 1% dry non-fat milk). Add enough to submerge the nitrocellulose filter.

6. Rock in the cold room overnight.

2.9 Staining and Detection of Western Blot HAZARDOUS CHEMICAL INFO:-Amido Black Stain and Destain are flammable irritants. Wear gloves when handling and dispose of in proper waste containers. -NBT/BCIP is highly toxic. WEAR GLOVES when handling and dispose of all liquid waste containing NBT/BCIP in the appropriate waste container.

Staining with Amido Black:1. Remove nitrocellulose blot from the freezer and cover with a minimal amount of amido

black.2. Rock at room temperature for 5 minutes.3. Decant stain back into its original container then wash the blot with amido black destain

until all background color is gone.4. Decant destain into the proper waste container.

35

5. Place the blot on Kimwipe to air dry.6. Observe the stained blot. Save it to compare to the immunostained half. Wrap the blot

in plastic wrap. Copies of the stained blot should be made for each group member. Scanning and printing the blot can achieve this.

Detection of the antibody:1. Decant the primary antibody into the sink.2. Wash the blot with TBS-T for 5 minutes, rocking. Decant the TBS-T into the sink. Repeat

2 more times. 3. Add the secondary antibody (Goat anti-rabbit IgG alkaline phosphatase conjugated

diluted 1:10,000 in TBS-T). 4. Rock the blot at room temperature for 1 hour. Save a small volume (500L) of the

secondary antibody in a 1.5 ml tube to use as a control, keep on ice.5. Decant the rest of the secondary antibody into the sink. 6. Wash the blot with 50 ml of TBS-T. Rock at room temperature for 5 minutes.7. After 5 minutes, decant the TBS-T into the sink, add fresh TBS-T and repeat for a total of

six 5 minute post-antibody TBS-T washings.8. Add 500 L of the NBT-BCIP to the secondary antibody you saved. A blue color should

develop within a couple minutes.9. Decant last wash on the blot. Add 10 ml NBT-BCIP solution directly to your blot. Agitate

until color develops. (Should occur within 1 to 10 minutes).10. Once color has developed, decant the NBT-BCIP solution into its appropriate waste

container. Rinse the nitrocellulose with TBS-T. Decant into the sink.11. Air dry the nitrocellulose on a Kimwipe. Observe and record. Wrap the nitrocellulose in

plastic wrap and store in your notebook. Copies of the blot should be made for each group member.

36

Appendix A: Solutions Guide

GENERAL SOLUTIONS

Ampicillin Stock100 mg/ml stock solution: for example, 0.5g ampicillin sodium salt into 5 ml dH2O. Filter sterilize, and store at -20°C.

LB Amp100 µg/ml final concentration: 1:1,000 dilution of ampicillin stock into LB broth.

When making LB amp plates, add 1 ml ampicillin stock (100mg/ml) into 1L LB Agar broth. *NOTE: Ampicillin is heat-sensitive, so LB agar broth must be cooled to 60°C after coming out of the autoclave, before the ampicillin is added. Setting the water bath to 60°C and letting the LB agar broth cool in there for an hour is a good way to ensure the LB agar doesn’t solidify.

When making LB amp broth, add 1µl of ampicillin stock (100mg/ml) for each 1ml of LB broth.

TE bufferNeed (final conc.): 10mM Tris-Cl (pH 7.5), 1mM EDTA (pH 8.0)Make from liquid stocks of Tris-Cl and EDTA5ml 2M Tris-Cl (pH 7.5)2ml 0.5M EDTA (pH 8)993ml dH2O

2M Tris-Cl (pH 8.0)177.6g Tris-Cl10.6g Tris-baseIn ~950mL sterile dH2O**pH 8.0**Bring up to 1L with sterile dH2O

0.5M EDTA (pH 8)18.6g EDTA disodium salt (FW= 372.2)In ~75ml sterile dH2OHeat in microwave to dissolve salt***bring pH to 8.0***Bring up to 100mL with sterile dH2O

37

50X TAE stock (pH 8.5)242g Tris Base (FW= 121.14)In ~700ml sterile dH2OCarefully add 57.1mL Glacial Acetic Acid100mL 0.5M EDTA (pH 8.0)Bring up to 1L with sterile dH2O

pH 8.5, but no adjustment needed*Dilute 50X TAE stock 1:10 for a 5X stock*

6X DNA sample buffer0.25 g Bromophenol Blue40 g Sucrose100 ml dH2O

λ Hind III marker100 µL λ Hind III Digest (NE Bio Labs stock)150 µL TE50 µL 6X DNA sample buffer

20X SSC (pH 7)175.3 g NaCl88.25 g Na3 Citrate•2H2O1 L dH2O**pH 7.0**

2X SSC10ml 20X SSC90ml dH2O

10X TBS (pH 7.4)60.6 g Tris base87.6g NaCl800 ml dH2OQS to 1000ml

TBS-T1X TBS, 0.1% Tween-20

1 ml Tween-20 (use large orifice tips to pick up Tween)1999 ml 1X TBS

Phosphate Buffer (PBS)4.0g NaCl, 0.1g KCl0.72g Na2HPO4 , 0.12g KH2PO4

In ~400ml sterile dH2O

38

**pH 7.4** , Bring to 500ml with sterile dH2O

MODULE 1

1.1: Isolation of plasmid DNA

Solution I0.50 g D-Glucose0.625 ml 2M Tris-Cl (pH 8)1 ml 0.5M EDTAAdd dH2O to make total volume 50ml**add 5 mg/ml lysozyme just before use**

Solution II2 ml 1M NaOH1 ml 10% SDS7 ml dH2O**Prep fresh**

5M Potassium Acetate 29.5 ml glacial Acetic Acid QS to 100 ml dH2O Add KOH pellets until pH=4.8Store in refrigerator

Heat-treated RNase A (100mg/ml)Dissolve 600 mg (0.6g) of pancreatic RNase A (Sigma R-4875) in 6 ml 10mM Tris-Cl/15mM NaCl. Divide into six 1.5ml microfuge tubes and heat in 100°C heat block for 15 minutes. Allow tubes to cool slowly to room temperature. Store at -20 °C.

10mM Tris-Cl/15mM NaCl0.1576 g Tris-Cl0.0876 g NaCl100ml dH2O

Salt Saturated PhenolTris buffered Phenol pH 6.6/7.98-Hydroxyquionoline added until dark yellow/orange color

Chloroform:Isoamyl Alcohol (24:1)480 ml Chloroform20 ml Isoamyl Alcohol

39

TE bufferSee general solutions section

1.4: Transformation

50 mM CaCl2

0.73 g CaCl2

100 ml dH2O ** Make fresh**

Transformation buffer1ml 100 mM CaCl2

1 ml 100 mM Tris-Cl1 ml 100 mM NaCl7 ml dH2O**Store at 4°C**

1.6: Secondary selection of transformed bacteria

0.145 M Sterile Saline (pH ~7)4.25 g NaCl500 ml dH2O** Autoclave to sterilize**

1.8: Cracking gel

Cracking Buffer (pH 6.8) 0.788 g Tris-Cl1.0 g SDS0.058 g Na2EDTA•2H2O13.6 g Sucrose0.1 g Bromophenol Blue100 ml dH2O** pH 6.8**

1.9: Biotin labeling of DNA

3 M Sodium Acetate (pH 4.8)24.6 g Sodium Acetate100 ml dH2O

40

** pH 4.8**

1.11: Southern blot

Cracking Buffer See 1.8 above

0.5M NaOH/0.8M NaCl20 g NaOH46.752 g NaCl1 L dH2O

0.5M Tris/1.5M NaCl (pH 7)250 ml 2 M Tris-base solution87.6 g NaCl600 ml dH2O ** pH 7**QS to 1L

10X SSC See general solutions for 20X SSC

1.13: Hybridization of Southern Blot

Prehybridization Solution (per group, prep fresh)5 ml Formamide2.5 ml 20X SSC0.5 ml 100X Denhardt’s solution (doesn’t keep more than 24 hours!)0.25 ml 1M Phosphate Buffer200 µL Herring sperm DNA (2mg/ml, made fresh), freshly denatured

Hybridization Solution (per group, prep fresh)4.5 ml Formamide 2.5 ml 20X SSC0.1 ml 100X Denhardt’s solution (doesn’t keep more than 24 hours!)0.4 ml 1M Phosphate Buffer1.5 ml dH2O200 µL Herring sperm DNA (2mg/ml), freshly denaturedBiotin-labeled probe DNA

100X Denhardt’s Solution0.2 g Ficoll 0.2 g Polyvinylpyrrolidone0.2 g Bovine Serum Albumin (BSA)10ml sterile dH2O.

41

**Doesn’t keep more than 24 hours**

1.14: Detection of DNA

2X SSC/0.1% (w/v) SDS 50 ml 20X SSC450 ml dH2O0.5 g SDS

0.2X SSC/0.1% (w/v) SDS 5 ml 20X SSC495 ml dH2O0.5 g SDS

0.16X SSC/0.1% (w/v) SDS 4 ml 20X SSC496 ml dH2O0.5 g SDS

1.15: Development of Blot

Buffer 1 : Final Concentration: 0.1 M Tris-Cl 0.15 M NaCl

8.7 g NaCl15.764 g Tris-Cl1 L dH2O

Buffer 2: 3% (w/v) BSA in Buffer 13g BSA per 100 ml Buffer 1**Doesn’t keep more than 24 hours, prep fresh**

SA-AP: **Needs to be made immediately before use**1 µL SA-AP per 1 ml Buffer 2 (approx. 10 ml needed per group)

Buffer 3Final concentration: 0.1M Tris-Cl

0.1M NaCl 50 mM MgCl2

15.764 g Tris-Cl5.844 g NaCl10.15 g MgCl2

1 L dH2O

42

1.17: PCR

20 µM Primer Dilutions (from 500 µM stock primers)5 µL 500µM stock120µL dH2O**Primers should be stored long term at 500 µM conc. and diluted to 20 µM in smaller batches**

10 mM dNTP mix (from 100 mM individual dNTP stocks)500µL dCTP500µL dTTP500µL dATP500µL dGTP3 ml dH2O *1 µL of 10mM dNTP mix per 50µL reaction*

1.25mM dNTP mix262.5µL dH2O37.5µL 10mM dNTP mix *8 µL of 1.25mM dNTP mix per 50 µL reaction*

MODULE 2

2.2: SDS-PAGE prep and Pierce Protein Assay

100mM IPTG0.02383g IPTG1 ml dH2O

4X Resolving Buffer (pH 8.9)18.17g Tris base10 g SDS (measure in hood)100 ml dH2O**pH 8.9**

Lysis Buffer5 ml 1M Tris (pH 8.0)3 ml 5M NaCl1 ml Triton X-100

43

91 ml dH2O**add 0.0057 g DTT/10 ml Lysis Buffer fresh immediately before use**

2.3: SDS-PAGE

4X Stacking Buffer (pH 6.8) 6.055 g Tris base0.4 g SDS100 ml dH2O**pH to 6.8**

5X Running Buffer7.55 g Tris Base36 g GlycineBring solution to 500 ml volume and stirpH should be 8.3 but don’t adjustAdd 2.5 g SDS**Store at 4°C**Dilute to 1X before using

10X SDS sample buffer11.7ml 4X Tris-Cl/SDS, pH 6.85.0 ml glycerol (30% final)1 g SDS (10% final) (weigh in hood)2 mg bromophenol blue Add dH2O to 10 ml volume *Store in .5 ml aliquots at -20*Add 50µL β-ME (5%) to each 1ml tube before use

4X Tris-Cl/SDS, pH 6.8 (0.5 M Tris-Cl with 0.4% SDS)6.05g Tris Base in 40 ml dH2OAdjust pH to 6.8 with 1M HClAdd dH2O to 100 ml totalAdd 0.4 g SDS (weigh in hood)*Store for up to 1 month*

Coomassie Blue Stain200 ml Methanol50 ml Glacial Acetic Acid1 g Coomassie Blue250 ml dH2O

Coomassie Blue Destain200 ml Methanol

44

75 ml Glacial acetic Acid725 ml dH2O

2.4: Dry Gel

Gel Drying Buffer50 ml Glycerol (10%)35 ml Acetic Acid (7%)125 ml Methanol (25%)290 ml dH2O (58%)*Glycerol is added first in a large graduated cylinder, mix well with water. Add the acid last.*

2.6: SDS-PAGE and Western Blot

Western Blot Transfer Buffer (pH 8.3)2.93 g Glycine5.81 g Tris base200 ml Methanol800 ml dH2O**pH 8.3**

2.7: Blocking with primary antibody

Blocking Buffer5 g dry milk0.635 g Tris-Cl0.118 g Tris base0.877 g NaCl100ml dH2O

TBS-T See general solutions section.

Primary Antibody Dilution (1:5,000)0.1% Tween-20, 1% (w/v) dry milk

50 ml 1X TBS50 µL Tween-200.5 g dry milk10 µL Anti-GST antibody

2.8: Staining with Amido Black and detection using secondary antibody

Amido Black Stain112.5 ml Methanol5.0 ml Acetic Acid

45

0.25 g Amido Black132.5 ml dH2O

Amido Black Destain112.5 ml Methanol5.0 ml Acetic Acid132.5 ml dH2O

Secondary Antibody Dilution (1:10,000)4 µL Anti-Rabbit IgG40 ml TBS-T

Appendix B: Sterile TechniqueIt is very important in microbiology and genetics to work with pure cultures. Unfortunately, this is difficult. The world around us is covered with microorganisms. Microorganisms are even carried on dust particles in the air. In order to protect sterile broth, plates, slants and pure cultures from the microbes all around us, we must practice sterile (aseptic) technique. This simply means that sterile surfaces or sterile media must be protected from contamination by microbes in the air or residing on non-sterile surfaces. A simple example of the problem is that a sterile Petri plate can become contaminated with bacteria when the lid is removed. In sterile technique, only sterile surfaces touch other sterile surfaces and exposure to the air is kept to a minimum.

In the classroom, you often need to practice sterile technique when you inoculate a pure culture of a microorganism into fresh medium. Sometimes this is a transfer to a tube of liquid broth and at other times, it is a transfer to a petri plate-containing agar. While there are other circumstances that require sterile technique, these are the most common and they will be described in more detail on the pages that follow.

Appendix C: Spread Plate Technique

1. Dispense the appropriate volume of sample into the center of a sterile agar plate.2. Dip the glass spreader (aka “hockey stick”) in alcohol. 3. Pass the spreader through the flame of a Bunsen burner to burn off the alcohol. (This

sterilizes the spreader).

***IMPORTANT***Keep the dish of alcohol behind the Bunsen burner.

Keep the alcohol dish covered when you are not using it.Keep your hand above the spreader at all times or flaming alcohol may roll toward your hand.

If the dish of alcohol catches on fire, cover the dish with the glass lid and it will go out.

4. Cool the spreader by touching it to the agar where there is no sample.

46

5. Spread your sample over the entire surface of the agar.6. Sterilize the spreader before putting it back on the bench.

Appendix D: Use of a Rainin Pipettor

Take note: Never rotate the volume adjustor beyond the upper or lower range of the pipettor, as

stated by the manufacturer. Never use the pipettor without the tip in place; this could ruin the precision piston that

measures the volume of fluid. Never lay down the pipettor with a filled tip; fluid could run back into the piston. Never let plunger snap back after withdrawing or ejecting fluid; this could damage the

piston. Never immerse the barrel of the pipettor in fluid. Never flame pipettor or tips. Careful with the p-10 pipettors. These should be gently tapped into a tip, not slammed.

They will snap off!

If you drop your pipettor, the precision piston system can be damaged; therefore, if your pipettor is dropped, be sure to check the pipetting accuracy has not been affected.

Recommended Volume Ranges:Model p10: 0.5-10 μL, the number after the decimal point is in redModel p20: 1-20 μL, the number after the decimal point is in redModel p200: 20-200 μL, there is no decimal pointModel p1000: 200-1000 μL, the numbers after the decimal point are in black

Pipetting Directions – Method1. Set the desired volume by holding the pipettor body in one hand and turning the

volume adjuster knob until the correct volume shows on the digital indicator. Approach the desired volume by dialing downward from a larger setting.

2. Press tip onto shaft by a slight twisting or tapping motion.3. Depress the plunger to FIRST POSITIVE STOP. This part of the stroke is the calibrated

volume displayed on the digital micrometer.4. Holding the pipettor vertically (never more than 20˚ from vertical), immerse the tip just

below the level of the liquid.5. Allow the pushbutton to return SLOWLY to the up position. Move the tip so that it stays

slightly below the level of the liquid as you draw up.6. Wait one to two seconds to ensure that the full volume of sample is drawn up into the

tip.7. Withdraw the tip from the sample liquid.8. To dispense the sample, place the tip end against the sidewall of the receiving vessel

and depress the plunger to the FIRST STOP. Wait one to two seconds. Then depress the plunger to the SECOND STOP, expelling any residual liquid in the tip.

9. With the plunger fully depressed, withdraw the pipettor from the vessel carefully with

47

the tip sliding along the wall of the vessel.

10. Let the plunger return slowly to the UP position. If an air bubble is observed, re-pipette the sample.

11. Pre-rinsing the tip with the liquid being pipetted is recommended. A significant film may be retained on the inside wall of the tip, resulting in an error. Since the film remains relatively constant in successive pipettings with the same tip, refilling the tip a second time and using this quantity as the sample may obtain good reproducible results.

12. Discard the tip by depressing the tip ejector button smartly in the appropriate waste container.

48

APPENDIX E: GST Plasmid Map

49

APPENDIX F: Frequently Used DNA/Protein Markers

Lambda DNA-Hind III Digest Prestained Protein Marker

100 bp DNA Ladder 1Kb DNA Ladder

50

APPENDIX G: Streak Plate Method1 2

3 4

5

Flame loop in between each step except between 4 and 5.Do not flame loop between steps 4 and 5.

51

APPENDIX H: PCR Reagents and Conditions for 1.17

Cycling Program: GST

95°C 5 min Initial Denaturation

95°C 1 min5X50°C 1 min

72°C 1 min

95°C 1 min25X51°C 1 min

72°C 1 min

72°C 10 min Final elongation°C HOLD ***************

SAMPLESInitial Stock Concentration Components 1 2 3 4 5 6 7 Template DNA* 1 1 1 3 colonies 3 colonies 1 1 10X Buffer 2.5 2.5 2.5 2.5 2.5 2.5 2.525mM MgCl2 1 3 6 1 1 1 110mM dNTPs 0.5 0.5 0.5 0.5 0.5 0.5 0.520μM Forward Primer 1.25 1.25 1.25 1.25 1.25 XXX 1.2520μM Reverse Primer 1.25 1.25 1.25 1.25 1.25 1.25 XXX5U/μl Taq Polymerase 0.25 0.25 0.25 0.25 0.25 0.25 0.25 dH2O

*NOTE: Samples 1-3, 6 & 7: Use PLASMID DNASample 4: Transformed ColoniesSample 5: Non-Transformed ColoniesDESIRED FINAL VOLUME: 25µL

52

APPENDIX I: Southern Blot Setup

53

Platform

10 CM

10X SSC

Wick

Paper Towels

Whatman Paper

Whatman Paper

Nitrocellulose

Agarose Gel

APPENDIX J: Protein Gel Setup

54

APPENDIX K: Protein Gel Running Setup

55

56

APPENDIX L:

PIERCE PROTEIN ASSAY for Module 2 Practice RunOD Value

Label L Alb (Stock 2mg/ml)

L dH2O ml Dye

[Alb g/ml] ReadingA

Reading B

S1 (blank) 0 100 2 0S2 2.5 97.5 2 50S3 5.0 95.0 2 100S4 7.5 92.5 2 150S5 10.0 90.0 2 200S6 12.5 87.5 2 250S7 15.0 85.0 2 300S8 25.0 75.0 2 500

Label L Sample

L dH2O

ml Dye OD Values g/ml in

Cuvette

g/ml Original Solution

Unknown 1 2Unknown 2 2

222222

Label L Sample

L dH2O

ml Dye OD Values g/ml in

Cuvette

g/ml Original Solution

Unknown 1 2

57

Unknown 2 2222222

APPENDIX M:

PIERCE PROTEIN ASSAY for Module 2

58

OD ValueLabel L Alb (Stock

2mg/ml)L dH2O ml

Dye[Alb g/ml] Reading

AReading

BS1 (blank) 0 100 2 0S2 5.0 95.0 2 100S3 7.5 92.5 2 150S4 10.0 90.0 2 200S5 12.5 87.5 2 250S6 15.0 85.0 2 300S7 25.0 75.0 2 500

Label L Sample

L dH2O

ml Dye OD Values g/ml in

Cuvette

g/ml Original Solution

22222222

Label L Sample

L dH2O

ml Dye OD Values g/ml in

Cuvette

g/ml Original Solution

22222222

Label Average g/ml Original Solution of

g /lOriginal solution

l of protein that equates to 60g

59

each treatment totalTransformedTransformed + IPTGControlControl +IPTG

APPENDIX N: Graphing your protein data in Excel(Leigh – please inert your awesome instructions here for graphing!)

APPENDIX N: Graphing your protein data in Excel

1. Enter your standard concentrations into column A.2. Enter the measured ABS into columns B and C.3. Calculate average of each reading into column D.4. Highlight columns A and D.5. On the insert tab, choose scatter plot with no lines.6. Right click on the graph data and choose trend line.

a. Click on linearb. Choose Display equation on chartc. Choose Display R-squared value on chart

7. Label axes, and title.

Adding Error Bars8. Enter standard deviation formula into column E

a. Place the curser into E1 and clicking on Formulas, b. Select insert function, c. Select STDEV,d. Click OK, e. Click the square in the number 1 line.f. Highlight B1 and C2 cells.g. Click the square in the Number 1 line. h. Click OK. i. Copy formula down column E.

9. Click onto the chart.10. In the chart tools at the top of the sheet, choose Layout

60

11. Under layout, choose Error Bars,” more error bars options”.12. Choose both + and – error bars.13. Choose Custom and specify value.14. Highlight the standard deviations in column E for both plus and minus.15. Click OK.16. Click close.

APPENDIX N: RPM to G-Force Conversions

Equipment RPM G-Force (RCF)Beckman J2-21 w/JA 14 rotor (250mL tubes) 5,000 3,840Beckman J2-21 w/JA 17 rotor (30 mL tubes) 5,000 3,440Beckman J2-21 w/JA 17 rotor (30 mL tubes) 9,500 12,400Beckman J2-21 w/JA 17 rotor (30 mL tubes) 15,000 31,000IEC Centra 7 Desktop w/ 15 mL tubes 2,800 1,098IEC Centra 7 Desktop w/ 50 mL tubes 2,800 1,098Eppendorf Centrifuge 5702 w/ 15 mL tubes 2,800 1,120Eppendorf Centrifuge 5702 w/ 50 mL tubes 2,800 1,180Eppendorf Centrifuge 5415 C w/ 1.5 mL tubes 14,000 15,980Sorvall Legend Centrifuge w/ 1.5 mL tubes 14,000 18,800

61

Notes

62

Notes

Notes

63

Notes

Notes

64

Notes

Notes

65

Notes

Notes

66

Notes

Notes

67

Notes

68