developmentally regulated and lineage-specific rearrangement of t cell receptor vα/δ gene segments

0014-2980/00/0707-1988$17.50+.50/0 © WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2000

Developmentally regulated and lineage-specificrearrangement of T cell receptor V > / p genesegments

Pablo Pereira, Veronique Hermitte, Marie-Pierre Lembezat, Laurent Boucontet,Veronique Azuara and Kalliopi Grigoriadou

Unite du Developpement des Lymphocytes, Centre National de la Recherche Scientifique URA1961, Institut Pasteur, Paris, France

To quantitate the frequency of V § / ˇ gene utilization by TCR + ˇ T cells we have generated alarge panel of + ˇ T cell hybridomas and characterized their productive VDJ rearrangements.Using three novel mAb specific for the V ˇ 5 chain and for several members of the V ˇ 6 sub-family together with previously described V § - and V ˇ -specific mAb we have also quantitatedthe frequency of + ˇ and § g cells expressing those V § / ˇ gene segments and located in differ-ent anatomical sites. We have also characterized the members of the V ˇ 7/ADV10 subfamilyexpressed in C57BL/6 mice and analyzed the representation of individual ADV10 gene seg-ments in § g and + ˇ cells, as well as in precursor cells, in a situation in which TCR-dependentselection is negligible. Our results show that (i) although many V § / ˇ gene segments have thepotential to rearrange to either D ˇ and J ˇ segments or to J § segments, only a limited num-ber of V § / ˇ gene segments are expressed by a quantitatively important fraction of + ˇ cells;(ii) such restricted usage of a limited number of V ˇ gene segments by + ˇ cells is mainlyestablished at the level of V(D)J rearrangement, and (iii) there is very little overlap betweenV § / ˇ gene segments expressed by + ˇ and § g cells.

Key words: + ˇ T cell / § g T cell / V gene usage / Rearrangement / V § / ˇ gene segment

Received 12/1/00Revised 17/3/00Accepted 28/3/00

[I 20454]

Abbreviations: B6: C57BL/6 DN: Double negative i-IEL:Intestinal intraepithelial lymphocytes

1 Introduction

Lymphocyte antigen receptors expressed by § g and + ˇlymphocytes are assembled from variable (V), diversity(D) and joining (J) elements by a process termed V(D)Jrecombination. The genes that encode the TCR g and theTCR + chains lie in different loci, whereas the genes thatencode the TCR § and TCR ˇ chains are found in a singlecomplex (the TCR § / ˇ locus) [1, 2] composed of about 75V genes followed by two D ˇ gene segments, two J ˇgene segments, the C ˇ gene, the V ˇ 5 gene segment, the61 J § gene segments and the C § gene [3]. The rear-rangement of TCR + , TCR ˇ and TCR g gene segmentsoccurs in CD4–CD8– double negative (DN) thymocytesthat are uncommitted to either the § g or the + ˇ T celllineage [4–7], whereas the rearrangement of TCR § genesegments takes place in CD4+CD8+ cells that are com-mitted to the § g T cell lineage [8]. All known V § to J §rearrangements occur by deletion and proceed in both

chromosomes in most § g T cells [9], resulting in the exci-sion of the TCR ˇ locus from the chromosome. Thus, thedevelopmental ordering of rearrangement and expres-sion of TCR ˇ and TCR § genes is essential to ensureT cell lineage specificity.

The extent at which V § / ˇ gene segments expressed by§ g and + ˇ cells overlap and the mechanisms responsible

for the apparent utilization of different V § / ˇ gene seg-ments by § g and + ˇ cells are still controversial. This isdue, in part, to our lack of precise knowledge on the fre-quencies at which different V § / ˇ gene segments areused by both T cell subsets. To date, 16 mouse V § / ˇgene segments belonging to ten V § / ˇ subfamilies havebeen found rearranged to C ˇ [3]. Furthermore, experi-ments using PCR-based analyses have shown rear-rangement of members of other V § subfamilies to (D ˇ ) J ˇelements and transcripts containing all six members ofthe V § 2 (ADV2) subfamily present in BALB/c mice werefound joined to (D)JC ˇ [10–12]. From those experimentsit was suggested that a large fraction of the V § / ˇ genepool can rearrange to TCR ˇ elements and that cellularselection plays an important role in shaping the V ˇ reper-toire expressed by + ˇ cells. In contrast, analyses of non-functional rearrangements in human + ˇ cells [13], of

1988 P. Pereira et al. Eur. J. Immunol. 2000. 30: 1988–1997

VD ˇ 2-excised linear molecules in normal and SCID thy-mocytes [14] and of the frequencies at which V § 2 genesegments rearranged to TCR ˇ elements are expressed inCD3 4 -deficient mice [15] suggested that the restrictiveusage of V ˇ gene segments in + ˇ cells is primarilyimposed at the level of gene rearrangement.

In this report we have analyzed the V § / ˇ gene segmentusage in a large panel of + ˇ T cell hybridomas and in nor-mal + ˇ and § g cells located in different anatomical sitesusing three novel mAb specific for different V § / ˇ chainstogether with previously described V § - and V ˇ -specificmAb. We have also characterized the members of theV ˇ 7/ADV10 subfamily expressed in C57BL/6 (B6) miceand analyzed the representation of individual ADV10gene segments in § g and + ˇ cells as well as in precursorcells in a situation in which TCR-dependent selection isnegligible. Our results show that, although many V § / ˇgene segments have the potential to rearrange to DJ ˇ orto J § , there is a clear preference for a limited number ofgenes that rearrange to DJ ˇ and there is little overlap-ping between V ˇ and V § gene segments. Furthermore,the V ˇ repertoire is mainly established at the level ofV(D)J rearrangement.

2 Results

2.1 A few V > / p gene subfamilies represent themajority of the expressed TCR p intestinalintraepithelial lymphocyte repertoire

To investigate the V ˇ gene utilization by + ˇ cells we pro-duced a large panel of + ˇ T cell hybridomas originatedfrom B6 and DBA/2 mouse strains. Previous studies inF2 recombinant strains originated from these parentalstrains showed that their expressed TCR + ˇ repertoire isinfluenced by genes linked to the TCR § / ˇ locus [16, 17]and, therefore, it was possible that B6 and DBA/2 micewould utilize different V § / ˇ gene segments. RNA from147 + ˇ intestinal intraepithelial lymphocyte (i-IEL) hybrid-omas were reverse-transcribed and amplified with prim-ers specific for the C ˇ gene segment and 11 differentV § / ˇ gene subfamilies and the amplified products weresequenced. Eleven hybridomas expressed two differentin-frame VDJ ˇ junctions, likely to represent non-allelically excluded cells [18] or double hybrids, and wereexcluded from the analysis. The representation of the 11different V § / ˇ gene subfamilies on the resulting 136hybridomas (77 originated from B6 and 59 from DBA/2mice) is shown in Table 1. Five V ˇ subfamilies (V ˇ 2/DV102, V ˇ 4/DV104, V ˇ 5/DV105, V ˇ 6/ADV7 and V ˇ 7/ADV10; see [3] for the different nomenclatures) represent89% of the TCR ˇ repertoire in the panel of B6 i-IELhybridomas, whereas three of them (V ˇ 4, V ˇ 5 and V ˇ 6)

Table 1. Expression of funtional V ˇ (D ˇ )J ˇ rearrangementsin i-IEL hybridomas from B6 and DBA/2 strainsa)

V § / ˇ gene subfamily Number of hybridomas(% of the total in the strain)

C57BL/6 (n=77) DBA/2 (n=59)

V ˇ 1 DV101 0 0

V ˇ 2 DV102 14 (18.9) 1 (1.7)

V ˇ 3 V § 6 ADV6 1 (1.3) 0

V ˇ 4 DV104 20 (26.0) 15 (25.4)

V ˇ 5 DV105 10 (13.0) 6 (10.1)

V ˇ 6 V § 7 ADV7 20 (26.0) 35 (54.2)

V ˇ 7 V § 10 ADV10 5 (6.5) 1 (1.7)

V ˇ 7 V § 4 AV4 0 1 (1.7)

V ˇ 8 V § 2 AV2 1 (1.3) 1 (1.7)

V ˇ 8 V § 11 AV11 1 (1.3) 0

V ˇ 9 V § 17 AV17 0 0

Other V § / ˇ 5 (6.5) 2 (3.4)

a) For the nomenclature of the different V § / ˇ subfamilies see[3] and references therein. Other V § / ˇ refers to non testedV § / ˇ gene subfamilies. Numbers in parentheses representrelative frequencies. Eleven clones contained two func-tional V ˇ (D ˇ )J ˇ rearrangements and are not included. Twoclones from DBA/2 expressed the V + 1 chain and V ˇ 4 andV ˇ 6. Three clones from DBA/2 V + 7 chain and V ˇ 4 and V ˇ 6(two of them) or V ˇ 4 and V ˇ 2. Five clones from B6expressed the V + 1 chain and V ˇ 4 and V ˇ 6 (one clone), V ˇ 4and V ˇ 2 (two clones) and V ˇ 4 and V ˇ 6 (two clones). Oneclone from B6 expressed the V + 1 chain and V ˇ 6 and V § 10

constituted 90% of the expressed TCR ˇ repertoire in thepanel of DBA/2 i-IEL hybridomas. Thus, in spite of thepotential usage of a large number of V-gene segmentsby + ˇ cells, the + ˇ i-IEL repertoire is largely formed bythe use of few V-gene segments.

2.2 q p cells in different anatomical sites expressthe same V p gene segments

Given the above results, it appeared useful to producemAb able to recognize different V ˇ chains. To that end,we immunized TCR ˇ -deficient mice with different + ˇ Tcell hybridomas expressing distinct V + V ˇ chains. Threedifferent mAb appeared to be specific for V § / ˇ chains:F45.152 recognizes the V ˇ 5 chain in every mouse straintested, 9D3 recognizes the V ˇ 6.3 chain in B6 mice andthe V ˇ 6.4 in DBA/2 mice [19] and F4.22 recognizes thetwo members of the V ˇ 6/ADV7 subfamily in B6 mice that

Eur. J. Immunol. 2000. 30: 1988–1997 Distinct V § / ˇ gene segment usage by § g and + ˇ cells 1989

Fig. 1. Expression of V + and V ˇ chains by + ˇ cells in differentorgans in B6 mice. (A) DN thymocytes from a pool of fivemice were stained with FITC-labeled anti-V + 1 or V + 4 Ab,anti- ˇ -Tricolor and biotin-labeled anti-V ˇ Ab followed bystreptavidin-APC and analyzed in a FACScalibur. Plots showthe expression of the indicated V + and V ˇ chains amongelectronically gated + ˇ cells. Numbers indicate the percent-age of positive cells in each quadrant. At least 100,000 alivecells were analyzed. One experiment representative of fouris shown. (B) DN thymocytes and LN cells were cultured inanti- + ˇ -coated plates and IL-2 for 4 to 5 days. Growingblasts or freshly isolated i-IEL were incubated with the indi-cated FITC-labeled anti-V + or anti-V ˇ Ab together with PE-labeled anti- ˇ Ab and analyzed in a FACScan. A minimum of20,000 viable cells were analyzed. Results show the fractionof + ˇ cells expressing the indicated V + or V ˇ chains in 4 to20 mice analyzed individually, except for the fraction of V + 4i-IEL which represents the mean of two experiments analyz-ing a pool of four mice each.

Fig. 2. Pairing of different V + and V ˇ chains in + ˇ cells located in distinct anatomical sites. Cells were prepared as in the legendof Fig. 1 and stained with FITC-labeled anti-V + Ab and biotin-labeled anti-V ˇ Ab followed by streptavidin-PE and analyzed in aFACScan. Data are shown as the fraction of cells expressing the indicated V ˇ chains among electronically gated Vg1+ (left) V + 4+

(middle) and V + 7+ (right) + ˇ cells. For comparison, the frequency of V ˇ utilization amongst the B6 hybridomas presented inTable 1 is also shown (i-IEL hybrids)

have more than 90% identity at the nucleotide level withthe previously described p Q 12 [1].

With these three mAb and the previously described anti-V ˇ 4 mAb [20], we quantitated the frequency of + ˇ cellsexpressing these different V ˇ chains in several anatomi-cal sites in B6 mice (Fig. 1). Together, the four mAb rec-ognize 60–75% of the + ˇ cells present in the thymus, LNand intestinal epithelia, indicating that the usage of a lim-ited set of V § / ˇ gene segments by + ˇ cells is a generalcharacteristic of + ˇ cells located in different anatomicalsites. However, small differences in the utilization ofthese V ˇ chains by + ˇ cells located in different organswere observed. These differences are due, in part, to theuneven pairing of some V ˇ chains with different V +chains (Fig. 2) together with the different representationof individual V + gene segments in distinct anatomicalsites (Fig. 1 and [21]). It is noticeable that among the V ˇchains studied, the members of the V ˇ 6 subfamily rarelyappear together with the V + 4 chain, whereas no suchpreference was observed for the V ˇ 4 and V ˇ 5 chains(Fig. 2).

2.3 Utilization of different V > / p gene segmentsby > I and q p T cells

Among the V ˇ chains most commonly used by + ˇ cellsto form their TCR, V ˇ 2/DV102, V ˇ 4/DV104, and V ˇ 5/DV105 gene segments have only been found functionallyexpressed as part of ˇ chains, although transcripts ofthese genes joined to J § have been reported [11]. In con-trast, one or several members of two other V § / ˇ genesubfamilies, V ˇ 6/ADV7 and V ˇ 7/ADV10, which appear tobe used by a sizable fraction of + ˇ cells ([22–27] andTable 1), have also been found as part of functional §chains [28, 29]. The frequency of utilization of differentV § / ˇ gene segments by § g and + ˇ cells is not known.We, therefore, quantitated the fraction of § g and + ˇ cells


Fig. 3. Expression of V § / ˇ chains by LN § g and + ˇ cells. LN cells were cultured in plates coated with either anti- ˇ or anti- g mAband IL-2 for 4 days. Growing blasts were stained with PE-labeled anti- ˇ Ab (upper panels) or PE-labeled anti- g Ab (lower panels)together with the indicated FITC-labeled anti-V § / ˇ Ab and analyzed in a FACScan. A minimum of 50,000 alive cells were ana-lyzed. Plots of one representative experiment are shown. Numbers over the histograms represent the fraction (mean ± SD of fourto six independent determinations) of + ˇ cells (upper panels) or § g cells (lower panels) expressing the indicated V § / ˇ chains.Similar results were obtained when spleen cells or thymocytes were analyzed.

Fig. 4. Comparison of the ADV10 subfamily members nucle-otide sequences of B6 mice. The sequence of the primer inthe leader sequence is shown in italics. Gaps introduced tomaximize homology are denoted by asterisks. Agreement ofthe sequences is denoted by dashed lines.

expressing different V § / ˇ chains using the available mAb.The results of one such experiment are shown in Fig. 3.Consistent with previous results [30–32], about 10%, 6%and 2% of the LN § g cells were stained by Ab recogniz-ing members of the V § 2 (ADV2), V § 8 (AV8) and V § 11(AV11) subfamilies, respectively. The anti-V § 2 mAb alsorecognized a sizable proportion (1–2%) of + ˇ cells in B6mice, whereas no more than 0.2% of the + ˇ cells are rec-ognized by the anti-V § 8 or the anti-V § 11 mAb. Con-versely, between 5% and 30% of the + ˇ cells could berecognized by any of the mAb specific for the V ˇ 4 chain,the V ˇ 5 chain or one or several members of the V ˇ 6/ADV7 subfamily. These Ab, however, were rarely reactivewith § g cells. Altogether, these results indicate a remark-able, albeit not complete, preference of different V § / ˇgene segments to be expressed as part of an § or ˇ chain.

2.4 Different members of the same V > / p genesubfamily are used by > I and q p cells

From the experiments presented above, it appeared thatmost V § / ˇ subfamilies are preferentially used by either§ g cells or + ˇ cells to form their TCR. Members of two

large V § / ˇ subfamilies (ADV10/V ˇ 7 and ADV2/V § 2),however, appear to be used by a sizable proportion of § gand + ˇ cells (see Table 1 and Fig. 3). To determinewhether different members of the V ˇ 7/ADV10 subfamilyare used by § g or + ˇ cells, we analyzed the frequenciesat which transcripts containing any individual ADV10gene segment are joined to either J § C § or D ˇ J ˇ C ˇ seg-ments in B6 mice. Previous studies had already shownthat a single member of the ADV2 gene subfamily wasoverrepresented in the ADV2C ˇ transcripts isolated fromBALB/c thymocytes [12].

Eight different V-gene segments were found in theseanalyses and their nucleotide sequences are shown inFig. 4. The sequences of three of them (DV10S7,AV10S1 and AV10S2) have been previously reported(see [3]), whereas those of the other five V-gene seg-ments are novel. They were named accordingly to the


Fig. 5. Relative representation of transcripts containing dif-ferent ADV10 subfamily members joined to either J § C § or(D ˇ )J ˇ C ˇ segments. RNA purified from enriched § g or + ˇ Tcell populations were amplified by RT-PCR with ADV10 andC § – or C ˇ -specific primers. The amplification products werecloned and sequenced to verify the identity of the ADV10gene segment used. Results shows the relative frequency atwhich each indicated ADV10 subfamily member is foundamong the total ADV10J § C § or ADV10(D ˇ )J ˇ C ˇ clones.

Fig. 6. The relative representation of different ADV10 sub-family members is imposed at the level of gene rearrange-ment. RNA isolated from enriched + ˇ cells or from total thy-mocytes obtained from CD3 4 -deficient mice were convertedto cDNA and amplified as in the legend of Fig. 5. DNA fromthymocytes of CD3 4 -deficient mice was also amplified withthe same ADV10 primer and a J ˇ 1-specific primer. Theamplification products were cloned and sequenced to verifythe identity of the ADV10 gene segment used. Results showthe relative frequency at which each indicated ADV10 sub-family member is found among total ADV10J § C § orADV10(D ˇ )J ˇ C ˇ clones.

WHO-IUIS nomenclature for TCR genes (see [3]). Ofthese five, AV10S10, AV10S12, AV10S11 and AV10S14,show more than 97% identity at the nucleotide level withpreviously described sequences and are likely allelicforms, whereas the other, AV10S13, shares between80% and 90% identity at the nucleotide level with anyother previously described ADV10 sequence [3]. Thepreviously described AV10S3 gene segment [3], isolatedfrom a mouse strain which shares the same TCR ˇ haplo-type than B6 mice, was not found in our analyses.

The frequencies at which transcripts containing individ-ual ADV10 gene segments are expressed together withC § or C ˇ are clearly different (Fig. 5). Thus, about 85% ofthe ADV10J § C § transcripts contain either, AV10S1,AV10S2, AV10S12 or AV10S10, whereas two otherADV10 gene segments, DV10S7 and DV10S13, repre-sent more than 95% of the ADV10D ˇ J ˇ C ˇ transcripts.The highly homologous AV10S11 and AV10S14 arerarely expressed in B6 mice. In spite of these clear differ-ences, however, every gene segment of the ADV10 sub-family could be found expressed with the J § C § segmentor with the D ˇ J ˇ C ˇ segment (Fig. 3 and see below).From these experiments we conclude that, although anygene segment of the ADV10 subfamily can be joined toeither J § C § or D ˇ J ˇ C ˇ segments, the gene segmentsthat are usually found joined to the J § C § segment aredifferent from those found joined to the D ˇ J ˇ C ˇ seg-ment.

2.5 Restriction of the TCR V p repertoire is dueto preferential rearrangement and isindependent of TCR-dependent selection

To analyze the extent at which TCR-dependent selectioncould be responsible for the limited usage of V § / ˇ genesegments by + ˇ cells, we quantitated the frequency atwhich transcripts containing any individual ADV10 genesegment are joined to D ˇ J ˇ C ˇ segment in thymocytesisolated from CD3 4 -deficient mice and compared themwith those found in + ˇ thymocytes from normal mice.Because of their inability to signal through the TCR com-plex, CD3 4 -deficient mice lack mature § g and + ˇ T cells[33] and their TCR ˇ rearrangements should represent anon-selected pool of TCR ˇ chains. The results of suchanalyses are shown in Fig. 6. As can be seen, two genesegments, DV10S7 and DV10S13, account for the largemajority of ADV10C ˇ transcripts and they show almostidentical frequencies in both types of animals. Similarresults were obtained when we analyzed directly ADV10rearrangements instead of transcripts in CD3 4 -deficientmice, except that a slightly lower frequency of DV10S13was found at the level of rearrangements (Fig. 6). Theseexperiments indicate that the preferential utilization ofthe DV10S7 gene segment by + ˇ cells is imposed by itspreferential rearrangement to D ˇ and J ˇ segments.


This conclusion is supported and extended to most V ˇgene segments by the analyses of V § / ˇ gene rearrange-ments present in the + ˇ i-IEL hybridoma panel. Thus,although we did not look for all non-functional rearrange-ments present in the hybridomas, we sequenced non-functional rearrangements from 39 hybridomas (26%).This number is close to the maximum expected if most+ ˇ cells contain two TCR ˇ rearrangements and if hybrid-omas loose chromosomes from either parent cell ran-domly. Of the non-functional rearrangements 90% con-cerned a V-gene segment of the V ˇ 2/DV102, V ˇ 4/DV104, V ˇ 5/DV105 or V ˇ 6/ADV7 subfamilies, and only10% had rearranged a member of a different V § / ˇ sub-family (not shown). As these frequencies are similar tothose found in functional rearrangements in the samepanel of hybridomas (Table 1), these data indicate thatthese V § / ˇ gene segments rearrange frequently in the+ ˇ precursor cells. Taken together, these experimentsstrongly suggest that the restriction of the V ˇ repertoireis due to preferential rearrangement of certain V § / ˇ genesegments to TCR ˇ elements and is largely independentof antigen selection.

3 Discussion

3.1 General remarks

The data presented in this manuscript are consistentwith the following conclusions: (1) only a small number ofthe V-gene segments encoded within the TCR § / ˇ locusis represented in ˇ chains expressed by + ˇ cells in differ-ent anatomical sites. (2) There is very little overlap in V § /ˇ gene usage between § g and + ˇ cells. (3) The restriction

of V gene segments in the expressed V ˇ gene repertoireis primarily imposed by preferential rearrangement of afew V gene segments.

3.2 q p cells express a small number of V > / p genesegments

Although the notion that + ˇ cells utilize a limited set ofV § / ˇ gene segments to form their ˇ chains is mostlyaccepted, a precise definition of these gene segmentsand of the frequencies at which they are used by + ˇ cellsis lacking. Previous studies in the mouse were confinedto the analysis of V ˇ usage by a limited set of hybrid-omas [18, 23, 24] and to the utilization of a single mAbspecific for the V ˇ 4 segment [20]. Our analysis of a largerset of T cell hybridomas and with the use of three novelV ˇ -specific mAb recognizing the V ˇ 5 chain and three ofthe four members of the V ˇ 6 subfamily in B6 mice notonly confirms previous data suggesting a limited use ofV ˇ gene segments by + ˇ cells but also allows their

quantification. Thus, in a B6 mouse 60–75% of the adult+ ˇ cells express either the V ˇ 4/DV104, the V ˇ 5/DV105 orone of three members of the V ˇ 6 subfamily, and this irre-spective of their localization in vivo. From our and previ-ous analyses of hybridomas it is expected that a rela-tively important fraction of + ˇ cells will use either theV ˇ 6.1 segment (undetectable with the available mAb),the V ˇ 2/DV102 gene segment and the DV10S7 genesegment. Finally, close to 2% of the + ˇ cells express amember of the ADV2 subfamily, which is likely to be theADV2S7 segment [12]. A small fraction (less than 5%) of+ ˇ cells is expected to express other V § gene segmentsas part of their TCR ˇ chains. It appears, therefore, thatan adult B6 mouse contains about ten bona-fide V ˇ genesegments. Those are the V ˇ 2 (DV102), one V ˇ 4 (DV104)(although a second V ˇ 4 gene segment may exist in B6mice), one V ˇ 5 (DV105), four V ˇ 6 (ADV6), one or twomembers of the V ˇ 7/ADV10 subfamily (S7 and S13) andone member of the ADV2 subfamily (named ADV2S7 in[30] and ADV2S6 in [34]). To those should be added theV ˇ 1/DV101 gene segment, which is only expressed dur-ing fetal life [26]. The total number of different V ˇ genesegments may vary slightly in different strains of mice,mostly due to the different number of V ˇ 6 gene seg-ments present in different TCR § / ˇ haplotypes (i.e. thissubfamily contains four members in B6 mice and sixmembers in DBA/2 mice; [35] and P.P. unpublished).Thefact that all members of the ADV10 and ADV2 subfami-lies can be found rearranged to D ˇ J ˇ C ˇ (this manuscriptand [12]), together with the apparent facility at whichtranscripts containing different V § subfamilies joined toJ ˇ C ˇ can be amplified by PCR [10, 11, 15], suggests thata large number of V § / ˇ gene segments can be used toform a TCR ˇ chain. If + ˇ cells expressing those V § / ˇchains are rare is because the frequency at which thoseV § / ˇ gene segments rearrange to D ˇ and/or J ˇ elementsis very low.

3.3 Little overlap in V > / p gene usage between > I andq p cells

Whereas a number of V § / ˇ gene segments frequentlyused by + ˇ cells, including V ˇ 2 (DV102), V ˇ 4 (DV104)and V ˇ 5 (DV105), have not been found as part of func-tional TCR § chains, some of the members of the V ˇ 6/ADV7 subfamily were originally cloned as part of TCR §chains [28, 36] and they could even be found as func-tional TCR § transcripts in § g T cell hybridomas [29].However, the frequency of cells containing V ˇ 6J § C §transcripts, obtained from the analyses of a large panelof newborn T cell hybridomas was found to be very low[37], contrasting with a very high frequency of cellsexpressing V ˇ 6D ˇ J ˇ C ˇ transcripts. RT-PCR analysis ofV ˇ 6J § C § transcripts in normal cells have produced con-


flicting results with some groups reporting their abun-dance [15, 38] and others their absence [39]. Our resultsclearly show that § g cells expressing V ˇ 6 chains are veryrare in B6 mice, indicating that the members of the V ˇ 6/ADV7 subfamily are mostly V ˇ and not V § gene seg-ments. The possibility that the specific site of the V § / ˇchain recognized by these mAb used here is masked bythe TCR g chain in § g cells cannot be formally excludedat present. However, we believe this possibility is unlikelybecause we could isolate § g cells recognized by theanti-V ˇ 6 Ab and similar results were obtained with a dif-ferent mAb which recognizes a different epitope in theB6 V ˇ 6.3 gene segment (not shown). It appears, there-fore, that all V ˇ gene segments frequently used by + ˇ Tcells are rarely used by § g T cells, indicating that V § andV ˇ gene segments are functionally different. This conclu-sion is further strengthened by the results showing aninverse correlation in the frequency at which transcriptsof individual V ˇ 7/ADV10 and V ˇ 8/ADV2 gene segmentsare expressed together with C § or C ˇ (this manuscriptand [12]), indicating that some of the V § / ˇ gene seg-ments are V ˇ genes and others are V § genes.

3.4 Restriction of V gene segments in the expressed V pgene repertoire is primarily imposed by preferentialrearrangement of a few V gene segments

Two different mechanisms have been suggested previ-ously to account for the restriction of V gene segmentsexpressed by + ˇ cells: a selective rearrangement ofdefined V § / ˇ gene segments to DJC ˇ [13, 14] and aselection of expressed TCR ˇ chains [11]. Both the analy-ses of non-productive rearrangements in the + ˇ T cellhybridomas and the fact that individual members of theADV10 subfamily are present at similar frequencies inVDJ rearrangements isolated from normal or CD3 4 -deficient mice are consistent with the former hypothesis.Neither our findings nor previous results [13, 14], how-ever, exclude selection for developing + ˇ cells bearingparticular + ˇ receptors [16, 17, 20], or the preference ofsome V ˇ chains to pair with different V + chains (Fig. 2).They indicate that such selective events are not primarilyresponsible for the restricted V ˇ gene usage observed in+ ˇ cells.

An important question is how a given V § / ˇ gene seg-ment is preferentially targeted for rearrangement to ˇ

gene segments. The fact that the first cloned V ˇ genesegments are located in the D-proximal region of thelocus, led to the suggestion that V ˇ gene usage dependson the relative chromosomal localization of the V genesegments [40]. However, the finding that the V ˇ 6 sub-family members are located either in the middle or in theD-distal end of the locus [41] together with the fact that

other V ˇ gene segments belong to V § subfamilies, themembers of which are interspersed with other V § genesegments [41], led to the suggestion that chromosomallocation alone does not determine usage of V § / ˇ genesegments [14, 15].

The D-proximal region contains the V ˇ 1/DV101, V ˇ 2/DV102, V ˇ 4/DV104 and V ˇ 5/DV105 gene subfamilieswith no V gene segments mostly used for J § rearrange-ment interspersed among them. Interestingly, theDV10S13, the DV10S7 and the ADV2S7 gene segmentsare also the most D-proximal gene segments among themembers of their family, although other V § elements areinterspersed among them. Furthermore, preferential utili-zation of the most D-proximal members of several V § / ˇsubfamilies has been recently shown in the ˇ -chainsexpressed in newborn thymus [34]. It is, therefore, likelythat chromosomal position is a factor determining V § / ˇgene segment usage. However, other factors arerequired to explain the selective rearrangement of a lim-ited set of V § / ˇ gene segments to TCR ˇ elements. Differ-ential local accessibility of these segments to the recom-binase activity, being that induced by influencing CpGmethylation or histone acetylation (reviewed in [42, 43]) isunlikely a satisfactory explanation for determining V § / ˇgene segment usage, as they are expected to influencerelatively large regions and not individual V gene seg-ments. Most likely, such regulatory elements should befound in the vicinity of the V gene segments themselves.One possible candidate could be the heptamer andnonamer RSS flanking the V § / ˇ gene segments. How-ever, the fact that all members of the ADV10 subfamilyshare identical RSS makes this possibility unlikely. Amore likely candidate is the promoter of the V § / ˇ genesegments. In this context, the promoter of a V Q segmenthas been found to be critical for the rearrangement of achicken Ig Q light chain in a transgenic mouse model [44].Unfortunately, only very limited number of V § / ˇ genesegment promoters have been functionally analyzed todate [45–47]. Characterization of the promoter regions ofdifferent members of the ADV10 subfamily which rear-range frequently to J ˇ or J § elements may be an impor-tant step in understanding why very similar gene seg-ments are preferentially targeted to either TCR ˇ or TCR §elements.

4 Materials and methods

4.1 Animals

B6 and DBA/2 mice were obtained from Iffa-Credo(L’Abresle, France) and used between 8–10 weeks of age.CD3 4 -deficient mice [33] were obtained from CDTA (Orleans,France). TCR ˇ -deficient mice [48] were maintained in ouranimal facilities.


4.2 Cell purifications and cultures

Single-cell suspensions were prepared from the thymus,spleen and LN according to standard procedures. DN thy-mocytes were prepared by complement-mediated lysis asdescribed [26]. The preparation of i-IEL has been previouslydescribed in detail [49]. i-IEL (5×105 cells/ml) were culturedin DME with Glutamax-I medium (Gibco-BRL, Gaithersburg,MD) supplemented with sodium pyruvate, 5×10–5 M 2-ME,nonessential amino acids and antibiotics (all from Gibco-BRL) and 10% FCS (Boehringer Mannheim, Mannheim, Ger-many), in plates previously coated with either anti- + ˇ , anti-V + 1 or anti-V + 7 mAb (10 ? g/ml). To prepare § g and + ˇ

blasts, spleen, LN, total thymocytes or DN thymocytes wereincubated in the conditions described above in plates previ-ously coated with anti- g or anti- ˇ mAb. Mouse rIL-2 wasadded at a final concentration of 100 U/ml.

4.3 Production of T cell hybridomas

At 3–5 days after initiation of the i-IEL cultures describedabove, growing blasts were fused to the TCR § g – variant ofthe BW5147 thymoma cell line at a 1:1 ratio in 0.5 ml of 50%polyethylene glycol as described [50]. The cells were thendistributed in 96-well flat-bottom plates in Opti-MEM withGlutamax-I medium (Gibco-BRL) supplemented with5×10–5 M 2-ME, antibiotics, 10% FCS, 6 ? M Azaserine(Sigma, St. Louis, MO) and 100 mM hypoxantine (Gibco-BRL).

4.4 Production of B cell hybridomas

TCR ˇ knockout mice were immunized i.p. two to four timesat 2-week intervals with 5×106 hybridoma cells and once i.v.with 106 hybridoma cells resuspended in PBS. Three daysafter the last injection, spleen cells were fused with SP2/0cells as described [50]. The cells were then distributed in 96-well flat-bottom plates in complete medium supplementedwith HAT (Gibco-BRL). Culture supernatants from growth-positive wells were tested for their ability to bind to theimmunizing hybridoma cell but not to a TCR-negative variantof the same hybridoma. Binding of the Ab to the hybridomacells was detected with FITC-labeled goat anti-mouse Ig(Caltag, South San Francisco, CA) and analyzed with aFACScan. The fine specificities of the selected Ab weredetermined by their ability to stain + ˇ T cell hybridomas thatexpress different TCR + and TCR ˇ chains. Three differentmAb appeared to be specific for V § / ˇ regions: 9D3 recog-nizes the V ˇ 6.3 chain in B6 mice and the V ˇ 6.4 in DBA/2mice [19], F45.152 recognized six of six hybridomasexpressing the V ˇ 5 chain but not hybridomas expressingany other V ˇ chain including V ˇ 2, V ˇ 4, V ˇ 6 and V ˇ 7. Fur-thermore, F45.152 recognized a sizable proportion of V + 1-,V + 4- and V + 7-positive + ˇ cells in every mouse strain tested,including B6, C57BL/10, B10.D2, BALB/c, C3H/HeJ, CBA/J,DBA/2, FVB/N, A/J and NOD. F4.22 recognized seven of

seven B6-derived hybridomas (four V + 1+, two V + 7+ and oneV + 4+) expressing any of the two members of the V ˇ 6/ADV7subfamily in B6 mice that have more than 90% identity at thenucleotide level with the previously described p Q 12 [1], but itdid not recognize any hybridoma of B6 origin expressing adifferent V ˇ chain, including other members of the V ˇ 6 sub-family. It also stained some hybridomas of DBA/2 origin,suggesting that it also recognized one member of this sub-family in DBA/2. F4.22 stained a sizable proportion of V + 1+,and V + 7+

+ ˇ cells in B6, C57BL/10, B10.D2 (which share thesame TCR ˇ haplotype) but did not stain any + ˇ cell in BALB/c, C3H/HeJ, CBA/J, 129/Sv and FVB/N. 76.4 anti-pan- ˇ ,F4.67 anti-V + 7, and 49.2 anti-V + 4 were also obtained inthose fusions and used throughout this work. All those mAbare IgG2a, ‹ except 49.2 that is IgG1, ‹ and all were purifiedfrom culture supernatant by affinity chromatography on pro-tein G-Sepharose (Pharmacia, Uppsala, Sweden), and FITC-labeled and biotinylated by standard procedures.

4.5 Antibodies, immunofluorescence staining and flowcytometric analysis

FITC-labeled anti-V § 2, anti-V § 8 and anti-V § 11, PE-labeledanti-V ˇ 4 and biotin-labeled anti-V + 4 were obtained fromPharMingen (San Diego, CA). All other mAb were prepared inthe lab and labeled according to standard procedures. Cells(105–106) were incubated in staining buffer (PBS, 3% FCS,0.1% NaN3) with the indicated labeled Ab for 30 min on ice.After two washes the cells were incubated with streptavidin-PE (Southern Biotechnology, Birmingham, AL) or strep-tavidin-APC (PharMingen) for 15 min on ice. After anotherwash, the indicated number of viable cells were analyzedusing a FACScan or a FACScalibur flow cytometer (BectonDickinson, Mountain View, CA). Dead cells were gated outby their staining with propidium iodide. Data was analyzedusing the LysysII or the CellQuest programs.

4.6 Oligonucleotide primers and PCR conditions

The following oligonucleotide primers were used: V ˇ 1:ATTCAGAAGGCAACAATGAAAG, V ˇ 2: GTTCCCTGCAGATC-CAAGCC, V ˇ 4: CCGCTTCTCTGTTGAACTTCC, V ˇ 5:CAGATCCTTCCAGTTCATCC, V ˇ 6 (V § 7): TCAAGTCCAT-CAGCCTTGTC and CTGTAGTCTTCCAGAAATCAC, V § 6(V ˇ 3): TTCCTGGCTATTGCCTCTGAC, V § 10 (V ˇ 7): CGCA-GAGCTGCAGTGTAACT and CAATCCTTCTGGGACAAAGC,V § 4 (V ˇ 7): GAAAGCTTCAGTGCAAGAGTC, V § 11 (V ˇ 8):GCTACAGCACCCTGCACATC, V § 2 (V ˇ 8): GTCCCCA-ATCTCTGACAGTC, V § 17 (V ˇ 9): TCTCTGAACTTTCAGA-AGCC, C ˇ : CGAATTCCACAATCTTCTTG, and C § :TGGCGTTGGTCTCTTTGAAG. PCR was performed using aGeneAmp PCR system 9600 (Perkin-Elmer/Cetus, Norwalk,CT). Each cycle consisted of incubations at 92°C for 20 s, fol-lowed by 55°C for 30 s and 72°C for 30 s. Before the firstcycle, a 2-min 94°C denaturation step was included and afterthe 35th cycle the extension at 72°C was prolonged for 4 min.


4.7 Nucleic acid preparation and sequencing analysis

Genomic DNA was prepared by the proteinase K-phenolextraction-ethanol precipitation method. Total cellular RNAfrom the hybridoma cells, T cell blasts or total thymocyteswas extracted with RNA-B (Bioprobe Systems, Montreuil,France). cDNA was synthesized with Oligo(dT) (Pharmacia)using superscript reverse transcriptase (Gibco-BRL) accord-ing to the manufacturer’s instructions. Sequences spanningthe VDJ junctions were amplified by PCR using the primersindicated above. After amplification, 4–8 ? l of each PCRreaction mixture was incubated with Shrimp Alkaline Phos-phatase and Exonuclease I to remove the excess of primersand dNTP and sequenced by the dideoxy chain terminationmethod using the sequenase enzyme as described in theSequenase Version 2.0 DNA polymerase for sequencingPCR products kit (Pharmacia-USB) or the ABI PRISM DyeTerminator Cycle Sequencing Ready Reaction Kit (PerkinElmer). The C ˇ primer used for sequencing was TCACCA-GACAAGCAACA.

To sequence the ADV10 subfamily members expressed inB6 mice, DN thymocytes and LN cells were stimulated inanti- + ˇ – or anti- § g -coated plates as described above. RNAisolated from growing + ˇ and § g blasts were converted intocDNA and amplified with a primer, the sequence of which ispresent in the leader of all published ADV10 gene segments(TTCTGTGCACCCAGGTTTGC), together with either C ˇ orC § primers. The PCR products were cloned into the TA-cloning vector using the TA cloning kit (Invitrogen, SanDiego, CA) following the manufacturer’s instructions. Plas-mid DNA was amplified with the M13 forward and reverseprimers and sequenced as described above. The C § primerused for sequencing was ACACAGCAGGTTCTGGGTTC.Eight different sequences were found from a total of 160clones isolated from seven independent PCR. To control forputative polymorphism in the leader sequences of differentADV10 subfamily members the same cDNA preparationswere amplified with a V ˇ 7/ADV10-specific primer togetherwith a C ˇ or C § primer. No V ˇ sequence different from theones previously characterized was found. Sequences thatappeared only once and that differed by a single base pairwere considered as Taq polymerase errors.

Acknowledgments: We thank A. Cumano, V. Barreto and J.diSanto for critical reading of the manuscript. This work wassupported by institutional grants and by grants from the“Association pour la Recherche sur le Cancer”, “Fondationpour la Recherche Medicale” and “Association Nationalepour la Recherche contre le Sida”.

References

1 Chien, Y. H., Iwashima, M., Kaplan, K. B., Elliott, J. F. andDavis, M. M., A new T cell receptor gene located within the alphalocus and expressed early in T cell differentiation. Nature 1987.327: 677–682.

2 Satyanarayana, K., Hata, S., Devlin, P., Roncarolo, M. C., DeV-ries, J. E., Spits, H., Strominger, J. L. and Krangel, M. S.,Genomic organization of the human T cell antigen-receptor § ˇlocus. Proc. Natl. Acad. Sci. USA 1988. 85: 8166–8170.

3 Arden, B., Clark, S. P., Kabelitz, D. and Mak, T. W., Mouse T cellreceptor variable gene segment families. Immunogenetics 1995.42: 501–530.

4 Petrie, H. T., Scollay, R. and Shortman, K., Commitment to theT cell receptor- § g or - + ˇ lineages can occur just prior to the onsetof CD4 and CD8 expression among immature thymocytes. Eur. J.Immunol. 1992. 22: 2185–2188.

5 Dudley, E. C., Girardi, M., Owen, M. J. and Hayday, A. C., § gand + ˇ T cells can share a late common precursor. Curr. Biol.1995. 5: 659–669.

6 Capone, M., Hockett. R. D. Jr. and Zlotnik, A., Kinetics of T cellreceptor g + and ˇ rearrangements during adult thymic develop-ment: T cell receptor rearrangements are present in CD44+CD25+

pro-T thymocytes. Proc. Natl. Acad. Sci. USA 1998. 95:12522–12527.

7 Livak, F., Tourigny, M., Schatz, D. G. and Petrie, H. T., Charac-terization of TCR gene rearrangements during adult murine T celldevelopment. J. Immunol. 1999. 162: 2575–2580.

8 von Boehmer, H., Aifantis, I., Feinberg, J., Lechner, O., Saint-Ruf, C., Walter, U., Buer, J. and Azogui, O., Pleiotropic changescontrolled by the pre-T cell receptor. Curr. Opin. Immunol. 1999.11: 135–142.

9 Malissen, M., Trucy, J., Jouvin-Marche, E., Cazenave, P.-A.,Scollay, R. and Malissen, B., Regulation of TCR § and g geneallelic exclusion during T cell development. Immunol. Today.1992. 13: 315–322.

10 Seto, D., Koop, B. F., Deshpande, P., Howard, S., Seto, J.,Wilk, E., Wang, K. and Hood, L., Organization, sequence, andfunction of 34.5 kb of genomic DNA encompassing severalmurine T cell receptor § ˇ variable gene segments. Genomics1994. 20: 258–266.

11 Wang, K., Kuo, C. -L., Koop, B. F. and Hood, L., The expressionof mouse T cell receptor TCRDV genes in BALB/c spleen. Immu-nogenetics. 1994. 40: 271–279.

12 Jouvin-Marche, E., Aude-Garcia, C., Candeias, S., Borel, E.,Hachemi-Rachedi, S., Gahery-Segard, H., Cazenave, P.-A.and Marche, P. N., Differential chronology of TCRADV2 gene useby § and ˇ chains of the mouse TCR. Eur. J. Immunol. 1998. 28:818–827.

13 Migone, N., Padovan, S., Zappador, C., Giachino, C., Bottaro,M., Matullo, G., Carbonaa, C., De Libero, G. and Casorati, G.,Restriction of the T cell receptor V ˇ gene repertoire is due to pref-erential rearrangement and is independent of antigen selection.Immunogenetics 1995. 42: 323–332.

14 Nakajima, P. B. and Bosma, M. J., Characterization of excisedDNA intermediates associated with V(D)J recombination at the Tcell receptor ˇ locus. Mol. Cell. Biol. 1997. 17: 2631–2641.

15 Gallagher, M., Candeias, S., Martinon, C., Borel, E., Malissen,M., Marche, P. N. and Jouvin-Marche, E., Use of TCR ADVgene segments by the ˇ chain is independent of their positionand of CD3 expression. Eur. J. Immunol. 1998. 28: 3878–3885.

16 Sperling, A. I., Cron, R. Q., Decker, D. C., Stern, D. A. andBluestone, J. A., Peripheral T cell receptor + ˇ variable gene rep-ertoire maps to the T cell receptor loci and is influenced by posi-tive selection. J. Immunol. 1992. 149: 3200–3207.

17 Pereira, P., Lafaille, J. J., Gerber, D. and Tonegawa, S., The Tcell receptor repertoire of intestinal intraepithelial + ˇ T lympho-cytes is influenced by genes linked to the major histocompatibil-ity complex and to the T cell receptor loci. Proc. Nat. Acad. Sci.USA 1997. 94: 5761–5766.

18 Sleckman, B. P., Khor, B., Monroe, R. and Alt, F. W., Assemblyof productive T cell receptor ˇ variable region genes exhibits alle-lic inclusion. J. Exp. Med. 1998. 188: 1465–1471.


19 Gerber, D. J., Azuara, V., Levraud, J.-P., Huang, S. Y., Lembe-zat, M.-P. and Pereira, P., Interleukin-4 producing + ˇ T cells thatexpress a very restricted TCR repertoire are preferentially local-ized in the liver and in the spleen. J. Immunol. 1999. 163:3076–3082.

20 Lefrancois, L., LeCorre, R., Mayo, J., Bluestone, J. A. andGoodman, T., Extrathymic selection of TCR + ˇ + T cells by classII major histocompatibility complex molecules. Cell 1990. 63:333–340.

21 Haas, W., Pereira, P. and Tonegawa, S., Gamma/delta cells.Annu. Rev. Immunol. 1993. 11: 637–685.

22 Happ, M. P., Kubo, R. T., Palmer, E., Born, W. K. and O’Brien,R. L., Limited receptor repertoire in a mycobacteria-reactive sub-set of + ˇ T cells. Nature. 1989. 342: 696–698.

23 Ezquerra, A., Cron, R. Q., McConnell, T. J., Valas, R. B., Blue-stone, J. A. and Coligan, J. E., T cell receptor ˇ -gene expressionand diversity in the mouse spleen. J. Immunol. 1990. 145:1311–1317.

24 Takagaki, Y., Nakanishi, N., Ishida, I., Kanagawa, O. and Tone-gawa, S., T cell receptor + and ˇ genes preferentially utilized byadult thymocytes for the surface expression. J. Immunol. 1989.142: 2112–2121.

25 Nagler-Anderson, C., McNair, L. A. and Cradock, A., Self-reactive, T cell receptor- + ˇ lymphocytes from the intestinal epi-thelium of weanling mice. J. Immunol. 1992. 149: 2315–2322.

26 Azuara, V., Levraud, J. P., Lembezat, M. P. and Pereira, P., Anovel subset of adult + ˇ thymocytes that secretes a distinct pat-tern of cytokines and expresses a very restricted T cell receptorrepertoire. Eur. J. Immunol. 1997. 27: 544–553.

27 Sperling, A. I., Decker, D. C., DiPaolo, R. J., Stern, D. A.,Shum, A. and Bluestone, J. A., Selective expansion of V + 2-V ˇ 7TCR + ˇ cells in C57BL/6 mice is postnatal and extrathymic.J. Immunol. 1997. 159: 86–91.

28 Arden, B., Klotz, J. L., Siu, G. and Hood, L. E., Diversity andstructure of genes of the alpha family of mouse T cell antigenreceptor. Nature 1985. 316: 783–787.

29 Casanova, J.-L., Romero, P., Widmann, C., Kourilsky, P. andMaryanski, J. L., T cell receptor genes in a series of class I majorhistocompatibility complex-restricted cytotoxic T lymphocyteclones specific for a Plasmodium berghei nonapeptide: implica-tions for T cell allelic exclusion and antigen-specific repertoire.J. Exp. Med. 1991. 174: 1371–1383.

30 Pircher, H., Rebaı, N., Groettrup, M., Gregoire, C., Speiser, D.E., Happ, M. P., Palmer, E., Zinkernagel, R. M., Hengartner, H.and Malissen, B., Preferential positive selection of V § 2+CD8+ Tcells in mouse strains expressing both H-2k and T cell receptorV § a haplotypes: determination with a V § 2-specific monoclonalantibody. Eur. J. Immunol. 1992. 22: 399–404.

31 Tomonari, K., Negative selection of Tcra-V8+CD8+ T cells byMHC class I molecules. Immunogenetics 1992. 44: 291–295.

32 Jameson, S. C., Nakajima, P. B., Brooks, J. L., Heath, W.,Kanagawa, O. and Gascogne, N. R. J., The T cell receptor V § 11family. Analysis of allelic sequences polymorphism and demon-stration of J § region-dependent recognition by allele-specificantibodies. J. Immunol. 1991. 147: 3185–3193.

33 Malissen, M., Gillet, A., Ardouin, L., Bouvier, G., Trucy, J., Fer-rier, P., Vivier, E. and Malissen, B., Altered T cell development inmice with a targeted mutation of the CD3-epsilon gene. EMBO J.1995. 14: 4641–4653.

34 Weber-Arden, J., Wilbert, O. M., Kabelitz, D. and Arden, B., V ˇrepertoire during thymic ontogeny suggests three novel waves of+ ˇ TCR expression. J. Immunol. 2000. 164: 1002–1012

35 Azuara, V., Lembezat, M. P. and Pereira, P., The homogeneity ofthe TCR ˇ repertoire expressed by the Thy-1dull

+ ˇ T cell popula-tion is due to cellular selection. Eur. J. Immunol. 1998. 28:3456–3467.

36 Yague, J., Blackman, M., Born, W., Marrack, P., Kappler, J.and Palmer, E., The structure of V § and J § segments in themouse. Nucleic Acids Res. 1988. 16: 11355–11364.

37 Happ, M. P. and Palmer, E., Thymocyte development: an analy-sis of T cell receptor gene expression in 519 newborn thymocytehybridomas. Eur. J. Immunol. 1989. 19: 1317–1325.

38 Miescher, G. C., Liao, N. S., Lees, R. K., MacDonald, H. R. andRaulet, D. H., Selective expression of V ˇ 6 genes byB2A2–CD4–CD8– T cell receptor + / ˇ thymocytes. Eur. J. Immunol.1990. 20: 41–45.

39 Wilbert, O. M., Weber-Arden, J., Kabelitz, D. and Arden, B.,TCR- ˇ gene rearrangement and selection during fetal thymocytedevelopment. J. Immunol. 1997. 159: 3338–3346.

40 Elliot, J. F., Rock, E. P., Patten, P. A., Davis, M. M. and Chien,Y.-H., The adult T cell receptor ˇ -chain is diverse and distinctfrom that of fetal thymocytes. Nature 1988. 331: 627–631.

41 Wang, K., Klotz, J. L., Kiser, G., Bristol, G., Hays, E., Lai, E.,Gese, E., Kronenberg, M. and Hood, L., Organization of the Vgene segments in mouse T cell antigen receptor § ˇ locus.Genomics 1994. 20: 419–428.

42 Sleckman, B. P., Gorman, J. R. and Alt, F. W., Accessibility con-trol of antigen-receptor variable-region gene assembly: role ofcis-acting elements. Annu. Rev. Immunol. 1996. 14: 459–481.

43 Krangel, M. S., Hernandez-Munain, C., Lauzurica, P.,McMurry, M., Roberts, J. L. and Zhong, X. -P., Developmentalregulation of V(D)J recombination at the TCR § ˇ locus. Immunol.Rev. 1998. 165: 131–147.

44 Lauster, R., Reynaud, C.-A., Martensson, I.-L., Peter, A., Buc-chini, D., Jami, J. and Weill, J.-C., Promoter, enhancer andsilencer elements regulates rearrangement of an immunoglobulintransgene. EMBO J. 1993. 12: 4615–4623.

45 Kingsley, C. and Winoto, A., Cloning of GT box-binding pro-teins: a novel Sp1 multigene family regulating T cell receptorgene expression. Mol. Cell. Biol. 1992. 12: 4251–4261.

46 Punturieri, A., Shirakata, Y., Bovolenta, C., Kikuchi, G. andColigan, J. E., Multiple cis-acting elements are required forproper transcription of the mouse V ˇ 1 T cell receptor promoter.J. Immunol. 1993. 150: 139–150.

47 Kienker, L. J., Ghosh, M. R. and Tucker, P. W., Regulatory ele-ments in the promoter of a murine TCRD V gene segment.J. Immunol. 1998. 161: 791–804.

48 Itohara, S., Mombaerts, P., Lafaille, J., Lacomini, J., Nelson,A., Clarke, A. R., Hooper, M. L., Farr, A. and Tonegawa, S., Tcell receptor ˇ gene mutant mice: independent generation of § gT cells and programmed rearrangements of + ˇ TCR genes. Cell1993. 72–3: 337–348.

49 Ishikawa, H., Li, Y., Yamamoto, S., Kaufmann, S. H. E. andTonegawa, S., Cytotoxic and interferon + -producing activities of+ ˇ T cells in the mouse intestinal epithelium is strain dependent.Proc. Natl. Acad. Sci. USA 1993. 90: 8204–8208.

50 Pereira, P., Gerber, D., Huang, S. Y. and Tonegawa, S., Onto-genic development and tissue distribution of V + 1 expressing + ˇ Tlymphocytes in normal mice. J. Exp. Med. 1995. 182: 1921–1930.

Correspondence: Pablo Pereira, Unite du Developpementdes Lymphocytes, CNRS URA 1961, Institut Pasteur, 25 Ruedu Dr. Roux, F-75724 Paris Cedex 15, FranceFax: +33-1-45-68-89-21e-mail: ppereira — pasteur.fr


developmentally regulated and lineage-specific rearrangement of t cell receptor vα/δ gene segments

Documents