co-ordination of tgf-β and fgf signaling pathways in bone organ cultures
TRANSCRIPT
Co-ordination of TGF-b and FGF signaling pathways
in bone organ cultures
Aditi Mukherjeea,b,1, Sai Sai Dongc,1, Thomas Clemensa, Jesus Alvarezc,2, Rosa Serrac,*
aDepartment of Pathology, University of Alabama, Birmingham, AL, USAbDepartment of Cellular and Molecular Physiology, University of Cincinnati, Cincinnati, OH, USA
cDepartment of Cell Biology, University of Alabama at Birmingham, 1918 University Blvd, Birmingham, AL 35294-0005, USA
Received 3 June 2004; received in revised form 9 November 2004; accepted 9 November 2004
Available online 26 November 2004
Abstract
Transforming growth factor-b (TGF-b) is known to regulate chondrocyte proliferation and hypertrophic differentiation in embryonic bone
cultures by a perichondrium dependent mechanism. To begin to determine which factors in the perichondrium mediate the effects of TGF-b,
we studied the effect of Insulin-like Growth Factor-1 (IGF-I) and Fibroblast Growth Factors-2 and -18 (FGF2, FGF18) on metatarsal organ
cultures. An increase in chondrocyte proliferation and hypertrophic differentiation was observed after treatment with IGF-I. A similar effect
was seen after the perichondrium was stripped from the metatarsals suggesting IGF-I acts directly on the chondrocytes. Treatment with FGF-
2 or FGF-18 resulted in a decrease in bone elongation as well as hypertrophic differentiation. Treatment also resulted in a decrease in BrdU
incorporation into chondrocytes and an increase in BrdU incorporation in perichondrial cells, similar to what is seen after treatment with
TGF-b1. A similar effect was seen with FGF2 after the perichondrium was stripped suggesting that, unlike TGF-b, FGF2 acts directly on
chondrocytes to regulate proliferation and hypertrophic differentiation. To test the hypothesis that TGF-b regulates IGF or FGF signaling,
activation of the receptors was characterized after treatment with TGF-b. Activation was measured as the level of tyrosine phosphorylation
on the receptor. Treatment with TGF-b for 24 h did not alter the level of IGFR-I tyrosine phosphorylation. In contrast, treatment with TGF-bresulted in and increase in tyrosine phosphorylation on FGFR3 without alterations in total FGFR3 levels. TGF-b also stimulated expression
of FGF18 mRNA in the cultures and the effects of TGF-b on metatarsal development were blocked or partially blocked by pretreatment with
FGF signaling inhibitors. The results suggest a model in which FGF through FGFR3 mediates some of the effects of TGF-b on embryonic
bone formation.
q 2004 Elsevier Ireland Ltd. All rights reserved.
Keywords: Endochondral bone; Cartilage; Perichondrium; FGFR3; FGF18; IGF
1. Introduction
Endochondral bone formation involves the formation of
a cartilaginous template and its subsequent replacement by
osteoblasts to form bone (Cancedda et al., 1995). The
regulation of chondrocyte growth and differentiation during
this process is critical for proper skeletal development.
0925-4773/$ - see front matter q 2004 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.mod.2004.11.006
* Corresponding author. Tel.: C1 205 934 0842; fax: C1 205 975 5648.
E-mail address: [email protected] (R. Serra).1 These authors contributed equally to the work.2 Current address: Departamento de Morfologı́a y Biologı́a Celular,
Instituto Universitario de Oncologı́a del Principado de Asturias (IUOPA),
Facultad de Medicina, Universidad de Oviedo, Oviedo 33006, Asturias,
Spain.
Defects in regulation of this process can lead to disorders in
skeletal morphogenesis. Endochondral bone formation is
regulated by multiple mechanisms including factors ema-
nating from the surrounding matrix, oxygen supply,
inflammatory mediators, cytokines, and various growth
factors. Transforming growth factor-beta (TGF-b), insulin-
like growth factor-1 (IGF-1) and fibroblast growth factors
(FGFs) are important growth factors in bone and their
functions and interactions at various stages of bone
development control the pace of chondrocyte
differentiation.
The members of the TGF-b super family are secreted
signaling molecules that regulate many aspects of growth
and differentiation (reviewed in Massague, 1998; Moses
Mechanisms of Development 122 (2005) 557–571
www.elsevier.com/locate/modo
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571558
and Serra, 1996; Roberts and Sporn, 1990; Serra and
Chang, 2003). Members of the TGF-b superfamily are
expressed in embryonic and adult skeletal tissue (Gatherer
et al., 1990; Heine et al., 1987; Millan et al., 1991; Pelton
et al., 1990, 1991; Sandberg et al., 1988). TGF-bpromotes chondrogenesis in early-undifferentiated
mesenchymal cells (Denker et al., 1994; Leonard et al.,
1991) but inhibits hypertrophic differentiation in mature
cultures (Ballock et al., 1993; Bohme et al., 1995; Kato
et al., 1988; Serra et al., 1999; Tschan et al., 1993).
TGF-b inhibits both growth and hypertrophic differen-
tiation in embryonic metatarsal cultures in a perichon-
drium dependent manner (Alvarez et al., 2001, 2002).
Previous findings using chick tibiotarsus cultures showed
that the perichondrium can elaborate signals that nega-
tively regulate both chondrocyte proliferation and differ-
entiation (Di Nino et al., 2001; Long and Linsenmayer,
1998). Parathyroid Hormone (PTH) was shown to prevent
increased differentiation resulting from removal of the
perichondrium and our previous results indicated that
TGF-b regulated hypertrophic differentiation through
PTHrP (Long and Linsenmayer, 1998; Serra et al.,
1999). The mechanism of TGF-b mediated growth
inhibition through perichondrium was not addressed. It
is likely one or more factors in the perichondrium are
involved.
Several factors have been shown to regulate chondrocyte
proliferation in vivo. The most well characterized effects are
those of FGF and IGF. Fibroblast Growth Factor Receptor 3
(FGFR3) is expressed in chondrocytes in the proliferating
zone (Deng et al., 1996; Peters et al., 1993). The association
of Fgfr3 mutations in human dwarfing conditions and
results from genetically altered mice clearly show a role for
FGF and specifically FGFR3 in negatively regulating
chondrocyte growth (reviewed in Coumoul and Deng,
2003; Naski and Ornitz, 1998). Fgfr3-null mice demonstrate
skeletal overgrowth (Colvin et al., 1996; Deng et al., 1996)
while mice with an activating mutation in Fgfr3
(Fgfr3G380R) demonstrate dwarfism as a result of reduced
chondrocyte proliferation (Naski et al., 1998). Other
activating mutations of Fgfr3 (Fgfr3G375C and Fgfr3K650E)
also cause inhibition of both proliferation and differentiation
of chondrocytes resulting in retarded bone growth (Chen
et al., 1999; Li et al., 1999). Mice with Fgfr3-K644E
mutation (analogues to human thanatophoric dysplasia
type II) and Fgfr3-K644M mutation (analogues to human
severe achondroplasia with developmental delay and
acanthosis nigricans, SADDAN mutation) also show
dwarfism due to defective long bone development (Iwata
et al., 2000, 2001).
FGFR1 and FGFR2 are expressed in the perichondrium
and FGFR1 is also expressed in the hypertrophic chon-
drocytes unlike FGFR3, which is mainly expressed in
proliferating chondrocytes (Delezoide et al., 1998; Orr-Ur-
treger et al., 1991; Peters et al., 1992, 1993). The exact role
of FGFR1 and FGFR2 in endochondral bone formation is
not clear. Mutations in Fgfr-1 and -2 are associated mainly
with the craniosynostosis syndromes, with some appendi-
cular skeleton defects (Burke et al., 1998; Naski and Ornitz,
1998; Wilke et al., 1997).
Misexpression of FGF2 or FGF9 in chondrocytes also
results in skeletal dysplasia primarily due to reduced
chondrocyte proliferation (Coffin et al., 1995; Garofalo
et al., 1999). In addition, the total length and hypertrophic
area is reduced in embryonic rodent bones in organ culture
treated with FGF2 (Chen et al., 2001; Mancilla et al., 1998).
Recently, it was suggested that FGF18 is the endogenous
ligand of FGFR3 in prehypertrophic chondrocytes (Liu
et al., 2002; Ohbayashi et al., 2002). Mice with targeted
deletion of Fgf18 demonstrate increased proliferation,
similar to what is observed in Fgfr3-null mice. Furthermore,
FGF18 is expressed in the perichondrium adjacent to
FGFR3 in prehypertrophic chondrocytes suggesting para-
crine interactions regulate chondrocyte proliferation in vivo.
FGFR3 may also directly or indirectly regulate hypertrophic
differentiation (Chen et al., 2001; Naski et al., 1998). This
response is separate and independent of PTHrP (Chen et al.,
2001).
Insulin-like Growth Factors (IGF-I and IGF-II) stimulate
proliferation in chondrocytes (reviewed in Dupont and
Holzenberger, 2003; Schmid, 1995). IGFs stimulate longi-
tudinal growth in rat neonatal metatarsal cultures (Coxam
et al., 1995, 1996) and targeted disruption of Igf1, Igf2, or
Igf1r results in dwarfism (Liu et al., 1993). IGF-I and IGF-II
mRNA have been localized to the perichondrium in
developing long bones (Beck et al., 1988; Han et al.,
1987) and the receptors are concentrated in chondrocytes
and osteoblasts throughout skeletal development (Wang
et al., 1995). The activity of IGF is controlled by a family of
extracellular binding proteins, IGFBP1 through IGFBP6.
IGFBPs are differentially expressed in a variety of tissues
and cell types. All six IGFBPs are expressed in bone and
modulate IGF bioavailability. The expression pattern of
IGFBPs has been characterized in growth plate chondro-
cytes (Wang et al., 1995) but expression in the perichon-
drium has been largely overlooked and has only been
reported for IGFBP6 (Van Kleffens et al., 1998). TGF-b has
been shown to regulate expression of IGFs, IGF receptor,
and IGFBPs in many cell types including chondrocytes
(de Los Rios and Hill, 2000; Kveiborg et al., 2001;
Tsukazaki et al., 1994).
We propose that factors from the perichondrium mediate
the effects of TGF-b on endochondral bone development.
To begin to determine which factors are involved in TGF-bmediated inhibition of endochondral bone formation, we
test the effects of FGF2, which activates FGFR3 on
chondrocytes, and IGF-I on intact and perichondrium-free
metatarsal bones in organ culture. The results suggest FGF
and IGF act directly on chondrocytes to regulate growth and
hypertrophic differentiation. Next, we demonstrate that
treatment with TGF-b stimulates phosphorylation of
FGFR3 and general inhibitors of FGF signaling block or
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 559
partially block the growth and differentiation effects of
TGF-b on the organ cultures. The results suggest that TGF-
b can activate FGF signaling pathways during endochondral
bone formation and that FGF signaling is at least partially
required for the effects of TGF-b on metatarsal develop-
ment. We then show that TGF-b stimulates expression of
FGF18 making it a candidate target for TGF-b in the
perichondrium.
2. Results
2.1. The effects of IGF-I and FGF2 on metatarsal
development are mediated directly through chondrocytes
TGF-b is known to regulate chondrocyte proliferation
and hypertrophic differentiation in metatarsal organ cultures
by a perichondrium dependent mechanism, suggesting the
involvement of additional factors (Alvarez et al., 2001,
2002). FGF and IGF are known mediators of chondrocyte
proliferation (Coumoul and Deng, 2003; Dupont and
Holzenberger, 2003). We proposed a model in which
TGF-b activates the FGF signaling pathway or down-
regulates the IGF pathway resulting in the reduction in total
bone length and chondrocyte proliferation observed in TGF-
b treated organ cultures. Since the effects of TGF-b are
dependent on the perichondrium, the first prediction of the
model is that the effects of FGF or IGF on endochondral
bone formation are due to direct action on chondrocytes.
First, the effect of IGF-I or FGF2 on development in our
organ culture model was determined. Metatarsal bones
isolated from embryonic day 15.5 mice were either
untreated or treated with 10, 30, and 100 ng/ml of IGF-I
or FGF2 for 5 days (Fig. 1). Treatment with 100 ng/ml or
IGF-I or FGF2 gave the maximal response. Treatment with
IGF-I resulted in an overall increase in the length of the
bone while treatment with FGF2 resulted in a decrease in
the total bone length as previously described (Fig. 1A–C,G;
Coxam et al., 1996; Mancilla et al., 1998).
Total bone length is a combination of changes in
hypertrophic differentiation and proliferation during the
development of the bone. As previously described,
hypertrophic cartilage is seen as the clear area in the center
of the organ culture (Dieudonne et al., 1994; Serra et al.,
1999). Hypertrophic differentiation was measured as the
length of the clear area over the total length of the bone. The
measurement normalizes for any differences in the total
length of the bone. Treatment with IGF-1 resulted in an
increase in the amount of hypertrophic cartilage in the
culture and treatment with FGF2 resulted in a dramatic
decrease (Fig. 1H). The level of hypertrophic differentiation
measured in this way correlated with the percentage of
histologically hypertrophic cartilage observed in hematox-
ylin and eosin stained sections from each of the conditions
tested (Fig. 1D,E) and in the area of cartilage expressing
Col10a mRNA (not shown).
Next, the effects of each factor on proliferation were
measured as the percentage of cells that incorporated BrdU
into their nucleus (Fig. 1I–L). Treatment with IGF-I for 24 h
resulted in an increase in labeled chondrocytes relative to
untreated controls (Fig. 1L). Treatment with FGF2 resulted
in a decrease in the number of labeled chondrocyte nuclei;
however, the number of labeled nuclei was increased in the
perichondrium (Fig. 1K). The effects of FGF2 on develop-
ment of the metatarsal cultures mimicked the effects of
TGF-b previously reported (Serra et al., 1999). That is both
TGF-b and FGF2 inhibit hypertrophic differentiation and
chondrocyte proliferation while promoting proliferation in
the perichondrium.
Next, the role of the perichondrium in IGF-I and FGF2
mediated effects on metatarsal development were deter-
mined (Fig. 2). FGF and IGF ligands as well as IGFBPs
have already been localized to the perichondrium (Beck
et al., 1988; Han et al., 1987; Liu et al., 2002; Ohbayashi
et al., 2002; Van Kleffens et al., 1998) while FGFR3 and
IGFR1 are localized on prehypertrophic chondrocytes
(Deng et al., 1996; Peters et al., 1993; Wang et al., 1995).
Metatarsal bones in which the perichondrium had been
enzymatically removed were either untreated or treated with
IGF-I or FGF2 for 5 days. The total length and hypertrophic
area of the cultures was then measured (Fig. 2). Treatment
with IGF-I again resulted in an increase in the total length
and hypertrophic area of the bone suggesting that the effects
of IGF-I on chondrocytes are direct and not mediated
through the perichondrium. Treatment with FGF2 resulted
in a decrease in total length and hypertrophic area in the
absence of the perichondrium suggesting that, unlike
TGF-b, the effects of FGF2 on chondrocytes are direct.
2.2. TGF-b activates FGF signaling
If TGF-b acts through IGF or FGF we would expect that
treatment with TGF-b would result in alterations in the
activation state of the receptors. To test this hypothesis,
metatarsal cultures were either untreated or treated with
10 ng TGF-b/ml for 24 h. Bones treated with either FGF2 or
IGF-I were used as positive controls. IGFR1 phosphoryl-
ation was detected by Western blot using a phospho-IGFR1
specific antibody (Fig. 3). The total level of IGFR1 beta
subunit was also determined by Western blot. Alterations
were not detected in the total level or phosphorylation state
of the IGFR1 after treatment with TGF-b for 24 h (Fig. 3);
however, a reduction in the total level of IGFR1 was
detected after 5 days of treatment (not shown). FGFR3 was
immunoprecipitated from protein extracts made from
untreated and TGF-b treated metatarsals. Receptor
phosphorylation was detected by anti-phosphotyrosine
immunoblot. To control for the total receptor levels,
receptor protein was detected in blots that were stripped
of the anti-phosphotyrosine antibody and incubated with an
antibody for FGFR3. Alterations were not detected in the
total level of FGFR3 protein (Fig. 3). Little to no
Fig. 1. Effects of IGF-I and FGF2 on metatarsal bone development in organ culture. Metatarsal bones were cultured for 5 days in the absence (A) or
presence of 100 ng IGF-I/ml (B), or 100 ng FGF2/ml (C). The total length of bones was measured and the means and standard deviations were calculated
and graphed (G). Statistical significance was calculated using a Student’s t-test. P-values less than 0.0001 are indicated with an asterisk. Bones that were
untreated (D) or treated with IGF-I (E) or FGF2 (F) for 5 days were sectioned and stained with hematoxylin and eosin. The percent area of hypertrophic
cartilage was measured and the means and standard deviations were graphed (H). Statistical significance was calculated using a Student’s t-test. P-values
less than 0.0001 are indicated with an asterisk. Cultures that were untreated (I) or treated with IGF-I (J) or FGF2 (K) for 24 h were then incubated with
BrdU for 2.5 h. BrdU was detected by immunofluorescence. The percentage of BrdU positive cells was calculated and the means and standard deviations
were graphed (L). Treatment with IGF increased the total length, hypertrophic area, and incorporation of BrdU into the cultures. Treatment with FGF2
resulted in a reduction in the total length, percentage of hypertrophic cartilage, and incorpration of BrdU into chondrocytes.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571560
Fig. 2. The role of the perichondrium in IGF-I and FGF2 activity. The
perichondrium was enzymatically removed from metatarsal bones that
were then left untreated (A) or were treated with 100 ng IGF-I/ml (B) or
100 ng FGF2/ml (C). After 5 days in culture the total length (D) and the
percentage of the clear area representing hypertrophic cartilage (E) were
measured. The means and standard deviations were determined and
graphed. Statistical significance was calculated using a Student’s t-test.
P-values less than 0.0001 are indicated with an asterisk. Signaling by IGF-I
and FGF2 are not dependent on the perichondrium.
Fig. 3. Effects of TGF-b on IGF and FGF receptor activation. Proteins were
isolated from untreated bones (U) and bones treated with 10 ng TGF-b1/ml
(b) or 100 ng IGFI/ml or 100 ng FGF2/ml (C). Proteins were used in a
straight Western blot for phosphorylated IGF receptor 1 (PO4-IGFR) and
total IGF receptor 1 b subunit (IGFR). For FGFR3, proteins were
immunoprecipitated with an antibody to FGFR3, run on a gel, and Western
blot was performed with a phosphotyrosine specific antibody (PO4-
FGFR3). The blot was then stripped and incubated with an FGFR3 antibody
(FGFR3). Treatment with TGF-b resulted in an increase in the amount of
PO4-FGFR3 without and increase in total FGFR3 levels.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 561
phosphorylated FGFR3 was detected in untreated cultures
whereas cultures treated with TGF-b or FGF2 demonstrated
significant phosphorylation of FGFR3 (Fig. 3). Increased
FGFR3 phosphorylation was also detected after 5 days of
treatment (not shown). The data together suggest that TGF-
b acts to regulate development of metatarsal bones at least
in part by regulating FGF signaling.
2.3. TGF-b regulates the expression of FGF
signaling molecules
To determine if TGF-b regulated expression of genes
that encode FGF signaling proteins, RNA was extracted
from metatarsal bones that were untreated or treated with
TGF-b for 24 h. Expression levels of FGF2 and FGF18
mRNA were determined using semi-quantitative RT-PCR
(Fig. 4). FGF18 has been detected in the perichondrium of
developing bones and is thought to act in a paracrine manner
through FGFR3 on chondrocytes (Liu et al., 2002;
Ohbayashi et al., 2002). FGF2 is also expressed in skeletal
elements. The specified gene and glyceraldehyde-3-phos-
phate dehydrogenase (GAPDH) were amplified from cDNA
generated from RNA extracted from untreated and TGF-btreated metatarsal cultures. GAPDH was used to control for
the amount and quality of RNA used in each reaction. PCR
amplification was performed for a varying number of cycles
Fig. 4. Gene expression in metatarsal bones treated with TGF-b. RNA was
isolated from metatarsal bones in culture that had been left untreated (0) or
were treated with 10 ng TGF-b1/ml (C) for 24 h. cDNA was generated
from the RNA and used in semi-quantitative PCR amplification. FGF2,
FGF18, and glyceraldehyde-3-phosphate dehydrogenase (G, Gapdh) were
amplified for varying numbers of cycles (20–45 cy). Gapdh was used to
control for the amount of RNA used. Samples run in the absence of reverse
transcriptase (RT-) were used to control for the presence of DNA
contamination in the samples. Molecular weight markers are shown (M).
To quantify changes in gene expression, band intensity measurements were
made using Kodak gel imaging software from two separate experiments.
After normalization, treatment with TGF-b resulted in FGF18 mRNA
levels that were 3.8- and 14.2-fold above the control. FGF2 was regulated
1.4- and 1.7-fold above the untreated control.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571562
to determine the linear range for PCR product formation.
Band intensities were determined using Kodak software.
Intensities were normalized to the intensity of the GAPDH
bands so that normalized fold-differences in gene
expression in untreated and treated tissue could be
determined. Treatment with TGF-b resulted in a dramatic
increase in the levels of FGF18 mRNA (3.8- and 14.2-fold
induction in two separate experiments). FGF2 was only
marginally regulated by TGF-b (1.4- and 1.7-fold induction
in two experiments). The data suggest that TGF-b can
modulate the FGF pathway by regulating expression of
important mediators of signaling.
2.4. FGF18 regulates proliferation and differentiation
in organ cultures
Since FGF18 was identified as being regulated by TGF-
b, the effects of FGF18 on development of the organ
cultures was investigated (Fig. 5). Two dose response
experiments were performed (Fig. 5 and data not shown).
Doses between 10 and 600 ng FGF18/ml were tested.
Treatment with 200 ng FGF18/ml for 5 days resulted in a
decrease in the total bone length that was significant
(P!0.05). Higher doses resulted in only marginal further
decreases in length (Fig. 5B). The area of hypertrophic
cartilage was also reduced after treatment for 5 days with
50 ng FGF18/ml. Higher doses resulted in significant further
reductions in hypertrophic differentiation (Fig. 5C and data
not shown). It has been shown that FGF18 binds with high
affinity to FGFR3 that is expressed on proliferating
chondrocytes (Xu et al., 2000). Treatment with 200 ng
FGF18/ml for 24 h resulted in decreased chondrocyte
proliferation as measured by the incorporation of BrdU
(Fig. 5D,E). The level of inhibition was comparable to that
observed with TGF-b in the same experiment (Fig. 5D,E).
In addition, like TGF-b, FGF18 increased proliferation in
the perichondrium (Fig. 5D). The results suggest that
FGF18 is sufficient to regulate the proliferation and
differentiation of chondrocytes in mouse metatarsal bones.
This observation, in addition to regulation of FGF18 mRNA
by TGF-b supports a model in which TGF-b may act
through FGF18 in the perichondrium to regulate chondro-
cyte proliferation and/ or differentiation.
2.5. FGF inhibitors alter TGF-b responsiveness
To determine if FGF signaling is required for some of the
effects of TGF-b on metatarsal development, cultures were
treated with inhibitors of FGF activity followed
by treatment with TGF-b. The inhibitors used were
PSS [poly(4-styrenesulfonic acid)] (Liekens et al., 1999)
and a 16mer inhibitory peptide that mimics the confor-
mation of the receptor binding domain of FGF2 but has no
sequence homology to FGF2 (Cosic et al., 1994). PSS binds
to FGF at the heparin binding domain and prevents
binding to the receptor and heparin sulfate proteoglycans.
This compound has been used to block FGF signaling in
lens organ cultures (Cerra et al., 2003). First, the efficacy
of the inhibitors to block signaling by FGF2 and FGF18
in organ cultures was tested (Figs. 6 and 7). Cultures
were either left untreated or treated with the indicated
inhibitors overnight at which time half of the cultures
were treated with FGF2 or FGF18 for 5 days. The total
length of the bones (Figs. 6B and 7B) and the area of
hypertrophic cartilage (Figs. 6C and 7C) were measured.
The mean, standard deviation, and significance were
calculated and graphed. The inhibitors alone had an
effect on metatarsal development. PSS treatment resulted
in increased length and hypertrophy. The 16mer peptide
resulted in a slight decrease in length and hypertrophy.
These effects may be due to blocking different endogen-
ous FGF signaling pathways. Treatment with FGF2 or
FGF18 alone resulted in a statistically significant
decrease in the total length and the percentage of the
bone that contained hypertrophic cartilage, as expected
from our previous experiments. In the presence of PSS,
treatment with FGF2 or FGF18 resulted in a similar
statistically significant decrease in length suggesting PSS
does not block the signaling pathway used by FGF2 or
FGF18 that affects total bone length (Figs. 6B and 7B).
In contrast, the presence of PSS blocked the ability of
FGF2 and FGF18 to inhibit hypertrophic differentiation
(Figs. 6C and 7C). In the presence of the 16mer peptide,
total length was not significantly inhibited by FGF2 or
FGF18 suggesting that this inhibitor blocks the signaling
pathways used by FGF to regulated total bone length
(Figs. 6B and 7B). The presence of the 16mer peptide
partially blocked or blocked the effects of FGF2
and FGF18, respectively, on hypertrophic differentiation.
In the absence of the inhibitor, the area of hypertrophic
cartilage was reduced to 37 or 67% of control after
treatment with FGF2 and FGF18, respectively. In the
presence of the inhibitor, the area of hypertrophic
cartilage was reduced to 63 or 79% of the control after
FGF2 or FGF18 treatment, respectively. The results
suggest that the 16mer inhibitor can block or at least
partially block the signaling pathways used by FGF2 and
FGF18 that regulate both growth and hypertrophic
differentiation.
Next, cultures were either untreated or pretreated with
PSS or the 16mer peptide followed by treatment with
TGF-b (Fig. 8). As expected, treatment with TGFb in the
absence of inhibitors resulted in a decrease in the area of
hypertrophic cartilage. Treatment with PSS blocked most
of the effects of TGF-b on hypertrophic differentiation.
In the absence of the inhibitor, the area of hypertrophic
cartilage after treatment with TGF-b was 58% the level
of the untreated control (Fig. 8C). In the presence of
PSS, the area of hypertrophic cartilage was reduced after
treatment with TGF-b to 88% the level of the untreated
control. The presence of the 16mer peptide partially
blocked the effects of TGF-b on hypertrophic
Fig. 5. Effects of FGF18 on metatarsal development. (A) Whole mount appearance of bones untreated (control), treated with 200 ng FGF18/ml, or 600 ng
FGF18/ml, for 5 days. The black bars along the bones mark the central clear area of hypertrophic cartilage. The total length (B) and percent hypertrophic area
(C) of the bones was calculated and graphed. Statistical significance was determined using Student’s t-test. Statistical significance relative to the untreated
control is indicated with an asterisk. P-values are indicated on the graph. FGF18 inhibited total length and hypertrophic differentiation in the metatarsal
cultures. (D) Bones that were either untreated (control) or treated with 200 ng/ml FGF18 or 10 ng/ ml TGF-b1 for 24 h were incubated with BrdU for 2.5 h.
BrdU incorporation was measured by immunofluourescence. The percentage of BrdU positive chondrocytes was calculated and graphed (E). The standard
deviation and statistical significance are shown. FGF18 inhibited chondrocyte proliferation.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 563
Fig. 6. Effects of FGF inhibitors on the FGF2 response. (A) Bones were untreated or pretreated with PSS or the 16mer peptide inhibitor followed by treatment
with 0 or 100 ng FGF2/ml. After 5 days, total bone length (B) and hypertrophic area (C) were measured. The means and standard deviations were calculated
and graphed. Statistical significance was calculated using a Student’s t-test. P-values are indicated on the graph. A single asterisk represents significance
relative to the 0 FGF2 control of the sample treated with the same drug. A double asterisk indicates significance relative to the control without drug and without
FGF2. The dark lines next to the bones marks the clear area representing the hypertrophic zone.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571564
differentiation (Fig. 8C). In the absence of the inhibitor,
TGF-b inhibited hypertrophic differentiation to 49% the
level seen in the untreated control. In the presence of the
16mer peptide hypertrophic differentiation was reduced to
only 75% the level of control without TGF-b. The results
suggest that the FGF inhibitors, PSS and the 16mer
peptide, block or partially block the signaling pathway
used by TGF-b to regulate hypertrophic differentiation.
Since the drugs also block the effects of FGF2
and FGF18 on hypertrophic differentiation, we propose
that part of the effects of TGF-b on hypertrophic
differentiation are mediated through FGF.
Treatment with TGF-b in the absence of inhibitors
resulted in a decrease in the overall length of the bone as
previously reported (Fig. 8B). Total length was not
significantly altered after treatment with TGF-b in the
presence of the PSS inhibitor suggesting PSS blocked the
effects of TGF-b on length. However, since PSS did not
affect the signaling pathways used by FGF2 or FGF18
that regulate total bone length, it is not clear if this effect
of TGF-b is mediated through FGF2 or FGF18.
Furthermore, in the presence of the 16mer peptide,
TGF-b significantly inhibited bone length albeit to a
lesser degree than that seen in the absence of the peptide
(Fig. 8B). The 16mer peptide was able to more
completely block the effects of FGF2 and FGF18 on
bone length suggesting FGF may only partially mediate
the effects of TGF-b on bone length.
3. Discussion
TGF-b1 inhibits hypertrophic differentiation and chon-
drocyte proliferation by a perichondrium dependent mech-
anism in embryonic metatarsal cultures (Alvarez et al.,
2001; Alvarez et al., 2002). We proposed IGF and/or the
Fig. 7. Effects of FGF inhibitors on the FGF18 response. (A) Bones were untreated or pretreated with PSS or the 16mer peptide inhibitor followed by treatment
with 0 or 200 ng FGF18/ml. After 5 days, total bone length (B) and hypertrophic area (C) were measured. The means and standard deviations were calculated
and graphed. Statistical significance was calculated using a Student’s t-test. P-values are indicated on the graph. A single asterisk represents significance
relative to the 0 FGF18 control of the sample treated with the same drug. A double asterisk indicates significance relative to the control without drug and
without FGF18. The dark lines next to the bones marks the clear area representing the hypertrophic zone.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 565
FGF systems as the possible targets of TGF-b1 in the
perichondrium. We established that IGF-I and FGF2 can
regulate chondrocyte growth and differentiation in the
embryonic metatarsal cultures independent of the perichon-
drium. To test the hypotheses that TGF-b1 either down
regulates the IGF system and/or up regulates the FGF
system, we looked at IGFR1 and FGFR3 phosphorylation
after treatment with TGF-b. FGFR3 phosphorylation was
increased after TGF-b treatment but no change in IGFR1
phosphorylation was observed. We then focused on FGF
signaling. The inhibition of FGF signaling by pretreatment
with FGF inhibitors was used to access the requirement for
FGF signaling in the TGF-b response. The results suggested
that TGF-b1 regulates endochondral bone formation in
culture at least in part through activation of FGF signaling.
We also showed that TGF-b stimulates expression of FGF18
mRNA making it a likely target for TGF-b in the
perichondrium.
During endochondral bone formation, the perichon-
drium is involved in signaling pathways which negatively
regulate chondrocyte proliferation and differentiation (Di
Nino et al., 2001; Long and Linsenmayer, 1998),
including Ihh and TGF-b signaling (Alvarez et al.,
2001, 2002; Long et al., 2001). In contrast, we found that
both IGF-I and FGF2 can regulate chondrocyte growth
and differentiation even in the absence of the perichon-
drium. The treatment of metatarsal organ cultures with
IGF-I resulted in an increase in total bone length and
hypertrophic differentiation while treatment with FGF2
caused a decrease in bone length and hypertrophic
differentiation, both in the presence and the absence of
the perichondrium. Both IGF-I and IGF-II, and many
FGF ligands, most notably FGF18, (Beck et al., 1988;
Han et al., 1987; Liu et al., 2002; Ohbayashi et al., 2002;
Van Kleffens et al., 1998) are known to be expressed in
the perichondrium during endochondral bone formation
Fig. 8. Effects of FGF inhibitors on TGF-b response. Metatarsal bones were treated with PSS or with two concentrations of a 16mer inhibitor. They were then
treated with TGF-b1 and the bones were photographed after 5 days and total bone length (B) and hypertrophic area (C) were measured. The means and standard
deviations were calculated and graphed. Statistical significance was calculated using a Student’s t-test. P-values are indicated on the graph. A single asterisk
represents significance relative to the 0 TGF-b control of the sample treated with the same drug. A double asterisk indicates significance relative to the control
without drug and without TGF-b. PSS and, to a lesser extent, the higher concentration of the 16mer partially blocked the inhibitory effects of TGF-b on the total
length and hypertrophic area observed in the cultures. The dark lines next to the bones marks the clear area representing the hypertrophic zone. PSS and the
40 nM concentration of the 16mer peptide were tested in separate experiments.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571566
and it is possible that they are mediating the perichon-
drium dependent effects of TGF-b.
FGF signaling has been shown to play a critical role in
the regulation of bone growth. FGFR3 is expressed in
proliferating and prehypertrophic chondrocytes in the
epiphyseal growth plates (Naski et al., 1998; Ohbayashi
et al., 2002; Peters et al., 1993). It has been shown that
expression of activating Fgfr3 mutants in mice results in
dwarfism (Coumoul and Deng, 2003). In contrast, lack of
Fgfr3 in mice causes skeletal overgrowth, indicating that
FGFR3 signaling inhibits endochondral bone growth
(Colvin et al., 1996; Deng et al., 1996), making FGF
signaling a likely candidate for mediating the inhibitory
effects of TGF-b during endochondral bone formation. The
relationship between TGF-b and FGF signaling during
endochondral bone formation was explored in this study.
The results show that TGF-b increases FGF18 mRNA levels
and FGFR3 phosphorylation in the organ cultures,
suggesting that TGF-b1 may be targeting perichondrial
FGF ligands that in turn activate FGFR3, which is known to
inhibit chondrocyte proliferation and differentiation.
Recent work has suggested that FGF18 is the endogenous
ligand of FGFR3 in prehypertrophic chondrocytes (Liu
et al., 2002; Ohbayashi et al., 2002), and the expression of
FGF18 in the perichondrium has also been reported (Liu
et al., 2002; Ohbayashi et al., 2002) making it a possible
perichondrial target for TGF-b1. In our studies, TGF-b1
increases expression of FGF18 mRNA. Recent genetic
studies have identified a defect in chondrogenesis and
osteogenesis in mice lacking Fgf18 similar to that seen in
the Fgfr3 mutant mice (Liu et al., 2002; Ohbayashi et al.,
2002). Our study demonstrated that treatment of the
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 567
metatarsal organ cultures with FGF18 also results in
inhibition of chondrocyte proliferation and hypertrophic
differentiation, similar to treatment with FGF2, another
ligand for FGFR3.
We used two inhibitors of FGF signaling to determine if
there was a functional connection between TGF-b and FGF
signaling in endochondral bone formation. The first inhibitor,
PSS, is a heparin-mimicking polysulfonated compound
(Liekens et al., 1999). It was shown to inhibit binding of
FGF2 to heparin sulfate proteoglycans, abrogating the FGF/
proteogylcan and receptor complex. PSS has been used in
cell culture and organ culture models to block the effects of
FGF2 on specific biological processes (Cerra et al., 2003;
Liekens et al., 1999). The second inhibitor used was a novel
16mer peptide that was developed through resonant
recognition modeling (Cosic et al., 1994). The peptide has
conformational similarity to the receptor-binding domain of
FGF2 but has no sequence homology. It has been shown to
block FGF2 binding to FGFR1 and inhibit FGF2 induced
proliferation in fibroblasts and human glioma cells (Cosic
et al., 1994; Kono et al., 2003). Both inhibitors have been
characterized with regards to FGF2 and it’s high affinity
receptor FGFR1. It was not clear if the inhibitors would have
the same efficacy against FGF2 and FGF18 signaling in
metatarsal organ cultures. In the present study, we showed
that both inhibitors are able to block specific effects of FGF2
and FGF18. PSS blocked the effects of both FGF2 and FGF18
on hypertrophic differentiation but did not block the effects
on total bone length. The result suggests there may be
differences in the way FGF regulates proliferation versus
differentiation. It has been suggested in a recent study that
during FGFR3 signaling in bone growth, the MAPK pathway
mediates inhibition of hypertrophic chondrocyte differen-
tiation, whereas Stat1 mediates inhibition of chondrocyte
proliferation (Murakami et al., 2004). In contrast to PSS, the
16mer peptide blocked the effects of FGF2 and FGF18 on
total bone length but only partially blocked the effects on
hypertrophic differentiation. In addition, treatment with the
inhibitors alone had and effect on development of the
metatarsals. Treatment with PSS resulted in longer bones
with more hypertrophic differentiation while treatment with
the 16mer peptide resulted in shorter bones with less
hypertrophic differentiation. The effects of the inhibitors
alone likely represent the blocking of various endogenous
FGF signaling pathways. It also illustrates one of the caveats
of drug studies, which is that the exact specificity of the drug
in a particular system is difficult to determine.
In the present study PSS and the 16mer peptide blocked
and partially blocked, respectively, the effects of TGF-b on
hypertrophic differentiation. The drugs had similar effects
on TGF-b and FGF-mediated inhibition of hypertrophic
differentiation. We interpret this result to mean that that
FGF is at least partially required to mediate the effects of
TGFb on hypertrophic differentiation. As mentioned above,
the specificity of PSS has not been clearly established and
we cannot rule out the requirement of additional heparin-
binding growth factors required for the TGF-b response.
Such a factor could be required for TGF-b mediated effects
on bone length which, were blocked by PSS under
conditions in which the effects of FGF on bone length
were not affected. Likewise, the partial block of TGF-beffects on bone length with the 16mer peptide suggest that
additional factors may be required for the TGF-b mediated
reduction in bone length.
As TGF-b has been shown to regulate expression of IGFs,
IGF receptor, and IGFBPs in many cell types including
chondrocytes (de Los Rios and Hill, 2000; Kveiborg et al.,
2001; Tsukazaki et al., 1994), we also investigated whether
TGF-b1 regulates activation of the IGF receptor in
embryonic growth plate. We did not detect alterations in
IGFR phosphorylation after treatment with TGF-b. A lack of
change in receptor phosphorylation does not necessarily
mean a lack of an effect. Receptors in cells that are not targets
of TGF-b could drown out any effects of TGF-b on a subset of
receptors, thus, any co-ordination between TGF-b and IGF
signaling needs to be investigated further.
In conclusion, the study shows that both IGF-I and FGF2
have perichondrium independent effects on chondrocyte
proliferation and differentiation and that TGF-b interacts
with components of FGF signaling during endochondral
bone formation. Our results suggest that FGF ligands,
perhaps FGF18, modulate some of the perichondrium-
dependent inhibitory effects of TGF-b1 during endochon-
dral bone formation. FGF 18 and/or FGFR-3 knock out
mouse models can be used to enable further studies aimed at
understanding co-ordination of TGF-b and FGF18 signaling
specifically. Investigating the complex interaction between
TGF-b and FGF systems, which are key regulators of
skeletal development, will enhance our understanding of the
process of endochondral bone formation immensely.
4. Materials and methods
4.1. Embryonic metatarsal rudiment organ culture
The three central metatarsals from the hind limbs of
day E15.5 mouse embryos were removed and placed in
culture as previously described (Dieudonne et al., 1994;
Serra et al., 1999). For experiments to remove the
perichondrium, metatarsals from one limb were stripped
of the perichondrium while those from the contralateral
limb were kept intact. Collagenase type 2, 1 mg/ml in
PBS (Worthington biochemical Corp.), was used to
remove the perichondrium, as previously reported (Haaij-
man et al., 1999; Thesingh and Burger, 1983). Enzymatic
activity was stopped by transferring the bones to 10%
Fetal Bovine Serum in PBS and the remaining perichon-
drium was removed mechanically by rolling on a plastic
surface. All rudiments were cultured in 24-well plates in
1 ml of medium containing alpha-MEM (Gibco-BRL)
supplemented with 0.05 mg/ml ascorbic acid, 0.3 mg/ml
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571568
L-glutamine, 0.05 mg/ml gentamycin, 1 mM b-glycero-
phosphate, and 0.2% Bovine Serum Albumin (BSA).
Explants were grown at 37 8C in a humidified 5% CO2
incubator. IGF-1 (GroPep, Australia), FGF2 or FGF18
(R&D Systems, MN or US Biologicals), or TGF-b1
(R&D Systems, MN) were added to cultures 12–16 h
after dissection. Inhibitors PSS [poly(4-styrenesulfonic
acid)], MWZ70,000, (PolySciences,) and a 16mer
inhibitory peptide (Bachem, #H2176) were added within
a few hours after the dissection and TGF-b was added
the next morning. Cultures were observed and photo-
graphed with an Olympus SZH12 dissecting microscope
after 5 days of treatment. Cultures were fixed in fresh
4% paraformaldehyde in PBS overnight at 4 8C then the
cultures were dehydrated through a series of ethanols and
xylene and embedded in paraffin. Sections (5 mm) were
stained with hematoxylin and eosin or used for
immunodetection of BrdU incorporation and for in situ
hybridization.
The length of bones was calculated after 5 days of
treatment by measuring the length of each metatarsal in
photographs taken with an Olympus SZH12 dissecting
microscope with a Magnafire digital camera. The total
length was measured in photographs that were all taken
at the same magnification (25!). The actual bone length
was calculated by dividing the length measured on the
images by the magnification indicated on the microscope
and camera. The mean, standard deviation, and signifi-
cance were determined using a Student’s t-test calculated
with Microsoft Excel. Groups with a probability value
less than 0.05% (P!0.05) were considered significantly
different.
The percent of the bone rudiment containing hypertrophic
cartilage was calculated after 5 days of treatment by three
separate methods: (1) Measuring the total length of the bone
rudiment and the length of the ‘clear’ area on whole bones
(Alvarez et al., 2001; Dieudonne et al., 1994). (2) Measuring
the histologically hypertrophic area in hematoxylin and eosin
stained sections and/or (3) Measuring the area of the bone
culture containing Type X collagen (Col10a1) mRNA after
in situ hybridization. Measurements were taken from
photographs from a SZH12 dissecting microscope for
pictures of whole bones or an Olympus BX-51 upright
microscope for pictures of sections. The percent of the total
cartilage that was hypertrophic was calculated as: (length of
hypertrophic zone/total length)!100. The mean and stan-
dard deviation was calculated for each group. Significant
Table 1
RT-PCR conditions
Gene Forward Reverse
GAPDH ACCACAGTCCATGCCATCAC ACCACC
FGF2 AAGCGGCTCTACTGCAAGAACG TTCTGTC
FGF18 CAGATACCTTCGGGAGTCAAGTCC GCAGTT
differences were determined using the Student’s t-test.
Significantly different results were indicated by P!0.05.
4.2. BrdU labeling
Metatarsal bones were untreated or treated with IGF-1,
FGF2, or FGF18 for 24 h followed by treatment with
10 mM BrdU (Boehringer Mannheim) for 2.5 h as
previously described (Alvarez et al., 2001). Metatarsal
rudiments were then washed twice in PBS at 37 8C, fixed
in paraformaldehyde at 4 8C overnight, embedded in
paraffin, and cut into 5-mm sections. Sections were
deparaffinized, denatured in 2 N HCl for 20 min at 37 8C,
and neutralized in 1% boric acid/0.0285% sodium borate,
pH 7.6. Next, the sections were treated with 0.005 mg
trypsin/ml 0.05 M Tris, pH 7.6, for 3 min at 37 8C and
washed three times in PBS. Immunostaining was then
performed using Vectastain Elite staining kit (Vector
Laboratories) as described by the manufacturer. A rat
mAb directed to BrdU (Harlan) was used as the primary
antibody at a 1:200 dilution. Cy3-conjugated avidin
(Vector Laboratories) was substituted for the avidin–
biotin-peroxidase complex in the Vector Elite kit. Excess
Cy3-conjugated avidin was removed from the sections by
washing three times for 10 min each in PBS at room
temperature. The nuclei were counterstained with YoPro
(Molecular Probes), washed, and immediately mounted
with Aquapoly mount (Poly Sciences). Fluorescence was
observed and imaged using an Olympus BX-51 upright
microscope with a Magnafire digital camera and Photo-
shop software. BrdU postive and negative cells were
counted in a 400! field of cells about halfway between
the hypertrophic area and the end of the bone at both
ends of each bone. Thus, two fields were counted in each
of three to four bones under each condition. Perichon-
drium and hypertrophic cells were excluded. The
percentage of labeled nuclei for each field was calculated
as the number of red, BrdU stained cells over the total
number of cells (redCgreen) in the field multiplied by
100. The mean, standard deviation, and P-values were
determined using Microsoft Excel.
4.3. Semi-quantitative RT-PCR
RNA was extracted from cartilage cultures by lysis in
guanidine thiocyanate using the Ambion RNaqueous kit
(Cat# 1912; (Austin, TX)) and the manufacturers instructions
with the modification that the cartilage rudiments were first
Product size (bp) Anneal (8C)
CTGTTGCTGTAGCC 448 57
CAGGTCCCGTTTTGG 344 50
TCCTCGTTCAAGTCCTCC 647 57
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 569
homogenized in the guanidine solution in a microcentrifuge
tube with a small pestle. RNA was treated with RNase free
DNase (Promega, Madison, WI) for 1 h at 37 8C, phenol:-
chloroform extracted, and ethanol precipitated. Precipitation
of RNA was facilitated with 20 mg glycogen per sample
(Boehringer Mannheim). RNA concentration was deter-
mined spectrophotometrically. For RT-PCR analysis, cDNA
was synthesized from 1 mg of total RNA using oligo dT
primers using standard protocols (Curent Protocols in
Molecular Biology, Wiley). For each sample 5 ml cDNA
was amplified with 0.2 mM primers and 0.2 mM nucleotides
for varying cycles (15–45 cycles). Samples incubated
without reverse transcriptase were used to determine if
there was DNA contamination in the RNA samples. GAPDH
was used as an internal control for the amount of cDNA used
in each reaction. The marker is the 100 bp ladder from In
Vitrogen. Band intensity was determined using Kodak 1D
software and the Kodak gel imaging system. Band intensities
were normalized to GAPDH and the fold-change in gene
expression with and without TGF-b was determined. Primer
sequences and conditions used are shown in Table 1.
4.4. Immunoprecipitation and immunoblotting
After the indicated time in culture the bones were
transferred to standard RIPA buffer and homogenized. The
amount of protein was quantified using the Biorad protein
assay and 1 mg of protein was immunoprecipitated using
an anti-FGFR3 antibody (Santa Cruz Biologicals, CA,
#SC-123) or anti-IGFR1 antibody (Oncogene Science,
#GR11T) and protein G conjugated agarose (Sigma, MO)
overnight at 4 8C. The extracts were centrifuged at
15,000 rpm for 15 min and the pellets were washed with
the lysis buffer three times. The pellet was resuspended in
standard denaturing sample buffer, heated in a boiling
water bath for 3 min then run on a 7% SDS-polyacryl-
amide gel. The protein was transferred to nitrocellulose
membranes (BIORAD) and incubated with anti-phospho-
tyrosine antibody (PY20, Oncogene Science), anti-IGF
receptor1 beta antibody (Santa Cruz Biologicals, #sc-713)
or anti-FGR3 antibody (Santa Cruz Biologicals #SC-123).
The membrane was incubated with the appropriate
HRP-conjugated secondary antibody then developed
using the ECL kit from Amersham. For Western blots of
activated IGFR1, a phospho-specific IGFR1 antibody was
used (Cell Signaling, #3021). For straight Western blots,
equal amount of protein was loaded into each well. The
blots were processed as described (Current Protocols in
Molecular Biology, Wiley).
Acknowledgements
We thank Philip Sohn for excellent technical assistance.
This work is supported by AR45605 and AR46982 from
NIAMS/ NIH to Dr Serra.
References
Alvarez, J., Horton, J., Sohn, P., Serra, R., 2001. The perichondrium plays
an important role in mediating the effects of TGF-beta1 on
endochondral bone formation. Dev. Dyn. 221, 311–321.
Alvarez, J., Sohn, P., Zeng, X., Doetschman, T., Robbins, D.J., Serra, R.,
2002. TGFbeta2 mediates the effects of hedgehog on hypertrophic
differentiation and PTHrP expression. Development 129, 1913–1924.
Ballock, R.T., Heydemann, A., Wakefield, L.M., Flanders, K.C.,
Roberts, A.B., Sporn, M.B., 1993. TGF-b1 prevents hypertrophy of
epipheseal chondrocytes: Regulation of gene expression for cartilage
matrix proteins and metalloproteases. Dev. Biol. 158, 414–429.
Beck, F., Samani, N.J., Byrne, S., Morgan, K., Gebhard, R., Brammar, W.J.,
1988. Histochemical localization of IGF-I and IGF-II mRNA in the rat
between birth and adulthood. Development 104, 29–39.
Bohme, K., Winterhalter, K.H., Bruckner, P., 1995. Terminal differen-
tiation of chondrocytes in culture is a spontaneous process and is
arrested by TGF-b2 and basic fibroblast growth factoe in synergy. Exp.
Cell Res. 216, 191–198.
Burke, D., Wilkes, D., Blundell, T.L., Malcolm, S., 1998. Fibroblast growth
factor receptors: lessons from the genes. Trends Biochem. Sci. 23, 59–
62.
Cancedda, R., Cancedda, F.D., Castagnola, P., 1995. Chondrocyte
differentiation. Int. Rev. Cytol. 159, 265–358.
Cerra, A., Mansfield, K.J., Chamberlain, C.G., 2003. Exacerbation of TGF-
beta-induced cataract by FGF-2 in cultured rat lenses. Mol. Vis. 9, 689–
700.
Chen, L., Adar, R., Yang, X., Monsonego, E.O., Li, C., Hauschka, P.V.,
et al., 1999. Gly369Cys mutation in mouse FGFR3 causes achondro-
plasia by affecting both chondrogenesis and osteogenesis. J. Clin.
Invest. 104, 1517–1525.
Chen, L., Li, C., Qiao, W., Xu, X., Deng, C., 2001. A Ser(365)/Cys
mutation of fibroblast growth factor receptor 3 in mouse downregulates
Ihh/PTHrP signals and causes severe achondroplasia. Hum. Mol. Genet.
10, 457–465.
Coffin, J.D., Florkiewicz, R.Z., Neumann, J., Mort-Hopkins, T., Dorn
2nd., G.W., Lightfoot, P., et al., 1995. Abnormal bone growth and
selective translational regulation in basic fibroblast growth factor (FGF-
2) transgenic mice. Mol. Biol. Cell 6, 1861–1873.
Colvin, J.S., Bohne, B.A., Harding, G.W., McEwen, D.G., Ornitz, D.M.,
1996. Skeletal overgrowth and deafness in mice lacking fibroblast
growth factor receptor 3. Nat. Genet. 12, 390–397.
Cosic, I., Drummond, A.E., Underwood, J.R., Hearn, M.T., 1994. In vitro
inhibition of the actions of basic FGF by a novel 16 amino acid peptide.
Mol. Cell Biochem. 130, 1–9.
Coumoul, X., Deng, C., 2003. Roles of FGFRs in mammalian development
and congenital disease. Birth Defects Res. (Part C) 69, 286–304.
Coxam, V., Miller, M.A., Bowman, B.M., Qi, D., Miller, S.C., 1995.
Insulin-like growth factor 1 and parathyroid hormone effects on the
growth of fetal rat metatarsal bones cultured in serum-free medium.
Biol. Neonate 68, 368–376.
Coxam, V., Miller, M.A., Bowman, M.B., Miller, S.C., 1996. Ontogenesis
of IGF regulation of longitudinal bone growth in rat metatarsal
rudiments cultured in serum-free medium. Arch. Physiol. Biochem.
104, 173–179.
de Los Rios, P., Hill, D.J., 2000. Expression and release of insulin-like
growth factor binding proteins in isolated epiphyseal growth plate
chondrocytes from the ovine fetus. J. Cell Physiol. 183, 172–181.
Delezoide, A.L., Benoist-Lasselin, C., Legeai-Mallet, L., le Merrer, M.,
Munnich, A., Vekemans, M., Bonaventure, J., 1998. Spatio-temporal
expression of FGFR 1, 2 and 3 genes during human embryo-fetal
ossification. Mech. Dev. 77, 19–30.
Deng, C., Wynshaw-Boris, A., Zhou, F., Kuo, A., Leder, P., 1996.
Fibroblast growth factor receptor 3 is a negative regulator of bone
growth. Cell 84, 911–921.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571570
Denker, A.E., Nicoll, S.B., Tuan, R.S., 1994. Formation of cartilage-like
spheroids by micromass cultures of murine C3H10T1/2 cells upon
treatment with TGF-b1. Differentiation 59, 25–34.
Di Nino, D.L., Long, F., Linsenmayer, T.F., 2001. Regulation of
endochondral cartilage growth in the developing avian limb: coopera-
tive involvement of perichondrium and periosteum. Dev. Biol. 240,
433–442.
Dieudonne, S.C., Semeins, C.M., Goei, S.W., Vukicevic, S., Nulend, J.K.,
Sampath, T.K., et al., 1994. Opposite effects of osteogenic protein and
TGF-b on chondrogenesis in cultured long bone rudiments. J. Bone
Miner. Res. 9, 771–780.
Dupont, J., Holzenberger, M., 2003. Biology of insulin-like growth factors
in development. Birth Defects Res. (Part C) 69, 257–271.
Garofalo, S., Kliger-Spatz, M., Cooke, J.L., Wolstin, O.,
Lunstrum, G.P., Moshkovitz, S.M., et al., 1999. Skeletal dysplasia
and defective chondrocyte differentiation by targeted overexpression
of fibroblast growth factor 9 in transgenic mice. J. Bone Miner. Res.
14, 1909–1915.
Gatherer, D., ten Dijke, P., Baird, D.T., Akhurst, R.J., 1990. Expression of
TGF-b isoforms during first trimester human embryogenesis. Devel-
opment 110, 445–460.
Haaijman, A., Karperien, M., Lanske, B., Hendriks, J., Lowik, C.,
Bronckers, A., Burger, E., 1999. Inhibition of terminal chondrocyte
differentiation by bone morphogenetic protein 7 (OP-1) in vitro
depends on the periarticular region but is independent of parathyroid
hormone-related peptide. Bone 25, 397–404.
Han, V.K.M., D’Ercole, A.J., Lund, P.K., 1987. Cellular localization of
somatomedin (insulin-like growth factor) messenger RNA in the human
fetus. Science 236, 193–197.
Heine, U.I., Munoz, E.F., Flanders, K.C., Ellingsworth, L.R., Lam, H.-
Y.P., Thompson, N.L., et al., 1987. Role of transforming growth
factor-beta in the development of the mouse embryo. J. Cell Biol.
105, 2861–2876.
Iwata, T., Chen, L., Li, C., Ovchinnikov, D.A., Behringer, R.R.,
Francomano, C.A., Deng, C.X., 2000. A neonatal lethal mutation in
FGFR3 uncouples proliferation and differentiation of growth plate
chondrocytes in embryos. Hum. Mol. Genet. 9, 1603–1613.
Iwata, T., Li, C.L., Deng, C.X., Francomano, C.A., 2001. Highly activated
Fgfr3 with the K644M mutation causes prolonged survival in severe
dwarf mice. Hum. Mol. Genet. 10, 1255–1264.
Kato, Y., Iwamoto, M., Koike, T., Suzuki, F., Takano, Y., 1988.
Terminal differentiation and calcification in rabbit chondrocyte
cultures grown in centrifuge tubes: regulation by transforming
growth factor beta and serum factors. Proc. Natl Acad. Sci. USA 85,
9552–9556.
Kono, K., Ueba, T., Takahashi, J.A., Murai, N., Hashimoto, N.,
Myoumoto, A., Itoh, N., Fukumoto, M., 2003. In vitro growth
suppression of human glioma cells by a 16-mer oligopeptide: a
potential new treatment modality for malignant glioma. J. Neurooncol.
63, 163–171.
Kveiborg, M., Flyvbjerg, A., Eriksen, E.F., Kassem, M., 2001.
Transforming growth factor-beta1 stimulates the production of
insulin-like growth factor-I and insulin-like growth factor-binding
protein-3 in human bone marrow stromal osteoblast progenitors.
J. Endocrinol. 169, 549–561.
Leonard, C.M., Fuld, H.M., Frenz, D.A., Downie, S.A., Massague, J.,
Newman, S.A., 1991. Role of transforming growth factorb in
chondrogenic pattern formation in the embryonic limb: stimulation of
mesenchymal condensation and fibronectin gene expression by
exogenenous TGF-b and evidence for endogenous TGF-b-like activity.
Dev. Biol. 145, 99–109.
Li, C., Chen, L., Iwata, T., Kitagawa, M., Fu, X.Y., Deng, C.X., 1999. A
Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3)
causes dwarfism in mice by activation of STATs and ink4 cell cycle
inhibitors. Hum. Mol. Genet. 8, 35–44.
Liekens, S., Leali, D., Neyts, J., Esnouf, R., Rusnati, M., Dell’Era, P., et al.,
1999. Modulation of fibroblast growth factor-2 receptor binding,
signaling, and mitogenic activity by heparin-mimicking polysulfonated
compounds. Mol. Pharmacol. 56, 204–213.
Liu, J.P., Baker, J., Perkins, A.S., Robertson, E.J., Efstratiadis, A., 1993.
Mice carrying null mutations of the genes encoding insulin-like growth
factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59–72.
Liu, Z., Xu, J., Colvin, J.S., Ornitz, D.M., 2002. Coordination of
chondrogenesis and osteogenesis by fibroblast growth factor 18.
Genes Dev. 16, 859–869.
Long, F., Linsenmayer, T.F., 1998. Regulation of growth region cartilage
proliferation and differentiation by perichondrium. Development 125,
1067–1073.
Long, F., Zhang, X.M., Karp, S., Yang, Y., McMahon, A.P., 2001. Genetic
manipulation of hedgehog signaling in the endochondral skeleton
reveals a direct role in the regulation of chondrocyte proliferation.
Development 128, 5099–5108.
Mancilla, E.E., de Luca, F., Uyeda, J.A., Czerwiec, F.S., Baron, J., 1998.
Effects of fibroblast growth factor-2 on longitudinal bone growth.
Endocrinology 139, 2900–2904.
Massague, J., 1998. TGF-b signal transduction. Annu. Rev. Biochem. 67,
753–791.
Millan, F.A., Denhez, F., Kondaiah, P., Akhurst, R., 1991. Embryonic gene
expression patterns of TGF beta 1, beta 2, and beta 3 suggest different
developmental functions in vivo. Development 111, 131–143.
Moses, H.L., Serra, R., 1996. Regulation of Differentiation by TGF-b. Curr.
Opin. Genet. Dev. 6, 581–586.
Murakami, S., Balmes, G., McKinney, S., Zhang, Z., Givol, D., de
Crombrugghe, B., 2004. Constitutive activation of MEK1 in
chondrocytes causes Stat1-independent achondroplasia-like dwarfism
and rescues the Fgfr3-deficient mouse phenotype. Genes Dev. 18,
290–305.
Naski, M.C., Ornitz, D.M., 1998. FGF signaling in skeletal development.
Front Biosci. 3, D781–D794.
Naski, M., Colvin, J., Coffin, J., Ornitz, D., 1998. Repression of hedgehog
signaling and BMP4 expression in growth plate cartilage by fibroblast
growth factor receptor 3. Development 125, 4977–4988.
Ohbayashi, N., Shibayama, M., Kurotaki, Y., Imanishi, M., Fujimori, T.,
Itoh, N., Takada, S., 2002. FGF18 is required for normal cell
proliferation and differentiation during osteogenesis and chondrogen-
esis. Genes Dev. 16, 870–879.
Orr-Urtreger, A., Givol, D., Yayon, A., Yarden, Y., Lonai, P., 1991.
Developmental expression of two murine fibroblast growth factor
receptors, flg and bek. Development 113, 1419–1434.
Pelton, R.W., Dickinson, M.E., Moses, H.L., Hogan, B.L.M., 1990. In situ
hybridization analysis of TGF-b3 RNA expression during mouse
development: comparative studies with TGF-b1 and b2. Development
110, 600–620.
Pelton, R.W., Saxena, B., Jones, M., Moses, H.L., Gold, L.I., 1991.
Immunohistochemical localization of TGF-b1, TGF-b2, and TGF-b3 in
the mouse embryo: expression patterns suggest multiple roles during
embryonic development. J. Cell Biol. 115, 1091–1105.
Peters, K.G., Werner, S., Chen, G., Williams, L.T., 1992. FGF Two
receptor genes are differentially expressed in epithelial and mesench-
ymal tissues during limb formation and organogenesis in the mouse.
Development 114, 233–243.
Peters, K., Ornitz, D., Werner, S., Williams, L., 1993. Unique expression
pattern of the FGF receptor 3 gene during mouse organogenesis. Dev.
Biol. 155, 423–430.
Roberts, A.B., Sporn, M.B., 1990. The transforming growth factor-bs, in:
Sporn, M.B., Roberts, A.B. (Eds.), Peptide Growth Factors and their
Receptors. Springer, Heidelberg, pp. 419–472.
Sandberg, M., Vurio, T., Hirrovan, H., Alitalo, K., Vuorio, E., 1988.
Enhanced expression of TGF-beta and c-fos mRNAs in the
growth plates of developing human long bones. Development 102,
461–470.
Schmid, C., 1995. Insulin-like growth factors. Cell Biol. Int. 19, 445–457.
Serra, R., Chang, C., 2003. TGF-beta signaling in human skeletal and
patterning disorders. Birth Defects Res. (Part C) 69, 333–351.
A. Mukherjee et al. / Mechanisms of Development 122 (2005) 557–571 571
Serra, R., Karapalis, A., Sohn, P., 1999. PTHrP-dependent and -
independent effects of TGF-b on endochondral bone formation.
J. Cell Biol. 145, 783–794.
Thesingh, C., Burger, E., 1983. The role of mesenchyme in embryonic long
bones as early deposition site for osteoclast progenitor cells. Dev. Biol.
95 (2), 429–438.
Tschan, T., Bohme, K., Conscience, E.M., Zenke, G.,
Winterhalter, K.H., Bruckner, P., 1993. Autocrine or paracrine
TGF-b modulates the phenotype of chick embryo sternal
chondrocytes in serum-free agarose culture. J. Biol. Chem. 5,
5156–5161.
Tsukazaki, T., Usa, T., Matsumoto, T., Enomoto, H., Ohtsuru, A.,
Namba, H., et al., 1994. Effect of transforming growth factor-beta on
the insulin-like growth factor-I autocrine/paracrine axis in cultured rat
articular chondrocytes. Exp. Cell Res. 215, 9–16.
Van Kleffens, M., Groffen, C., Rosato, R.R., Van den Eijnde, S.M., Van
Neck, J.W., Lindenbergh-Kortleve, D.J., et al., 1998. mRNA expression
patterns of the IGF system during mouse limb bud development,
determined by whole mount in situ hybridization. Mol. Cell Endocrinol.
138, 151–161.
Wang, E., Wang, J., Chin, E., Zhou, J., Bondy, C.A., 1995. Cellular
patterns of insulin-like growth factor system gene expression
in murine chondrogenesis and osteogenesis. Endocrinology 136,
2741–2751.
Wilke, T.A., Gubbels, S., Schwartz, J., Richman, J.M., 1997. Expression of
fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3) in the
developing head and face. Dev. Dyn. 210, 41–52.
Xu, J., Liu, Z., Ornitz, D.M., 2000. Temporal and spatial gradients of Fgf8
and Fgf17 regulate proliferation and differentiation of midline
cerebellar structures. Development 127, 1833–1843.