dna antiguo, metodologÍa y daÑos moleculares. …
TRANSCRIPT
![Page 1: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/1.jpg)
UNIVERSIDAD DE SANTIAGO DE COMPOSTELA
INSTITUTO DE MEDICINA LEGAL
DDNNAA AANNTTIIGGUUOO,, MMEETTOODDOOLLOOGGÍÍAA YY
DDAAÑÑOOSS MMOOLLEECCUULLAARREESS..
AAPPRROOXXIIMMAACCIIÓÓNN AALL PPOOBBLLAAMMIIEENNTTOO
DDEELL NNUUEEVVOO MMUUNNDDOO
TESIS DOCTORAL
NURIA NAVERÁN RUIDO
2007
![Page 2: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/2.jpg)
UNIVERSIDAD DE SANTIAGO DE COMPOSTELA
FACULTAD DE MEDICINA
INSTITUTO DE MEDICINA LEGAL
DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES.
APROXIMACIÓN AL POBLAMIENTO DEL NUEVO MUNDO
Memoria que presenta, para optar al grado de doctor,
Nuria Naverán Ruido
En Santiago de Compostela, Octubre de 2007
![Page 3: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/3.jpg)
![Page 4: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/4.jpg)
El Doctor D. Ángel Carracedo Álvarez, Catedrático de Medicina Legal de la
Facultad de Medicina de la Universidad de Santiago de Compostela y la Doctora
Dª María Victoria Lareu Huidobro, Catedrática de Medicina Legal de la Facultad
de Medicina de la Universidad de Santiago de Compostela
CERTIFICAN:
Que la presente memoria que lleva por título “DNA ANTIGUO,
METODOLOGÍA Y DAÑOS MOLECULARES. APROXIMACIÓN AL
POBLAMIENTO DEL NUEVO MUNDO”, de la licenciada en Ciencias Biológicas
por la Universidad de Santiago de Compostela Nuria Naverán Ruido, ha sido
realizada bajo nuestra dirección, considerándola en condiciones para optar al
Grado de Doctor y autorizándola para su presentación ante el Tribunal
correspondiente.
Y para que así conste, firmamos la presente en Santiago de Compostela, a 2 de
Octubre de 2007.
Fdo.:Prof. Dr. Ángel Carracedo Álvarez Fdo.: Prof. Dra. M. Victoria Lareu Huidobro
Fdo: Nuria Naverán Ruido
![Page 5: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/5.jpg)
![Page 6: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/6.jpg)
Este trabajo ha sido financiado con una Beca Predoctoral de la
Xunta de Galicia con referencia DOG 30 de Septiembre de 2003 y por el
Servicio de Xenotipado – Nodo de Galicia con referencia 2006/SX019, y las
Becas de Estancia en el Extranjero de la Xunta de Galicia con referencia DOG
11 de Agosto de 2004 y de Universidad de Santiago de Compostela por la que
pude disfrutar de la estancia en la Universidad de Oxford del 1 de Septiembre
de 2004 al 1 de Abril de 2005 y la Beca de la Unión Europea Program GENE
TIME Marie Curie Early Stage Researcher Training Grant (MEST-CT-2004-
007909) por la que pude disfrutar de mi estancia en la Universidad de
Copenhague del 1 de Octubre de 2005 al 1 de Marzo de 2006.
![Page 7: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/7.jpg)
![Page 8: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/8.jpg)
VII
AGRADECIMIENTOS
Son muchas las personas a las cuales me gustaría agradecer estos años
de doctorado, y como leí una vez, este es el apartado más difícil de escribir. No
me gustaría olvidarme de nadie ni que nadie se sintiera ofendido por ello. Pero
probablemente se me escape alguno porque han sido muchas las personas que
han pasado por mi vida durante estos años.
Mis primeros agradecimientos van para mis directores de Tesis, Ángel
Carracedo y Maviki Lareu. Si no hubiera sido por la confianza que depositaron en
mi, ahora mismo no estaría aquí. Os agradezco el interés constante que le habéis
prestado a este trabajo de investigación y el continuo apoyo que me habéis
ofrecido. También os quiero agradecer vuestro apoyo a que realizara estancias
en el extranjero, probablemente estas hayan sido las que más me han
enriquecido profesional y personalmente.
A Toño por haberme animado siempre a seguir adelante, por todos sus
consejos y largas conversaciones, has hecho que no me sintiera tan sola en este
campo tan apartado del resto de investigaciones del laboratorio.
Por supuesto agradecer a todo el grupo de Medicina Legal, muchas han
sido las personas que han pasado por el laboratorio. Muchos seguimos juntos
pero otros ya se han ido. A los que todavía están; Paula, María Brión, Gloria,
Francesca, Vanesa, Anita, Ana Freire, Luisma, Eva, Meli, Alejandro, Amparo y en
especial a mis compis de noches, María Cerezo (gracias por tu ayuda con la
portada), Ángela, María Dosil, Alex, Manu, Fonde, Raquel. Gracias por vuestro
apoyo, por vuestra comprensión, gracias por estar ahí. En muchos no solo he
encontrado compañeros de trabajo, sino también verdaderos amigos.
Como ya he dicho muchas han sido las personas que han pasado por aquí
siendome totalmente imposible nombrar a todos. Quiero agradecer especialmente
a Ana Marmiesse y a Sandra Beleza especialmente por vuestra amistad.
Quiero agradecer a Jaume Bertranpettit el haberme acogido en su
laboratorio de Biología Evolutiva. A todo el grupo de la Pompeu Fabra, en el cual
me sentí integrada desde el primer día. Pero sobre todo Jaume, tengo que
agradecerte el haberme encontrado en tu laboratorio con las dos personas que
![Page 9: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/9.jpg)
VIII
más han marcado estos últimos 6 años. Al primero que quiero nombrar es a
Carles Lalueza-Fox, probablemente sea una de las personas a la que más tenga
que agradecer. Gracias por haberme transmitido toda tu sabiduría, por tus
consejos, por tu apoyo en momentos duros. Sin ti no habría sido posible toda esta
aventura. Llegué a Barcelona esperando encontrar a un gran profesional, y
además me encontré a un amigo.
Y por supuesto a la otra persona que tengo tanto que agradecer es a
Lourdes Sampietro. Creo que la complicidad que hemos llegado a tener estos
años es difícil de alcanzar, probablemente haya sido por este “duro mundo” del
DNA antiguo. Pero créeme tu apoyo ha sido fundamental. Gracias por todos los
meses que compartimos juntas en Copenhague (y tan juntas!), efectivamente han
sido toda una aventura; gracias por los últimos meses de escritura en los cuales
me has animado tanto a seguir adelante, gracias por acompañarme en los
momentos más duros de mi vida, gracias por haber estado siempre ahí. Hoy en
día es difícil encontrar a personas con tal calidad humana, espero que todo te
vaya de maravilla porque la verdad es que te lo mereces.
Quiero continuar mis agradecimientos por el laboratorio de Oxford, el
Henry Wellcome Biomolecules centre (ABC), en el cual el Dr. Alan Cooper me
acogió para lo que iba a ser una estancia de 3 meses y casi acaba convirtiéndose
en un año. Tengo que decir que fueron los mejores años profesional y
personalmente. Gracias a todo el grupo en donde encontré a amigos de verdad,
gracias Martin, Karen, Ross, Simon, Eske, Laura, Jaco, Greger, Matt, Paul y Phil.
Nunca olvidaré nuestras noches de cerveza y de nachos con queso.
A todas las personas que me he encontrado en Oxford, a mi familia
inglesa, a Pilar que fue mi contacto con España, como olvidarme de aquellas
lentejas!.
Por supuesto a otro laboratorio al que tengo que agradecer mi ya última
estancia, es al laboratorio del Dr. Eske Willerslev, el “Ancient DNA and Evolution
group”. Gracias Eske por haber confiado en mi y haber hecho posible mi estancia
en Copenhague. Gracias a todo el grupo por todos los momentos que hemos
vivido juntos. En especial quiero darle las gracias a Tom Gilbert, tu entusiasmo
por esta ciencia ha hecho que los últimos años de tesis no se hicieran tan cuesta
![Page 10: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/10.jpg)
IX
arriba, gracias por preocuparte siempre por Lourdes y por mi. También quiero
agradecer a Juan Sánchez el haber estado ahí día tras día ayudándonos a
progresar en nuestro trabajo, jamás he visto a una persona tan entregada al
trabajo como tu. Fuiste un gran apoyo en nuestro frío invierno Danés.
Sobre todo hay alguien a quien quiero agradecer todo el tiempo que ha
pasado conmigo no sólo en Copenhague sino también en Oxford, gracias Martin
por todo tu apoyo en los malos momentos, siempre me he sentido arropada a tu
lado, gracias por todos esos largos paseos, gracias por haber estado ahí.
Quiero dedicar esta tesis a todos mis amigos, que han sufrido tanto como
yo estos años, han celebrado mis triunfos y hemos llorado mis fracasos. Gracias
Esme por ser mi psicóloga particular, gracias por todos estos años que hemos
compartido juntas, por tu amistad incondicional, por ser como eres.
Gracias al Club Alpino Ourensan, no a la montaña en sí sino a todas esas
personas que me hicieron sentir que tenía una gran familia. Gracias Mar, Caro,
Iñaki, Manu, Franxo, Aviñoá, Pili, Mundi, Marga, Edu, Tato, Ana Dios, Elisa… por
todas esas cumbres que hemos compartido.
Y por último y en este caso más importante, quiero agradecer a mi familia
todo el apoyo que siempre he tenido, gracias a mis padres, a mis hermanas
Charo y Belén y a mi primisimo Javi, a mis tíos Francisco y Bego, gracias por
quererme, gracias por aguantar mi carácter, gracias por estar ahí. En especial
quiero agradecer a mi madre, por haber confiado en mi y apoyado en todo
momento. Y por supuesto a todo el resto de mi familia, tanto a los que están como
a los que ya no están.
Y a mi pequeñita familia de Santiago, gracias Julián, me resulta muy difícil
poder expresar todo lo que me has dado estos años, tu paciencia y comprensión
a la hora de tener que irme lejos. Sinceramente puedo decir que sin ti esta tesis
no habría sido posible, tu me has apoyado y has confiado en mi. Por todo ello
muchísimas gracias!
![Page 11: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/11.jpg)
![Page 12: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/12.jpg)
A MI MADRE
A MI FAMILIA
A MIS AMIGOS
![Page 13: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/13.jpg)
![Page 14: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/14.jpg)
Índice
![Page 15: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/15.jpg)
![Page 16: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/16.jpg)
Índice
XV
Índice..................................................................................XIII
Abreviaturas ......................................................................XIX
Justificación y Objetivos................................................XXIII
I. Introducción ..................................................................... 1
I.1. HISTORIA DEL DNA ANTIGUO (aDNA) .................................... 3
I.1.1. Estudios de aDNA en humanos .............................................. 13
I.1.2. Estudios de aDNA en Neandertales........................................ 14
I.1.3. Aplicaciones del aDNA en otros campos............................... 18
I.2. CRITERIOS DE AUTENTICIDAD ............................................. 19
I.3. DNA MITOCONDRIAL (mtDNA).............................................. 27
I.3.1. Características del mtDNA ...................................................... 28
I.3.2. Contenido del mtDNA............................................................... 31
I.3.3. Polimorfismos del mtDNA ....................................................... 34
I.3.4. Heteroplasmias en el mtDNA .................................................. 36
I.3.5. Transcripción del mtDNA ........................................................ 37
I.3.6. Replicación del mtDNA ........................................................... 38
I.3.7. Los haplogrupos mitocondriales ............................................ 39
I.3.8. Estudios antropológicos basados en el mtDNA ................... 41
I.3.9. Uso del mtDNA en restos antiguos ........................................ 44
I.4. DAÑOS POST MORTEM EN EL DNA...................................... 49
I.4.1. Daños que impiden la amplificación ................................... 52
I.4.1.1. DNA Cross-links .......................................................................... 52
I.4.1.2. Roturas en las cadenas ............................................................... 54
I.4.1.3. Modificaciones en la estructura del DNA ...................................... 55
I.4.2. Daños que permiten la amplificación.................................. 56
I.4.2.1. “ Miscoding Lesions”..................................................................... 56
I.4.2.2. “Jumping PCR ” ............................................................................ 66
I.4.3. Sustancias mutagénicas ...................................................... 70
![Page 17: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/17.jpg)
Índice
XVI
I.5. POBLAMIENTO DEL NUEVO MUNDO.................................... 72
I.5.1. Hallazgos arqueológicos y geológicos .................................. 73
I.5.2. Estudios genéticos................................................................... 76
I.5.2.1. Primera entrada en América ......................................................... 77
I.5.2.2. Origen de la ó las primeras migraciones ...................................... 85
I.5.2.3. Estudios de DNA antiguo.............................................................. 89
I.5.3. Conclusión ................................................................................ 91 II. Material y Métodos........................................................ 93
II.1. MATERIAL UTILIZADO PARA ESTE TRABAJO .................. 95
II.2. EXTRACCIÓN DE DNA .......................................................... 95
II.2.1. Limpieza y procesado de las muestras............................... 96
II.2.1.1. Hueso ......................................................................................... 96
II.2.1.2. Diente ......................................................................................... 96
II.2.1.3. Pelo ............................................................................................ 97
II.2.1.4. Coprolitos ................................................................................... 98
II.2.2. Extracción .............................................................................. 98
II.3. CUANTIFICACIÓN ............................................................... 101
II.3.1. TaqMan .................................................................................. 102
II.3.2. SYBR® Green I Dye ............................................................... 104
II.4. AMPLIFICACIONES ........................................................... 105
II.5. TRATAMIENTO ENZIMATICO Uracil-N-Glicosilasa (UNG)
.............................................................................................. 109
II.6. SNaPshot ............................................................................. 109
II.7. ENZIMAS DE RESTRICCIÓN Y FRAGMENTO DE 9bp ...... 113
II.8. PURIFICACIÓN DE LOS PRODUCTOS DE PCR ................ 115
II.8.1. Purificación a partir de agarosa .......................................... 115
II.8.2. Purificación directa de la PCR ............................................ 116
II.9. CLONACIÓN ......................................................................... 117
II.10. SECUENCIACIÓN................................................................ 118
![Page 18: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/18.jpg)
Índice
XVII
III. Resultados y Discusión............................................. 121
III.1: IDENTIFICATION OF SKELETAL REMAINS USING SHORT-AMPLICON MARKER ANALYSIS OF SEVERELY DEGRADED DNA EXTRACTED FROM A DECOMPOSED AND CHARRED FEMUR ..................................................... 123
III.2: CHALLENGING DNA: ASSESSMENT OF A RANGE OF GENOTYPING APPROACHES FOR HIGHLY DEGRADED FORENSIC SAMPLES......................................................... 143
III.3: PATTERNS OF DNA DAMAGE IN ATAPUERCA’S BRONZE AGE POPULATION ............................................................. 153
III.4: MTDNA STUDY OF PERUVIAN MUMMIES FROM THE “ANDEAN SANCTUARIES” IN THE INCA PERIOD .......... 179
III.5: ANCIENT DNA FROM COPROLITES REVEAL PRE-CLOVIS HUMAN PRESENCE IN NORTH AMERICA ....................... 209
Supplementary Online Material ....................................................... 223 IV. Conclusiones ............................................................. 245
V. Bibliografía .................................................................. 251
![Page 19: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/19.jpg)
![Page 20: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/20.jpg)
Abreviaturas
![Page 21: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/21.jpg)
![Page 22: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/22.jpg)
Abreviaturas
XXI
A Adenina
aDNA DNA antiguo (ancient DNA)
AP Sitio apurínico
BSA Bovine Serum Albumine (Albúmina de suero bovino) bp Pares de bases
BP Before present
C Citosina
CRS Cambridge Reference Sequence
Ct Cycle threshold
D-Loop Displacement-Loop
DNA Ácido desoxirribonucleico
dNTPs Deoxiribonucleótido trifosfato
ddNTPs Dideoxriboinucleótido trifosfato
DTT Ditiotreitol
EDTA Ácido etilen-diaminotetraacético
Et al. y colaboradores
ExoI Exonuclease I
G Guanina
g Gramo
h Hora
HVI Hypervariable region I
HVII Hypervariable region II
Kb Kilobases
Kg Kilogramo
L Litro M Molar Mb Megabases mg Miligramos
min Minutos
ml Mililitro
mM Milimolar
mtDNA DNA mitocondrial
ng Nanogramo
nM Nanomolar
![Page 23: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/23.jpg)
Abreviaturas
XXII
numtDNA Nuclear mitochondrial DNA-like sequence (Secuencias
nucleares mitocondriales)
PCR Polymerase Chain Reaction (Reacción en cadena de la
polimerasa)
pmol Picomoles
PTB N-phenylacyl thiazolium bromide / bromuro de N-Fenilacil
Tiazolio
RNA Ácido ribonucleico
rpm Revoluciones por minuto
RFLPs RestrictionFragment Lenght Polymorphism (Polimorfismos
basados en la longitud de los fragmentos de restricción)
SAP shrimp alkaline phosphatase
SAM S-Adenosil Metionina
SDS Dodecil sulfato de sodio
seg Segundo
SNP Single nucleotide polymorphism (Polimorfismo de
nucleótido único)
STRs Short Tandem Repeats
T Timina
Taq polimerasa DNA Polimerasa Thermus aquaticus
TE Tris-EDTA
Temp. Temperatura
Tm Temperatura de Melting (Temperatura de hibridación)
U Uracilo
µg Microgramos
µl Microlitros
µM Micromolar
µm Micrometro
UV Luz ultravioleta
x-Gal 5-bromo-4-cloro-3-indol-β-D-galactopiranosido
![Page 24: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/24.jpg)
Justificación y Objetivos
![Page 25: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/25.jpg)
![Page 26: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/26.jpg)
Justificación y Objetivos
XXV
Debido a la gran cantidad de trabajos que están apareciendo acerca del
DNA antiguo (aDNA) hemos querido llevar a cabo un estudio de las técnicas que
se utilizan, así como evaluar los criterios que se deben tomar para garantizar la
validez de los resultados obtenidos.
Las técnicas de extracción y amplificación que se han desarrollado en este
campo, han permitido la resolución de casos en los cuales el estado de
preservación del DNA no permitiría obtener una respuesta mediante técnicas
convencionales. Por este motivo el desarrollo de esta metodología del DNA
antiguo en laboratorios forenses puede servir de gran ayuda, ya que gran parte
de las muestras forenses que se deben analizar han sido encontradas en
ambientes poco propicios para su conservación, presentando una alta
degradación.
Otro de los grandes méritos del aDNA es contribuir a resolver ciertas
cuestiones genético-poblacionales. La genética de poblaciones pretende resolver
los movimientos migratorios que han ocurrido a lo largo de la historia. Pero el
estudio de las poblaciones actuales no siempre nos da los resultados correctos
debido a la gran mezcla que existe entre las mismas. El aDNA permite estudiar
poblaciones de cada uno de los períodos de interés, contribuyendo a resolver los
grandes enigmas de estas migraciones.
Los objetivos que se plantean en esta tesis son de dos tipos, por un lado
objetivos metodológicos y por otro lado unos objetivos poblacionales.
Los ojetivos metodológicos hacen referencia a todos aquellos procedimientos
técnicos conforme a los cuales se extrae el DNA antiguo, se clona, se cuantifica,
se genotipa y se garantiza su autenticidad. Los objetivos poblacionales incluyen el
análisis genético-poblacional de los resultados obtenidos entre las diferentes
poblaciones antiguas estudiadas y las poblaciones actuales.
![Page 27: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/27.jpg)
Justificación y Objetivos
XXVI
A continuación se detallan los OBJETIVOS inicialmente planteados en el proyecto
de tesis:
1. Optimización de las condiciones de extracción de DNA de muestras
problemáticas, de uso forense y en DNA antiguo.
2. Optimización de las técnicas utilizadas en DNA antiguo tales como
amplificaciones poco restrictivas, clonación, cuantificación mediante Real-
Time PCR.
3. Evaluación de la influencia de ciertas variables en la obtención de
resultados como son; el tipo de tejido, antigüedad, procedencia de la
muestra y condiciones en las cuales ha permanecido durante años, como
temperatura, humedad, pH del suelo…
4. Desarrollo de métodos de identificación rápida del DNA de interés en
muestras antiguas.
5. Estudio de los daños moleculares que nos podemos encontrar en las
muestras antiguas. Utilización de métodos como el enzima UNG para tratar
de minimizar estos daños.
6. Empleo de las técnicas de DNA antiguo puestas a punto en el laboratorio
para llevar a cabo un análisis de muestras antiguas en poblaciones
Amerindias, intentando contribuir al debate existente hoy en día acerca del
número de migraciones y de haplotipos fundadores del Nuevo Mundo.
![Page 28: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/28.jpg)
I. Introducción
![Page 29: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/29.jpg)
![Page 30: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/30.jpg)
Introducción
3
I.1. HISTORIA DEL DNA ANTIGUO (aDNA)
El estudio del DNA antiguo (aDNA) consiste en la recuperación y en el
análisis de secuencias de DNA a partir de restos antiguos o de especimenes de
museo. Estos estudios han proporcionado a la ciencia la oportunidad de vivir una
experiencia única, como es la de obtener una visión de los seres vivos del pasado
estudiando directamente su patrimonio genético (Lalueza-Fox 1998).
El DNA antiguo es una joven disciplina, que se remonta a sólo 23 años
atrás; que se está ganando su respeto dentro de la familia de las ciencias
moleculares. Para entender cómo el aDNA se ha ido abriendo paso es necesario
indagar un poco a lo largo de la historia de esta nueva ciencia (Figura 1).
El primer trabajo relevante en el DNA antiguo fue publicado en 1984 por un
grupo de investigadores dirigido por el Dr. Allan Wilson en Berkeley (Higuchi et al.
1984). El equipo de Wilson estudió el Quagga (Equus quagga) un animal parecido
a la cebra, extinguido en la segunda mitad del siglo XIX. El DNA usado para el
estudio fue extraído del tejido muscular seco de un ejemplar embalsamado,
conservado durante 150 años en el Museo de Historia Natural de Mainz,
Alemania. El DNA del quagga fue comparado con el de equinos vivos y se
demostró que estaba mucho más emparentado con las cebras que con los
caballos (cuestión sobre la cual los científicos no habían logrado ponerse de
acuerdo hasta ese momento). El material recuperado para este estudio no era
particularmente antiguo, lo interesante de la noticia fue haber recuperado el DNA
de una especie que ya no existía.
Dentro de las células vivas, el DNA está muy bien protegido. Existen,
además, eficientes mecanismos enzimáticos que lo reparan cuando sufre algún
daño. La cosa cambia por completo cuando las células mueren. Las estructuras
celulares se desintegran y las grandes moléculas biológicas quedan expuestas a
las inclemencias del ambiente. La temperatura, la humedad y la luz solar son
algunos de los factores que atentan contra la persistencia de esas moléculas.
Aunque, en determinadas circunstancias, el DNA puede perdurar durante mucho
tiempo. Sin embargo la cantidad de DNA en los tejidos antiguos es tan pequeña
![Page 31: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/31.jpg)
Introducción
4
que el aislamiento de la misma secuencia a través de clonación con bacterias se
hace prácticamente imposible, de forma que los resultados no pueden ser
repetidos en orden de verificar la secuencia. Todo esto hace que el desarrollo del
campo del DNA antiguo vaya demasiado lento. Entre los años 1984 y 1987 sólo
se publicaron trabajos esporádicos de nuevos hallazgos en este campo. Es de
destacar la extracción de ácidos nucleicos de una momia egipcia de una
antigüedad de 2.500 años (Pääbo 1985), mostrando así que los genes humanos
pueden ser accesibles con estas técnicas moleculares. Svante Pääbo confirma
que los especimenes momificados tanto natural como artificialmente presentan
DNA extraíble y estos no se limitan a especimenes recientes de museos, sino que
nos podemos remontar a miles de años.
Un evento crucial que condujo al avance de este campo fue el desarrollo
de la reacción en cadena de la polimerasa, PCR (Polymerase Chain Reaction), la
cual permitió obtener millones de copias del DNA deseado partiendo de pequeñas
cantidades de moléculas (pudiendo llegar hasta una sola molécula), siendo esta
una técnica mucho mas sensible y simple que cualquier otra técnica de
amplificación (Mullis et al. 1986; Mullis and Faloona 1987). Lo que permite que
una misma secuencia de DNA procedente de un individuo pueda ser amplificada
múltiples veces. De hecho cuando se intentaron replicar mediante PCR los
estudios del quagga cuyo DNA había sido clonado, aparecieron dos posiciones
que eran erróneas en la secuencia original (Paabo and Wilson 1988). Mostrando
esto lo importante que es en este campo la replicación de los resultados. En el
experimento de Higuchi, las posiciones dañadas en la hebra de DNA original,
probablemente habían sido reparadas por enzimas bacterianas provocando los
errores de la secuencia final. Con la PCR se produjo un enorme aumento en la
producción científica en el campo del aDNA (Pueden verse ejemplos en la Tabla
1) debido a lo fácil que resulta el uso de esta técnica. Gran cantidad de
cuestiones evolutivas y relaciones entre criaturas extinguidas y especies
modernas comenzaron a analizarse.
Muy a menudo estos estudios simplemente corroboraron las teorías
preexistentes, así por ejemplo se encontró que el mamut era un miembro de la
familia elephantidae (Hagelberg et al. 1994; Höss et al. 1994). Sin embargo, otros
![Page 32: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/32.jpg)
Introducción
5
estudios dieron resultados que entraban en conflicto con los análisis morfológicos.
Como el caso del Kiwi (género Apteryx) y la especie extinta Moa (ave gigante no
voladora oriunda de Nueva Zelanda), encontraron que no eran monofiléticas, y
que debieron de haber colonizado Nueva Zelanda en dos eventos separados
(Cooper et al. 1992).
A lo largo de estos años se han publicado gran cantidad de trabajos en
prestigiosas revistas científicas. Sin embargo el estado de preservación del DNA
de ciertos estudios parece totalmente incompatible con las propiedades químicas
conocidas de la estructura del DNA (Lindahl 1993a), por lo que esta ciencia
empezó a estar en peligro de perder toda su credibilidad. Lindahl denominó a este
fenómeno “DNA antediluviano” (Lindahl 1993b). Se publicaron estudios en los que
se obtenía DNA de especimenes de hacía varios millones de años. Uno de los
primeros trabajos fue la publicación de las secuencias de DNA procedentes de
una hoja de magnolia, de 17 – 20 millones de años de antigüedad, depositada en
arcilla en el fondo de un lago al norte de Idaho, Estados Unidos (Golenberg et al.
1990). Otros ejemplos son la obtención de DNA de organismos preservados en
ámbar (DeSalle et al. 1992; Cano et al. 1993) o por ejemplo la recuperación del
gen mitocondrial citocromo b a partir de un hueso de un dinosaurio de más de 80
millones de años (Woodward et al. 1994). Sin embargo estos trabajos resultaron
ser de dudosa credibilidad científica, ya que o fue imposible reproducirlos (Austin
et al. 1997) o se demostró que procedían de una contaminación. Ya que la PCR
proporcionó una buena herramienta en este campo pero, sin embargo, un
problema que añade es que se crea un aumento de posibilidad de contaminación
con DNA moderno (Willerslev and Cooper 2004).
Como resultado de esto se publicaron una serie de artículos enfocados en
la necesidad de reproducir todos aquellos resultados obtenidos en aDNA (Pääbo
1989; Pääbo et al. 1989; Lindahl 1993b). Esto llevó a que se formularan una lista
de criterios (ver el capítulo I.2) que se deberían seguir en este tipo de estudios
(Handt et al. 1994a; Cooper and Poinar 2000; Hofreiter et al. 2001b).
Muchos de estos trabajos analizaban fragmentos superiores a 500 bp lo
que contradecía anteriores observaciones acerca de que la fragmentación del
![Page 33: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/33.jpg)
Introducción
6
aDNA hace improbable la amplificación de segmentos superiores a 200 bp
(Pääbo et al. 1989; Cooper 1994).
Otro de los inconvenientes que presenta la PCR es la inhibición. Se trata
de una técnica muy sensible, por lo que impurezas que normalmente se
encuentran presentes en los extractos de DNA antiguo, (Kurosaki et al. 1993),
inhiben la amplificación (Hagelberg et al. 1989; Pääbo et al. 1989). Por ello es
necesario purificar o diluir la muestra, lo que conlleva a una pérdida del poco DNA
del que partimos, o usar sustancias como la BSA (albúmina de suero bovino) que
mejoran el rendimiento de esta técnica.
Rápidamente hueso y diente se presentaron como las mejores fuentes
para la obtención de aDNA, mucho mejores que los tejidos blandos (Hagelberg et
al. 1989). Aumentando el número de autores que prefieren diente frente a hueso,
ya que consideran que la calidad del DNA es mayor debido a una mejor
preservación (Kurosaki et al. 1993; Oota et al. 1995). Esto significó que los
museos rápidamente se convirtieron en almacenes donde se encontraba
almacenada toda la información genética del pasado.
Un avance importante en este campo ha sido la habilidad de extraer DNA
directamente de tierra y de muestras congeladas (Willerslev et al. 2003; Willerslev
and Cooper 2004; Willerslev et al. 2004) dando a los investigadores la libertad de
concentrarse directamente en ambientes de interés como por ejemplo el
Pleistoceno tardío en Beringia. Un gran número de estudios se han centrado en
los coprolitos, tanto de megafauna como de humanos (Poinar et al. 2001; Poinar
et al. 2003); pudiendo identificar el espécimen que los depositó y el contenido
fecal, incluso observar cambios en la dieta a través del tiempo (Hofreiter et al.
2000).
Otra área interesante dentro del aDNA es el estudio de enfermedades
infecciosas y la investigación de cómo se han propagado a lo largo de los años.
Esta información deriva de las grandes colecciones que poseen los museos de
especies fijadas en formol (Taubenberger et al. 1997) y en parafina (Jackson et al.
1998). Los especimenes que fueron investigados en el contexto de la
![Page 34: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/34.jpg)
Introducción
7
paleoepidemiología fueron de diferentes tipos y edades. Algunos de los muchos
ejemplos de trabajos realizados son, Mycobacterium tuberculosis (Zink et al.
2001) extraído de tejidos blandos momificados y de huesos o estudios en Yersinia
pestis (Gilbert et al. 2004a). Con estos trabajos se puede ver que la
paleoepidemiología no solo sirve para dar conocimiento acerca de situaciones
históricas, sino que además ayuda a entender el modo y el tiempo de evolución
mutacional de patógenos y endoparásitos (Pääbo et al. 2004).
![Page 35: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/35.jpg)
Introducción
8
Figura 1: Esquema de los trabajos más relevantes publicados, para números ver Tabla 1
11998844
1
11998855
2
11998866
3
11998877
4
11998888
5
11998899
6 7
11999900
8
11999922
9 10
11999933
11
11999944
12 13
14
11999966
15 11999977
16
11999988
17
11999999
18 19
22000000
20
21 y 22
22000011
23
22000022
24
25
26
22000033
27 28 y 29
30
22000044
31 32
22000055
33
34 y 35
22000066
36 37 y 38 39 - 42
![Page 36: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/36.jpg)
Introducción
9
1984 1 (Higuchi et al. 1984)
Recuperación de DNA de músculo de un
Quagga de 140 años de antigüedad (Equido de
sud-Africa extinguido a finales del siglo XIX)
1985 2 (Pääbo 1985)
Momia Egipcia 2400 años (3400 bp del gen
HLA del cromosoma 6).
Se trató de una contaminación
1986 3 (Mullis et al. 1986)
Descubrimiento de la Reacción en Cadena de
la Polimerasa (PCR).
Aparición de una poderosa arma para el DNA
antiguo.
1987 4 (Cann et al. 1987) Teoría de la Eva Mitocondrial
1988 5 (Pääbo et al. 1988) Tejido neuronal humano de 7.000 años de
antigüedad
6 (Thomas et al. 1989)
Estudio de tejido muscular del Lobo marsupial
(Thylacinus cynocephalus) de Tasmania
desaparecido en 1936 1989
7 (Hagelberg et al. 1989) Extracción de DNA a partir de Huesos de entre
300 y 5.500 años de antigüedad
1990 8 (Golenberg et al. 1990)
820 pb del gen rbcL del cloroplasto de una
Magnolia fósil de 17 – 20 millones de años de
antigüedad.
Irreproducible
9 (Cooper et al. 1992)
Estudio de 4 Moas (Aves gigantes de Nueva
Zelanda extinguidas hace unos 400 años).
Viendo que no se encontraban estrechamente
emparentadas con el Kiwi (Ave de Australia) 1992
10 (DeSalle et al. 1992)
Recuperación de DNA nuclear y mitocondrial de
una termita conservada en ámbar con 25 – 30
millones de años de antigüedad. Resultó ser una contaminación de Drosophila
1993 11 (Lindahl 1993a)
Estudios de los procesos de degradación del
DNA
![Page 37: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/37.jpg)
Introducción
10
12 (Woodward et al. 1994)
Recuperación de 174 bp de DNA mitocondrial
correspondiente al citocromo b, de un
Dinosaurio de 80 millones de años de
antigüedad.
Parece tratarse de una contaminación de una numt humana (Zischler et al. 1995).
13 (Höss et al. 1994)
Huesos de 4 Mamuts de entre 9.700 y 50.000
años de antigüedad, analizando 93 bp del
mitocondrial. 1994
14 (Handt et al. 1994b)
Hombre neolítico del Tirol de 5.300 – 5.100
años de antigüedad. Presentaba un haplogrupo
K (16224, 16311) típico de poblaciones de
Europa del Norte, descartando que se tratara
de un fraude; no era una momia egipcia o
peruana como se llegó a decir.
1996 15 (Hoss et al. 1996)
Amplificación de 1.100 pares de bases del DNA
mitocondrial de un Perezoso gigante de 13.000
años de antigüedad.
1997 16 (Krings et al. 1997) 1er Neandertal: “Feldhofer 1” (378 bp HVRI)
1998 17 (Poinar et al. 1998)
Estudio de 18 coprolitos pertenecientes al
Perezoso gigante con edades comprendidas
entre los 10.900 y los 31.410 años.
18 (Greenwood et al. 1999) Estudio de DNA nuclear y mitocondrial
procedente de Megafauna del Pleistoceno. 1999
19 (Krings et al. 1999) Neandertal: “Feldhofer 1” (340 bp de HVRII)
20 (Cooper and Poinar 2000) Criterios de Autenticidad
21 (Ovchinnikov et al. 2000) 2º Neandertal: “Mezmaiskaya” (345 bp de
HVRI) 2000
22 (Krings et al. 2000) 3er Neandertal: “Vindija 75” (357 bp de HVRI y
288 bp de HVRII)
2001 23 (Cooper et al. 2001) Primer genoma mitocondrial completo de una
especie extinta, el Moa de Nueva Zelanda
![Page 38: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/38.jpg)
Introducción
11
24 (Lalueza-Fox et al. 2002)
Estudio de Myotragus baleraricus (Bóvido
endémico de las Islas Baleares, desaparecido
hace unos 4.000 años)
25 (Barnes et al. 2002)
Estudio del efecto del cambio climático global
en la diversidad biológica durante el Pleistoceno
tardío en Beringia. Para ello analizaron varias
muestras de osos pardos “Ursus arctos”.
2002
26 (Schmitz et al. 2002)
4º Neandertal: “Feldhofer 2”. Detección de
posibles artefactos debidos a desaminaciones
de la Citosina en Feldhofer 1.
27 (Willerslev et al. 2003)
Estudios de sedimentos de Permafrost y de
zonas templadas de Beringia y de Nueva
Zelanda demuestran que se puede obtener
DNA de restos de fauna y flora en muestras de
hasta hace 400.000 años.
28 (Gilbert et al. 2003a) Estudios de daños en el DNA 29 (Gilbert et al. 2003b) Estudios de daños en el DNA
2003
30 (Caramelli et al. 2003)
Estudio de 2 Cromañones de 23.000 y 25.000
años de antigüedad, junto con restos animales
de las misma cueva para verificar que los
resultados no eran una contaminación
31 (Shapiro et al. 2004)
Estudio de un fragmento de 685 bp de la
Región Control del DNA mitocondrial en 442
Bisontes de la zona de Beringia. Demuestra
que la diversidad genética empezó a disminuir
drásticamente debido a cambios ambientales y
no por la acción humana como se pensaba. 2004
32 (Serre et al. 2004)
5º Neandertal: “Vindija 80”
6º Neandertal: “Vindija 77”
7º Neandertal: “Engis 2”
8º Neandertal: “La Chapelle-aux-Saints”
Se usaron primers específicos de neandertales
en 5 cromañones con resultados negativos.
![Page 39: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/39.jpg)
Introducción
12
33 (Noonan et al. 2005)
Se analizaron mediante la construcción de
librerías metagenómicas, 26.861 bp de
secuencia genómica de 2 osos de las cavernas
de 40.000 años de edad
34 (Lalueza-Fox et al. 2005) 9º Neandertal: “Sidrón 441”.
Primer neandertal de la Península Ibérica
2005
35 (Beauval et al. 2005) 10º Neandertal: “Les Rochers-de-Villeneuve 1”
36 (Sanchez and Endicott 2006) Diseño de una multiplex para aDNA
37 (Krause et al. 2006)
Genoma mitocondrial completo del Mamut,
viendo como este se encuentra más
relacionado con el elefante asiático que con el
africano
38 (Rompler et al. 2006)
Recuperación del gen nuclear del receptor de la
melanocortina de un Mamut de 43.000 años de
antigüedad. Este gen determina el color del
pelo en humanos y otros animales. Se
demuestra que es posible conocer
características de animales del pleistoceno que
no se pueden ver por el registro fósil.
39 (Orlando et al. 2006) 11º Neandertal: “Scladina” (100.000 YBP)
40 (Caramelli et al. 2006) 12º Neandertal: “Monti Lessini”
41 (Green et al. 2006)
Recuperación de un 0,04 % del DNA nuclear
del Neandertal de “Vindija 80”. Usando la
tecnología “454 sequencing platform”
2006
42 (Noonan et al. 2006) Recuperación de DNA nuclear del Neandertal
“Vindija 80” usando librerías metagenómicas. Tabla 1: Resumen de los trabajos más interesantes que se han ido publicando a lo largo de estos años en el DNA antiguo.
![Page 40: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/40.jpg)
Introducción
13
I.1.1. Estudios de aDNA en humanos
Debido al interés considerable que existe a nivel antropológico,
arqueológico y público de los restos humanos, es normal que estos reciban
una cierta atención por parte de la comunidad del DNA antiguo. La Teoría de
Eva Africana propuesta por Cann y colaboradores en 1987 derivada de sus
estudios en DNA humano mitocondrial, causa nuevas disputas acerca del
origen del hombre. Así el campo del aDNA se presenta como todo un reto,
debido a la gran colección de restos humanos que existen.
El material del que se puede partir para realizar este tipo de estudios,
puede ser tanto restos que se conservan tal cual porque han estado
congelados todo este tiempo, como es el caso del hombre del Tirol, Ötzi
(Handt et al. 1994b), como restos que se han disecado rápidamente, como por
ejemplo aquellas momias que se encuentran a gran altitud en los Andes
(Moraga et al. 2005). No obstante, la fuente principal de estudio son dientes y
huesos, existiendo otras fuentes de las que se pueden obtener DNA, entre
otras; paleoheces (Poinar et al. 2001) y pelo (Baker et al. 2001; Gilbert et al.
2006).
El aDNA presenta siempre un gran riesgo de contaminación, por eso
son necesarios una gran cantidad de criterios para verificar las secuencias, ya
que estamos hablando de cantidades ínfimas de DNA y generalmente
bastante degradadas. Pero cuando hablamos de aDNA humano, los riesgos
se multiplican, ya que el DNA humano se encuentra por todos lados; por lo
que se tienen que seguir protocolos mucho más rigurosos.
Sin embargo estudios de aDNA han sabido dar respuesta a una gran
cantidad de preguntas como son el poblamiento del continente Americano
(Stone and Stoneking 1998), Asia Central (Lalueza-Fox et al. 2004), Islas
Andamanesas (Endicott et al. 2003), Japón (Oota et al. 1995) entre otros…
![Page 41: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/41.jpg)
Introducción
14
I.1.2. Estudios de aDNA en Neandertales
Entre los estudios que han tenido mayor relevancia dentro del campo de
la Antropología destaca la caracterización genética del hombre de Neandertal.
Los Neandertales son un grupo de homínidos extintos que habitaron Europa y
el oeste de Asia, entre hace 300.000 y 30.000 años aproximadamente, en este
tiempo fueron acumulando características morfológicas que les fueron
haciendo cada vez más diferentes de sus antecesores africanos. Durante
parte de este tiempo coexistieron con los humanos modernos, Homo sapiens
sapiens, originarios del continente africano.
Tal y como define Carles Lalueza – Fox en su libro “Genes de
Neandertal” (Lalueza-Fox 2005): “Hace 40.000 años, unos emigrantes
africanos, los cromañones, entraron en Europa y se encontraron con otros
humanos de físico distintivo, los neandertales, que llevaban allí más de
doscientos mil años. Al cabo de unos diez mil años, en un proceso que todavía
no comprendemos totalmente, los primeros se habían impuesto, y los
segundos se habían extinguido”.
Los Neandertales se reconocieron por primera vez como un grupo
diferente al de los humanos modernos hace 150 años con los restos fósiles
encontrados en Feldhofer en el Valle de Neander (Neander Thal), a las
afueras de Düsselforf, Alemania. A partir de este se fueron encontrando más
restos en Europa y en el oeste de Asia.
La relación filogenética de este grupo con el humano actual ha sido
ampliamente discutida barajándose tres hipótesis:
1. Los Neandertales fueron los ancestros directos de los europeos actuales.
2. Los Neandertales fueron totalmente reemplazados por los humanos
modernos sin mezclarse.
3. A pesar de ser finalmente reemplazados por el hombre moderno, existió
cierta mezcla entre ambas subespecies durante el período de
convivencia, por lo que potencialmente habría cierta contribución
genética de los Neandertales al pool genético humano actual.
![Page 42: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/42.jpg)
Introducción
15
Después de siglo y medio de largos debates en los que no se llegaba a
ninguna conclusión, apareció la posibilidad de intentar aclarar esto mediante el
estudio genético de estos especimenes, esto fue gracias a la tecnología del
DNA antiguo (Lalueza-Fox 2005), haciendo posible que en el año 1997 se
pudiera analizar por primera vez un fragmento de 378 bp (divididos en
pequeños fragmentos de unas 100 bp) de la región control del DNA
mitocondial; HVRI .
Hasta la fecha se han analizado fragmentos de DNA mitocondrial de 12
Neandertales diferentes (Krings et al. 1997; Krings et al. 1999; Krings et al.
2000; Ovchinnikov et al. 2000; Schmitz et al. 2002; Serre et al. 2004; Beauval
et al. 2005; Lalueza-Fox et al. 2005; Caramelli et al. 2006; Orlando et al.
2006), (Tabla 1:, Figura 2) todos produciendo secuencias que los excluyen de
los humanos modernos.
Figura 2: Localización geográfica de los 12 neandertales en los que se ha estudiado el DNA mitocondrial hasta el momento. Los círculos oscuros corresponden a individuos con una guanina (G) en la posición 16258 del DNA mitocondrial; los círculos claros corresponden a individuos con una adenina (A) en la misma posición. Imagen modificada de Lalueza-Fox et al. (2005).
![Page 43: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/43.jpg)
Introducción
16
Por supuesto estos estudios han generado gran controversia; algunos
autores apuntan que la divergencia entre el Homo neanderthalensis y el Homo
sapiens se encuentra sobreestimada (Gutiérrez et al. 2002). Estos autores
plantean que se ha reportado un número de mutaciones muy grande pero no
se han tenido en cuenta que muchas de estas posiciones pueden ser falsas
debido a fenómenos de daños post mortem. Sin embargo a medida que se
han ido publicando más trabajos se han ido aportando más datos haciendo
que la probabilidad de que esas mutaciones sean falsas disminuyera (Cooper
et al. 2004).
Así el elevado número de diferencias observadas entre las secuencias
de Neandertal recuperadas hasta la fecha y las secuencias humanas actuales
ha sido interpretado como evidencia de que no ha habido una contribución
genética significativa por parte de los Neandertales. Aceptándose como más
probable la hipótesis 2. El homo neanderthalensis habitó Europa y partes de
Asia occidental desde hace 230.000 hasta 29.000 años atrás, durante el
Paleolítico medio.
Sigue existiendo un debate acerca de si se produjo algún tipo de
híbrido debido a las evidencias de ciertos restos encontrados como el caso de
un niño de 24.500 años de antigüedad encontrado en el sur de Portugal (Lagar
Velho). Este presentaba una morfología que parecía una mezcla entre
neandertales y cromañones (Tattersall and Schwartz 1999). Pero este caso ha
perdido fuerza y pocos investigadores lo consideran como un buen candidato
a ser un híbrido. De todas formas si hubo cruzamientos entre ellos estos
debieron de ser mínimos y evolutivamente no favorables (Lalueza-Fox 2005).
Mediante el análisis de estas secuencias de DNA mitocondrial se ha
visto que eran un grupo muy homogéneo y que existe una mezcla de linajes,
como se puede ver en la muestra Feldhofer 2 (Alemania) y la de Vindija
(Croacia) que son mucho más parecidas entre si que la de Feldhofer 2 y
Feldhofer 1, a pesar de haberse encontrado en la misma cueva. Por lo que
parece que no había una fuerte estructuración geográfica de los linajes
mitocondriales entre los neandertales.
![Page 44: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/44.jpg)
Introducción
17
Otra deducción que se puede hacer observando las secuencias de
estos 12 neandertales es cuando observamos la posición 16258, la mitad de
ellos presentan una G mientras que la otra mitad una A, encontrándose la
misma variante en sitios tan alejados como son la península Ibérica y los
Balcanes. Por lo que el tamaño poblacional de los neandertales parece que
tenía que ser lo suficientemente grande para que esta posición haya
perdurado en el tiempo, así que tuvo que tratarse de una variación que ya
existía entre los neandertales previamente a al última gran glaciación hace
130.000 años (Lalueza-Fox et al. 2005).
Recientemente el equipo de Svante Paabo ha obtenido las primeras
secuencias de DNA genómico neandertal (Green et al. 2006; Noonan et al.
2006) usando uno de los especimenes de yacimiento de Vindija en Croacia
“Vindija 80”. El cual parece que presenta una gran cantidad de DNA y que se
encuentra en buen estado. Gracias a estos resultados se ha podido calcular la
edad de divergencia entre humanos modernos y Neandertales (Figura 3:). Sin
embargo, recientemente se han cuestionado estos resultados (Wall and Kim
2007), mostrando como cada uno de estos trabajos es inconsistente con el
otro, por lo que existe la posibilidad de que uno de ellos sea producto de
contaminación con DNA humano moderno.
Figura 3: Divergencia estimada para humanos anatómicamente modernos y Neandertales basándose en secuencias genómicas. El antecesor común de neandertales y humanos modernos se remonta a hace 706.000 años y las poblaciones ancestrales de humanos y de neandertales se separaron hace unos 370.000 años antes de la emergencia del hombre anatómicamente moderno. Esquema de Noonan et al. (2006).
![Page 45: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/45.jpg)
Introducción
18
A la luz de los primeros resultados del DNA genómico, nace así el
proyecto Genoma Neandertal en el cual se incluyen también los restos del
yacimiento del Sidrón (Asturias, España), restos que también parecen
presentar mucho DNA. Con este proyecto se pretende secuenciar los tres mil
millones de pares de bases que forman su genoma. Esto ayudará a aclarar
nuestra relación evolutiva con los neandertales, y ayudará a identificar los
cambios genéticos que permitieron a los humanos modernos dejar África y
difundirse con rapidez por diversas regiones del mundo hace unos 100.000
años.
I.1.3. Aplicaciones del aDNA en otros campos
Las aplicaciones de las tecnologías del aDNA y del DNA degradado
son múltiples. Por ejemplo, en las ciencias forenses los objetivos de las
investigaciones son: estudios de DNA en la escena del crimen (Schneider et
al. 1999), la identificación de victimas en desastres masivos como son los
accidentes aéreos (Clayton et al. 1995), así como víctimas de crímenes de
guerra y tortura (Alonso et al. 2001).
También han sido usadas las técnicas para la identificación de
personajes importantes como son los hijos putativos de Luis XVI (Jehaes et al.
2001) o los famosos miembros de la familia Romanov (Gill et al. 1994). En
este caso se usaron con éxito los STRs (Short Tandem Repeats) autosómicos
para la identificación, en vez del uso del DNA mitocondrial que se venía
usando hasta ahora en los estudios de aDNA.
![Page 46: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/46.jpg)
Introducción
19
I.2. CRITERIOS DE AUTENTICIDAD
Debido al número de trabajos que han ido apareciendo a lo largo de estos
años, se ha hecho necesaria la publicación de unos criterios a seguir para
asegurar la calidad de los datos obtenidos en DNA antiguo. Así podemos citar,
entre otros, una gran cantidad de trabajos en los cuales se referencia la
necesidad de los mismos: Lindahl (1993b); Handt et al. (1994a); Cooper and
Poinar (2000); Hofreiter et al. (2001b); Pääbo et al. (2004); Gilbert et al. (2005a).
Estos criterios comenzaron como unas simples sugerencias (Handt et al. 1994a) y
se han convertido a lo largo de los años en una detallada y extensa lista de
requisitos resultando en los bien conocidos nueve criterios propuestos por Alan
Cooper y Hendrik Poinar (2000). Estos autores se quejan de que la falta de estos
criterios hace que la autenticidad de los resultados sea incierta. Sin embargo son
pocos los trabajos que adoptan estos nueve criterios; y en muchos casos no
explican el porque no han usado alguno de ellos. Otros trabajos utilizan otro tipo
de criterios sin ninguna explicación de porque los usan, generalmente
adaptándolos a su situación particular. Todo esto hace que los resultados sean de
cierta incredulidad y que exista un gran escepticismo en este campo no sólo para
los que trabajamos en él, sino para el resto de la comunidad científica.
A continuación paso a citar estos nueve criterios (Cooper and Poinar 2000):
Criterio 1: Aislamiento de las áreas de trabajo. El objetivo de este criterio es separar las muestras y el DNA extraído
de los productos de PCR amplificados.
Es necesario tener un laboratorio de aDNA, donde tienen lugar las
extracciones y las primeras PCRs, y un laboratorio principal, donde todos los
procesos post-PCR tienen lugar, tales como reacción de amplificación,
electroforesis, clonación, secuenciación…
Lo ideal es que estas áreas se encuentren en diferentes edificios y que no se
pueda entrar en el laboratorio de aDNA cuando se haya entrado previamente
en el laboratorio principal, en orden de evitar cualquier contaminación con
productos de amplificación.
![Page 47: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/47.jpg)
Introducción
20
En el laboratorio de aDNA se deberán llevar a cabo una serie de medidas de
precaución, como son el uso, durante la noche, de luz ultravioleta, presión
positiva (el aire del laboratorio se halla a una presión ligeramente mayor que
la del exterior, evitando la entrada de aire del exterior), limpieza exhaustiva
con lejía y etanol. Todas las áreas de trabajo se limpiarán antes y después
de haber trabajado en ellas. Por nuestra parte se usarán trajes especiales y
evitaremos toda aquella ropa con la que hayamos entrado en el laboratorio
principal, se usarán máscaras, dobles pares de guantes, gorros, botas…
Toda precaución es poca cuando se trata de aDNA.
Criterio 2: Uso de controles negativos tanto en la extracción como en la amplificación.
El objetivo de este criterio es buscar contaminantes que se puedan
haber producido en alguno de los pasos de la extracción y de amplificación.
Consiste en añadir uno o más tubos en cada uno de los pasos (extracción o
amplificación) con todos los reactivos pero en vez de muestra llevarán agua.
De esta forma se puede saber si los reactivos que estamos usando están
contaminados, o si la contaminación se produjo en alguno de estos pasos.
De hecho, es conveniente usar más de un control negativo a fin de poder
detectar la mínima contaminación que pudiera existir (Pääbo et al. 2004).
A veces simplemente los controles negativos no sirven para detectar
moléculas contaminantes que se puedan encontrar en el laboratorio. Handt
y colaboradores lo definen como “Efecto carrier” (Handt et al. 1994a). Estos
dicen que muchas moléculas quedan impregnadas en los tubos de plástico
y por lo tanto no sirven como moléculas molde en la PCR, no apareciendo
en los controles negativos, pero existen moléculas “transportadoras” que
pueden desplazar estas moléculas contaminantes de la superficie del
plástico permitiendo así que estén disponibles para la amplificación. Estas
moléculas transportadoras pueden ser DNA o moléculas de azúcar de los
extractos de DNA. Esta por lo tanto es una fuente de contaminación que
causa muchas preocupaciones en los casos donde existe un bajo número
de copias de DNA.
![Page 48: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/48.jpg)
Introducción
21
Algo que contribuiría a la credibilidad en este campo es, que los
investigadores publicaran también las frecuencias de los resultados
negativos y las contaminaciones que han detectado en los estudios que
llevaron a cabo (Handt et al. 1994a).
Criterio 3: Apropiado comportamiento molecular.
Debido a la degradación del DNA, el éxito en la obtención de grandes
fragmentos de DNA en los estudios de DNA antiguo debe de ser tratado con
precaución. Así este criterio se basa en que debe de existir una relación
inversa en cuanto a la longitud del fragmento a amplificar y la intensidad de
la amplificación (Handt et al. 1994a). Deberíamos obtener mucha más
amplificación de fragmentos pequeños que de aquellos que superen las 500
bp. Así como deberíamos obtener DNA mitocondrial en aquellas muestras
en las que se ha obtenido DNA nuclear, por encontrarse el primero en un
número de copias mayor. Además las secuencias obtenidas deben de tener
un sentido filogenético y enmarcarse dentro de un contexto (Cooper and
Poinar 2000).
Este criterio es rebatido por ciertos autores, (Pusch and Bachmann
2004), que hacen hincapié en que la ausencia de grandes fragmentos
amplificados no sirve como método de autentificación de que la muestra no
esté contaminada. Sus estudios se basan en mezclas de DNA
contemporáneo (y por lo tanto de buena calidad) con extractos de DNA
antiguo. Se vio como en algunas ocasiones la extracción de aDNA era
capaz de inhibir la amplificación de DNA actual, o aumentar el número de
mutaciones en el DNA contemporáneo. Vieron además como el potencial
inhibitorio de los extractos de aDNA en la PCR es impredecible y puede no
tener que ver con la edad de la muestra. Es decir, el efecto inhibitorio debe
ser determinado experimentalmente para cada extracto. Demostraron que el
fallo en la amplificación de grandes fragmentos no indica necesariamente la
ausencia de DNA de alto peso molecular en la mezcla.
![Page 49: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/49.jpg)
Introducción
22
Criterio 4: Repetidas amplificaciones del mismo o de diferentes extractos.
Este criterio tiene dos propósitos, por un lado detectar
contaminaciones esporádicas que se puedan producir y por otro lado
detectar los cambios consistentes, debidos a lesiones en el DNA, en
aquellos estratos que presentan un número de copias muy bajo. Por lo que
se trata de llevar a cabo múltiples PCRs con diferentes primers y de
diferentes extracciones que deben producir resultados consistentes. El usar
fragmentos que se solapen también nos sirve para poder detectar posibles
numts cuando estamos analizando DNA mitocondrial.
Criterio 5: Clonación de los productos. La clonación consiste en introducir las cadenas de DNA producidas en
la PCR dentro de bacterias, de forma que cada bacteria recibe una única
copia del DNA amplificado. Cada una de estas bacterias se convierte en una
colonia que contiene millones de copias del DNA introducido. La clonación
nos permite descifrar si hay secuencias diferentes mezcladas en nuestro
producto de PCR (Figura 4).
Figura 4: Esquema del proceso de clonación. Esquema modificado de Noonan et al. (2006)
Al analizar por separado cada una de las moléculas podemos ver que
tipos de fenómenos se están produciendo, ya que los productos de nuestra
PCR son en el fondo un conjunto relativamente heterogéneo de secuencias
(Lalueza-Fox 2005). La clonación y la secuenciación de múltiples clones no
solo nos ayudará a ver las diferentes especies moleculares presentes en el
producto de amplificación, sino que también observar daños y fenómenos
PCR Extract
![Page 50: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/50.jpg)
Introducción
23
como el jumping PCR que nos indica el origen antiguo de las moléculas de
DNA ya que estas suelen estar degradadas y es más probable que se
produzcan saltos entre unas moléculas y otras durante la PCR (Handt et al.
1994a). Algo que en las secuencias directas sería imposible observar.
Criterio 6: Replicación independiente. El objetivo de este criterio es la obtención de resultados consistentes
por grupos independientes. Esto es de especial importancia cuando se
trabaja con muestras humanas, o cuando obtenemos resultados nuevos que
nunca antes se habían reportado.
Se trata de enviar un fragmento de la muestra, si puede ser desde la
misma institución de origen, a otro laboratorio con el que se esté
colaborando. De esta manera, si el DNA obtenido es realmente el DNA
endógeno, deberíamos obtener las mismas secuencias en ambos
laboratorios. Este riguroso procedimiento se lleva a cabo para evitar las
posibles contaminaciones intra-laboratorio, que suelen ser específicas de
cada laboratorio (Lalueza-Fox 2005). En los casos en los que la muestra sea
previamente contaminada, la replicación independiente no nos va a
solucionar nada, ya que saldrá en ambos sitios la misma secuencia.
Criterio 7: Preservación bioquímica. El objetivo que se persigue es el estudio de otras biomoléculas cuyo
estado de preservación se pueda relacionar con el del DNA. Técnicas como
el estudio del colágeno o la racemización de aminoácidos, nos pueden dar
una idea de cómo se encuentra el DNA de la muestra (Poinar and
Stankiewicz 1999).
La técnica más utilizada se basa en la observación del grado de
degradación de los aminoácidos después de la muerte del organismo como
un proceso parejo a la degradación del DNA, ya que está influido por los
mismos factores que afectan al DNA como son pH o temperatura. En el
organismo vivo, todas las proteínas se encuentran en forma de
L-Aminoácidos pero a medida que estas se van degradando las formas L
![Page 51: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/51.jpg)
Introducción
24
pasan a su isómero D, en un proceso denominado racemización. Cuando
las proteínas se hallan completamente degradadas, se llega a un equilibrio,
en el cual el 50% de los aminoácidos están en forma L y el 50% en forma D.
Se ha sugerido que, si únicamente un 10% (o menos) de las formas L han
pasado a D, es indicativo de que las proteínas se hallan relativamente bien
conservadas y esto puede extrapolarse al DNA. El análisis previo de las
formas L/D de algunos aminoácidos, como es el caso del ácido aspártico (es
el que registra una de las tasas de transformación más rápidas), en aquella
muestras de interés, nos dirá si tenemos alguna posibilidad de encontrar
material genético en buen estado (Lalueza-Fox 2005).
Criterio 8: Cuantificación. Consiste en conocer el número de moléculas de las que partimos en
una amplificación. Se pueden usar varios métodos pero los mejores y más
exactos son por PCR competitiva o por Real-Time PCR dándonos el número
de moléculas presentes en el extracto antes de comenzar la reacción de
amplificación. Cualquier otro método de cuantificación del DNA total no sería
de mucha utilidad en este tipo de trabajos, ya que la cantidad de DNA
procedente de bacterias y de hongos en estos extractos suele ser muy alta,
con lo que no nos daría una medida exacta del DNA endógeno (Handt et al.
1994a). Es muchísimo más útil utilizar primers específicos del organismos
que estamos estudiando.
Son muchos los autores que insisten en que si el número de
moléculas inicial que presenta una muestra es superior a mil, es improbable
que se produzcan errores al analizarlo. Pero si necesitamos realizar un
estudio en el cual el número de moléculas es muy bajo, será necesario llevar
a cabo varias amplificaciones independientes para poder verificar los datos
para evitar que estemos dando por verídicas moléculas que presentan
artefactos (Handt et al. 1996; Hofreiter et al. 2001a). Conocer el número de
moléculas del cual partimos es una herramienta muy útil para determinar el
rol de las moléculas contaminantes y los errores que se pueden producir en
la amplificación del DNA antiguo (Handt et al. 1996).
![Page 52: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/52.jpg)
Introducción
25
Criterio 9: Restos asociados Este criterio se basa en analizar paralelamente los restos que se
encuentran en un mismo yacimiento. Hay dos motivos para hacer esto, por
un lado porque en un mismo yacimiento se espera que los restos se
encuentren igual preservados y por otro lado porque si en un mismo
yacimiento se encuentran humanos y animales, el estudio de estos animales
con primers humanos nos puede indicar posibles contaminaciones a priori,
funcionando estos como buenos controles negativos (Cooper and Poinar
2000).
Aunque respecto a la primera premisa no siempre se cumple que los
restos de un mismo yacimiento se encuentren en el mismo estado de
preservación, ya que hay veces que dentro de una misma zona las
condiciones son diferentes, haciendo que unas muestras puedan presentar
una buena preservación mientras que otras no. En la literatura se citan
varios casos de este tipo siendo uno de ellos el caso de la cueva de Vindija
en Croacia; donde se encontraron varios restos de Neandertales (Serre et
al. 2004). Se analizaron varias muestras de un mismo nivel, viendo como
sólo una; Vindija 80 presentaba un nivel de preservación bioquímica muy
bueno, mientras que el resto de las muestras que se encontraron allí
variaban entre un nivel intermedio a un nivel muy bajo de preservación.
Llegando a la conclusión de que sería imposible obtener DNA de buena
calidad de esas muestras (Green et al. 2006), esto se le achacó a que
podían existir diferentes partes de la cueva que presentasen una mayor
cantidad de agua, o que los restos se encontrasen en una zona por donde
pasase el agua en algún momento haciendo así que la preservación del
DNA en esos huesos fuera mucho más difícil.
![Page 53: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/53.jpg)
Introducción
26
No todos los autores están de acuerdo de que con estas reglas podamos
autentificar los resultados de nuestras muestras. Ya que algunos exponen que
siguiendo las reglas de aDNA como son, clonación, amplificaciones
independientes de fragmentos pequeños y mediante overlapping, no siempre se
puede llegar a la secuencia correcta (Pusch and Bachmann 2004). Ya que han
visto como sustancias presentes en los extractos de DNA antiguo inducen a la
mutagénesis (como se explica en el capitulo I.4 acerca de daños post mortem en
el aDNA). Siendo la replicación independiente en otro laboratorio, otro criterio que
no se sirve en el caso de estos daños post mortem ya que algunas mutaciones
ocurren repetidamente en amplificaciones independientes. Sobre todo ciertas
posiciones particulares que tienen a mutar con facilidad, son las llamadas
Hotspots (ver capitulo I.3). Estos autores proponen que sería necesario identificar
las causas de las mutaciones observadas y desarrollar estándares para testar el
efecto mutagénico del aDNA como un criterio más de autenticidad.
Por lo tanto la adopción estricta de todos los criterios no sirve para
garantizar la autenticidad y puede dar apariencia de autenticidad a resultados
problemáticos (Gilbert et al. 2005a). Pero también está claro que gran cantidad de
estudios que no han seguido estos criterios o que sólo han seguido alguno de
ellos presentan unos resultados con una gran probabilidad de que sean ciertos.
Por lo que la existencia de unos criterios es necesaria, pero cada trabajo es
independiente y hay ciertos resultados que se autentifican solos y no se pueden
usar estos criterios como un impedimento sino como una ayuda para la
credibilidad.
![Page 54: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/54.jpg)
Introducción
27
I.3. DNA MITOCONDRIAL (mtDNA) Las mitocondrias son orgánulos citoplasmáticos de doble membrana,
responsables del metabolismo energético celular en las células eucarióticas,
generando ATP a través del proceso de fosforilación oxidativa (Figura 5). La
mitocondria presenta una doble membrana, la membrana externa separa la
mitocondria del citosol, mientras que la interna sufre invaginaciones formando las
crestas mitocondriales penetrando en la matriz mitocondrial. A diferencia de la
mayor parte de los orgánulos citoplasmáticos, las mitocondrias son lo bastante
grandes como para observarse bajo microscopía óptica (0.5µm – 10µm).
Figura 5: Esquema de una mitocondria (http://www.search.com/reference/Mitochondrion)
El origen de las mitocondrias, según la teoría endosimbiótica (Margulis et
al. 1990), se cree que está en una bacteria que hace unos 1,5 billones de años se
introdujo en una célula proto-eucariota en una relación de simbiosis. Esta bacteria
le confirió energía a la célula mientras que la célula le confirió un ambiente seguro
a la bacteria. En esta simbiosis la bacteria relegó parte de sus funciones a la
célula, haciendo que perdiera parte de su autonomía, de ahí que probablemente
perdiera parte de sus genes. El DNA mitocondrial (mtDNA) codifica una pequeña
fracción de las proteínas mitocondriales. Las proteínas restantes del mtDNA son
codificadas por el DNA nuclear (nDNA).
![Page 55: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/55.jpg)
Introducción
28
El número de mitocondrias varía dependiendo del tipo de célula; aquellas
que requieren mucha energía como son las nerviosas o musculares contienen
miles de mitocondrias mientras que otras células como es el caso de las
espermáticas pueden contener sólo unos pocos cientos (Jobling and Gill 2004).
En contraste con otros orgánulos celulares, la mitocondria presenta su
propio DNA, el cual codifica para algunas de sus propias biomoléculas. Este DNA
se encuentra localizado en la matriz mitocondrial y en cada mitocondria se
encuentran normalmente varias copias de este ácido nucleico (Taanman 1999).
I.3.1. Características del mtDNA
El DNA mitocondrial presenta las siguientes características (Lareu and
Salas 1999):
El mtDNA humano es una molécula de DNA circular, cerrada y de doble
cadena. Presenta una longitud de 16.569 bp y fue secuenciado en su
totalidad por primera vez en 1981 por (Anderson et al. 1981) y fue luego
revisada por (Andrews et al. 1999) modificando 18 nucleótidos. A la
secuencia se le denomina Cambridge Reference Sequence (CRS) y es
actualmente usada como referencia.
La distribución de las bases difiere en las dos cadenas del mtDNA. Una de
las cadenas de la molécula es rica en purinas y es conocida como la cadena
pesada o H (Heavy). La cadena complementaria es rica en pirimidinas y es
conocida como la cadena ligera o L (Light).
El mtDNA representa menos del 1% del DNA celular total, sin embargo
presenta un gran número de copias. Se estima que las células de mamíferos
contienen varios miles de copias (200 – 1700) de mtDNA dependiendo del
tipo de tejido.
![Page 56: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/56.jpg)
Introducción
29
El mtDNA presenta herencia materna y en consecuencia:
• No presenta recombinación.
• Tiene naturaleza haploide. Todas las copias de mtDNA de un individuo
son iguales excepto cuando existe heteroplasmia (ver apartado I.3.4).
• Todos los individuos de un mismo linaje materno exhiben la misma
secuencia de mtDNA (exceptuando casos excepcionales en donde
exista segregación de heteroplasmias en algún individuo del linaje o
evidentemente mutaciones puntuales a nivel germinal).
Durante la formación del zigoto, la célula espermática contribuye con su
genoma nuclear pero no con su mtDNA. Las mitocondrias del esperma son
selectivamente destruidas por el oocito; se ha demostrado que el mtDNA
paterno es destruido por un proceso de ubiquitinización (Pakendorf and
Stoneking 2005). Por lo tanto parece que el mtDNA se hereda por vía
exclusivamente materna.
Aunque en el año 1999 se empezó a poner en duda la herencia sólo
materna y por lo tanto la existencia de recombinación (Awadalla et al.
1999). En el trabajo presentado por Erika Hagelberg (Hagelberg et al.
1999) muestra la existencia de recombinación aunque cuando se
reanalizaron las muestras se demostró que se trataba de un error de
alineamiento y se tuvieron que retractar. Algunos de los casos reportados
como posibles recombinaciones se cree que pueden ser debidos a
interpretaciones erróneas de los electroferogramas (Bandelt et al. 2005),
como por ejemplo las guaninas unidas a adeninas en posición 3’, que son
interpretadas erróneamente con ciertos kits de secuenciación (cosa que se
soluciona al secuenciar la cadena complementaria), o el caso de los tractos
homopoliméricos tanto en HVRI como HVRII. Otros casos se trata de claras
contaminaciones o de mezclas de muestras.
Sin embargo sí que se ha reportado un caso de recombinación en el cual
hubo segregación mitocondrial paterna asociado a una miopatía
mitocondrial (consistente en una delección de 2 pares de bases en el gen
mitocondrial ND2) (Schwartz and Vissing 2002). En este caso el mtDNA de
la sangre era materno mientras que el del músculo era casi en su totalidad
paterno. Por lo que se llega a la conclusión de que la segregación paterna
![Page 57: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/57.jpg)
Introducción
30
es posible y por lo tanto también la recombinación en el DNA mitocondrial.
Pero se trata de un caso aislado, que no pudo repetirse en otro laboratorio
y que además no se encuentra asociado a ninguna otra miopatía (Bandelt
et al. 2005). Al tratarse de un fenómeno bastante raro, la recombinación no
cobra mucha importancia al no haber diferentes moléculas de DNA para
que la molécula resultante de la recombinación puedan diferir de la original
(Pakendorf and Stoneking 2005).
Para que esto pueda ser probado es necesario que se sigan una
serie de pruebas de autentificación como en el caso de los estudios de
aDNA (Bandelt et al. 2005).
Tasa de mutación elevada: La tasa de evolución del DNA mitocondrial es en
promedio de 5 a 10 veces superior al DNA nuclear (Brown et al. 1979). La
región codificante evoluciona 2 – 4% por millón de años mientras que la no-
codificante muestra una tasa de evolución del 8,4% por millón de años. De
esta manera, desde un punto de vista antropológico, el análisis de ambas
regiones nos proporciona información en diferentes escalas temporales.
Pero dentro de la misma región control la tasa de mutación es heterogénea,
existen ciertos puntos calientes = “hotspots” que tienen una tasa de
mutación mucho más elevada que el resto de las posiciones (Pakendorf and
Stoneking 2005). Estas mismas posiciones aparecen también como puntos
que tienden al daño en DNA antiguo. Tema tratado más adelante así como
en los resultados y en la conclusión. Existen varios motivos que explican
esta tasa de mutación tan elevada, (Lareu and Salas 1999):
a) El núcleo celular está poco oxigenado, al encontrarse el metabolismo
del oxigeno relegado a un compartimiento específico como es la
mitocondria. Este debe de ser la principal razón de la evolución para
separar el núcleo en las células eucariotas. Existe un alto número de
radicales libres en la zona de ubicación del mtDNA (membrana interna)
con efecto mutagénico. En la mitocondria se consume más del 90% del
oxígeno celular en el catabolismo oxidativo por lo que existe un continuo
flujo de radicales libres en la matriz mitocondrial.
Por lo tanto, el DNA de la mitocondria debe ser el único que es sensible
al daño oxidativo. Los radicales oxígeno deben de ser los responsables
![Page 58: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/58.jpg)
Introducción
31
de la alta tasa de mutación, rápida evolución y de la decadencia con los
años de este orgánulo, así como contribuir a varias enfermedades
degenerativas hereditarias humanas maternas (Lindahl 1993a).
b) El mtDNA no presenta proteínas de protección como las histonas, por lo
que está poco protegido y los radicales de oxígeno influyen
directamente.
c) La mitocondria tiene un sistema de reparación del DNA menos eficiente
que el del núcleo por lo tanto los errores que se produzcan en la
replicación son menos propensos a repararse que aquellos cambios que
se producen en el núcleo (Brown et al. 1979).
d) Las mutaciones surgen mayoritariamente durante la replicación: el
mtDNA tiene muchas más rondas de replicación que el DNA
cromosómico debido a grandes cuellos de botella durante la oogénesis
(Pakendorf and Stoneking 2005).
I.3.2. Contenido del mtDNA
En el genoma mitocondrial existen dos regiones principales (Pakendorf and
Stoneking 2005):
a) Una gran región codificante (90%). Contiene 37 genes: 28 codificados
por la cadena pesada (H) y nueve por la ligera (L). De entre los 37 genes,
13 codifican para polipéptidos involucrados en la cadena de la fosforilación
oxidativa. El resto de los genes codifica para 22 tipos de moléculas de
tRNA y dos de rRNA (12S y 16S), los cuales forman parte de la maquinaria
de síntesis proteica de la mitocondria (Figura 6). Estos genes no se
encuentran interrumpidos por intrones y no existen secuencias intergénicas
o están limitadas a unas pocas bases. Comparando esta secuencia con las
proteínas mitocondriales se vio que presentaba su propio código genético,
el cuál se separa un poco del nuclear (Taanman 1999).
Entre esos 37 genes se encuentra el Citocromo b localizado entre las
posiciones 14747 y 15882 (Figura 6). Se han llevado a cabo una gran
![Page 59: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/59.jpg)
Introducción
32
cantidad de estudios del citocromo b en DNA antiguo (Higuchi et al. 1984;
Noro et al. 1998; Lalueza-Fox et al. 2000; Willerslev et al. 2003; Burger et
al. 2004). Se trata de una proteína que está envuelta en la oxidación
celular, fotosíntesis y otros procesos bioquímicos donde las reacciones
redox son necesarias. Esta región es particularmente interesante en los
estudios de DNA antiguo debido a que las diferentes especies muestran
considerables polimorfismos a lo largo de sus 1000 pares de bases.
Haciendo que sea una región idónea para diferenciar entre especies.
b) Una región pequeña de aproximadamente 1,2 kb conocida como región control (Figura 6). Contiene las secuencias control de la transcripción y el
origen de replicación de la cadena pesada del mtDNA (Meyer et al. 1999)
(ver Figura 7). También contiene lugares de unión de factores de
transcripción y secuencias conservadas relacionadas con el inicio de la
replicación de la cadena H y secuencias asociadas a la finalización del
bucle de desplazamiento o D-Loop (pequeña estructura de triple cadena
(Taanman 1999)). Esta región es muy polimórfica y contiene dos regiones
hipervariables bien caracterizadas, definidas por Vigilant et al. (1989) y
conocidas como la región hipervariable I (HVRI), que incluye las posiciones
de la 16024 a la 16569 y la región hipervariable II (HVRII) que va desde la
posición 1 a la 579.
Dentro de HVRI se encuentran dos posibles sitios de unión a proteínas que
son Mt5 (16194 – 16208) y Mt3 (16499 – 16506); estas posiciones serán
comentadas más adelante (Taanman 1999).
![Page 60: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/60.jpg)
Introducción
33
Figura 6: Representación esquemática del genoma mitocondrial humano. Adaptada de MITOMAP (http://www.mitomap.org).
Esta región no codificante es en lo que se basa la identificación forense
mediante mtDNA. De la misma manera, dada su alta variabilidad, es de gran
utilidad en el estudio antropológico de la evolución humana ya que las diferencias
interpoblacionales a nivel mitocondrial son un reflejo molecular de
acontecimientos históricos que se han venido sucediendo durante los últimos
milenios.
![Page 61: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/61.jpg)
Introducción
34
Hay ciertas secuencias dentro del DNA nuclear que provienen de
inserciones del mitocondrial, estas son conocidas como NUMTS (NUclear
MiTochondrial Sequences) las cuales al tener la tasa de evolución del DNA
nuclear (mucho menor que el del mtDNA) pueden ser usadas como “fósiles
moleculares”. Al analizar el genoma humano se encontró que el número de estas
secuencias se encontraba entre 250 y 600 de diferentes longitudes (Pakendorf
and Stoneking 2005). El problema que presentan estas secuencias es que son de
difícil detección y pueden ser confundidas como auténticas secuencias de
mtDNA, llevando a conclusiones erróneas. En el caso del DNA antiguo su
dificultad no reside en la amplificación preferente de secuencias nucleares
endógenas, puesto que, debido a la escasez y fragmentación del DNA antiguo, el
DNA molde de partida es mayoritariamente de origen mitocondrial. Sin embargo
las secuencias numtDNA exógenas (de los investigadores, arqueólogos, del
ambiente...) pueden convertirse en fuente de contaminación adicional de origen
moderno. El problema aquí reside en la dificultad de identificar la fuente de
origen.
Debido a su función como fósiles moleculares han sido usados para
localizar más exactamente cuando se originaron los humanos modernos
(Mishmar et al. 2004).
I.3.3. Polimorfismos del mtDNA
Los polimorfismos que caracterizan al DNA mitocondrial son:
a) Polimorfismos de secuencia:
Las transiciones son el tipo predominante de sustitución ocurriendo mucho
más frecuentemente que las transversiones. El número de transiciones
pirimidínicas en la cadena L es mucho mayor que el de transiciones
purínicas (Meyer et al. 1999). La mayoría de la variación en la secuencia
se encuentra dentro de la denominada región control, y dentro de la misma
hay posiciones que tienden a variar más que otras, son las que se conocen
como “Hotspots”.
![Page 62: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/62.jpg)
Introducción
35
b) Polimorfismos de longitud:
En el mtDNA existen tractos homopoliméricos donde es habitual encontrar
inserciones o deleciones de una o más bases nucleotídicas. Desde el
punto de vista formal, estos polimorfismos se engloban dentro del grupo de
los polimorfismos de longitud, sin embargo nada tienen que ver, desde el
punto de vista biológico, con los polimorfismos de longitud que caracterizan
a los micro y minisatélites. Estos tractos están localizados en las
posiciones 16184 – 16193 interrumpido por una T en la posición 16189 de
la región hipervariable I (HVRI) y 303 – 315 interrumpido por una T en la
posición 309 de la región hipervariable II (HVRII) (Lareu and Salas 1999).
Con una frecuencia bastante elevada, coexisten moléculas con un número
diferente de inserciones dentro de una misma mitocondria o en
mitocondrias distintas de la misma célula. Este estado se conoce con el
nombre de heteroplasmía de longitud.
Un marcador importante que consiste en una delección, respecto de la
secuencia de referencia, de 9 pares de bases (CCCCCTCTA) se encuentra
situado en la región no codificante entre el gen de la segunda subunidad de la
citocromo oxidasa y el RNA de transferencia de la lisina (Wrischnik et al. 1987).
Esta deleción de 9 bp se ha venido utilizando como un marcador específico de
poblaciones asiáticas, postulándose que tuvo un origen asiático único, y en
consecuencia, se ha utilizado como marcador para la reconstrucción de los
procesos asociados a la colonización de América (Torroni et al. 1992; Lalueza-
Fox 1996) y de las islas del Pacífico.
En el mtDNA tan solo se ha descrito un microsatélite corto en la posición
514 de la región D-Loop del genoma mitocondrial. Se trata de un microsatélite
dinucleotídico (AC)n con un bajo grado de heterocigosidad, lo que limita mucho
su utilidad.
![Page 63: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/63.jpg)
Introducción
36
I.3.4. Heteroplasmias en el mtDNA
El concepto de heteroplasmia hace referencia a la presencia de tipos
diferentes de DNA mitocondrial en la misma mitocondria, célula o individuo. En
contraposición, se denomina homoplasmia a la presencia de un único tipo de
mtDNA. Por lo tanto la heteroplasmia se define como el estado en el que un
individuo presenta más de un genotipo de mtDNA (Lareu and Salas 1999).
El estado heteroplástico de un individuo puede ser debido a la transmisión de la
madre a través de la línea germinal o bien por una mutación somática ocurrida
dentro del individuo.
En un principio se pensó que la heteroplasmia era un fenómeno poco
frecuente, pero trabajos posteriores demostraron que en las células somáticas la
heteroplasmia era más frecuente de lo que previamente se creía. Se estima que
cerca del 14% de la población presenta un segundo tipo de mtDNA en una
frecuencia de al menos el 1% (Tully and Levin 2000) y de hecho es bastante
probable que presentemos más de un tipo entre los trillones y trillones de mtDNA
que existen en nuestro organismo (Pakendorf and Stoneking 2005).
De este modo, cuando una mutación surge en una de las moléculas de
mtDNA dentro de la mitocondria, esto crea una mezcla intracelular de moléculas
mutantes y normales. Cuando una célula heteroplásmica se divide, la herencia
mitocondrial en las células hijas es una cuestión de azar. Como resultado de ello,
después de varios ciclos de división celular, la proporción del mtDNA mutante y
normal en una célula puede derivar hacia el mutante puro o hacia el normal puro
(homoplasmia) en un proceso conocido como segregación replicativa.
![Page 64: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/64.jpg)
Introducción
37
I.3.5. Transcripción del mtDNA
Existen dos sitios principales de iniciación de la transcripción situados en el
D-loop (ITH1 e ITL) situados a 150bp el uno del otro (Figura 7).
La transcripción de la cadena H comienza en la posición nucleotídica 561 (ITH1),
localizada dentro de su promotor (HSP) e inmediatamente adyacente al gen
tRNAPhe; mientras que la transcripción de la cadena L comienza en la posición
nucleotídica 407 (ITL) localizada dentro del promotor de la misma (LSP). Al lado
de estas posiciones se encuentran los elementos potenciadores (Enhancers)
requeridos para una óptima transcripción (Taanman 1999).
Figura 7: Representación esquemática de la iniciación de la replicación y la transcripción del DNA mitocondrial humanos. Los sitios de iniciación de la transcripción y la dirección de la síntesis se indican con flechas, mientras que las líneas de puntos representan el RNA sintetizado. En la región D-loop (secuencia de 1118bp comprendida entre los nucleótidos 577 y 16028) se encuentran los principales sitios de iniciación de la transcripción; ITH1 rodeado por el promotor de la cadena H (HSP), que dirige la transcripción de la cadena H. ITL rodeado por el promotor de la cadena L (LSP), que dirige la transcripción de la cadena L. ITH2 corresponde al punto secundario de iniciación de la transcripción de la cadena H, localizado en el gen tRNAPhe. CSB I, II y III corresponden a 3 bloques muy conservados asociados al inicio de la replicación de la cadena H. OH corresponde al inicio de replicación de la cadena H mientras que TAS (termination-associated sequence) corresponde al punto de terminación de la síntesis de la cadena H. Imagen tomada de Taanman (1999).
A pesar de la proximidad de los promotores HSP y LSP, los estudios de
transcripción in vitro demuestran que estos elementos son funcionalmente
independientes.
Para la cadena H, existe un segundo punto de iniciación de la transcripción,
localizado en la posición nucleotídica 638 (ITH2) en el gen tRNAPhe,
inmediatamente adyacente al gen 12S rRNA. Pero este sitio se usa con menos
frecuencia para la transcripción. Normalmente la transcripción comienza en el ITH1
(Taanman 1999).
![Page 65: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/65.jpg)
Introducción
38
I.3.6. Replicación del mtDNA
Es importante conocer como tiene lugar la replicación del DNA
mitocondrial, ya que esto luego va a influir o se cree que influye en la tasa de
daños post mortem (Gilbert et al. 2003b).
Estudios basados fundamentalmente en microscopía electrónica y
centrifugación de cultivos celulares analizando las moléculas de mtDNA indican
que el DNA mitocondrial humano contiene dos orígenes de replicación separados
físicamente para cada una de las cadenas (OH y OL). La iniciación de cada
cadena ocurre en un único sitio diferente muy alejado el uno del otro que hacen
por lo tanto que el proceso de elongación sea unidireccional y asimétrico (Tapper
and Clayton 1981). La síntesis de DNA se inicia en OH que está localizado
downstream de LSP en la región D-Loop del genoma y se procesa alrededor de la
cadena L desplazando a la otra cadena H (Taanman 1999). La replicación de la
cadena H continúa unidireccionalmente hasta alcanzar OL, después de haber
atravesado 2/3 del genoma; momento en el cual comienza la síntesis de la
cadena L (Figura 8). Esta se sintetiza en la otra dirección y va desplazando a la
cadena H (Wallace et al. 1995).
Por lo tanto D-Loop es una región de triple cadena generada por la síntesis
de una pequeña pieza de cadena H de DNA, la 7sDNA que se extiende desde el
origen de replicación OH (posición 110) hasta el codón de parada en la posición
16106 (Doda et al. 1981; Meyer et al. 1999).
Figura 8: A la izquierda puede verse los dos orígenes de replicación en cada una de las cadenas OL y OH. Imagen modificada de Tapper and Clayton (1981). A la derecha se ve cómo tiene lugar la replicación del DNA mitocondrial.
![Page 66: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/66.jpg)
Introducción
39
La replicación del mtDNA parece estar íntimamente relacionada con la
transcripción mitocondrial, ya que parece que un pequeño transcrito mitocondrial
originado en ITL (Figura 7) es el que sirve de primer para la iniciación de la
replicación de la cadena H (Taanman 1999). De hecho no está claro cuál es el
mecanismo que decide entre la elongación del transcrito o la síntesis de la
cadena H.
En lo que respecta a la iniciación de la síntesis de la cadena L, el origen se
encuentra localizado en una region no-codificante de unos 30 nucleótidos y se
encuentra flanqueado por 5 genes de tRNA (Figura 6). OL sólo se activa cuando la
cadena H parental es desplazada por la cadena H que se está sintetizando.
Estudios in vitro sugieren que esta configuración sirve de estructura de
reconocimiento a la primasa mitocondrial, la cual proporciona un primer
(fragmento de RNA corto) para la síntesis de la cadena L. Aunque no se
descartan que estructuras secundarias adicionales puedan contribuir al
reconocimiento de la primasa in vivo.
I.3.7. Los haplogrupos mitocondriales
El concepto de haplogrupo fue introducido por vez primera por Torroni a
inicios de los años 90 (Torroni et al. 1992). Podríamos definir un haplogrupo o
cluster mitocondrial como una agrupación de haplotipos que comparten ciertas
sustituciones diagnósticas (definidas por enzimas de restricción o por
secuenciación directa) y que presentan un origen común. Esto implica que los
polimorfismos que definen cada haplogrupo se produjeron exclusivamente en las
líneas antecesoras de todos los haplotipos que lo integran. Torroni et al. (1992)
analizaron la variabilidad del mtDNA en diferentes grupos raciales amplificando
todo el genoma mitocondrial en 9 fragmentos solapantes de 1.500 a 3.000 bp de
longitud y digiriéndolos independientemente con 14 enzimas de restricción. Los
haplotipos obtenidos pueden ser clasificados en diferentes agrupamientos que
comparten las mismas mutaciones puntuales; mutaciones estables y antiguas que
forman parte de regiones codificantes. Estos agrupamientos denominados
haplogrupos resultan específicos de determinadas regiones geográficas
facilitando de este modo una gran información acerca de las relaciones
![Page 67: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/67.jpg)
Introducción
40
interpoblacionales. De manera que pueden distinguirse clusters exclusivamente
africanos, europeos y asiáticos respectivamente, ver Figura 9.
En la región control existen también determinadas mutaciones que son
informativas en cuanto al establecimiento de los haplogrupos. Por el contrario, al
ser una región tan hipervariable también existen posiciones que introducen
mucho ruido de fondo en las filogenias apareciendo indistintamente en distintos
haplogrupos. Esta característica ha resultado ser de extrema utilidad para la
inferencia de patrones migratorios dentro y fuera de cada continente.
La combinación de los datos de secuencia y de enzimas de restricción de
regiones codificantes y no codificantes disponibles, así como el análisis de
nuevos marcadores ha llevado a una disección cada vez más compleja de los
diferentes haplogrupos mundiales, que queda reflejada en su compleja
nomenclatura.
Figura 9: Migraciones del DNA mitocondrial. Imagen tomada de MITOMAP (http://www.mitomap.org)
![Page 68: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/68.jpg)
Introducción
41
Tres de los haplogrupos principales (L1, L2, y L3) agrupan a todos los
linajes del África Subsahariana (Richards et al. 2000), nueve (H, I, J, K, T, U, V, W
y X) abarcan casi todo el ADN mitocondrial de los caucasoides de Europa, África
del Norte y Asia occidental. Finalmente, los haplogrupos A, B, C, D, E, F, G y M
abrazan la mayoría de los linajes descritos para Asia, Oceanía y los nativos
americanos.
I.3.8. Estudios antropológicos basados en el mtDNA
Los estudios del mtDNA en genética de poblaciones se han venido
utilizando para tratar temas de carácter general, como por ejemplo el origen del
hombre anatómicamente moderno, los nativos americanos, etc. La interpretación
de todos los resultados del análisis de la molécula de mtDNA ha tenido una
consecuencia de gran impacto en el mundo de las ciencias: el origen africano de
la molécula de mtDNA y, por extensión, de las poblaciones humanas.
Rebecca Can (Cann 1987), en base a los resultados obtenidos en el
estudio de individuos de poblaciones de Asia, Australia, Nueva Guinea, Europa y
África, formula la hipótesis conocida como la “Eva mitocondrial”. En este trabajo
observó tres cosas:
o Una gran uniformidad genética en todos los organismos estudiados,
demostrando que las clasificaciones raciales no tenían ningún soporte
genético.
o Las variaciones genéticas más importantes se encontraban en
individuos africanos.
o Con estos resultados se podían confeccionar un árbol filogenético
donde las ramas más antiguas se correspondían siempre con individuos
africanos.
Por lo que todos los genomas mitocondriales actuales derivan de uno sólo
que tiene su origen en África. La mujer que portaba esta mitocondria es la “Eva
Africana”.
![Page 69: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/69.jpg)
Introducción
42
De esta hipótesis se deduce que la especie Homo sapiens surgió en África
hace poco más de 200.000 años, a partir de un grupo relativamente pequeño de
individuos que posteriormente ha ido aumentando hasta alcanzar los 6.000
millones de humanos actuales. El hecho de que la variación pueda retrotraerse a
hace solo unos miles de años, significa que estas poblaciones modernas fueron
substituyendo a las poblaciones arcaicas locales de Eurasia, que eran mucho
más antiguas. Si en vez de reemplazarlas se hubieran mezclado con ellas como
propone la hipótesis multirregionalista, la variación genética que encontraríamos
en la humanidad actual en diferentes continentes debería llevarnos hasta hace un
millón de años o más (Lalueza-Fox 2005).
Esta interpretación ha sido enormemente controvertida debido
fundamentalmente a la utilización de determinados métodos de reconstrucción
filogenético. No obstante hoy en día, la hipótesis africana del origen del hombre
moderno ha servido de apoyo a un gran número de estudios. Esta hipótesis está
avalada por el hecho de que las poblaciones africanas actuales conservan más
diversidad genética que las poblaciones de otros continentes, de hecho Europa
es el continente genéticamente más uniforme; esto no significa que los africanos
sean más antiguos o menos evolucionados que el resto sino que el tiempo
transcurrido desde la salida de africana ha permitido que surgieran diversos
linajes que se hallan localizados en áreas geográficas concretas. La hipótesis
formulada por Cann (Cann 1987) está basada en el principio de coalescencia
según el cual, asumiendo que hubo un origen único para todos los organismos
vivos, se deduce que toda la variación en cualquier segmento del DNA (ya sea
mitocondrial o nuclear) en las generaciones presentes debe en última instancia
proceder de un único ancestro que existió en generaciones previas. En el caso
del mtDNA, al ser de herencia unilineal (materna), esta reconstrucción de los
linajes “hacia atrás” es evidentemente mucho más sencilla (Figura 10).
De este planteamiento se deduce que este ancestro era femenino (Eva) ya
que este genoma se hereda de forma matrilineal, que este ancestro mitocondrial
no era el único individuo vivo, sino un miembro de la población para la que el
resto de los linajes mitocondriales se fueron perdiendo con el paso de las
generaciones, y que este ancestro no fue la primera mujer que apareció en el
![Page 70: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/70.jpg)
Introducción
43
planeta, sino que solamente representa el punto de origen de todos los linajes
mitocondriales. Más aún, el análisis directo del mtDNA a través de fósiles de
Neandertales y de sus contemporáneos (primeros humanos modernos europeos),
indican que no ha existido contribución del DNA mitocondrial de Neandertales en
el pool génico de humanos modernos (Krings et al. 1997; Krings et al. 1999;
Krings et al. 2000; Ovchinnikov et al. 2000; Schmitz et al. 2002; Caramelli et al.
2003).
Figura 10: Esquema de la hipótesis de Eva Africana. En la figura puede verse como todas las mitocondrias actuales provienen de una única mitocondria. Imagen tomada de http://cosmicvariance.com/2006/01/30/mitochondrial-eve-and-you/
Otro tema que el mtDNA ha ayudado a entender mejor han sido las
migraciones de las poblaciones humanas, como son el poblamiento del Nuevo
Mundo, la colonización del Pacífico, la migración hacia Nueva Guinea y Australia
y el asentamiento en Europa (ver las referencias citadas en Pakendorf and
Stoneking (2005). Sin embargo el mtDNA es un solo locus, y solo refleja la
historia materna de la población, no siendo muy preciso ya que este locus puede
estar sometido a efectos de deriva o de selección. Por lo tanto estos estudios
necesitan ser complementados con datos obtenidos del cromosoma Y e
idealmente con datos de autosómicos.
![Page 71: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/71.jpg)
Introducción
44
En los últimos años, con el desarrollo de la tecnología de tipado masivo se
está convirtiendo en muy común secuenciar el genoma mitocondrial completo.
Árboles filogenéticos basados en secuencias del genoma completo proveen
mayor resolución que los árboles basados sólo en la secuenciación de la región
control. Pudiendo revelar sucesos en la historia de las poblaciones que no se
pueden ver mediante sólo RFLPs y/o la región control; aunque estos estudios son
muy caros y tediosos, con lo que hay que ver si verdaderamente es necesario
llevarlos a cabo o poner en práctica una alternativa más razonable que combina
la secuenciación de la región control con la secuenciación de determinadas
partes de la región codificante (Pakendorf and Stoneking 2005).
Aunque el mtDNA cada vez se usará menos como marcador único para
resolver problemas de evolución o la historia de las poblaciones, aún hay ciertas
cuestiones para las cuales el mtDNA es importante. Debido a la gran cantidad de
copias que presenta lo hace ideal para estudios de DNA antiguo o para
aplicaciones en forense.
I.3.9. Uso del mtDNA en restos antiguos
El DNA mitocondrial se encuentra en muestras arqueológicas en
muchísima mayor cantidad que el DNA nuclear (Greenwood et al. 1999)
presentando unas características que hace que sea una molécula muy apropiada
para estudios de restos antiguos (Greenwood and Pääbo 1999). En consecuencia
una gran cantidad de análisis genéticos antiguos han usado y usan la bien
caracterizada región control hipervariable del mtDNA.
Dependiendo de la edad de la muestra, muchas veces sólo el mtDNA esta
presente y por lo tanto es el único material de estudio para ver las afinidades
genéticas de las poblaciones antiguas. Sin embargo uno de los mayores
problemas en aDNA, y que no suele ser admitido, es la contaminación (Pakendorf
and Stoneking 2005). Ya que el mtDNA de las muestras antiguas no difiere
mucho del de los humanos modernos, por lo que es difícil saber si se trata del
auténtico DNA o de una contaminación.
![Page 72: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/72.jpg)
Introducción
45
Como ya se ha dicho anteriormente el estudio del DNA mitocondrial
permite realizar estudios sobre los distintos haplogrupos existentes. Así
basándonos en los resultados obtenidos en HVR podemos comparar nuestras
poblaciones antiguas con las poblaciones modernas e incluirlas dentro del árbol
filogenético humano basado en la Secuencia de Referencia de Cambridge (CRS)
(Anderson et al. 1981). El problema radica en que cuando las moléculas están
dañadas y/o contaminadas (ver capítulo 4) nos lleva a la interpretación errónea de
los haplogrupos. Esto ocurre, sobre todo, en aquellos haplogrupos como los que
son de origen Euroasiático que se diferencian entre ellos usando menos de cinco
posiciones diferentes, a veces incluso sólo es una la diferencia; si justo esas
bases resultan dañadas entonces la designación del haplogrupo será incorrecta
(Gilbert et al. 2003b).
Dentro de las poblaciones humanas modernas ciertas posiciones
nucleotídicas tienden a mutar a unas tasas mucho mayores que otras dentro de
HVR; estas son las posiciones mencionadas anteriormente, que reciben el
nombre de Hotspots (Excoffier and Yang 1999; Meyer et al. 1999; Bandelt et al.
2002; Vega et al. 2003). Esta variación en la tasa de daño se ha sugerido que
está en relación con la estructura secundaria y terciaria del DNA (Heyer et al.
2001) y es posible que los mismos sitios puedan ser susceptibles a los daños post
mortem. Por ejemplo, si la conformación que adopta la estructura secundaria
predispone a algunos sitios a un ataque hidrolítico, entonces eso puede ser una
posición hipermutable in vivo y una posición que tiende al daño post mortem. Si
los hotspots coinciden con posiciones que determinan un haplogrupo entonces la
probabilidad de equivocarnos al asignarlo a un haplogrupo o a otro se multiplican.
Por lo tanto ciertos trabajos que han dado resultados muy dudosos como es el
caso de las secuencias de “Lake Mungo 3” (Adcock et al. 2001) apoyando la
hipótesis multirregionalista; se pueden explicar como daños post mortem que no
han sido identificados como tales, llevando a una interpretación errónea de los
resultados (Gilbert et al. 2003b).
![Page 73: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/73.jpg)
Introducción
46
Gilbert et al. (2003b) llevo a cabo un estudio con muestras humanas y con
datos publicados de animales. Este se basó en dos fragmentos del DNA
mitocondrial; el gen citocromo oxidasa subunidad III (COIII) y HVR1, para ver si
este patrón era el mismo que lo que se observaba in vivo. Encontrando que el
daño post mortem no se distribuye al azar en estas regiones, sino que la tasa de
mutación era mucho más alta en HVR1 que en las regiones codificantes.
Las secuencias antiguas pueden reflejar las auténticas tasas de mutación
en las regiones codificantes, como es el caso de COIII (Citocromo Oxidasa
subunidad III), las cuales in vivo son normalmente enmascaradas por la selección.
Así, por lo tanto, al analizar las secuencias post mortem también se observan
hotspots en esas secuencias como aparecen en HVR. Aunque HVR no contiene
genes funcionales, estudios en poblaciones modernas muestran que los daños no
se producen de una manera aleatoria sino que la variación de la secuencia se
concentra en unos pocos sitios. De forma que aunque no todas las posiciones
dañadas mostradas en el trabajo se observan como hotspots en trabajos
actuales, sí una gran mayoría. Las posiciones que no aparecen in vivo pueden
interpretarse como un fenómeno estocástico y por lo tanto no tendría ninguna
importancia o bien porque in vivo exista algún tipo de protección en esas
posiciones que puede ser degradada o que desaparece después de la muerte.
Si partimos de la Teoría neutralista que postuló Kimura en 1983,
destacamos que la mayoría de los sitios invariables están sujetos a
características funcionales. Aunque la región control es no codificante, se sabe
que tiene los principales elementos reguladores para la transcripción y la
replicación. Es el sitio de unión de numerosas moléculas como son DNA y RNA
polimerasas y otros factores de transcripción y reguladores por lo que podrían
estar sujetos a una presión evolutiva. HVR2 sería más importante funcionalmente
ya que contiene el origen de replicación de la cadena H (Meyer et al. 1999). Esta
sería una buena explicación para entender que la tasa de substitución de HVR1
sea aproximadamente dos veces mayor que la de HVR2 (Meyer et al. 1999). Así
por ejemplo Gilbert et al. (2003b) encuentran en HVR1, Mt 5 que se cree que es
el sitio de unión de una proteína. Meyer et al. (1999) plantea que ciertas proteínas
viven más que el DNA, por lo que es posible que la baja tasa de mutación post
![Page 74: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/74.jpg)
Introducción
47
mortem esté relacionada con que la proteína sigue unida al DNA ofreciéndole
protección. Asi mismo Gilbert también localizó una región llamada LDR1 (Low
Diversity Region) que comprende desde 16365 a 16395; ausente de daño post
mortem algo que es inusual y sugiere que se encuentra protegida de alguna
manera del daño hidrolítico, una posibilidad que apunta Gilbert es una asociación
con una proteína similar a la que postula Meyer et al. (1999) para Mt 5. Si esto se
confirma sería la primera característica estructural identificada por el DNA
antiguo.
Existe una gran polémica acerca de si estos hotspots in vivo coinciden con
los sitios de daño post mortem. Esto es debido a la alta probabilidad de
contaminación de los restos antiguos, ya que el DNA contaminante puede imitar a
daños en la secuencia y también puede permitir fenómenos de Jumping PCR
entre el DNA endógeno y el contaminante (ver capítulo 4). Aumentando así el
número de sitios dañados por la introducción de posiciones que difieren entre el
contaminante y el auténtico DNA. Por lo que Gilbert (Gilbert et al. 2005c) llevó a
cabo un estudio de daños post mortem en “no humanos” donde la contaminación
es mucho menos probable. Se basó en el estudio de Shapiro et al. (2004) en
bisontes antiguos y los comparó con los datos de especimenes actuales.
Confirmando que el daño post mortem se correlaciona con los sitios
hipermutables in vivo. Sugiriendo que los hotspots mutacionales existen tanto en
secuencias humanas como en no humanas y que estas no son artefactos debido
a contaminación o recombinación.
Stoneking (2000) propone una forma de testar si los hotspots son debidos
a posiciones hipervariables o si por el contrario, es la recombinación la que
provoca que hayan aparecido esas mutaciones a lo largo de los linajes
(Hagelberg et al. 1999). Si los sitios hipervariables son de hecho hotspots
mutacionales, las nuevas mutaciones que se produzcan deberían de ocurrir
preferentemente en estas posiciones; sin embargo si los sitios hipervariables no
son hotspots mutacionales sino que ocurren por recombinación o por otro
proceso, entonces una nueva mutación se esperaría que se produjera en
cualquier posición y no preferentemente en los sitios hipervariables.
![Page 75: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/75.jpg)
Introducción
48
Existen posiciones que evolucionan mucho más rápido que todo el
conjunto de HV1 y HV2 ocurriendo preferentemente en sitios hipervariables en la
región control.
Por lo tanto parece que es la estructura secundaria del DNA mitocondrial la
que influye en la susceptibilidad de estos sitios al daño, y así se puede explicar la
similitud de las tasas de los daños post mortem e in vivo en la región control;
mientras que las tasas de mutación de las regiones funcionales varían ya que no
sólo influye la conformación que adopta el DNA en esa posición sino que también
la selección afecta in vivo a estas mutaciones y esto no se produce una vez que
el organismo ha muerto.
![Page 76: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/76.jpg)
Introducción
49
I.4. DAÑOS POST MORTEM EN EL DNA
El estudio del mtDNA como una herramienta arqueo-genética ha ido en
aumento. Mediante las técnicas usadas en el DNA antiguo se ha intentado
obtener información que permita contestar una gran cantidad de preguntas que
de otra forma serían imposibles de responder. Recientemente, el estudio de el
daño post mortem ha permitido dar una visión de los procesos mutacionales que
tienen lugar dentro de las mitocondrias y que normalmente están enmascarados
por los procesos de reparación propios.
El número de trabajos en el DNA antiguo ha ido en aumento, lo que ha
llevado a detectar una serie de problemas que han causado un gran escepticismo
acerca de la autenticidad de los resultados (Gilbert et al. 2003b). A pesar de
rigurosos protocolos, se han observado contaminantes en los productos de
amplificación. Estos se suelen identificar cuando se repiten las amplificaciones y
los productos son diferentes o cuando se clonan los productos. Otro gran
problema que se presenta es el efecto de los daños post mortem en el DNA
endógeno que a menudo es subestimado. Este tipo de daño puede provocar la
imposibilidad de aplicar ciertas técnicas moleculares como por ejemplo la
imposibilidad de llevarse a cabo la PCR, o bien puede provocar secuencias
erróneas llevando a una interpretación incorrecta de los datos (Pääbo 1989).
Cuando un organismo muere, su DNA comienza a degradarse. Dentro de
las células vivas, la integridad de las moléculas de DNA se mantiene
continuamente por procesos de reparación enzimáticos (Lindahl 1993a). Después
de la muerte de un organismo, los compartimentos celulares que normalmente
secuestran enzimas catabólicas se rompen y como consecuencia, el DNA se
degrada rápidamente por acción de dichas enzimas como son las lipasas,
proteasas, amilasas y nucleasas de los lisosomas. Además el ataque de
bacterias, hongos e insectos también provoca la degradación de macromoléculas
(Pääbo et al. 2004). Bajo extrañas circunstancias, como son cuando los tejidos
sufren una rápida desecación después de la muerte, baja temperatura o altas
concentraciones de sales; las nucleasas pueden destruirse o inactivarse antes de
que todos los ácidos nucleicos se reduzcan a mononucleótidos y así el DNA
![Page 77: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/77.jpg)
Introducción
50
puede escapar de esta degradación (Smith et al. 2001; Poinar et al. 2003). De
esta formavprocesos químicos lentos pero persistentes empiezan a afectar al
DNA. Muchos de esos procesos son similares a los que ocurren en los
organismos vivos, pero después de la muerte los procesos de reparación no se
encuentran activos; por lo que los daños se van acumulando progresivamente
hasta que el DNA pierde su integridad.
La tasa de descomposición del DNA es tan rápida, que basándonos en la
cinética de desaminación y despurinización de los cuatro nucleótidos, se ha
estimado que en condiciones salinas fisiológicas, pH neutro y una temperatura de
15ºC, en 100.000 años el daño hidrolítico destruiría todo el DNA (Lindahl 1993a).
Algunas condiciones ambientales como son las bajas temperaturas (permafrost),
pueden duplicar o triplicar el tiempo de recuperación del DNA. Mientras que, si el
DNA se encuentra en ambientes cálidos este tiempo tiende a reducirse. Por lo
tanto amplificar DNA de más de un millón de años es demasiado optimista.
Svante Pääbo profundizó en el conocimiento de las características físico-
químicas del DNA antiguo así como en los procesos que contribuyen a su
degradación (Pääbo et al. 1989) y así tras estudiar doce especimenes de
diferente procedencia y antigüedad mediante diversas técnicas, concluyó que su
material genético se encontraba modificado de forma similar en todos ellos,
siendo la fragmentación y las modificaciones oxidativas las manifestaciones más
abundantes.
![Page 78: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/78.jpg)
Introducción
51
A continuación se presenta un esquema que trata de resumir los diferentes
tipos de daños que nos podemos encontrar:
I.4.1. Daños que impiden la amplificación:
I.4.1.1. DNA Cross-links
I.4.1.2. Roturas en las cadenas
Proceso enzimático : nucleasas endógenas que cortan el
DNA
Proceso no enzimático:
• Ataque hidrolítico:
o Uniones fosfodiester
o Uniones glucosídicas: provocan sitios sin bases,
provocando la ruptura de la cadena.
I.4.1.3. Modificaciones en la estructura del DNA
Daño oxidativo:
• Radicales libres: ej. O2, H2O2, OH
• En las uniones químicas de los residuos de
desoxirribosa fragmentación del anillo
• En los dobles enlaces de pirimidinas fragmentación
del anillo
• Citosinas y Timinas que se transforman en Hidantoinas
bloqueo de la Taq
I.4.2 Daños que permiten la amplificación:
I.4.2.1. “Miscoding Lesions”
I.4.2.2. Jumping PCR
![Page 79: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/79.jpg)
Introducción
52
I.4.1. Daños que impiden la amplificación
I.4.1.1. DNA Cross-links
Un tipo de daño en el DNA son los “cross-links” o uniones
intermoleculares que bloquean a la DNA polimerasa, estos fueron
observados directamente mediante microscopía electrónica en preparaciones
de DNA antiguo (Pääbo 1989).
Poinar y colaboradores observaron que siguiendo los protocolos de
extracción desarrollados para restos fecales actuales era imposible obtener
DNA de las heces encontradas en una cueva cercana a las Vegas, Nevada
(Poinar et al. 1998). Por lo que elaboraron un estudio de los componentes
volátiles de esas heces. Así se detectaron alquilpiracinas, furanones y
furaldehidos, todos ellos productos de la condensación de grupos carbonilos
de azúcares reducidos con aminas primarias. Las alquilpiracinas se forman a
través de la condensación de los componentes dicarbonilos con aminoácidos
y los productos furano son indicativos del avanzado estado de la reacción de
Maillard, lo cual puede resultar en un intensivo crosslinking entre
macromoléculas como son proteínas y ácidos nucleicos. Se ha sugerido que
estos productos de Maillard son el componente principal en los extractos de
DNA antiguo.
Se encuentra descrito un fenómeno asociado a enfermedades como la
diabetes mellitus que consiste en la unión de la glucosa y otros
monosacáridos con las proteínas, este fenómeno recibe el nombre de
glicación o glicosilación no enzimática. La reacción de glicación fue
descubierta por el químico francés L. Maillard en 1912 estudiando la pérdida
de lisina (aminoácido esencial) en los alimentos en conserva, cuando estos
son ricos en proteínas y en glúcidos. De gran importancia a la industria
alimentaria, esta reacción no atrajo a médicos o investigadores en medicina
hasta la década de los 70. La glicación implica una reacción en la cual los
azúcares (glucosa en general, pero no exclusivamente) reaccionan de forma
no enzimática con las proteínas (y en menor grado lípidos y DNA) para
formar los productos de glicación precoz, también llamados de Amadori. En
![Page 80: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/80.jpg)
Introducción
53
una segunda fase de la ruta de la glicación (que ahora en sí es independiente
de la glicemia), una serie compleja de reordenamientos intramoleculares y
reacciones oxidativas conduce a la formación de compuestos múltiples, muy
reactivos, colectivamente conocidos como “productos de glicación avanzada”
y que son llamados compuestos AGE o AGEs (Njoroge and Monnier 1989).
Esta es la reacción de Maillard (como también se le conoce a la glicación).
Los intermediarios dicarbonilo de la reacción de Maillard son muchísimo más
reactivos que la glucosa. Durante varios años se pensó que los productos de
glicación avanzada se formaban solamente en las macromoléculas
extracelulares. Más recientemente, sin embargo, se ha demostrado que, de
hecho, los AGEs se forman en las proteínas de la célula in vivo y más aún;
también se forman en el DNA in vitro.
Debido a la presencia de estos productos de Maillard, se usó el agente
químico bromuro de N-Fenilacil Tiazolio o PTB (del inglés, N-
phenacylthiazolium bromide), un agente que corta los crosslinks entre
proteínas y los derivados de los azúcares, como es la pentosa del DNA
(Vasan et al. 1996). Se hicieron varios experimentos con y sin PTB para ver
si esto influía en la eficiencia de la amplificación viéndose que el uso de PTB
provocaba amplificación y las bandas eran ligeramente mas fuertes cuanta
mas cantidad de PTB se usaba; mientras que no existía ningún tipo de
amplificación cuando este agente químico no era usado. Gracias a este
agente los restos fecales del trabajo de Poinar fueron atribuidos a
Nothrotheriops shastensis, una especie de perezoso que se extinguió hace
11.000 años (Poinar et al. 1998). Este no es el único ejemplo de su uso en la
amplia literatura del DNA antiguo; como ejemplos tenemos, entre otros, la
amplificación de DNA procedente de un Neandertal de más de 40.000 años
(Krings et al. 2000), el uso en la extracción de DNA procedente de tres restos
fecales de más de 2.000 años atribuidos a Nativos Americanos (Poinar et al.
2001) o en el estudio de la distribución de daño post mortem de Gilbert et al.
(2003b).
![Page 81: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/81.jpg)
Introducción
54
I.4.1.2. Roturas en las cadenas
Uno de los tipos mas obvios de daños en el DNA es la degradación en
pequeños fragmentos, generalmente de entre 100 y 500 pares de bases. Se
ha visto que esto no va en función de la edad de la muestra sino que la
reducción de tamaño es debida tanto a procesos enzimáticos (mediante
nucleasas endógenas) que ocurren después de la muerte, como a ataques
hidrolíticos no enzimáticos que se pueden dar en distintos puntos del DNA
aunque sólo unos cuantos provocan la ruptura de la molécula.
Mientras que en el DNA el enlace fosfodiester (entre azúcares) es muy
estable (aunque también se producen lesiones hidrolíticas), el enlace N-
glucosídico (base-azúcar) es muy inestable; la unión base + ribosa es mucho
menos susceptible a hidrólisis que la unión base + desoxirribosa. Se ha visto
que la tasa de despurinización (pérdida de guaninas y adeninas) es
muchísimo más elevada que la pérdida de las timinas y citosinas;
observándose in vivo hasta 100 – 500 veces más (Lindahl and Nyberg 1972).
Además se vio que la estructura de la doble hélice no le protegía mucho de
este tipo de hidrólisis. En el momento en que se produce un sitio sin base
(sitios apurínicos o sitios apirimidínicos), la cadena se vuelve muy débil y se
acaba rompiendo por β-eliminación. Esto también ocurre in vivo pero
afortunadamente rápidamente se produce la reparación del DNA por una
cascada de enzimas (endonucleasa AP, fofodiesterasa, DNA polimerasa y
DNA ligasa). Se estima que in vivo en genomas grandes como son los de las
células de mamíferos, se producen al día entre 2.000 y 10.000 sitios
apurínicos que son posteriormente reparados (Lindahl 1993a). Este tipo de
daño en sí mismo no impide la amplificación, pero reduce la posibilidad de
amplificación de un fragmento grande de DNA.
![Page 82: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/82.jpg)
Introducción
55
I.4.1.3. Modificaciones en la estructura del DNA
La longitud de las secuencias de DNA que pueden ser amplificadas
por PCR no solo se ve limitada por las rupturas de las cadenas, sino también
por lesiones que bloquean a la Taq polimerasa y esta no puede seguir
sintetizando la cadena.
Las radiaciones pueden actuar directamente en el DNA o bien
provocar la formación de radicales libres, como son los radicales peróxido
(.O2), el peróxido de hidrógeno (H2O2) y los radicales hidroxi (.OH), los cuales
son creados a partir de moléculas de agua que han sido sometidas a
radiación (Höss et al. 1996).
Los principales sitios de ataque oxidativo son los dobles enlaces de las
pirimidinas, provocando la fragmentación del anillo (Lindahl 1993). Además,
las uniones químicas de los residuos de desoxirribosa son susceptibles a la
oxidación resultando en la fragmentación del anillo de azúcar (Figura 11).
Pääbo muestra extractos de DNA procedentes de tejidos de diferente
antigüedad que fueron sometidos a hidrólisis en condiciones ácidas y luego
estas bases nitrogenadas fueron analizadas por HPLC de fase reversa
(Pääbo 1989). Observó como muestras más o menos recientes (4 años)
presentan un patrón muy similar al que puede dar una línea celular mientras
que en extractos antiguos el patrón de A y G se mantiene más o menos igual,
cosa que no ocurre con los picos de C y T que se ven reducidos y aparecen
en menos de un 5% de la cantidad esperada. Viendo así como las pirimidinas
son mucho más sensitivas a daños oxidativos que las purinas.
Usando cromatografía de gases/espectrofotometría de masas
(GC/MS), Höss et al. (1996) observaron dos formas predominantes, que son
las pirimidinas oxidadas; 5-hidroxi-5-metilhidantoina (5-OH-5-MeHyd), la
principal forma derivada de la timina debido a una exposición a la radiacción
γ, y la 5-hidroxihidantoina (5-OH-Hyd). Mientras que otros daños oxidativos e
hidrolíticos previenen la amplificación del DNA debido a la fragmentación del
![Page 83: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/83.jpg)
Introducción
56
mismo, en este caso parece que estas formas (hidantoinas) bloquean a la
polimerasa durante la PCR impidiendo por lo tanto la amplificación del DNA
(Höss et al. 1996; Pääbo et al. 2004).
Figura 11: Estructura del DNA, las flechas señalan los principales puntos de ataques oxidativos (flechas azules) e hidrolíticos (flechas verdes); las flechas de mayor tamaño indican los puntos principales de daños hidrolíticos. Figura modificada de Hofreiter et al. (2001b)
I.4.2. Daños que permiten la amplificación
I.4.2.1. “ Miscoding Lesions”
Una pequeña proporción de los daños en el DNA no impide la
replicación; pero sin embargo genera lesiones que llevan a la interpretación
errónea de los resultados. Se define “miscoding lesions” como modificaciones
de las bases cambiando la apariencia del DNA, lo que puede generar
haplotipos erróneos (Gilbert et al. 2003b). Tales modificaciones serían fáciles
de distinguir al observar los clones ya que presentan un número mayor de
diferencias que aquellas que veríamos si el DNA amplificado fuera moderno.
![Page 84: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/84.jpg)
Introducción
57
Aquellos errores que encontramos entre los clones los podemos dividir en:
Sustituciones Consistentes:
Son aquellas sustituciones que aparecen en todos los clones de una
misma amplificación (Figura 12, círculos rojos). Se inician a partir de una
molécula que se encontraba dañada o bien son debidas a
incorporaciones erróneas en los primeros ciclos de PCR y por lo tanto
va a repercutir en el resultado final.
Singletons:
Son aquellas sustituciones que se observan en uno o varios, pero no en
todos los clones de una misma amplificación (Figura 12, círculos
verdes). Son debidos a errores que comete la polimerasa en los últimos
ciclos de PCR por lo tanto no son debidas a modificaciones presentes
en las moléculas de DNA de la muestra.
Figura 12: Clones procedentes de tres PCRs diferentes. Los puntos indican que esas posiciones son idénticas a la secuencia consenso. En rojo se marcan las sustituciones consistentes mientras que en verde los singletons. Imagen modificada de Hofreiter et al. (2001a)
![Page 85: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/85.jpg)
Introducción
58
Se ha visto que el daño más común es la transición frente a la
transversión (Meyer et al. 1999) y esto no sólo ocurre in vivo sino que
también se observa que dentro de los daños post mortem el número de
transversiones es claramente inferior al de transiciones (Higuchi et al. 1984;
Pääbo 1985). Dada la complementariedad del DNA se pueden resumir las
transiciones en dos tipos a las que se les han llamado, transición “Tipo I” que
corresponde a A/T G/C y transición “Tipo II” que corresponde a C/G T/A
(Hansen et al. 2001). Lo importante es saber si estos cambios se producen
por igual en una base como en la otra o bien si cada uno de estos grupos
proviene de un único evento mutacional.
Las bases del DNA son susceptibles a la desaminación hidrolítica; en
concreto el principal objetivo de esta desaminación es la citosina y su
homóloga la 5-metilcitosina. En células de mamíferos se ha visto que su
reparación es bastante lenta y junto con su alta tasa de desaminación
contribuye a una tasa de mutación muy alta, viéndose por lo tanto un cambio
de C a T. Este fenómeno se ha visto in vivo asociado a procesos
mutagénicos y carcinogénicos en humanos (Lindahl 1993a). Comparando la
tasa de desaminación de la C con la tasa de desaminación de las purinas se
ve como esta última no es tan común (Lindahl 1993a).
Uno de los primeros estudios grandes que se ha llevado a cabo en
este campo ha sido el de Gilbert el al. (2003a), para ello Tom Gilbert usó un
gran número de datos publicados en Gilbert et al. (2003b) así como otros
estudios de DNA antiguo de humanos y Neandertales, osos y ratites.
![Page 86: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/86.jpg)
Introducción
59
La explicación de los dos tipos de cambios puede resumirse en:
• Transiciones Tipo I : A/T G/C Este tipo de error se puede explicar por dos posibles eventos, como
serían la T se modificaría a C o bien la A se desaminaría a
Hipoxantina (HX) que es un análogo de la guanina.
Hofreiter et al. (2001b) dice que el cambio de T a C es altamente
improbable, por lo que cada vez que vemos este tipo de cambio
sabemos que esto es debido a la desaminación de la A a HX.
Aunque esta hipótesis se ve debilitada al comparar los estudios “in
vivo” e “in vitro” donde aparecen formas oxidadas de la timina; la 5-
formiluracilo (fU) que tiene la capacidad de emparejar con cualquiera
de las bases siguientes, T, G o C. Se demostró que la pareja fU:G,
produciendo por lo tanto la modificación T C, es el tipo más común
de emparejamientos erróneos (Anensen et al. 2001). Aunque
experimentos más recientes han encontrado que este tipo de
reacciones oxidativas producen modificaciones en una proporción baja
(Gilbert et al. 2003a).
Los últimos trabajos (Gilbert et al. 2007) se han llegado a plantear la
posibilidad de que este no sea un verdadero daño, sino que podría ser
debido a una incorporación errónea de la enzima que actúa en la PCR.
• Transiciones Tipo II : C/G T/A Este error se puede explicar tanto por la citosina que sufre una
desaminación y se transforma en uracilo (análogo de la timina)
produciéndose un cambio final de C T; o bien porque se produzca
el otro cambio, G A (ver Figura 13).
De todas formas esto pareció solucionarse cuando Hofreiter et al
(2001b) demuestran, que la modificación G a A es altamente
improbable, por no decir imposible. Por lo tanto cualquier cambio de G
a A observado es debido a un daño causado en la otra cadena por una
modificación de C a T.
![Page 87: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/87.jpg)
Introducción
60
Figura 13: Esquema del daño Tipo II, que se puede explicar por las dos vías; bien la C que se desamina a U o bien es la G la que pasa a A. Imagen tomada de Gilbert et al. (2003a)
Existe una gran controversia acerca de cual es el causante de cada
uno de los tipos de daños. La naturaleza de la PCR hace que cualquier daño
que exista en cualquiera de las dos cadenas se vea reflejado, haciendo
imposible saber cuál ha sido el verdadero cambio (Gilbert et al. 2007). Para
intentar solucionar este problema se han llevado a cabo una serie de
experimentos que se pasan a explicar a continuación:
a) Single Primer Extension PCR (SP-PCR)
Para saber cuál es el daño que se está produciendo en cada uno de
estos grupos se llevó a cabo el experimento “Single Primer extension PCR
(SP-PCR)”; que consiste en que la muestra se amplifica (25 ciclos) con el
primer L o el H, seguido de una amplificación de 45 ciclos con ambos
primers. La fase inicial enriquece una de las cadenas (H o L), dirigiéndose la
PCR normal a un producto mayor de la cadena amplificada inicialmente
(Hofreiter et al. 2001a). Después de esos 25 primeros ciclos, sólo una
![Page 88: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/88.jpg)
Introducción
61
cadena sirve como molde, así incorporaciones erróneas debido a
modificaciones en esa cadena predominarán entre los clones analizados.
Los nucleótidos incorporados como resultado de modificaciones en las
moléculas de aDNA serán vistas en la cadena generada por el primer usado
durante los primeros 25 ciclos (ver Figura 14).
Gilbert et al. (2003a) analizaron 32 clones derivados de SP-PCR y en
ningún caso vio juntas en la misma secuencia ambos cambios de cada uno
de los diferentes tipos de daño. Como se puede ver el la Figura 14 esto nos
viene a indicar que no existen evidencias de que el daño oxidativo de la T
pasando a fU o que la G sufra modificaciones y de lugar a una A; por lo que
este tipo de cambios no jugarían un papel post mortem muy importante.
Si la amplificación viene de una sola cadena siempre tenemos que
ver, en el caso del daño tipo II, el cambio G A (que es debido a la
desaminación de la C), nunca podríamos ver el cambio C T, ya que sería
indicativo de que la que se desaminado es la G. Exactamente lo mismo
pasaría para el daño tipo I. Esto ha servido para que otros autores (Pääbo et
al. 1990) expliquen como si se observan estos dos cambios en la misma
secuencia es indicativo de un fenómeno de jumping PCR (proceso explicado
en el apartado I.4.2.2). Por lo que todos los daños se pueden achacar a la A
que se desamina y se transforma en HX; del mismo modo que por este
experimento también llegamos a la conclusión de que la C se desamina a U,
siendo este el causante del daño tipo II.
![Page 89: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/89.jpg)
Introducción
62
Figura 14: Diferencias entre el experimento de SP-PCR y la PCR directa. Al llevar a cabo la PCR normal, no vemos cual es el daño que se está produciendo y al final vemos todos los daños por igual, mientras que cuando se lleva a cabo el experimento de SP-PCR se ve como nunca van a aparecer juntos el cambio consistente A G con el cambio consistente T C, y lo mismo para las dos posibilidades del daño tipo II, C T con G A. Viendo así claramente como cada uno de los grupos de daños son debidos a un único evento mutacional.
Llevando a cabo experimentos de SP-PCR se ha visto que no existe
una cadena específica propensa al daño hidrolítico dentro de la región
control. Pero lo que si que se ha visto es que cuando la cantidad de daño
aumenta, menos amplificaciones son iniciadas de la cadena H (Gilbert et al.
2003a). De esto se puede deducir o bien que la cadena L se conserva mejor
o que por lo menos prevalece más tiempo en condiciones de amplificarse.
SP-PCR Primer H
C T A G
G A T C
C T y G A A G y T C
SP-PCR Primer L
PCR
(A) (C) U G T HX L
(C) (A) HG U HX T
Tipo II Tipo I
C A C G L
T A C G L
HA C A C
HA T G C
![Page 90: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/90.jpg)
Introducción
63
Esto puede sugerir la rápida degradación post mortem del desplazamiento
secundario (D-loop) de la cadena H. Los datos indican que ese aumento del
daño hace que pocas moléculas H conserven la habilidad de actuar como
moldes durante la amplificación enzimática. En las células vivas el
desplazamiento de la cadena 7S del D-loop implica que debe de haber dos
copias de la cadena H por cada cadena L en esa región (Wallace et al.
1995). Los datos obtenidos de las transiciones indican que esa cadena H
extra no está disponible para la amplificación, y es posible que las posiciones
expuestas contribuyan a una rápida degradación post mortem. Pero si esto
ocurriera dejaría expuesta la cadena L a una rápida degradación (Lindahl
1993a). Por lo que debe de existir algún tipo de impedimento en la cadena H
para amplificarse cuando el daño aumenta, se ha sugerido que esto sea
debido a hidantoinas que bloquean la replicación pero dejan al DNA
estructuralmente sano (Höss et al. 1996).
b) Enzima Uracil DNA Glycosilasa (UNG)
En el caso del daño Tipo II, tenemos otra forma de determinar cual es
el motivo de daño; y este es basándonos en el uso de un enzima de E. Coli;
Uracil DNA Glycosilasa (UNG). Esta enzima es el producto del gen ung de
Escherichia Coli. UNG quita los residuos uracilo del DNA sin destruir la
columna vertebral azúcar-fosfodiester. Esto crea sitios en el DNA sin bases
que son susceptibles de roturas hidrolíticas por β-eliminación a elevadas
temperaturas. Por lo que normalmente va acompañado de la fragmentación
de las cadenas.
Últimamente es bastante rutinario el uso de este enzima para prevenir
contaminaciones “carry-over” de productos de PCR previos (Longo et al.
1990). Sin embargo en DNA antiguo su uso tiene un significado diferente ya
que se utiliza para desechar aquellas cadenas que presenten daños post
mortem que nos llevarían a interpretar erróneamente los resultados. Cada
vez más gente empieza a usar el enzima UNG en sus trabajos (Hofreiter et
al. 2001a; Gilbert et al. 2003a; Gilbert et al. 2003b).
![Page 91: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/91.jpg)
Introducción
64
Cuando se usa este enzima se ve que son eliminados un número
importante de errores C/G T/A, demostrando que este cambio es producido
por un único evento; la desaminación de la citosina (Hofreiter et al. 2001a).
Después del uso de este tratamiento los productos no presentan muchos más
errores que muestras actuales sin daños.
La desaminación de la citosina parece ser algo común en DNA extraído
de especimenes antiguos. Por lo que la mejor forma de evitar estas
incorporaciones erróneas causadas por la desaminación de la citosina sería
el uso de forma rutinaria del tratamiento con UNG; sin embargo como el
resultado final de este tratamiento lleva a la ruptura de la molécula, ciertos
autores (Hofreiter et al. 2001a) piensan que puede ser el final del DNA
endógeno de una muestra si este presenta un número ínfimo de moléculas y
por otro lado en aquellos extractos en donde el número moléculas iniciales es
elevado, es bastante improbable que se produzcan cambios consistentes por
lo que el uso de este enzima no sería necesario.
Al llevar a cabo estos dos últimos experimentos también se preguntaron si
el número de transiciones Tipo I era igual al de transiciones Tipo II. Hofreiter et
al. (2001a) demuestran en su estudio de 11 huesos pertenecientes a osos del
Pleistoceno que la mayor parte de las sustituciones consistentes son
desaminaciones de la citosina. A esta conclusión llegan muchos otros autores
(Lindahl 1993a; Hansen et al. 2001; Gilbert et al. 2003a) en donde ven que el
daño predominante es el daño Tipo II.
Existe una controversia en determinar como de frecuente es el daño Tipo II
frente al daño Tipo I. Lindahl (1993a) dice como ya hemos destacado arriba, que
la tasa in vivo de este tipo de transición es unas 40 veces superior a la
desaminación hidrolítica de la adenina generando T/A C/G durante la
replicación. Pero Gilbert et al. (2003a) dice que los factores que envuelven al
daño hidrolítico varían un poco entre post mortem e in vivo.
![Page 92: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/92.jpg)
Introducción
65
Algunos autores (Hansen et al. 2001) se han cuestionado si la
heterogeneidad de los productos de PCR de restos fósiles es debida a errores
de la DNA Polimerasa o a incorporación errónea debido al daño en el DNA
molde o bien a ambos. La tasa de error de la Taq es de 10-4 – 10-5 por nucleótido
y por ciclo (Eckert and Kunkel 1990) y se ha visto que esta es independiente del
molde de partida y de las condiciones de la PCR. Hansen et al. (2001) llevaron a
cabo un estudio para ver si todas las sustituciones observadas eran debidas a la
Taq, y vieron que la heterogeneidad observada no se podía explicar sólo por los
errores de la polimerasa, sino también por lesiones en el DNA molde. Ellos
proponen que para evitar ver algún tipo de daño por la polimerasa es mejor el
uso de la high-fidelity (Hi-Fi) polimerasa en vez de la Taq, cuya tasa de error es
de 10-6 – 10-7 por nucleótido y por ciclo, lo que permitirá ignorar por completo la
probabilidad de que los errores sean debidos a la polimerasa durante la PCR.
c) GS20 DNA 454 sequencing system
El nuevo sistema de secuenciación GS20 (Genome Sequencer 20)
(Roche) revoluciona los métodos de secuenciación en masa de DNA al
ofrecer una innovadora herramienta que permite secuenciar y ensamblar de
forma rápida, eficiente y simple genomas completos. Esta tecnología permite
secuenciar las cadenas por separado, viendo así cuál es el causante del
daño. Se trata de un equipo creado a partir de nanotecnología diseñada por
la compañía estadounidense “454 Life Sciences” siendo capaz de secuenciar
casi 20 millones de bases en menos de 5 horas y mediante el software
adecuado, mapear estos fragmentos. Para ello el DNA es fragmentado y
desnaturalizado, cada fragmento de DNA de cadena sencilla es amplificado
por emPCR (amplificación por PCR en emulsión) y la lectura de cada una de
las cadenas se realiza mediante pirosecuenciación (Margulies et al. 2005).
Por lo que cada secuencia leída deriva de fragmentos de DNA de una sola
cadena.
Mediante el uso de esta tecnología, Tom Gilbert analizó el DNA de los
cloroplastos en muestras actuales y comparó los daños con DNA mitocondrial
de muestras de permaforst (Mammuthus primigenius). Así llegó a la
![Page 93: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/93.jpg)
Introducción
66
conclusión de que el daño tipo II es el principal tipo de daño, ocurriendo en un
94% de las transiciones y en un 88% de todas las incorporaciones erróneas.
Vio como no había una cadena propensa al daño, se da por igual en la
cadena L que en la H. Y que aunque la principal causa de este tipo de daño
es debida a la desaminación de la citosina, también vio como, en contra de
las conclusiones obtenidas de trabajos anteriores, el cambio G A también
juega un papel importante (Gilbert et al. 2007). A la luz de los resultados
obtenidos, Gilbert y colaboradores (Gilbert et al. 2007) advierten de que el
cambio C T y G A pueden ser vistos en la misma cadena y esto no ser
indicativo de un fenómeno de jumping PCR (explicado en el apartado
siguiente).
Otros trabajos ya habían empleado esta nueva tecnología (Green et al.
2006; Stiller et al. 2006) encontrando el mismo patrón de error que el que
encuentra Gilbert. Por lo que es interesante que se lleven a cabo más
trabajos utilizando esta metodología para poder comparar si este patrón de
daños ocurre por igual en muestras de diferentes contextos, y poder llegar así
a comprender mejor el daño en el aDNA.
I.4.2.2. “Jumping PCR ”
A lo largo de toda la amplia literatura del DNA antiguo se encuentran
citados muchos fenómenos de Jumping PCR (Pääbo et al. 1989; Krings et al.
1997; Poinar et al. 1998; Greenwood et al. 1999; Willerslev et al. 1999;
Hofreiter et al. 2001a).
Pääbo et al. en 1990 demostró como determinadas lesiones en el DNA
como son roturas, sitios apurínicos o daños por radiaciones ultravioleta
pueden causar la extensión del primer saltando a otro DNA molde durante la
PCR (Pääbo et al. 1990). La Taq cuando encuentra el final de la molécula
muchas veces inserta una A (residuo de Adenosina). La Taq no tiene
actividad exonucleásica 3’–5’, por lo que esa base errónea (A) no es
eliminada. Esta prematura finalización del producto hace que salte a otra
![Page 94: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/94.jpg)
Introducción
67
molécula y la polimerización continúa creando “in vitro” productos de
recombinación.
Cuando el DNA está tan dañado que ninguna molécula permite a la
polimerasa actuar directamente de un primer al otro, los primers se extienden
durante el primer ciclo de PCR hasta los puntos donde existen lesiones o se
acaban los fragmentos, causando que la polimerasa se pare. Durante los
siguientes ciclos esos primers extendidos pueden unirse con otras moléculas
molde y extenderse más. Después de un número suficiente de ciclos los dos
primers han llegado tan lejos que se unen las moléculas formando una
molécula completa de doble cadena (ver Figura 15). De esta forma esta
molécula quimérica sirve como molde para una PCR convencional. Este
fenómeno es el que se conoce como “Jumping Polimerase Chain Reaction” ó
“Jumping PCR”; y consiste simplemente en esto; la Taq salta de una
molécula molde a otra presentándonos una molécula quimérica como si fuera
la original (Figura 15).
Figura 15: Fenómeno de Jumping PCR. Los rombos verdes indican posiciones que se encuentran dañadas o bien en donde termina la cadena de golpe, viendo así como se producen fenómenos de jumping entre varias moléculas distintas obteniendo así una quimera. Imagen tomada de Pääbo et al. (1989)
![Page 95: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/95.jpg)
Introducción
68
La ilegítima A (o T en la cadena complementaria), añadida por la Taq,
puede ser detectada cuando se secuencian los clones siendo muy difícil
detectarla por secuenciación directa. Así muchas veces vemos que en aDNA
(moléculas que generalmente se encuentran bastante dañadas) presentan
una gran proporción de moléculas quiméricas.
Pääbo et al. (1990) demostraron como la recombinación “in vitro” ocurre
con elevada frecuencia cuando existe ruptura en la molécula (para ello
utilizaron la sonicación), cuando se produce despurinización y por radiación
mediante luz UV; mientras que no se observa con las moléculas intactas. Si
la amplificación se inicia a partir de una o muy pocas moléculas, cualquier
daño inducido por jumping PCR se va a ver reflejado en la mayoría de las
moléculas sino en todas, enmascarando el producto final.
En los extractos de DNA antiguo puede existir un mix de moléculas de
diferentes orígenes (contaminaciones); con lo que el fenómeno de jumping
PCR hace que la obtención de la verdadera molécula sea difícil. Ejemplos de
posibles moléculas de DNA a parte de la de interés pueden ser, copias de
DNA mitocondrial en el DNA nuclear (numts), DNA patógeno que se
encuentra en los tejidos, pero sobre todo la contaminación con DNA
moderno. Por lo que sin un apropiado tratamiento para eliminar el DNA
contaminante del ambiente, es muy fácil y desafortunadamente común
amplificar ambos tipos de DNA; y esto depende siempre de la concentración
de ambos y del estado de degradación del DNA endógeno. Todas estas
características hacen que obtengamos datos incorrectos. Por lo tanto el
fenómeno de Jumping PCR permite la recombinación entre un gran número
de fuentes, generando un amplio rango de secuencias.
Los efectos de jumping pueden aumentar el número aparente de daños
en secuencias clonadas por introducir posiciones que difieren entre el
contaminante y el DNA auténtico (Pääbo et al. 1990). Un claro ejemplo de
interpretación errónea de los resultados es el que reporta Kuznetsov y
colaboradores, mostrando la identificación de una nueva especie de búfalo
encontrado en Vietnam “Linh Duong” basándose en la amplificación del gen
![Page 96: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/96.jpg)
Introducción
69
12S rRNA del DNA mitocondrial (Kuznetsov et al. 2001). Cuando se
intentaron reproducir los resultados se demostró que la secuencia reportada
era una quimera de 3 tipos diferentes de DNA de mamíferos que se
encontraban presentes en el extracto (Hassanin 2002).
Mediante fenómenos de Jumping PCR también se puede explicar otra
causa del aumento del cambio G/C A/T, aunque la principal causa sea la
desaminación de la citosina como ya se ha descrito en el apartado anterior.
Cuando la PCR tiene lugar y se está llevando a cabo la extensión del primer,
este al llegar al final de la molécula molde inserta una A. Si el DNA está
degradado y no presenta el sitio para que se una el otro primer se puede
producir un fenómeno de Jumping como hemos visto y este ocurre
frecuentemente en oposición a una C (ver Figura 16). Por lo que como
resultado final lo que estamos viendo es de nuevo un cambio C a T, por un
método distinto al de la desaminación de la Citosina (Hofreiter et al. 2001a).
Obviamente estos dos mecanismos (Jumping y desaminación) pueden ocurrir
en la misma muestra sin embargo el hecho de que la mayor parte de estos
cambios desaparezcan cuando se usa el enzima UNG sugiere que es la
desaminación de la citosina la principal causante de este tipo de error.
Figura 16: Esquema que explica a qué puede ser debido los cambios de C a T. Imagen tomada de Hofreiter et al. (2001a)
![Page 97: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/97.jpg)
Introducción
70
I.4.3. Sustancias mutagénicas
Un apartado aparte merecen aquellas sustancias que se encuentran en los
extractos de DNA antiguo y que bien o inhiben la amplificación o provocan
mutaciones en las secuencias amplificadas.
Ciertos autores (Pusch and Bachmann 2004) encontraron que los
extractos de DNA antiguo poseían sustancias capaces de inhibir la amplificación
del DNA moderno si estos eran añadidos al mix de PCR. Pero no sólo eso, sino
que además demostraron que estos extractos presentaban efectos mutagénicos
ya que cuando se conseguía la amplificación se veía como el DNA moderno
portaba un gran número de mutaciones que no aparecían cuando este se
amplificaba independientemente. Además se vio que las mutaciones no ocurrían
al azar, sino que tendían a acumularse en sitios específicos que ya se habían
visto en otros estudios tanto in vivo como post mortem, estas posiciones se los
llamados “Hotspots” (ver capítulo 3).
Al ver que los extractos de aDNA podían inducir mutaciones en la PCR, se
especula sobre la coextracción de sustancias químicas que pueden provocar la
alteración de las secuencias. Estas sustancias mutagénicas pueden acumularse
en las muestras durante la diagénesis1. Aunque los procesos diagenéticos son
poco conocidos, se sabe que los especimenes una vez muertos van
acumulando iones metálicos. Por ejemplo en muestras antiguas se puede
encontrar manganeso, bario, estroncio, plata y uranio en cantidades de hasta
5.000 veces superiores a las que podemos encontrar en muestras actuales. En
particular el manganeso es conocido por su efecto mutagénico y es utilizado
como agente mutágeno en muchos kits de biología molecular. Debería
esperarse por lo tanto una relación directa entre la concentración de Mn2+ y la
1 DIAGENESIS Incluye todos los procesos físicos y químicos que afectan al sedimento después del deposito y hasta antes del metamorfismo de bajo grado. Los procesos diagenéticos no operan con uniformidad y regularidad, por lo que el tiempo y edad geológica de las rocas o sedimentos no son factores cruciales en los productos de la diagénesis.
![Page 98: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/98.jpg)
Introducción
71
fiabilidad del DNA, pero esta ni se ve ni tampoco es así. Eso es debido a que el
manganeso tiene varias valencias que difieren en su actividad biológica. La
medida del manganeso se refiere al total y no diferencia entre las distintas
valencias. Además del efecto mutagénico del Mn2+ también depende de la
concentración de otros iones, como por ejemplo del Mg2+. De hecho se ha visto
que factores como una elevada concentración de magnesio y un elevado pH
inducen a que se produzcan más errores en la polimerización (Eckert and
Kunkel 1990; Kunichika et al. 2002). Todas las DNA polimerasas requieren la
presencia de un catión divalente para su activación, pero cierto número de
metales divalentes se ha visto que son mutagénicos y carcinogénicos, y por lo
tanto disminuyen la fidelidad de la Taq (Eckert and Kunkel 1990). La
mutagénesis en E. Coli por las concentraciones de Mn2+ es un fenómeno
conocido. Parece que no tiene que ver con la unión del Mn2+ a los sitios de
ocupación de la polimerasa, sino más bien a la unión del Mn2+ al DNA molde. Se
llevaron a cabo una serie de experimentos en los cuales sustituían el Mg2+ por
Mn2+ en la PCR y se vio como el número de mutaciones aumentaba
considerablemente; y el número mayor de mutaciones correspondía a cambios
de T C y de A G; esto no se veía cuando se llevaba a cabo la PCR con
una mezcla de magnesio y de manganeso; en donde el número de mutaciones
disminuía pero seguía siendo mayor que cuando se usaba sólo magnesio
(Svetlov and Cooper 1998; Kunichika et al. 2002).
Todo esto sugiere que muy pequeñas concentraciones de manganeso
sirven para activar a la Taq y que esta sea muy fiable, pero a medida que
aumentan las concentraciones de Mn+2 libres comienzan a producirse errores.
Este efecto mutagénico parece ser debido a la unión del Mn+2 a regiones de
cadena simple dentro del DNA (Beckman et al. 1985; Eckert and Kunkel 1990).
![Page 99: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/99.jpg)
Introducción
72
I.5. POBLAMIENTO DEL NUEVO MUNDO
A lo largo de las últimas décadas antropólogos e investigadores de
diferentes laboratorios de todo el mundo han enfocado sus estudios en contestar
las siguientes preguntas: ¿Quiénes fueron los primeros americanos?, ¿Cuándo
llegaron por primera vez al Nuevo Mundo los ancestros Nativo Americanos?,
¿Cómo fue este proceso de expansión o migración? y ¿De dónde provenían
estos grupos ancestrales? (Schurr 2004).
En la historia de estas poblaciones nativas se han producido dos grandes
cuellos de botella, uno en la primera entrada del hombre en el continente
americano y otro cuando se produjo la colonización de este continente por los
europeos, trayendo enfermedades que acabaron con un gran número de
población y por el proceso mismo de colonización que llevó a que las poblaciones
existentes diezmaran. Además en los últimos 500 años el pool génico americano
ha sido sustancialmente remodelado debido a la entrada de europeos, creando
así un porcentaje de mestizos muy elevado, así como también el flujo de
africanos que fueron llevados a este continente como esclavos. Dificultando hoy
en día el estudio de las poblaciones ancestrales (Schurr 2004).
Haciendo un seguimiento a nivel molecular del cromosoma Y y del DNA
mitocondrial, se ve una clara influencia europea masculina más que femenina.
Esto tiene una explicación histórica bien documentada, los colonizadores
europeos eran hombres y las mujeres llegaron mucho más tarde y en un número
mucho menor que el de los hombres; lo que llevó a una mezcla entre hombres
europeos con indígenas americanas; por lo que el DNA mitocondrial no se ha
visto tan influenciado por europeos como el cromosoma Y (Schurr 2004).
También se ha observado una cierta mezcla africana, viendo algunos haplotipos
del cromosoma Y y muchos haplogrupos del mitocondrial como es el caso del
haplogrupo L. En términos generales se puede decir que la mayor influencia
europea se encuentra en el norte del continente, una influencia africana mayor a
lo largo de las áreas costeras, sobre todo en el Caribe Atlántico y la influencia
amerindia más fuerte se encuentra en el centro y en las regiones surestes del
continente (Green et al. 2000).
![Page 100: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/100.jpg)
Introducción
73
Pero lo que realmente nos interesa en este capítulo es, ¿Quiénes fueron
los primeros pobladores de este continente? y ¿Cuándo y cómo se llevó a cabo
esta expansión?.
I.5.1. Hallazgos arqueológicos y geológicos
En 1929 Ridgely Whiteman, un joven indígena de 19 años, encuentra una
serie de huesos en la aldea de Clovis, Nuevo México. En 1932, una excavación
realizada por un equipo dirigido por Edgar Billings Howard de la Universidad de
Pensilvania confirmó que se trataba de un asentamiento indígena durante el
Pleistoceno resultando en un yacimiento de una antigüedad entre los 12.900 y los
13.500 años.
Es entonces cuando la comunidad científica norteamericana aceptó que la
Cultura Clovis era la más antigua de América y que estaba directamente
relacionada con la llegada de los primeros hombres. Esto se conoció como
Consenso Clovis y tuvo gran aceptación mundial hasta fines del siglo XX. El
Consenso Clovis fue la base de la teoría del poblamiento tardío de América. De
acuerdo con este modelo, las poblaciones humanas entraron por primera vez en
América hará unos 12.900 años por Beringia, después de la última gran
glaciación (24.000 – 13.050), y continuaron por el corredor libre de hielo que se
había abierto entre los dos grandes glaciares que cubrían Norte América;
expandiéndose rápidamente por las inhabitadas tierras americanas (Schurr 2004).
Debido a que no se habían encontrado o confirmado sitos más antiguos, y que
otras tradiciones líticas americanas parecían derivar de esta cultura Clovis,
muchos arqueólogos creyeron que estos fueron los primeros humanos en entrar
en el continente.
Según esta teoría fue a partir de la migración de pueblos siberianos y
mongoles que atravesaron el estrecho de Bering extendiéndose más tarde por
todo el continente, desde Alaska hasta la Patagonia, ocupando lógicamente en
primer lugar el hemisferio norte. La expansión a lo largo de Norte América fue
muy rápida, se ha calculado que les llevó unos 200 años (Waters and Stafford
2007).
![Page 101: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/101.jpg)
Introducción
74
Durante la última gran glaciación, la Glaciación de Würm o Wisconsin, la
concentración de hielo en los continentes hizo descender el nivel de los océanos
en unos 120 metros. Este descenso hizo que en varios puntos del planeta se
crearan conexiones terrestres, como por ejemplo Australia – Tasmania con Nueva
Guinea; Filipinas e Indonesia; Japón y Corea. Uno de esos lugares fue Beringia.
Debido a que el Estrecho de Bering, que separa Asia de América, tiene una
profundidad de entre 30 y 50 metros, el descenso de las aguas dejó al
descubierto un amplio territorio que alcanzó 1.500 kilómetros de ancho uniendo
las tierras de Siberia y Alaska. Su primera formación sucedió hace
aproximadamente 40.000 años manteniéndose durante unos 4.000 años. Su
segunda formación se produjo aproximadamente hace 25.000 años
permaneciendo hasta hace unos 11.000 – 10.500; momento en el cual volvieron a
subir las aguas al final de la glaciación, inundando gran parte del territorio y
separando Asía de América por el Estrecho de Bering. Durante este período
existió la posibilidad de que tribus primitivas de Asia pudieran cruzar el Puente de
Beringia.
El dato más importante para establecer una teoría migratoria durante la
última glaciación es el hecho de que Canadá estaba completamente cubierta de
hielo durante la última glaciación, invadida por dos gigantescas placas: la placa
de hielo Laurentina y la placa de hielo Cordillerana. Esto hacía imposible la
entrada al continente más allá de Beringia.
Se desarrolló entonces una teoría: poco antes de finalizar la última
glaciación y que el Puente de Beringia se inundara, comenzaron a derretirse los
bordes en contacto de las dos grandes placas de hielo que cubrían Canadá,
abriendo un corredor libre de hielo de unos 25 kilómetros de ancho, que seguía,
primero el valle del río Yukón y luego el borde este de las Montañas Rocosas por
el corredor del río Mackenzie (ver Figura 17). Se estima que esto ocurrió hace
unos 14.000 años. En ese momento los seres humanos que estaban en Beringia
pudieron avanzar hacia el interior de América aunque no hay evidencia que lo
pruebe. Esta teoría se ve avalada por los descubrimientos de la Cultura Clovis
con una datación de hace 13.500 para concluir que estos fueron los primeros en
![Page 102: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/102.jpg)
Introducción
75
habitar este continente ingresando por Beringia. Y a partir de esta cultura habrían
descendido todas las demás culturas indoamericanas.
Figura 17: Alternativas rutas desde Asia hacia el Nuevo Mundo. Las flechas discontinuas representan el paso a través de las dos placas glaciares. Las líneas continuas representan la ruta a lo largo de la costa Pacífica. Imagen sacada de Eshleman et al. (2003)
Pero pronto se empiezan a complicar las cosas poniendo el modelo Clovis
en entredicho cuando aparecen nuevos sitios arqueológicos anteriores a esta
cultura Clovis. Entre ellos el famoso yacimiento de Monte Verde, en el sur de
Chile. Estos hallazgos arqueológicos de Monte Verde, demuestran la presencia
humana hace 14.500 años, desempeñando un papel central en la crisis del
Consenso Clovis.
La comunidad científica tardó en aceptar de forma unánime esta datación,
que chocaba frontalmente con la teoría generalmente compartida sobre el
proceso de poblamiento americano. La datación de este nuevo yacimiento no
concordaba con la teoría Clovis, ya que presentarían la misma edad que la de la
supuesta entrada por el norte del continente. A parte de que este yacimiento ha
aportado restos que no parecen asociados a esta cultura. Su existencia implica
que los ancestrales Nativo Americanos llegaron al Nuevo Mundo anteriormente a
![Page 103: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/103.jpg)
Introducción
76
13.000 años, y por lo tanto comenzaron a asentarse en América antes de que
emergiera la tradición lítica Clovis en Norte América. A partir de las últimas
décadas del siglo XX la teoría del poblamiento tardío (antigüedad, lugar de
ingreso, rutas migratorias, etc.), comienza a entrar en crisis.
Más recientemente ha ido tomando fuerza la posibilidad de que los
pobladores de América provenientes de Beringia utilizaran una ruta alternativa
hacia el sur bordeando la costa (ver Figura 17). Debido al descenso del nivel del
océano esa posible ruta se encontraba al oeste de la actual costa norteamericana
y en el presente está cubierta por las aguas del Océano Pacífico, complicando los
estudios arqueológicos. Aunque estudios submarinos han encontrado alguna
herramienta de piedra con antigüedades de unos 10.000 años. Puede que los
primeros inmigrantes llegaran al continente Americano durante la última gran
glaciación atravesando Beringia, pero una vez allí se encontraron con miles de
kilómetros de glaciar, lo que hacía que fuera totalmente imposible poder penetrar
en el continente por la tierra; por lo que tuvieron que seguir una ruta por las costa.
Estamos hablando por lo tanto de fechas superiores a la formación del corredor
entre los dos glaciares; hace unos 16.800 – 14.850 años (Schurr 2004).
Simultáneamente se han producido otros hallazgos arqueológicos,
genéticos, lingüísticos y geológicos que han abierto múltiples teorías y complejas
combinaciones sobre el verdadero origen, momento de llegada y rutas seguidas
para el poblamiento de América.
I.5.2. Estudios genéticos
Estudios detallados de DNA mitocondrial (para seguir el linaje femenino) y
del cromosoma Y (para seguir el linaje masculino) han incrementado nuestro
entendimiento acerca de la historia y la genética de las poblaciones nativo
Americanas. Mediante estos estudios se pueden identificar los linajes maternos y
paternos presentes dentro de las poblaciones, caracterizar la extensión de la
diversidad dentro de ellos, y ver de que forma se han dispersado las diferentes
poblaciones.
![Page 104: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/104.jpg)
Introducción
77
En el momento en el que se produjo el primer contacto con europeos a
finales del siglo XV los Nativo Americanos presentaban diferentes culturas y
lenguas indígenas. Es probable que estas culturas y estas lenguas surgieran “in
situ” durante el crecimiento de la población y la adaptación a los diversos
ambientes. Es interesante comparar la enorme riqueza de sus culturas y de los
ambientes en los que viven con el bajo grado de diversidad genética que se ha
observado en estas poblaciones. Por eso el principal propósito de los estudios
recientes ha sido utilizar los datos genéticos para reconstruir los eventos
históricos que estas poblaciones han experimentado.
I.5.2.1. Primera entrada en América
Antes de saber cuando fue la primera entrada en América es necesario
que los investigadores aclaren cuantos eventos migracionales hubo. Los
resultados varían ampliamente, pero las fechas que son más consistentes con
los datos arqueológicos son aquellas que hablan de una entrada hace unos
15.000 años.
Greenberg propone una teoría en la que dice que se han producido tres
olas migratorias provenientes de Asia; basándose en datos lingüísticos,
dentales y genéticos (Greenberg et al. 1986). Esta teoría dominaría durante las
dos últimas décadas. De acuerdo con esta, la primera migración ocurrió hace
aproximadamente unos 11.000 años. Los descendientes modernos de esta
migración hablan lenguajes que pertenecen a la familia Amerindia, la cual está
ampliamente representada a través del norte y del sur de América. La segunda
migración ocurriría hace unos 9.000 años, y sus modernos descendientes
hablarían lenguas Na-Dene, concentrándose básicamente en Alaska y en el
noroeste de Canadá. La última migración fue la más reciente, hace sólo unos
4.000 años, y sus descendientes hoy en día hablan lenguas Eskimo-Aleut, que
viven en el ártico y están distribuidas desde Alaska hasta Groenlandia. En la
Figura 18 puede verse la distribución de estas poblaciones en el mapa del
continente americano. Pero los datos que más favorecen esta teoría son los
lingüísticos y aún así son bastante debatidos (Mulligan et al. 2004).
![Page 105: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/105.jpg)
Introducción
78
Esta teoría hizo que se llevaran a cabo una serie de estudios genéticos
basándose en aquellos linajes que se heredan sólo por vía materna o por vía
paterna. Lo que ha servido para intentar entender mejor los eventos
migratorios.
a) Estudios del DNA mitocondrial (mtDNA)
Los primeros estudios del DNA mitocondrial de nativo americanos
revelan que existen 4 grupos principales de haplogrupos (Wallace et al. 1985).
Se ve así como la mayoría de los haplotipos Nativo Americanos pertenecen a
los cuatro antiguos linajes mitocondriales A2, B2, C1 y D1; los sublinajes que
caracterizan estos haplogrupos se han visto en bajas frecuencias en Asia
(Schurr et al. 1990).
A comienzos de 1990 Antonio Torroni y sus colaboradores llevan a
cabo una serie de estudios de RFLPs (Restriction Fragment Length
Polymorphisms) en el mtDNA (Torroni et al. 1992), encontrando así las
posiciones diagnósticas de estos haplogrupos nativo americanos (Tabla 2).
Estos haplogrupos se encuentran ampliamente esparcidos por toda América
pero distribuidos de formas diferentes. Así se observa una disminución del
haplogrupo A de Norte a Sur, mientras que los haplogrupos C y D aumentan
en la misma dirección. El haplogrupo B no presenta una distribución clinal
como los anteriores, básicamente porque se encuentra ausente en el norte de
Estados Unidos y en una elevada proporción tanto en el sur de EEUU como
en la región andina (Figura 18) (Schurr 2004).
![Page 106: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/106.jpg)
Introducción
79
Figura 18: Distribución de los haplogrupos de DNA mitocondrial dentro de las poblaciones Nativo Americanas. Los 5 haplogrupos aparecen en diferentes colores, el cuadro blanco “OTH” (del inglés “others”, otros) indica aquellos haplogrupos que se hayan podido encontrar y que no pertenezcan a los 5 haplogrupos representados, los cuales provienen de África o de Europa. Imagen tomada de Schurr (2004).
Los 4 haplogrupos se encuentran presentes en toda América, pero
dentro de ellos pueden localizarse mutaciones genéticas diferentes según se
trate de indígenas de Sudamérica o Norteamérica. Esto sugeriría que una vez
ingresados a América, algunos grupos migraron rápidamente hacia
Sudamérica, mientras que otros poblaron Norteamérica y Centroamérica.
También se puede observar como en muchas tribus hay pérdidas de al menos
uno de los haplogrupos. Esto se puede ver por ejemplo en las poblaciones de
Centro América, en donde hay esencialmente haplogrupos A y B. Esto es
indicativo del papel que tienen el flujo génico y los efectos fundadores
provocando extinciones y fijaciones al azar de los diferentes haplogrupos en
las poblaciones Amerindias (Schurr 2004).
![Page 107: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/107.jpg)
Introducción
80
HAPLOGRUPO MITOCONDRIAL
POSICIONES DIAGNÓSTICAS
HG A2 +HaeIII:663
16290, 16319, 64, 146, 153, 235
HG B2 Deleción de una repetición de 9bp entre los genes
COII/tRNALys
16189, 16217, 16223
HG C1 +AluI:13262
16298, 16327, 249del, 290 – 291del
HG D1 -AluI:5176
16325, 16362
HG X2a −DdeI:1715, +HaeIII:16517
16189, 16213, 16278, 153, 195, 200
Tabla 2: Principales posiciones diagnósticas en la región control del mtDNA de los cinco haplogrupos fundadores de América. Entre las posiciones se pueden observar algunas deleciones “del” dentro del haplogrupo C1. Posiciones localizadas en Bravi et al. (2007).
No se ve una relación de los haplogrupos con las tres oleadas
propuestas por Greenberg. Por lo que algunos autores proponen que la mejor
forma de explicar esta distribución de los cuatro haplogrupos sería mediante
una única migración (Forster et al. 1996; Bonatto and Salzano 1997; Silva et
al. 2002; Mulligan et al. 2004), y así la variación genética que se ha visto se
podría explicar como diferenciación “in situ” o por movimientos poblacionales
ocurridos después de la colonización inicial, y no como consecuencia de
diferentes entradas. Los cuatro haplogrupos principales sufrieron un cuello de
botella, seguido de una gran expansión poblacional (Bonatto and Salzano
1997).
Aunque otras teorías hablan de una entrada de los haplogrupos A, C y
D provenientes de Siberia mientras que el haplogrupo B representaría una
segunda migración. Esta teoría se basa en el hecho de que el haplogrupo B
parece ser más joven que los otros linajes fundadores y se encuentra
ampliamente distribuido por el sureste de Asia, pero ausente en Siberia
![Page 108: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/108.jpg)
Introducción
81
(Torroni et al. 1992; Torroni et al. 1993a; Torroni et al. 1993b; Schurr 2004).
Por lo que los Amerindios habrían entrado antes que los Na-Dene; afianzando
por lo tanto la teoría Pre-Clovis.
Algunos autores no encuentran en los Na-Dene una migración a parte,
sino que estos permanecieron en Beringia aislados y se distribuyeron
constituyendo los Na-Dene y los Esquimos, reduciendo su diversidad (Bonatto
and Salzano 1997). En la Figura 19 pueden verse algunos de los posibles
modelos propuestos.
Torroni propone que la primera entrada fue hace aproximadamente
unos 20.000 – 35.000 años (Torroni et al. 1992; Torroni et al. 1993a). Aunque
esta edad puede estar sobreestimada ya que se basa en la suposición de que
hubo un solo haplotipo fundador, pero puede ser que dentro de un mismo
haplogrupo hubiera varios haplotipos fundadores, por lo que disminuiría esta
edad notablemente y la fecha de colonización del continente Americano sería
mucho más cercana a los que defienden una entrada tardía o el modelo de
que la primera población que entró fue la de la cultura Clovis (Mulligan et al.
2004; Schurr 2004).
Por otro lado, otros autores (Brown et al. 1998) estiman que la edad de
entrada del haplogrupo B es de 17.000 – 13.000 años, lo que supone que el
haplogrupo B llegó a América en una migración separada y más tardía que
aquella que portó los otros haplogrupos en una entrada temprana. Forsters y
colaboradores deducen que debió de ocurrir hace unos 20.000 – 25.000 años
trayendo consigo los ancestros de los hablantes de lenguas amerindias, y que
los que hablaban Eskimo y Na-Dene entraron hace 11.000 años mediante una
única y rápida expansión (Forster et al. 1996). Por lo que parece que el
haplogrupo B habría entrado en América al mismo tiempo que lo hicieron los
haplogrupos A, C y D. Otros defienden la teoría de que los cuatro haplogrupos
habrían entrado juntos durante la última gran glaciación y de ser alguno de
ellos más joven y haber entrado un poco más tarde, este sería el haplogrupo
A (Bravi et al. 2007).
![Page 109: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/109.jpg)
Introducción
82
El problema está en saber si ha habido un único haplotipo fundador
(Torroni et al. 1992; Torroni et al. 1993a; Brown et al. 1998; Bandelt et al.
2003) o si hubo varios haplotipos que entraran en América (Merriwether et al.
1996; Rickards et al. 1999). Es necesario un estudio a fondo donde mediante
SNPs de la región codificante y la secuenciación de la región control, se
pueda demostrar si los datos que existen pertenecen a un mismo haplotipo o
no (Schurr 2004; Schurr and Sherry 2004). Algunos de estos estudios han
comenzado a llevarse a cabo (Bravi et al. 2007) siendo cruciales para
determinar en que momento se produjo la entrada del hombre en este
continente.
Figura 19: Esquema de los posibles modelos de migración en el Nuevo Mundo (Schurr 2004). Los modelos son los siguientes: (1) Los haplogrupos A – D y X llegaron juntos en una única migración proveniente del centro de Siberia; (2) Los haplogrupos A – D entraron en una primera migración y el haplogrupo X representa una migración separada; (3) Hubo una migración inicial portando los haplogrupos A, C y D, mientras que los haplogrupos B y X representan una migración separada procedente de diferentes regiones de Siberia y del este de Asia; (4) Los haplogrupos C y D habrían entrado en una segunda expansión de grupos ancestrales.
Se encontró un quinto haplogrupo mitocondrial, el haplogrupo X (Brown et al. 1998) (ver Tabla 2). Sus frecuencias más elevadas las
encontramos en el noreste de EEUU, aunque se puede encontrar
esporádicamente por el resto del continente (ver Figura 18). Este haplogrupo
fue un poco controvertido, ya que se pensó que podía ser debido a un
contacto con Europeos (Torroni et al. 1993a), pero pronto se vio que el
![Page 110: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/110.jpg)
Introducción
83
haplogrupo X Nativo Americano portaba un sitio de restricción único que no
había sido observado en otros linajes (DdeI:1715) (Forster et al. 1996)
aceptándose ahora como uno de los haplogrupos fundadores. Pero esta
posición es indicativa del haplogrupo X2, el cual también se encuentra en
Asia, por lo que para estar seguros de estar hablando de un haplotipo
amerindio necesitaríamos observar otras posiciones diagnósticas en la región
control (ver Tabla 2), para poder localizar el haplogrupo X2a característico de
América. Además en Europa, a parte de que el haplogrupo es diferente, ver
Reidla et al. (2003), este encuentra también en un porcentaje muy bajo, lo que
resulta improbable que se haya producido esta amplia distribución sin que se
hayan detectado otros haplogrupos europeos más comunes, a parte del
haplogrupo H (Eshleman et al. 2003).
Este haplogrupo podría representar una migración a parte proveniente
de algún sitio de Eurasia (Figura 19). Se encuentra ausente en casi todas las
poblaciones indígenas de Siberia excepto en los grupos Altai (Torroni et al.
1993a; Eshleman et al. 2003; Schurr 2004). Tiene una edad estimada en
Eurasia de unos 35.000 – 20.000 años, siendo por lo tanto su edad en
América más reciente (30.000 – 13.000 años) (Brown et al. 1998).
b) Estudios del Cromosoma Y
Estudios complementarios de los mitocondriales son los del
cromosoma Y, el cuál se hereda sólo por vía paterna; dándonos una nueva
fuente de información genética acerca del poblamiento de América.
Se han identificado dos principales linajes fundadores, designados C y
Q (de acuerdo con la nomenclatura del cromosoma Y). Ambos están
presentes en las tres poblaciones lingüísticas y según algunos autores
(Mulligan et al. 2004) son consistentes con una única migración.
El haplogrupo C está presente en alrededor de un 5% de los Nativos
Amerindios mientras que el haplogrupo Q (representado por dos SNPs M3 y
M45) se encuentra en un 76% (Figura 20). De una forma parecida a lo que
![Page 111: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/111.jpg)
Introducción
84
ocurre con los haplogrupos mitocondriales; estos haplogrupos del cromosoma
Y son comunes en América pero muy poco comunes en cualquier otra región
del mundo a excepción del norte de Asia, donde tienen unas frecuencias de
28% y 18% respectivamente (Mulligan et al. 2004). Underhill y colaboradores
obtienen una edad para el haplogrupo Q-M3 de 13.800 años (Underhill et al.
2000). Favoreciendo una entrada tardía de este linaje en el Nuevo Mundo.
Más recientemente se identificó una variante del cromosoma Y, la
M242 (Figura 20), que según ciertos autores se desarrolló inmediatamente
antes de la entrada en América, esta presenta una antigüedad de unos
15.000 – 18.000 años (Seielstad et al. 2003). Esta variante ocurre dentro del
haplogrupo P-M45 en Asia Central, antes de que apareciera el SNP Q-M3.
Por esta misma razón, el marcador Q-M242 parece que marca la entrada
inicial del hombre en América de una forma más precisa que el marcador Q-
M3 (Schurr 2004).
Figura 20: Esquema modificado de Seielstad et al. (2003), donde se presentan de forma simplificada los diferentes SNPs de los que se hablan en el texto. Se muestran así el superhaplogrupo P y los haplogrupos Q y R, con sus diferentes SNPs característicos. El SNP M3 determina el haplogrupo Q, esta mutación se produjo una vez se encontraba en América; mientras que el M242 se produjo en Asia, justo antes de la entrada en América. El haplogrupo R, muestra entre los diferentes haplotipos, aquel que presenta el SNP M173, que según algunos autores también habría migrado hacia el continente americano.
Otros autores hablan de otro haplogrupo que habría entrado en una
segunda migración, el haplogrupo R (Figura 20), se basan para ello en el
estudio del SNP M173 (Lell et al. 2002). Hablando de cómo es compartido
entre poblaciones del este de Siberia y del norte y centro América. Estos
autores también hablan de que en esta segunda migración se habría
HG P HG Q HG R
![Page 112: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/112.jpg)
Introducción
85
producido la entrada del haplogrupo C del que se ha hecho referencia
anteriormente. Sin embargo este haplogrupo R-M173 es bastante
problemático ya que parece más probable que provenga de contactos con
Europeos.
I.5.2.2. Origen de la ó las primeras migraciones
Aunque hoy en día la teoría más aceptada es que el hombre llegó a
América procedente de Asia, a lo largo de estos años han surgido múltiples
teorías que intentaban explicar el poblamiento del Nuevo Mundo (Figura 21).
Figura 21: Diferentes rutas migratorias al continente americano que se han propuesto. Imagen tomada de Schurr (2004)
FUENTE ASIÁTICA
Gran cantidad de poblaciones asiáticas han sido propuestas como
probables fuentes de migración en el continente americano. Siberia es el
principal punto de partida de los estudios, ya que los primeros pobladores
tuvieron que pasar por ella antes de cruzar el puente de Bering. Sin embargo,
las poblaciones modernas de más al este no presentan el haplogrupo
mitocondrial B, lo que sugiere que estas son genéticamente diferentes de las
poblaciones ancestrales asiáticas.
![Page 113: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/113.jpg)
Introducción
86
Es posible que el haplogrupo B hubiera estado presente en el este de
Siberia antes de que el Nuevo Mundo fuera colonizado y que luego se hubiera
extinguido (Torroni et al. 1993b). Si este no fuera el caso, entonces el este de
Siberia no es el candidato de una única migración (Eshleman et al. 2003).
Los análisis confirman que las poblaciones Siberianas están
relacionadas con las migraciones amerindias, pero debido a que no hay
solapamiento de haplogrupos A, C y D, parece que toda la variación
amerindia ocurrió ya dentro de América (Torroni et al. 1993b).
En lo que se refiere al haplogrupo B y su ausencia en Siberia, se ha
explicado como dos posibles migraciones diferentes, la primera portando los
haplogrupos A, C y D y la segunda portando el haplogrupo mitocondrial B. La
ruta más probable de esta segunda migración pude haber sido a lo largo de la
costa (Figura 21). Por lo que el haplogrupo B no habría tenido contactos con el
este asiático donde se encuentra ausente (Torroni et al. 1993b).
Por otro lado, los cuatro mayores haplogrupos fundadores (A, B, C y D)
han sido identificados en poblaciones del centro y del este de Asia.
Recientemente la atención se ha puesto en las poblaciones que viven en el
macizo de Altai (Starikovskaya et al. 2005; Rohland and Hofreiter 2007),
cordillera de Asia central que ocupa territorios de Rusia, China, Mongolia y
Kazajstán, además de estos cuatro haplogrupos, el haplogrupo X ha sido
reportado en una modesta frecuencia del 3,5 % (Eshleman et al. 2003;
Mulligan et al. 2004).
Aunque otros autores sostienen que la evidencia genética sugiere que
América fue poblada mediante una sola población proveniente de Mongolia y
no de Siberia, basándose en que en Siberia no se encuentra el haplogrupo B,
mientras que en Mongolia se encuentran los cuatro haplogrupos
indioamericanos (Kolman et al. 1996; Merriwether et al. 1996). Se basan no
sólo en la ausencia de este haplogrupo B en Siberia, sino también en que en
Mongolia se encuentran presentes la mayoría de los haplotipos que estos
autores consideran fundadores de América.
![Page 114: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/114.jpg)
Introducción
87
¿AMÉRICA DEL SUR PRIMERO?
Uno de los elementos que ha llamado la atención de algunos
investigadores es la reiteración de sitios de gran antigüedad en Sudamérica y
la escasa cantidad de los mismos en Norteamérica. El dato es llamativo entre
otras cosas porque Estados Unidos y Canadá han dedicado grandes recursos
a investigar los sitios arqueológicos, a diferencia de lo que sucede en el sur.
Por lo que es poco probable que sitios más antiguos del norte hayan quedado
sin descubrir. Así si América fue poblada desde Siberia los sitios más antiguos
debieran hallarse en el norte.
Adicionalmente, algunos estudios han detectado diferencias genéticas y
fenotípicas de consideración entre los paleoindios sudamericanos y
norteamericanos. Los primeros con rasgos más australoides, mientras que los
segundos con rasgos más mongoloides. Estos elementos han causado una
creciente adhesión de algunos investigadores a la hipótesis de un
poblamiento autónomo de América del Sur, no proveniente de Norteamérica.
Esta hipótesis se relaciona estrechamente con la teoría del ingreso por la
Antártida desde Australia.
Cuando los europeos llegan al sur del continente se encuentran en
Tierra de Fuego con unos habitantes que se convierten en el centro de un
fuerte debate antropológico. Estos individuos que presentaban una
antigüedad de 10.000 – 11.000 años, con el aumento de la temperatura
después de la última gran glaciación, quedaron aislados al formarse el
Estrecho de Magallanes hace unos 8.000 años. Así permanecieron hasta la
llegada de los europeos lo que provocó un descenso enorme de la población.
Estos individuos presentaban una constitución física totalmente diferente al
resto de los habitantes del continente americano, recordando más a los
indígenas australianos que a los de los otros pobladores de América. Se
especuló si podía tratarse de una migración Australiana a través de la
Antártida. Aunque ciertos rasgos, como la cara amplia y plana o el cabello
negro y liso, demostraban que procedían de poblaciones asiáticas.
![Page 115: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/115.jpg)
Introducción
88
Creándose así un gran dilema acerca del origen de estas poblaciones y
dejando abierta la posibilidad de una colonización diferente de la asiática. Fue
necesario esperar a los estudios del DNA antiguo para poder resolver esta
incógnita.
También se ha sugerido una entrada desde la Polinesia a América del
Sur (Rickards et al. 1999) basándose en algunas características lingüísticas y
culturales comunes entre los polinesios y las poblaciones andinas, así como
muchos productos de agricultura que se cultivaban en América y que también
estaban presentes en la Polinesia. Pero no hay datos genéticos que soporten
esta idea.
FUENTE EUROPEA
Ciertos autores defienden que el origen de la tecnología Clovis es
debida a una migración Europea (Stanford and Bradley 2000). Se basan en el
hecho de que existe muy poca relación entre la tecnología usada en la cultura
Clovis con las tecnología que existía en el Norte de Asia, y además se vio
mucha relación con la cultura Solutrense del Paleolítico Europeo. De acuerdo
con esto, esta cultura salió del Oeste de Europa durante la última gran
glaciación y cruzó el Océano Atlántico a lo largo de las placas de hielo
existentes alcanzando Norte América. Esto explicaría la falta de precursores
de la cultura Clovis en Siberia.
Aunque rápidamente esta teoría se descartó, viendo como estas
culturas presentaban una separación temporal de unos 5.000 años y que
además se tuvieron que recorrer 4.000 millas para poder llegar hasta el nuevo
continente.
![Page 116: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/116.jpg)
Introducción
89
I.5.2.3. Estudios de DNA antiguo
El estudio de muestras antiguas permite a los investigadores hacer un
estudio del registro genético recolectando datos de diferentes períodos. Las
técnicas de DNA antiguo, asociadas a los avances biotecnológicos de las dos
últimas décadas, han permitido recuperar material genético de restos del pasado.
Las dificultades metodológicas y el riesgo de contaminación por DNA exógeno ha
conllevado que muchos de los estudios de DNA antiguo se hayan basado en
poblaciones humanas de continentes diferentes al lugar de origen de los
investigadores implicados en el análisis. El hecho de obtener secuencias
amerindias en un laboratorio donde no se ha analizado material genético del
continente americano refuerza la autenticidad de estas secuencias. En este
sentido, el hecho de que los nativos americanos presenten cinco linajes
mitocondriales distinguibles de los europeos contribuye a autentificar los
resultados de DNA antiguo (Lalueza-Fox et al. 2001).
La recuperación de material genético de restos precolombinos de
yacimientos americanos es fundamental para poder reconstruir el poblamiento de
este continente. Pero este tipo de estudios muestran una gran problemática en
parte debido al bajo número de muestras que se analizan; pero los restos
antiguos son la única forma directa de detectar los cambios genéticos de las
poblaciones.
Mediante estos estudios se ha visto que el contacto con los europeos no
ha afectado de una forma muy significativa al DNA mitocondrial en América
(Stone and Stoneking 1998). Y que los haplogrupos A, B, C y D han sido
encontrados en muestras prehistóricas tanto del norte con del sur de América
(Parr et al. 1996; Santos et al. 1996; Lalueza-Fox et al. 1997; Stone and
Stoneking 1998; Carlyle et al. 2000; Kaestle and Smith 2001). Se ha mostrado la
presencia del haplogrupo X en dos muestras de 4.000 y 1.000 años de
antigüedad de América del Sur (Santos et al. 1996). Pero en este trabajo sólo se
han encontrado las posiciones 16223 y 16278, las cuales pueden asociarse con
otros haplogrupos, por lo que estos resultados deben de tomarse con cuidado. No
se han encontrado haplogrupos nuevos que puedan representar linajes
![Page 117: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/117.jpg)
Introducción
90
fundadores extintos, pero aunque estos se encontraran es difícil demostrar si
estos son auténticos o si se trata de una contaminación.
Algunos ejemplos de estos estudios muestran cómo se ha producido el
poblamiento del Caribe (Lalueza-Fox et al. 2001) viendo una baja diversidad
genética respecto a la mayoría de las poblaciones amerindias (sólo haplogrupos
C y D, que son mayoritarios en el Sur de América), lo cual puede ser evidencia de
un efecto fundador en el origen de las poblaciones caribeñas.
Stone y Stoneking recogieron secuencias de 108 individuos de un
cementerio de Illinois (Medio Oeste de EEUU) de 1.300 años de antigüedad.
Mostrando una clara presencia de los cuatro haplogrupos fundadores A, B, C y D.
La presencia del haplogrupo X es probable, ya que se han encontrado no solo las
posiciones 16223 y la 16278 sino también la 16093, 16189, 16227 y la 16357
(Stone and Stoneking 1993; Stone and Stoneking 1998), demostrando la
presencia del haplogrupo X en América antes de la llegada de los Europeos.
La mejor forma de solucionar dilemas como el origen de los habitantes de
Tierra de Fuego es mediante un estudio genético, pero los pocos individuos que
quedaban debido a la entrada de los europeos hicieron que la mejor alternativa
para resolver este misterio fuera mediante el DNA antiguo. Así Carles Lalueza-
Fox analiza sesenta muestras de fueguinos a partir de restos óseos de diversas
colecciones de museos; encontrando los haplogrupos mitocondriales C (39%) y D
(61%) (Lalueza-Fox 1996; Lalueza-Fox et al. 1997). Esto ayudó a resolver esta
cuestión; así aunque estos individuos presenten algunas características
morfológicas particulares, los fueguinos eran genéticamente amerindios,
emparentados con todos los otros indígenas del continente americano.
Descartando, por lo tanto, que se encontraran emparentados con los australianos.
Por lo que estas características físicas especiales que presentaban se han
explicado como adaptaciones a zonas tan inhóspitas como las que se encuentran
cerca de la antártida, dando lugar a individuos más robustos.
![Page 118: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/118.jpg)
Introducción
91
Otros trabajos han encontrado haplotipos fundadores nuevos (Kemp et al.
2007) por lo que sugiere que el número de estos se haya subestimado lo que nos
llevaría a una edad de entrada en el Nuevo Mundo más reciente.
I.5.3. Conclusión
América fue el último continente en ser colonizado por los humanos
modernos. Tanto estudios del DNA mitocondrial como del cromosoma Y proponen
una entrada del hombre al continente Americano en un intervalo de hace unos
20.000 – 15.000 años. Esta primera migración provendría del centro-sur de
Siberia, dispersándose por todo el continente americano. Esto sería anterior a
que emergiera la cultura Clovis en Norte América (hace unos 13.000 años). Estas
fechas caen en la mitad de la última gran glaciación, antes por lo tanto de que se
produjera el Corredor de Mackenzie entre las grandes capas glaciares que
cubrían el continente. Por lo que la colonización debe de haberse producido por
una ruta costera para alcanzar Sudamérica, encajando perfectamente el
yacimiento de Monte Verde al sur de Chile que presenta una antigüedad de unos
14.000 años (Schurr 2004; Schurr and Sherry 2004). Estos primeros inmigrantes
aparentemente portaron con ellos los haplogrupos mitocondriales A – D (quizás
también el X) y el HG Q del cromosoma Y (Haplotipo M45, M242 y M3).
Una siguiente expansión puede haber traído el HG X mitocondrial (e igual
algún otro haplotipo A – D) y contribuir con los haplogrupos C y R del cromosoma
Y. Pero sobre todo estos últimos haplogrupos del Y han sido bastante discutidos.
Esta segunda migración se habría diseminado sólo por América Central y
América del Norte, pudiendo haber coincidido con la formación del corredor libre
de hielo entre los dos grandes glaciares, hace unos 12.550 años (Schurr 2004).
Finalmente, las poblaciones que se habían asentado en Beringia podrían
haberse expandido por el norte de Norte América, después de la última gran
glaciación dando lugar a los Eskimo-Aleut y a los Na-Dene. Se basan en que
estas poblaciones parece que han experimentado una historia diferente, ya que
presentan diferentes perfiles de haplogrupos con respecto a los amerindios.
![Page 119: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/119.jpg)
Introducción
92
Presentan un gran número de haplogrupos A y D, mientras que el C se encuentra
en bajas frecuencias y el B y X están ausentes (Schurr and Sherry 2004).
En conclusión, las diversas teorías con base tanto en restos humanos
como en datos genéticos y moleculares no apoyan el origen reciente (menos de
12.500 años) del poblamiento americano, si bien las distintas posiciones postulan
desde 14.000 hasta más de 20.000 años. Pero todo esto son generalizaciones ya
que no hay nada claro acerca de este tema y múltiples investigadores continúan
centrándose en este continente para poder resolver este dilema.
![Page 120: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/120.jpg)
II. Material y Métodos
![Page 121: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/121.jpg)
![Page 122: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/122.jpg)
Material y Métodos
95
II.1. MATERIAL UTILIZADO PARA ESTE TRABAJO
En esta tesis se presentan diferentes muestras con las que se ha
trabajado, se encuentran divididas en función de los trabajos independientes que
se realizaron:
• Dientes de la Edad de Bronce de la Sierra de Atapuerca (Burgos, España)
o Universidad de Santiago de Compostela, Instituto de
Medicina Legal.
o Replicación: Universidad Pompeu Fabra de Barcelona
• Huesos, Dientes y pelo de Momias Precolombinas (Andes, Perú)
o Universidad de Oxford, Ancient Biomolecules Center (Oxford,
Inglaterra)
o Replicación: Universidad Pompeu Fabra de Barcelona
• Coprolitos de los primeros pobladores americanos (Oregon, EEUU), así
como pelos modernos de las personas implicadas en la excavación
o Universidad de Copenhague, Niels Bohr Institute (Dinamarca)
o Replicación: Max Plank Institute; Departamento de Genética
de la Evolución (Leipzig, Alemania)
o Replicación: Universidad de Uppsala, Biología evolutiva
(Suecia)
II.2. EXTRACCIÓN DE DNA
Este capítulo describe los métodos utilizados para obtener DNA de una
gran variedad de tejido; huesos, dientes, pelos y coprolitos. Las técnicas usadas
son diferentes en función de los diferentes tejidos. Aquel tejido que de una mayor
cantidad y calidad de DNA será discutida más adelante, pero siempre dentro de
un mismo grupo de muestras, ya que no es posible extrapolar los datos a todas
las muestras debido a que cada grupo presenta una edad y unas condiciones de
preservación totalmente diferentes.
![Page 123: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/123.jpg)
Material y Métodos
96
La extracción y las primeras PCRs fueron llevadas a cabo en laboratorios
independientes del laboratorio principal. En Oxford y en Copenhague incluso
estaban en edificios independientes separados a unos 15 minutos andando.
Varios tipos de precauciones se tuvieron en cuenta para prevenir la
contaminación de las muestras con DNA exógeno. Como es el uso de máscaras,
trajes especiales, guantes. Las superficies de trabajo se limpiaron regularmente
con lejía y el laboratorio estuvo todos los días irradiado con luz U.V. durante un
par de horas. Además el laboratorio cuenta con aire de presión positiva para
evitar el flujo de material atmosférico, otra de las posibles fuentes de
contaminación.
II.2.1. Limpieza y procesado de las muestras
Todas las muestras excepto las de heces fueron decontaminadas
previamente a la extracción. Que se basa en retirar de la superficie de las
muestras cualquier contaminante que pudiera haber, utilizando para ello lejía,
etanol y la irradiación con luz U.V.
II.2.1.1. Hueso
Los huesos fueron usados directamente al tratarse de fragmentos muy
pequeños. Se usó lejía y etanol y luego se pulverizaron usando un Braun
Mikrodismembrator U (B. Braun Biotech International, Germany). Las muestras se
introducen en una cápsula estéril en cuyo interior se encuentra una bola de acero
inoxidable que permite la pulverización de la muestra.
II.2.1.2. Diente
Dado que los dientes de Atapuerca eran material de museo, era imposible
utilizar el diente al completo, por lo que fue necesaria la ayuda de un dentista
para poder hacer un fino corte transversal en el diente y luego recuperar restos de
dentina de su interior, para poder luego volver a pegarlos y devolverlos así al
museo. Aproximadamente 10 mg de polvo de diente fueron usados para la
extracción.
![Page 124: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/124.jpg)
Material y Métodos
97
En Oxford los dientes tampoco se utilizaron en su totalidad, sino que se
siguió el método de (Gilbert et al. 2003b) cuya finalidad es obtener muestra lo
menos contaminada posible por eso se intenta conseguir polvo de diente de su
interior, dejando el esmalte sin tocar. Este método consta de las siguientes partes
(Figura 22):
a. Se usó silicona que al contacto con el agua se endurece. Se forma como
una especie de masa y se mete en un molde cuadrado. Allí metemos el
diente con la raíz hacia arriba y se entierra completamente. Se deja allí
toda la noche hasta que la silicona esté totalmente solidificada.
b. Se corta la silicona con un bisturí exponiendo la raíz al aire.
c. Se realiza un corte horizontal retirando la parte de raíz que se encuentra
descubierta; con discos totalmente estériles.
d. Se introduce un torno de dentista por la raíz y nos quedamos así con el
polvillo que obtenemos de la dentina y de la cavidad pulpar; que se espera
que esté totalmente estéril.
Figura 22: Esquema de la obtención de polvo de diente. Esquema sacado de (Gilbert et al. 2003b)
II.2.1.3. Pelo
En Oxford el pelo fue lavado con agua destilada y con SDS al 10% y luego
se cortó en pequeños trozos y se hirvió en agua durante 5 minutos para disolverlo
bien.
En Copenhague los pelos de las personas que trabajaron en la excavación
fueron lavados en lejía 1:20 antes de llevar a cabo la extracción. Se usó unos 5
cm de pelo para cada extracción.
![Page 125: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/125.jpg)
Material y Métodos
98
II.2.1.4. Coprolitos
Para este tipo de muestras no se usó ninguno de los métodos anteriores,
así como tampoco se radiaron con U.V. Pero se intentó coger muestra del interior
del coprolito, separando todo el exterior que podría estar contaminado.
II.2.2. Extracción
A continuación se describen los métodos de extracción que se utilizaron
para todas las muestras estudiadas:
Tanto las muestras de Atapuerca como las momias precolombinas
fueron extraídas usando el protocolo de fenol-cloroformo utilizado en previos
trabajos de DNA antiguo (Barnes et al. 2002) el cual está diseñado para recoger
todo el DNA presente en la muestra. Primero sufrieron una descalcificación con
10 ml de 0,5M EDTA pH 8.0 toda la noche a temperatura ambiente, después de
centrifugación se descartó el sobrenadante y la muestra se incubó a 50ºC 24
horas en 5 ml de buffer de extracción que contenía: Tris-HCl (10mM pH8.0), NaCl
(10mM), proteinasa K (2% w/v), Ditiotreitol (DTT, 8% w/v), dodecil sulfato sódico
(SDS, 5% w/v), y N-phenacylthiazone bromuro (PTB, 10mM); este último sólo
para las momias. En este buffer de digestión, el DTT destruye la estructura
cuaternaria de las proteínas. La Proteinasa K es una proteasa que rompe la
estructura terciaria de la cadena aminoacídica. El SDS es un detergente que
actúa desnaturalizando proteínas y solubilizando las membranas biológicas. El
PTB actúa rompiendo los crosslinks entre proteínas y la glucosa (Vasan et al.
1996) y ha sido empíricamente demostrado que aumenta el éxito de las PCRs en
muestras antiguas, aunque el mecanismo que utiliza aún no está del todo claro.
Después de 24 horas incubándose el sobrenadante se decantó e un tubo de 15
ml donde se extrajo 3 veces; las primeras dos con fenol (5 ml) y una tercera con
cloroformo (5 ml). Con centrifugaciones intercaladas de 10 minutos a 6000 rpm. El
fenol crea una fase hidrofóbica que contiene proteínas y péptidos mientras que el
DNA permanece en la fase acuosa que es con la que nos quedamos. Después de
la centrifugación con cloroformo obtenemos una última fase acuosa que fue
transferida a un Amicon Ultra-30 centrifugal filter (Millipore). Después de pasar la
![Page 126: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/126.jpg)
Material y Métodos
99
fase acuosa a través del filtro (30Kda) la membrana fue lavada con agua
destilada (5 ml) y así la muestra purificada se concentró a un volumen final de 150
µl. Las muestras de DNA fueron almacenadas a -20ºC hasta que fueron utilizadas
para las amplificaciones, pero por lo menos se dejaron reposar 24 horas.
La extracción de pelos modernos, que se llevó a cabo para las personas
implicadas en la excavación de las muestras procesadas en Copenhague se llevó
a cabo de la siguiente manera:
1. Se añadieron los pelos a un eppenorf de 1,5 ml, al que se le añadió 200 µl
de buffer de lisis y 20 µl de Proteinasa K.
Buffer de lisis 25 mM Tris
25 mM NaCl
1% SDS
5 mM CaCl2
Un poco de DTT
2. Se puso en el agitador durante 1 hora a 55ºC para que se deshiciera bien
el pelo.
A continuación usamos la columnas de QIAquick (QIAgen Ltd.) con el
protocolo de purificación de PCR. En el apartado de purificación se explica en
que se basa este kit.
3. Añadimos 5 volúmenes de buffer PB (1000 µl) con la muestra en la
columna. Como no nos cabe todo, lo hacemos en dos pasos de 650 µl.
4. Centrifugamos 1 minuto a 6000 rpm
5. Añadimos 750 µl de buffer PE
6. Centrifugamos 1 minuto a 6000 rpm
7. Centrifugamos 1 minuto a 13000 rpm
8. Colocamos la columna en un eppendorf limpio y añadimos 50 µl de buffer
EB
9. Centrifugamos 1 minuto a 13000 rpm
Ya tenemos el DNA extraído para ser utilizado.
![Page 127: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/127.jpg)
Material y Métodos
100
La extracción de los restos de coprolitos se llevó a cabo siguiendo el
protocolo de (Willerslev et al. 2003) que se basa en los siguientes pasos:
1. Añadir 0,1 g de heces en cada tubo FAST PREB en la campana de
extracción. Estos tubos presentan una bolitas que ayudan a deshacer la
muestra.
Hacemos cada muestra por duplicado para luego juntarlas y obtener más
DNA
2. Suspender el pellet en 600 µl de solución enzimática
12,5 ml solución enzimática 2,5 ml of 10% Sarcosil
0,625 ml 1M Tris pH 7.8
0,5 ml 0.5M NaCl
Añadir agua hasta 11,925 ml
Justo antes de usar:
0,43 ml de 50mM Beta – mercaptoetanol
10 mg de Proteinasa K (640 µl de un stock a 14-22 mg/ml)
0,625 ml 1M DTT
0,25 ml PTB (100mM)
El Sarcosil (N-Laurosyl Sarcosine Sodium salt) es un detergente, como el
SDS. Y el mercaptoetanol rompe la estructura terciaria de las proteínas.
3. Agitar las muestras en el agitador (4 sesiones x 45 minutos) y poner los
tubos en hielo durante 1-2 minutos entre cada sesión. Hay que ponerlos en
frío porque la muestra se calienta y así evitamos que el DNA se rompa.
4. Dejar las muestras con la solución enzimática agitando a 55ºC toda la
noche.
5. Darles un spin
6. Añadir 150 µl de NaCl a la solución enzimática
7. Añadir 375 µl de Cloroformo/Octanol (24:1)
8. Rotar los tubos a temperatura ambiente entre 30 minutos y 12 horas
Filtrar con 30.000 MWCO
![Page 128: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/128.jpg)
Material y Métodos
101
9. Centrifugar la solución a 12.000g durante 2 minutos
10. Recoger la fase acusosa y pasarla a un tubo Eppendorf de 1,5 ml e
incubar a 2 – 3ºC durante al menos 1 hora, permitiendo a los sedimentos
asentarse.
11. Centrifugar la solución a 12.000g durante 2 minutos y mover el
sobrenadante a un tubo de 15 ml.
12. Añadir 5 ml de buffer de Quiagen PB y agitamos
13. Pasar la muestra por una columna spin QIAquick y centrifugar 1 minuto a
10.000g. Descartar el filtrado.
14. Añadir 500 µl del Salton Wash buffer 1 (SW1) y centrifugar 1 minuto a
10.000g
15. Añadir 500 µl del Salton Wash buffer 2 (SW2) y repetir centrifugación.
Repetir los pasos 14 y 15 para eliminar los ácidos húmicos.
16. Añadir 500 µl del buffer AW1 y centrifugar 3 minutos a 15.000g. Descartar
el filtrado y volverlo a centrifugar para retirar cualquier residuo de etanol
que inhibiría la PCR.
17. Colocar la columna en un eppendorf limpio, y para eluir el DNA añadir 50
µl de buffer EB en el centro de la membrana y dejarlo a temperatura
ambiente durante 10 minutos. Luego centrifugar la columna durante 1
minuto a 10.000 g y el extracto ya está listo para su uso.
Repetir este paso. Así obtendremos un volumen final de 50 µl.
II.3. CUANTIFICACIÓN
La cuantificación de las muestras antiguas es una técnica fácil de realizar y
que nos puede dar una gran información antes de llevar a cabo ningún otro
experimento. Dándonos una idea de que es lo que podemos esperar de las
muestras con las que estamos trabajando. Los errores que se pueden producir
con un bajo número de copias son mucho mayores que si estamos trabajando
con grandes concentraciones.
En los trabajos que presento en esta tesis utilizo dos métodos de
cuantificación, que en los resultados será discutidos acerca de cuál considero que
![Page 129: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/129.jpg)
Material y Métodos
102
es el más idóneo. Ambos se basan en la técnica de PCR en tiempo real, que se
basa en la cuantificación del número de moléculas que vamos obteniendo en
cada ciclo de PCR. Así se puede hacer una estima del número de moléculas
iniciales.
II.3.1. TaqMan
Con este tipo de estudios no sólo se puede ver la concentración de
nuestras muestras sino también cómo se encuentran de degradadas, ya que
se analizan dos fragmentos de diferentes tamaños (107 y 278 bp) dentro de la
región HVI. Esta información adicional es muy útil ya que el aDNA
normalmente se encuentra bastante fragmentado, por lo que la eficiencia de la
amplificación debe de ser inversamente proporcional a la longitud de la
amplificación (Pääbo et al. 2004).
Esta metodología se basa en el uso de una sonda que posee un quencher
y un fluoróforo; en esta situación la fluorescencia del fluoróforo es absorbida
por el quencher y no permite se emisión (Figura 23). La sonda se une a una
pequeña región localizada entre los primers y es degradada por la actividad
exonucleásica de la Taq, liberando el fluoróforo de la sonda, lo que permite que
emita fluorescencia. La medida de esta fluorescencia es recogida por el
instrumento y permite la cuantificación de la muestra.
Este experimento fue llevado a cabo en la Universidad Pompeu Fabra de
Barcelona y en primer lugar fue necesario un estándar de mtDNA, que se
obtuvo de la amplificación con los primers L15997 y H017, correspondiente a
un amplicon de 628 bp. Se usó el espectrofotómetro ND1000 - Nanodrop
(NanoDrop Technologies) para su cuantificación. Como este nos da la
concentración en ng/µl y a nosotros nos interesaba saber del número de
moléculas de las cuales partíamos, se hizo una conversión usando el número
de Avogadro (NA) y el peso del fragmento utilizado. Una vez que sabíamos el
número de moléculas de las cuales partíamos en el estándar, se llevaron a
cabo 10 diluciones seriadas para calcular la curva de calibrado. El diseño de
los primers y de las sondas fue llevado a cabo usando Primer Express 2.0
![Page 130: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/130.jpg)
Material y Métodos
103
software (Applied Biosystems). Las secuencias de los primers del fragmento
pequeño son L16001 ACCATTAGCACCCAAAG CTAAGA y H16065
GCGGTTGTTGATGGGTGAGT, y para el fragmento grande L16088
TCACCCATCAACAACCGCTAT y H16344 GGGACGAGA AGGGATTGACT.
La sonda usada para el fragmento pequeño fue FAM-CAAGCAAGTACAGCAA-
MGB y para el grande fue VIC-GAAGCAGATTTGGGTAC-MGB (Alonso et al.
2004).
Figura 23: Esquema del funcionamiento de las sondas TaqMan para medir la cuantificación mediante PCR en tiempo real.
![Page 131: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/131.jpg)
Material y Métodos
104
La amplificación fue llevada a cabo en 20µl de reacción con 1x Master Mix
Taqman Universal PCR (Applied Biosystems), 0,5µM de cada primer, 50nM de
cada sonda, 1mg/ml BSA y 1µl del extracto de DNA. Para hacer la recta de
calibrado se usaron las 10 diluciones seriadas del estándar en vez del extracto
de DNA.
El parámetro Ct (Cycle threshold parameter, Parámetro del ciclo umbral),
fue determinado mediante el software SDS como el ciclo en el cual la
fluorescencia aumenta exponencialmente. El número de moléculas para cada
fragmento se calcula mediante la curva estándar.
II.3.2. SYBR® Green I Dye
Otro de los métodos usados en PCRs de tiempo real es el SYBR® Green I
Dye, que se trata de un marcador fluorescente que se une a la doble cadena
del DNA emitiendo luz cuando el fluoróforo es excitado.
Este método no es tan específico como el anterior, necesita que sólo haya
una banda en la PCR y que el primer-dimer sea reducido al máximo, pero este
resulta mucho mas económico y más rápido que el anterior. Para llevar a cabo
este experimento, en primer lugar fue necesario optimizar la PCR.
Como Template se usó DNA medido con el espectrofotómetro y con una
concentración de 10 ng/µl. Los primers se usaron a una concentración de 5µM
y fueron los siguentes; 16280F (5’-aacaaacctacccacccttaac-3’) y 16340R (5’-
tgtgctatgtacggtaaatggc-3’). El mix de SYBR Green está compuesto por SYBR
Green I Dye, Ampli-Taq Gold DNA polimerasa y dNTPs con dUTP. Por lo que
se llevaron a cabo una serie de reacciones con diferentes concentraciones de
primers, con y sin BSA para comparar los resultados y decidirnos por cuál es la
mejor concentración de primer que nos minimize los productos inespecíficos.
Para ello se usaron en un volumen final de 50µl, 25µl de Master Mix, 5µl de
DNA, y diferentes cantidades de primer con un volumen final de 50nM, 300nM
y 900nM. Todas las muestras se corrieron por triplicado, con/sin BSA (2µl de
![Page 132: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/132.jpg)
Material y Métodos
105
10mg/ml). El programa de amplificación consistió en 10 minutos a 95ºC para
activar la Taq Gold y luego 40 ciclos de 15 segundos a 95º y 1 minuto a 60º.
Para analizar los resultados se corrieron las muestras en un gel de agarosa
para confirmar que no existían productos inespecíficos y también se generó
una curva de disociación en el ABI7000SDS (Applied Biosystems).
Se calculó la óptima concentración del primer que de el número más bajo
de Ct sin que exista amplificación inespecífica. Se llegó a la conclusión de que
el experimento funciona mejor con BSA y con una concentración un poco
elevada de primers. Así para futuros experimentos se usó BSA y una
concentración final del primer de 300 nM. Para el cálculo de la recta patrón se
usó un fragmento de DNA de 61bp (5’-aacaaacctacccacccttaacagtacatagtaca
taaagccatttaccgtacatagcaca- 3’) que se corrió 3 veces con diluciones desde 106
a 50 copias. Para cuantificar la posible inhibición de las muestras se cargaron
diluciones 1:2, 1:4 y 1:8, cuando dieron malos resultados se repitió el
experimento también con el original y con la dilución 1:16.
Dada la importancia que presenta la desaminación de la citosina en
muestras antiguas, todas las muestras se volvieron a cuantificar usando el
enzima UNG (explicado más adelante) para poder calcular la cantidad de
moléculas sin daño de las que partimos. En un volumen final de 25µl se usaron
12,5µl de master mix, 2,5µl de 3µM de cada primer, 2µl de BSA (10mg/ml), y
0,25µl de enzima UNG (sólo en ciertos experimentos). El programa usado para
la amplificación es igual que el citado anteriormente, con la excepción de
cuando se usa UNG que en este caso aumentamos un ciclo de 48ºC 30
minutos al inicio.
II.4. AMPLIFICACIONES
Este es uno de los apartados más difíciles de resumir al tratarse de
diferentes condiciones según los primers utilizados y según los laboratorios en los
que se llevó a cabo el trabajo.
![Page 133: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/133.jpg)
Material y Métodos
106
Todas las primeras PCRs se realizaron con un número de ciclos alto (entre
40 y 50), con una temperatura de anneling muy baja (sobre 50ºC) y con unas
condiciones poco restrictivas, es decir, altas concentraciones de magnesio, de
primers, uso de BSA… Todo ello para forzar la PCR al máximo e intentar que se
amplifique el poco DNA que pueda haber. Por eso mismo es normal que estas
PCRs generen muchas bandas inespecíficas, por lo que será necesario correr las
muestras en un gel de agarosa y cortar la banda que tenga la longitud correcta.
Explicaré el protocolo seguido en Oxford, ya que los utilizados en los otros
laboratorios sólo sufrieron ligeras modificaciones de este. Para más detalles
consultar cada uno de los trabajos.
La amplificación se llevó a cabo en una reacción final de 25 µl que contenía
entre 1 – 5 µl de muestra, 1,25 U Hi-Fi Polimerasa (Invitrogen), 1x Buffer, 1,2
mg/mL BSA, 2 mM MgCl2, 0,25 mM dNTPs y 1 µM de cada primer. Aunque no se
usó la Hi-Fi polimerasa para todos los estudios realizados, se recomienda en los
estudios de DNA antiguo ya que aumenta la fidelidad de las amplificación en este
tipo de estudios en los que el DNA suele estar bastante degradado y también por
la tendencia de que se produzcan incorporaciones erróneas durante la PCR
(Gilbert et al. 2003b; Pääbo et al. 2004). Esta enzima contiene un mix de otras
dos Taq polymerase (Thermus aquaticus) y Pyrococcus GB-D polymerasa (la cual
tiene actividad exonucleasa 5’ 3’). El mix también contiene una Taq
termoestable que previene a la polimerasa actuar hasta que sea activada por la
temperatura de desnaturalización de la PCR. La BSA actúa como un quelante
inespecífico de los posibles inhibidores en el mix de reacción, los cuales muy a
menudo se extraen junto con el DNA. El programa de amplificación que se usó se
basa en 40 ciclos de 94ºC durante 45 segundos, 58ºC durante 45 segundos y
68ºC durante 1 minuto y medio. Con una desnaturalización inicial de un minuto y
medio a 94ºC. Todos los primers utilizados para estos trabajos se representan en
la Tabla 3. En todas las PCRs se usaron negativos de amplificación (normalmente
1 cada 5 muestras) los cuales incorporaban agua destilada en vez de muestra.
Todas estas primeras PCRs se llevaron a cabo en un laboratorio pre-PCR
separado del laboratorio principal para evitar la posible contaminación con
amplicones de otras amplificaciones.
![Page 134: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/134.jpg)
Material y Métodos
107
Primer L Secuencia (5’ 3’) Primer H Secuencia (5’ 3’)
HVSI
L15997 caccattagcacccaaagct H16142 ttgtacggtaccataaatac
L16055 gaagcagatttgggtaccac H16157 actacaggtggtcaagtatttatggt
L16121 tactgccagccaccatgaat H16218 tacaagcaagtacagcaatc
L16131 caccatgaatattgtacggt H16236 ggctttggagttgcagttgatg
L16159 tacttgaccacctgtagtac H16260 ttggtatcctagtgggtgagg
L16185 acccaatccacatcaaaacc H16261 ctgcaactccaaagccaccc
L16209 cccatgcttacaagcaagta H16281 ttggtatcctagtgggtgagg
L16247 ctatcacacatcaactgcaa H16306 tgtacggtaaatggctttatgtactatg
L16254 cacatcaactgcaactccaaa H16313 ctatgtacggtaaatggctttatg
L16275 cacccctcacccactagga H16380 gtcaagggacccctatctgag
L16296 cccacccttaacagtacatagtacataa H16382 tggtcaagggacccctatct
H16401 tgatttcacggaggatggtg
H16410 gtcccttgaccaccatcctc
HVSII
L034 gagctctccatgcatttggt H255 tctgtgtggaaagtggctgt
L127 gagcaccctatgtcgcagta H405 ttttggcggtatgcactttt Tabla 3: Primers usados para la amplificación de la región control del mitocondrial.
En algunos casos se llevó a cabo una segunda PCR a partir de esa
primera banda que se cortó del gel. Estas sólo se realizaron para aquellas bandas
que aparecían muy tenues en el gel. Para ello ya se usaron las mismas
condiciones que se especifican más adelante al realizar las PCRs de los clones.
Con las muestras procesadas en Copenhague se llevaron a cabo también
amplificaciones para ver si las muestras pertenecían a algún tipo de animal o
podían presentar alguna contaminación de estos. Para ello se usaron los primer
especificados en la Tabla 4.
![Page 135: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/135.jpg)
Material y Métodos
108
ANIMAL Primer F Secuencia (5’ 3’) Primer R Secuencia (5’ 3’)
Puma ND5-6F cagtcatctcaaactgacactg ND5-7R gagcactctatgattgatcatg
Perro IWL 22F tgaatcacccctactgtgctat IWL220R gtttctcgaggcatggtgat
IWL 150F ggtttgccccatgcatataa IWL 206R aagcccttattggactaggtga
Oso L16030 ctattccctggtacatac H16091 gggggtattcgaggacatac
Oso, Nutria, Jabalí Upse-L16164 gccccatgcatataagcatg Uspe-H16299 ggagcgagaagaggtacacgt
Foca, león, gato, hamster ATP8_1F gccacagttagatacatc ATP8_3R gaggtgaatagattttcgttc
Bisonte BisCR-16633F gccccatgcatataagcaag BisCR-16810R gcctagcgggttgctggtttcacgc
Neotoma Lepida
(woodrat) Lepidus_F ccttacaggcctattcctagcc Lepidus_R atctcggcaaatgtgggtta
Tabla 4: Primers usados para la búsqueda de algún tipo de animal entre las muestras de heces de Oregón.
Para visualizar las muestras y cortar la banda correcta se llevó a cabo una
electroforesis en gel de agarosa (2%, Sigma-Aldrich, UK) con bromuro de etidio el
cual al aplicar luz ultravioleta de onda corta (BioRad Gel Doc 2000) permite la
visualización de las bandas. Como marcador de tamaños se usaron φX174
DNA/HaeIII ladder (Promega, UK) y pBR322/MspI digest (Biolabs), que se
corrieron junto con las muestras (12,5 µl). Se cortó la banda correspondiente con
pipetas pasteur estériles y se purificaron (ver apartado de purificación a partir de
agarosa) para su posterior clonación. Para aquellas muestras en las que la banda
era muy débil, se volvió a correr pero esta vez en un gel de agarosa de bajo punto
de fusión, se cortó la banda, se fundió a 65º durante 20 minutos y luego se eluyo
en 20-30 µl de agua destilada, para llevar a cabo una segunda PCR.
![Page 136: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/136.jpg)
Material y Métodos
109
II.5. TRATAMIENTO ENZIMATICO Uracil-N-
Glicosilasa (UNG)
El enzima AmpErase® (Uracil N-glicosilasa) (Applied Biosystems) de E.Coli
retira los uracilos que aparezcan en el DNA dejando un hueco que luego será
hidrolizado dando como resultado la ruptura de la cadena. Esto permite eliminar
todos aquellos daños debidos a la desaminación de la citosina (explicado en el
capitulo I.4).
Para ello se usó directamente en la PCR, las condiciones son las mismas
que las explicadas en el apartado correspondiente, con la modificación de este
nuevo reactivo en cantidad de 0,25U en un volumen final de 25 µl. Dos nuevos
pasos se introdujeron al programa de PCR; uno primero de 10 minutos a 40ºC y
un segundo de 10 minutos a 95º. El paso a 40ºC permite al enzima retirar los
uracilos y la incubación a 95º, permite la ruptura de la cadena por donde el uracilo
fue retirado y la inactivación de la enzima para evitar que pueda intervenir en el
resto de la amplificación.
II.6. SNaPshot
Todos los estudios de aDNA en humanos implican la clonación de las
secuencias, lo que es un método muy caro y que requiere mucho tiempo. Se
intentó desarrollar un método para poder testar las muestras antes de proceder a
la clonación, utilizando sólo aquellas que parecieran tener los haplotipos
deseados.
Para ello se diseñó un estudio basado en la tecnología SNaPshot. Esta es
una técnica robusta que permite una detección altamente específica de los SNPs.
Consiste en una minisecuenciación con una sonda que se une al DNA que nos
interesa en las posiciones inmediatamente upstream a la polimórfica. Con estas
sondas se realiza una reacción semejante a la PCR pero con el uso de
dideoxinucleótidos cortando la polimerización tras la adición de un único
![Page 137: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/137.jpg)
Material y Métodos
110
nucleótido. Estos dNTPs están marcados con un fluorocromo, de forma que dada
uno de los cuatro tipos (ddATP, ddGTP, ddCTP y ddTTP) lleva un marcaje que
emite a una longitud de onda diferente. A la hora de diseñar las sondas de
minisecuenciación para los multiplexes se les va añadiendo a su extremo 5’
secuencias de DNA no humano o polinucleótidos, de forma que cada uno de los
productos tenga un tamaño diferente y conocido por nosotros (Tully et al. 1996).
De esta manera, al analizar los datos de la electroforesis a través de programas
informáticos, el tamaño de la sonda definirá el SNP concreto del que se trata y la
longitud de onda a la que emite facilitará la identidad del dNTP añadido y el
genotipo del SNP. Todo el proceso viene resumido en la Figura 24. Esta técnica
presenta una gran especificidad y el hecho de que se puedan usar las mismas
condiciones de reacción para detectar varios nucleótidos permite que se puedan
diseñar multiplexes para la detección simultánea de varios SNPs por muestra.
Figura 24: Esquema de los pasos de la reacción de SNaPshot, imagen cedida por Juan Sanchez (Sanchez and Endicott 2006)
![Page 138: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/138.jpg)
Material y Métodos
111
En un principio se buscaron SNPs de la región control del DNA
mitocondrial, para ello se usaron los primers L16159/H16236 y L16206/H16346
(ver Tabla 5). Pero el problema que presentaban estas regiones es que las
posiciones nucleotídicas por separado (que es como las analiza el SNaPshot)
pueden ser indicativas de muchos tipos de haplogrupos. Por ello se decidió
diseñar primers en la región codificante que testaran posiciones específicas de los
hapogrupos amerindios A, B, C, D y X (Tabla 5).
Primer L Secuencia (5’ 3’) Primer H Secuencia (5’ 3’) SNP HG
L00654 cacatcaccccataaacaaataggt H00686 gggatgcttgcatgtgtaatct 663 A
L05164 caccacgaccctactactatctcg H05183 ggatggaattaagggtgttagtcat 5178 D
L06206 ccccgcataaacaacataagc H06232 actatagcagatgcgagcaggagta 6221 X
L08272 ggcccgtatttaccctatagcac H08328 gaggtgttggttctcttaatctttaac 8281 (9bp del) B
L09532 cactccagcctagcccctac H09578 gagtgggacttctaggggattt 9543 C
L16159 tacttgaccacctgtagtac H16236 ggctttggagttgcagttgatg Varios –
L16206 aagtacagcaatcaaccctc H16346 aagtacagcaatcaaccctc Varios –
Tabla 5: Primers usados para la amplificación de SNPs a lo largo del DNA mitocondrial para ser usados en SNaPShot y para su posterior clonación. Se realizaron 2 multiplexes diferentes, una con los primers de la región codificante y otros con los de la región control HVI.
Para las amplificaciones se llevaron a cabo multiplexes en un volumen final
de 25 µl que contenía 1x Platinum Taq High Fidelity PCR buffer (Invitrogen), 2
mM MgSO4, 200 mM de cada dNTP, 1 µM de cada primer (Tabla 5) y 1 U de
Platinum Taq HiFi DNA polimerasa (Invitrogen). El programa que se usó fue el
siguiente: 94ºC durante 2 minutos seguido de 40 ciclos de 94ºC 30 segundos,
60ºC 30 segundos y 68ºC 45 segundos. Con una extensión final de 6 minutos a
68ºC.
El exceso de primers y de dNTPs se retiraron añadiendo 1 µl (1 U/µl)
shrimp alkaline phosphatase (SAP) y 0,02 µl (10 U/µl) Exonuclease I (ExoI)
(Amersham Pharmacia Biotech) a 2,5 µl de producto de PCR e incubando la
mezcla a 37ºC durante 30 minutos seguidos de 15 minutos a 75ºC.
![Page 139: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/139.jpg)
Material y Métodos
112
La reacción de minisecuenciación se llevó a cabo en un volumen final de 8
µl que contenía 1 µl de producto de PCR purificado, 4 µl de mix de SNaPshot
(Applied Biosystems), 0,8 µl de mix de sondas (0,2 mM de cada sonda, ver Tabla
6) y 2,2 µl de agua Milli-Q. El mix de sondas se realizó en 160 mM de sulfato
amónico (Sigma-Aldrich) para minimizar las uniones entre primers (primer-dimer).
El programa que se usó se basó en 30 ciclos de 96ºC 10 segundos, 55ºC 5
segundos y 60ºC 30 segundos.
Posición testada
Sonda Secuencia del primer Nucleótidos detectados
SNPs de la región HVI 16189 16189snF tctctctctctctctctaatccacatcaaaaccccc T>C
16217 16217snF atgcttacaagcaagtacagcaa T>C
16223 16223snR tgcagttgatgtgtgatagttga G>A
16278 16278snF ctctctctctctctccctcacccactaggata C>T
16290 16290snF ctctctctctctctctctctctaggataccaacaaaccta C>T
16298 16298snR tctctctctctatggctttatgtactatgtactgtt A>G
16319 16319snF ctctctctccttaacagtacatagtacataaa G>A
16325 16325snF tcaacagtacatagtacataaagccatt T>C
16327 16327snR ctgatttgactgtaatgtgctatgtacg G>A
16362 16362snR ggggtcatccatgggg A>G
SNPs de la región codificante 663 00663snF tctctctctctctctcccataaacaaataggtttggtcct A>G
5178 05178snR tctctctctctctctctctctctctctctctggaattaagggtgttagtcatgtta G>T
6221 06221snF ctctctctctctctctctctcaacataagcttctgactcttacc T>C
8281 08281_9snR tctctctctctctctctctctctctctctttacagtgggctctagaggggg A>G
9545 09545snF tctctctctctctctctctcctaccccccaattagg A>G
Tabla 6: SNPs testados por SNaPshot con las sondas utilizadas. En cursiva viene la cola de nucleótidos añadida y el resto de la secuencia corresponde a la CRS (Anderson et al. 1981). F y R se refieren a si la sonda se une a la cadena forward o a la reverse. Se especifican también las dos opciones nucleotídicas que pueden aparecer para cada sonda, que en función de si esta en forma reverse o forward coincidirá o no con la CRS.
El exceso de nucleótidos se retiró añadiendo 1 µl (1 U/µl) de SAP e
incubando durante 30º a 37º seguido de 15 minutos a 75ºC. Dos microlitros de
este producto purificado se mezclaron con 18 µl de formamida Hi-Di (Applied
Biosystems) y 0,1 µl de marcador interno de tamaño GeneScan-120 Liz (Applied
![Page 140: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/140.jpg)
Material y Métodos
113
Biosystems) y se analizó mediante electroforesis capilar usando ABI Prism 3130
usando capilares de 34 cm y polímero POP-7 (Applied Biosystem). Las muestras
fueron analizadas usando los softwares GeneScan y Genotyper (Applied
Biosystem).
II.7. ENZIMAS DE RESTRICCIÓN Y FRAGMENTO DE 9bp
Para corroborar los datos obtenidos de las secuencias de HVI y HVII fue
necesario analizar ciertas posiciones de la región codificante del DNA
mitocondrial. Hay varias formas de testar estas posiciones, una de ellas es
mediante la técnica de SNaPshot que se usó en Copenhague y ha sido explicada
en el apartado anterior. Pero en el trabajo llevado a cabo en Oxford se utilizaron
las enzimas de restricción. Las cuales cortan la secuencia en función de la
existencia de ciertas dianas. Así para determinar el haplogrupo A se testó la
posición 663 y para ello se usó el enzima HaeIII, el cual corta la secuencia al
encontrar la diana “ggcc/ccgg" por lo tanto cuando encuentra el SNP
correspondiente a este haplogrupo (G). Para determinar el haplogrupo C se
estudió la posición 13262 usando el enzima AluI, cuya diana es “agct/tcga”.
Cortando cuando encuentra una G propia del haplogrupo C en esa posición. En el
caso del haplogrupo B no se usaron enzimas de restricción, sino se basó en la
comprobación de la existencia/ausencia de un fragmento de 9 pares de base (bp)
en la región COII/tRNAlys.
Las PCRs se llevaron a cabo como viene especificado en el apartado
correspondiente a la amplicación. Las secuencias de los primers y la temperatura
de anneling que se usó se encuentran en la Tabla 7.
Se chequearon las PCR en agarosa al 4% para asegurarnos de que hubo
amplificación. Con excepción de la deleción de 9bp que se usó al 5%, ya que la
diferencia entre si tiene o no tiene la delecion es mínima. Este gel se corrió a 75
voltios durante dos horas.
![Page 141: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/141.jpg)
Material y Métodos
114
Primer L Secuencia (5’ 3’) Primer H Secuencia (5’ 3’) Anneling
L00577 gtttatgtagcttacctcctc H00743 gatcgtggtgatttagagggt 53ºC
L08188 agcaaaccacagtttcatgc H08366 tttcactgtaaagaggtgttgg 54ºC
L13176 aggcgctatcaccactctgt H13320 gcaggaatgctaggtgtggt 57ºC
Tabla 7: Secuencias y temperatura de anneling de los primers usados para la amplificación de los fragmentos que contenían los SNPs específicos de los HGA, B (no es una posición nucleotídica sino la ausencia/presencia de un fragmento de 9bp) y C
Una vez chequeadas las secuencias correspondientes a los haplogrupos A
y C se procedió a la digestión. Se trataron 5 µl de producto de PCR con 10U de la
respectiva enzima y 2 µl de buffer de restricción 1x en un volumen final de 20 µl.
El mix se incubó durante 1 hora a 37ºC para que el enzima actuara y un paso final
de 20 minutos a 80ºC para inactivar al enzima.
Para asegurarnos de que la digestión funcionó se usó un vector de 600 pb
el pBluescript II SK(+), que presenta múltiples dianas a lo largo de su secuencia.
En la Tabla 8 puede verse el tamaño de los amplicones y los fragmentos
resultantes después del uso del enzima.
HG SNP Amplicón Enzima Fragmentos
A 663 167bp AluI 88bp + 79bp
B 8281 (9bp del) 179bp/170bp – 179bp / 170bp
C 13263 143bp HaeIII 88bp + 55bp
Tabla 8: Posiciones nucleotídicas determinantes de los haplogrupos A, B y C. Tamaño de los amplicones y enzimas utilizadas en el proceso de digestión con los tamaños de los fragmentos resultantes en el caso de la digestión positiva.
Los productos de digestión se chequearon en agarosa al 4%. Se corrieron
a 75 voltios durante 1 hora. Observando la existencia de 1 (no digestión) o de 2
bandas (el enzima encontró la diana correspondiente y cortó).
![Page 142: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/142.jpg)
Material y Métodos
115
II.8. PURIFICACIÓN DE LOS PRODUCTOS DE PCR
Antes de secuenciar los productos de PCR o de clonar es esencial
purificarlos. Este paso consiste en eliminar los restos de dNTPs, de primers,
los productos de PCR parcialmente amplificados en el paso de elongación y
todos aquellos componentes que puedan interferir en la reacción de secuencia
o en la clonación. Según si los productos iban a ser utilizados para clonación o
para secuenciar se emplearon dos técnicas diferentes:
II.8.1. Purificación a partir de agarosa
Todas las PCRs que se llevaron a cabo se cargaron en un gel de agarosa
al 2 – 3% para poder separar bien las posibles bandas inespecíficas que
pudieran aparecer, ya que al utilizar condiciones de PCR poco restrictivas
es muy fácil que amplifique cosas que no nos interesen. Las bandas
correspondientes se cortaron con pipetas Pasteur estériles y se purificaron
con el kit de QIAquick Gel Extraction (QIAgen Ltd.) Este protocolo se basa
en la purificación a través de una membrana de sílica de fragmentos entre
70 bp y 10 Kb. Los buffers de captura proveen a la muestra de la correcta
concentración de sales y de pH, permitiendo que el DNA se quede unido a
la membrana. Durante el paso de absorción los restos de primers así como
todas las impurezas, como sales, enzimas, restos de dNTPs, agarosa,
bromuro de etidio…; no se unen a la membrana de silica y pasan a través
de la columna. El paso de elución del DNA también es dependiente de la
concentración de sales y del pH del buffer de elución, pero en este caso es
más eficiente en condiciones básicas y bajas concentraciones de sal.
El protocolo es el siguiente:
1. Pesar la cantidad de agarosa que se ha cortado del gel y añadir 3
volúmenes de Buffer QG en 1 volumen de gel.
Este buffer solubiliza la agarosa y proporciona las apropiadas
condiciones de unión del DNA a la membrana de sílica. Este buffer
cambia de color en función del pH, avisándonos de si la fijación será
eficiente o no. Si el pH es mayor de 7.5 (lo que puede ocurrir si el gel
de agarosa o el buffer están incorrectamente preparados) la mezcla
![Page 143: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/143.jpg)
Material y Métodos
116
se volverá violeta y para corregirlo será necesaria la adición de
Acetato sódico 3 M, pH 5.0 antes de seguir el protocolo.
2. Incubar a 50ºC durante 10 minutos (o hasta que la agarosa se haya
disuelto totalmente).
3. Añadir 1 volumen de isopropanol a la muestra y mezclarlo.
4. Colocar el mix en una columna QIAquick y centrifugar 1 minuto.
5. Descartar el contenido del tubo colector.
6. Para lavar añadir 750 µl de Buffer PE a la columna y centrifugar.
Todas las sales son retiradas por este buffer.
7. Descartar el contenido del tubo colector y centrifugar 1 minuto para
asegurarnos de retirar todo el etanol ya que este podría interferir en
las subsecuentes reacciones enzimáticas.
8. Descartar el tubo colector y colocar la columna en un eppendorf de
1,5 ml limpio.
9. Para eluir el DNA añadir 50 µl de Buffer EB (10 mM Tris-HCl, pH 8.5)
en el centro de la membrana. Si contamos con poca cantidad de
DNA podemos concentrar la muestra usando menos cantidad de
buffer.
10. Dejar reposar un par de minutos, y luego centrifugar 1 minuto. El
DNA ya esta purificado y listo para usar.
II.8.2. Purificación directa de la PCR
Para ello se usaron placas de 96 pocillos comerciales Montage
PCRµ96 system (Millipore, U.S.A) con un tamaño de poro específico que no
permite que se vayan los productos de PCR pero sí todas aquellas
moléculas menores. Se añade a las muestras 100 µl de agua destilada, y
todo se transfiere a la placa. Se filtra en la bomba de vacío hasta que se
seque el pocillo. Ahora se añaden otros 100 µl de agua y se repite la
operación de filtrado. Las muestras ya estarían limpias, con lo que le
añadimos entre 20 – 30 µl de agua (en función de la señal que tuviéramos
en el gel de agarosa) y se dejan en agitación unos 10 minutos, para luego
transferir las muestras purificadas a una placa limpia y así ya está lista para
secuenciar.
![Page 144: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/144.jpg)
Material y Métodos
117
II.9. CLONACIÓN
Los productos de PCR una vez fueron purificados del gel de agarosa en
donde se cortó la banda correcta, fueron clonados. Para ello se usó el TOPO TA
Cloning kit (Invitrogen) con células competentes Escherichia coli TOP10F’. Para
ello se añadió el vector pCR 2.1-TOPO (0,25µl) (que contiene ampR gen) y una
solución salina (0,25µl) al producto de PCR purificado (1µl). Se centrifugó el mix y
se incubó a temperatura ambiente durante 5 minutos; este paso permite la
ligación de nuestro producto de PCR al vector de clonación. A esta mezcla se
añadieron 10 µl de células competentes y se incubaron en hielo durante otros 5
minutos. Para luego pasar al choque térmico (42ºC 30 segundos) que permitirá
penetrar el vector en el interior de las bacterias. Las muestras se retornaron
inmediatamente al hielo. Luego se le añadió medio S.O.C. (75µl) con el propósito
de que las células se recuperen y crezcan en la mezcla, por lo que se incubaron
(37ºC 1 hora) en continua agitación. De esta mezcla se usaron 50 µl para
plaquearlos en placas con LB que contenían, LB agar (1,5% w/v), ampicilina
(0,005% w/v), X-gal (4% w/v), y isopropil-beta-Dthiogalactopiranosido (IPTG,
100mM). Las placas se incubaron toda la noche a 37ºC.
La identificación de colonias que contuvieran el inserto es fácil debido a la
capacidad del medio de seleccionar aquellas células que poseen el vector
plasmídico pCR2.1-TOPO, ya que es este el que le da la resistencia al antibiótico
ampicilina que contiene el medio y por otro lado gracias al gen β-galactosidasa
que permite la metabolización del sustrato X-gal, lo que causa una acumulación
de catabolitos de color azul. Es en la mitad de este gen donde se inserta el
producto de PCR, por lo tanto está impidiendo la metabolización del sustrato. Por
lo que las colonias blancas tendrán tanto el plásmido (ya que han sido capaces
de crecer) y el inserto (no han metabolizado el X-gal). Las colonias blancas se
recogieron con puntas de micropipeta estériles y se transfirieron directamente al
mix de PCR.
Para la PCR se usaron los primers M13R (5’ GTC CTT TGT CGA TAC TG)
y T7 (5’CCC TAT AGT GAG TCG TAT TA) que se encuentran dentro del vector.
Para las amplificaciones (12µl volumen final) se usó polimerasa AmpliTaq Gold
![Page 145: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/145.jpg)
Material y Métodos
118
(0,75U, ABI), 1x buffer, dNTPs (25mM), MgCl2 (2mM), una colonia de bacterias y
los primers M13R/T7 (1µM cada uno). El programa de PCR que se usó consiste
en un paso de activación inicial a 94ºC durante 2 minutos, seguido de 35 ciclos de
94ºC 20 segundos, 53ºC 30 segundos y 72ºC 30 segundos. Con una extensión
final de 7 minutos a 72ºC . Una vez finalizada la PCR las muestras fueron
purificadas con el sistema Montage PCRµ96 (Millipore, U.S.A), especificado
anteriormente.
II.10. SECUENCIACIÓN
Para la secuenciación se usó Big Dye Terminator kit v3.1 (Applied
Biosystems, USA) el cual usa dNTPs marcados con fluorocromos de diferentes
absorbancias. Todas las secuencias analizadas provienen de productos de PCR
por lo que se usó siempre para la secuenciación el primer universal T7.
La reacción de secuenciación consistió en un volumen final de 10 µl con 0,5
µl del mix de BigDye, 2,5 µl de buffer 5x de secuenciación, 1 µl de primer T7 a
una concentración de 10 µM; 3 µl de DNA purificado y 5,5 µl de agua destilada.
El programa de secuenciación que se utilizó consta de una desnaturalización
inicial de 1 minuto a 95ºC, seguido de 30 ciclos de 1 minuto a 95ºC, 5 segundos
a 50º y 2 minutos a 60º. Un paso final de 5 minutos a 20ºC confiriéndole una
temperatura más estable a los productos de secuenciación.
Antes de cargar la reacción de secuencia en el Secuenciador fue necesario
llevar a cabo una purificación para retirar los restos de marcador, primers y sales
no utilizados. Que lo único que harían sería dar fluorescencia residual
interfiriendo en la lectura de las secuencias.
Para ello se usó un protocolo de precipitación con etanol. Que sigue los
siguientes pasos:
• Añadir a las muestras 64 µl de etanol al 96% y 26 µl de agua destilada
• Agitar un poco y dejar a temperatura ambiente durante 15 minutos
• Centrifugar a 3700 rpm durante 40 minutos a 4ºC
![Page 146: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/146.jpg)
Material y Métodos
119
• Invertir la placa y centrifugar a 200 rpm durante 1 minuto para retirar
todo el etanol
• Añadir 150 µl de etanol al 70% y centrifugar de nuevo a 2.500 rpm
durante 20 minutos
• Le damos la vuelta y otra vez a 200 rpm durante 1 minuto
• Dejamos evaporar al aire los restos de etanol que puedan quedar.
Una vez terminada la precipitación se les añade 10 µl de formamida a las
muestras y están lista para ser cargadas en el secuenciador. A lo largo de estos
trabajos se usaron diversos modelos del ABI prism; 3100, 3130 y 3730 (Applied
Biosystems). Para el análisis de las secuencias se uso el software Bioedit
(versión 7.0)
![Page 147: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/147.jpg)
![Page 148: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/148.jpg)
III. Resultados y Discusión
![Page 149: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/149.jpg)
![Page 150: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/150.jpg)
Resultados y Discusión
123
III.1: IDENTIFICATION OF SKELETAL REMAINS USING SHORT-
AMPLICON MARKER ANALYSIS OF SEVERELY DEGRADED DNA
EXTRACTED FROM A DECOMPOSED AND CHARRED FEMUR
M Fondevila, C Phillips, N Naverán, L Fernandez, M Cerezo, A Salas, A
Carracedo, MV Lareu
(Submitted to Forensic Science International Genetics)
![Page 151: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/151.jpg)
![Page 152: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/152.jpg)
Resultados y Discusión
125
Identification of skeletal remains using short-amplicon marker analysis of severely degraded DNA extracted from a decomposed
and charred femur
M. Fondevila1, C. Phillips*1,2, N. Naveran1, L. Fernández1, M. Cerezo1, A. Salas1,2,
Á. Carracedo1,2, M.V. Lareu1,2
1 Unidad de Genética, Instituto de Medicina Legal, Facultad de Medicina,
Universidad de Santiago de Compostela, 15782, Galicia, Spain
2 Grupo de Medicina Xenómica, CIBERER, Hospital Clínico Universitario, 15706;
Santiago de Compostela, Galicia, Spain
*communicating author: [email protected] Keywords degraded DNA analysis; forensic identification; STR; mini-STR; SNP Abstract Applying two extraction protocols to isolate DNA from a charred femur recovered
after a forest fire, a range of established and recently-developed forensic marker
sets were used to type the sample and confirm identity by comparison to a
daughter of the deceased. Identification of the remains indicated the individual had
been dead for ten years and the DNA was therefore likely to be severely degraded
from the combined effects of decomposition and exposure to high temperatures.
New marker sets comprised both reduced-amplicon STR and SNP multiplexes
specifically developed to analyze degraded DNA giving an opportunity to assess
the ability of each approach to successfully type highly degraded casework
material.
![Page 153: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/153.jpg)
Resultados y Discusión
126
1. Introduction A frequently encountered challenge in forensic casework is the analysis of highly
degraded DNA that requires extraction from a variety of difficult material. Bones
and teeth are included in this category as a principal source of DNA in the
identification of the remains of long deceased individuals. In these circumstances
standard STR markers can often fail, primarily because of their amplicon lengths.
Since DNA becomes progressively more fragmented as it degrades, a common
observation is to find a direct relationship between the amplicon length and the
frequency at which the locus fails to amplify completely or the allele pairs show
marked signal imbalance between short and long repeats [1, 2]. After prolonged
periods of degradation even the shortest amplicon STRs are seen to fail. Two
techniques can provide alternative approaches to the analysis of severely
degraded material: mitochondrial DNA (mtDNA) analysis and the use of short-
amplicon markers. Until recently mtDNA offered the only alternative to standard
STRs for analyzing degraded DNA and was usually more successful since high
copy numbers per cell and a covalently closed molecule confer greater resistance
to degradation processes than nuclear DNA. However, mtDNA has certain
acknowledged drawbacks: sequence variation is much less informative than STR
polymorphisms, it cannot be applied to all cases of identification using surviving
relatives due to its matrilineal inheritance and lastly, proper interpretation of
haplotype variability requires large-scale databases. The other alternative
approach of reducing the length of autosomal marker amplicons can be achieved
by re-designing the primers of existing STRs, commonly termed mini-STRs [3, 4]
or by analyzing SNPs (single nucleotide polymorphisms [5, 6]) offering two new
systems for typing degraded DNA. Both approaches provide improved
informativeness compared to mtDNA and, since the product rule can be applied to
the profiles generated from each set of markers, more manageable databases can
be used to characterize the variability in a population. While bringing the primers
of STRs closer to the repeat region helps to reduce amplicon size those with the
largest range of alleles such as FGA and D21S11 can still potentially suffer from
big differences in allele size and therefore disparity in amplification performance
between the extremes in repeat number. Although designing short-amplicon
primers around the single polymorphic base of SNPs is easier, multiplexes of 45-
![Page 154: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/154.jpg)
Resultados y Discusión
127
50 loci are required before a sufficient number of binary polymorphisms can match
the power of STRs to differentiation individuals [5].
Since the ability to successfully type severely degraded DNA is of paramount
importance, regardless of the shortcomings of the markers used, it is necessary to
properly assess how each of the two short-amplicon approaches perform in
comparison to conventional strategies. This report outlines the analysis of DNA
extracted from a femur recovered from human remains that had undergone a ten
year period of decomposition followed by exposure to the high temperatures
associated with forest fires. 1.1. Case Report
During the summer of 2006 a large number of forest fires, predominantly initiated
by arsonists, afflicted Galicia: the north-western part of Spain. Forest fires in this
region are characterized by very high temperatures caused by the resinous nature
of the wood in mixed Pine and Eucalyptus plantations. After one of these forest
fires was extinguished the investigators discovered a set of charred skeletal
remains uncovered by the burning of the underlying foliage. DNA analysis of the
remains was initiated to identify if they were from a fire victim or of a man reported
as missing in the area ten years previously. A surviving daughter was available for
comparison, illustrating, in this instance, the unsuitability of mtDNA and Y-
chromosome loci as single lineage markers in identification cases involving the
comparison of fathers with female descendants. A complete femur was submitted
for analysis that showed signs of exposure to intense heat, being completely
charred at both ends and on one side, as shown in Figure 1. On discovery the
skeletal remains had been observed to be half buried in the soil (suggesting one
side may have been protected from the fire) and several bones were reported to
have been fragmented, with pathology indicating acts of violence.
![Page 155: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/155.jpg)
Resultados y Discusión
128
2. Materials and Methods To isolate DNA from the femur we performed two different extraction methods,
and using the product of each in parallel analyses, typed the DNA with two
standard STR profiling kits: AmplSTR® Identifiler™ (Applied Biosystems: AB) and
Powerplex 16™ (Promega) plus, for the purposes of comparison: two SNP assays
developed by the SNPforID consortium (www.snpforid.org), HV1 mtDNA
sequencing and three mini-STRs multiplexes.
2.1. Sample preparation Prior to DNA extraction the femur was cleaned thoroughly using a scalpel and
mild-grade sandpaper, limiting attention to a small, 12cm. length of bone in an
area visibly less carbonized by the fire. Once the external layer of bone had been
completely removed and, with it, possible contaminant material, the bone was cut
into small portions with a handsaw. The internal face of the bone was further
cleaned using a scalpel and portions then pulverized in a liquid N2 mill yielding a
total of 8ml of fine bone dust.
2.2. DNA extraction Two extraction methods were performed in parallel: A) a normal phenol-chloroform
extraction process adapted for bone material, plus: B) an ancient DNA extraction
protocol [7] we have enhanced to improve the quality of the DNA extracted. A)
Phenol-chloroform samples were digested by adding to two 2.5ml aliquots of bone
dust: 2.3ml of a lysis mix comprising 2ml of 0.5M EDTA pH8 as buffer, 80µl of
DTT 1M, 140µl of 10% SDS and 50µl of protease-K 20ng/ml each. Samples were
consequently lysed overnight at 56ºC followed by normal phenol-chloroform
extraction with the DNA purified and concentrated with Centricon centrifugal filter
devices (Millipore) following the manufacturers protocol. The DNA extracts from
both dust aliquots were recovered in TE buffer and combined in a single tube. B)
1.5ml of bone dust was decalcified by a treatment with 10ml of an EDTA solution
(pH 8.8) and left at 37ºC overnight. Digestion involved sample centrifugation for 10
minutes at 15000rpm, discarding of the pellet followed by the addition of 1ml 5%
SDS, 500µl 1M Tris-HCl, 500µl 0.5M NaCl, 500µl 0.1M CaCl2, 2 x 50µl protease-K
(20mg/ml), 75µl of DTT and 7ml of H2O. The mixture was left for one day at 65ºC
![Page 156: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/156.jpg)
Resultados y Discusión
129
then one day at 75ºC. The last step of extraction was a phenol-chloroform method
as detailed previously [7]. Extraction procedures A) and B) were performed on
individual occasions separated by 24 hour periods with negative extraction
controls made in parallel.
2.3. Quantitation Both extracts were quantified using the real-time PCR Quantifiler™ human DNA
quantification kit (AB) that includes an internal PCR control (IPC) detecting PCR
inhibition. Reactions were performed using an AB 7300 real time PCR thermal
cycler following manufacturers protocols. On the basis of the IPC values obtained
during quantitation, samples were analyzed in tandem PCRs as dilutions 1/2; 1/4;
1/8; and 1/16 of the original extract.
2.4. STR typing Identifiler™ (AB) and Powerplex 16™ (Promega) STR typing kits were used
following unmodified manufacturers protocols. DNA samples were amplified neat
plus diluted: 1:2, 1:4, 1:8 and 1:16 for both STR sets. PCR amplification was
performed at a total volume of 12.5µl. Capillary electrophoresis was performed
throughout using an AB3130 and POP-6™ polymer.
2.5. SNP typing Two SNP multiplexes, previously developed by SNPforID, were genotyped using
SNaPshot™ mini-sequencing (AB), comprising a 52plex forensic identification set
[8] and a 34plex ancestry indicative set [9]. The identification 52plex genotypes
SNP alleles using two parallel mini-sequencing reactions detecting 23 and 29
SNPs (termed Auto1 and Auto2 respectively), while the ancestry indicative 34plex
detects all loci in a single mini-sequencing reaction. Both SNP sets were amplified
with single PCR multiplexes although the 52plex can alternatively be split into two
reduced-scale amplifications comprising 23 and 29 SNPs to provide improved
sensitivity for degraded DNA. We performed both the 52plex and dedicated
23plex/29plex amplifications to assess this effect. All the SNP analyses were
initiated with PCR using undiluted DNA extracts. Genotyping of the identification
SNP set followed the published protocol [8] except for the following modifications:
![Page 157: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/157.jpg)
Resultados y Discusión
130
the final PCR volume was reduced to 13.5µl, PCR annealing time was 50
seconds, and extension time 40 seconds. Mini-sequencing conditions were
modified to a final reaction volume of 6µl comprising: 2µl of Ready Reaction
SNaPshot™ mix, 1.5µl of extension primer mix (each primer at less than 0.2µM)
and 2µl of purified PCR product. Electrophoresis was performed with an AB 3130,
POP-6™ polymer and a 50cm capillary array using injection mix: 2µl undiluted
extension product, 9.5µl of HI-DI™ formamide and 0.3µl of AB LIZ™ 120 internal
size standard. The ancestry indicative 34plex SNP set used the same PCR and
mini-sequencing conditions and modifications detailed above for the 52plex.
Additional data regarding these SNP typing protocols is available as a download
from: www.snpforid.org.
2.6. Mini-STR typing Three short-amplicon mini-STR sets were used; Mini-NC01 and Mini-SGM, both
developed by the National Institute of Standards and Technology [10, 11
respectively] plus the commercial AmplSTR® MiniFiler™ kit (AB). The NIST sets
were analysed following the recommended protocol (http://www.cstl.nist.gov/
biotech/strbase/miniSTR/updated_NC01_protocol.pdf). The PCR reaction mix
comprised: 2.5µl of 10X PCR buffer, 2µl of 25mM MgCl2, 5µl of PCR primer mix
(1.3µM D10S1248, 1.3µM D14S1434 and 0.8µM D22S1045), 0.625µl of 10mM
dNTPs, 1.25µl of 10X BSA, 0.5µl AmpliTaq Gold™, 8.125µl of dH2O, and 5µl of
DNA extract. Cycling conditions comprised: pre-denaturation of 95ºC 10 min, 34
cycles of 94ºC 1min, 55ºC 1min and 72ºC 1min each, and a final extension of
60ºC for 45min. PCR products were electrophoresed with an AB 3130 sequencer
with POP6 polymer and 50cm capillary array using injection mix: 1µl of PCR
product,15µl of HI-DI™ formamide and 0.35µl of LIZ GS500™ size standard. The
MiniFiler™ kit was amplified and detected using manufacturers recommendations.
2.7. Mitochondrial DNA sequencing The HVS-I control region was amplified with 15997L (5’-CAC CAT TAG CAC CCA
AAG CT-3’) and 16236H (5’-CTT TGG AGT TGC AGT TGA TG-3’) primers using
three different PCR procedures: two based on Roche PCR components and the
alternative polymerases of Roche Taq polymerase or AB AmpliTaq Gold plus one
based on the Qiagen PCR Mastermix. The Roche PCR mix comprised: 8µl of
![Page 158: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/158.jpg)
Resultados y Discusión
131
dH2O, 2.5µl of BSA, 2.5µl of 10X PCR buffer (Roche), 0.75µl of 25mM MgCl2
(Roche), 0.5µl 10mM dNTP mix (AB), 0.4µl of Taq polymerase (alternatively
Roche or AB) and 3µl of undiluted DNA extract. The Qiagen PCR Mastermix
amplification mix comprised: 4µl of Qiagen PCR Mastermix, 4µl of H2O, 0.5µl each
of forward and reverse primers and 1µl of undiluted DNA extract. For both
protocols cycling conditions comprised: pre-denaturation of 95ºC 15 minutes, 35
cycles of 94ºC 30sec, 58ºC 1min 30sec and 72ºC 1min 30sec, and a final
extension of 72ºC 10 minutes. PCR product purification was performed with 96-
well MultiScreen® PCRµ96 plates (Millipore) following manufacturers
specifications. The cycle sequencing reaction used BigDye™ v.3.1 (AB) using
conditions: 1µl of primer at 10mM, 0.5µl of BigDye™ kit, 5.5µl of dH2O, 2.5µl of
BigDye 5x buffer and 3µl of PCR product, with cycling conditions, 96ºC 3min, 25
cycles with 96ºC 30sec, 50ºC 15sec, 60ºC 4min and a final extension of 60ºC
1min. Sequencing products were purified with SAP (GE Healthcare) added at an
equal volume to 10% of the final product. Samples were then purified with
Montage SEQ96 sequencing reaction cleanup kit (Millipore) following the
manufacturers guidelines. Sequencing products were electrophorezed using
standard conditions with an AB 3130 sequencer.
3. Results 3.1. Performance of marker sets. A summary of the genotyping results obtained with each DNA extraction system
for SNPs and with ancient DNA extraction for STRs is outlined in Table 1 and 2.
Electropherograms of the genotyping results obtained from the ancient DNA
extract for short-amplicon STR sets: MiniFiler™, mini-NC01 and mini-SGM plus
the three SNP sets are shown in Figure 2. mtDNA sequencing success is not
included in the table (since this marker was only analyzed for comparison
purposes) but gave good quality sequences in all analyses. The SNP results
indicated DNA extracts obtained from the modified ancient DNA protocol provided
better genotyping success than DNA from the normal phenol-chloroform protocol
indicating enhanced sensitivity with this extraction method. Each of the
conventional STR sets failed to amplify detectable alleles from any dilution or
extraction protocol including the shortest amplified products of amelogenin. In
![Page 159: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/159.jpg)
Resultados y Discusión
132
contrast, short-amplicon STRs gave detectable alleles in all three marker sets
used, although NIST mini-SGM only gave reliable genotypes for the shortest
amplicons of TH01. MiniFiler™ showed partial profiles for both extracts and signal
strength generally correlated with amplicon length with the exception of D16S539
that performed poorly in all cases despite a relatively short amplicon size. The
typing results of the NIST sets suggest while mini-SGM performs poorly, mini-
NC01 STRs amplify well with degraded DNA, although extra peaks are evident in
Figure 2-C at two loci. SNP genotyping proved to be the most successful
approach for analysis of the degraded DNA from the femur. Firstly, the subdivision
of the 52plex into a dedicated 23plex and 29plex gave complete profiles compared
to using a single combined PCR prior to mini-sequencing but improvements in
both success and signal strength was marginal. Secondly, previous observations
of Auto1 and Auto2 performance with a range of degraded DNA analyses
indicated that, regardless of the PCR multiplex used, Auto2 was consistently more
robust and sensitive, providing better quality peak patterns in nearly all cases. This
was also true of the results obtained in this study and is illustrated by adjacent
electropherograms B and D in figure 2. Lastly the population indicative 34plex
gave near identical success rates to the subdivided Auto1 and Auto2 PCR
indicating that a slightly larger-scale PCR and mini-sequencing reaction does not
affect performance with highly degraded DNA. Although some non-specific peaks
were seen in each of the mini-sequencing electropherograms only in a few cases
did these reach comparable heights to the SNP alleles and all were well separated
from the expected sizes of the alleles.
3.2. Informativeness of marker sets. Comparison of the genotype profiles from the femur with those of the claimed
relative gave a paternity index (PI) of 264.77 (probability = 99.62%) for STRs; a PI
of 42,645.42 (probability = 99.998%) for the identification set SNPs; and a
combined PI of 11,298,500.64 (probability = 99.99999%). These genotyping data
from the femur and assessments of paternity were reported as positive
identification of the person missing in the area 10 years previously. The PI and
probability values obtained indicate that when a full set of SNP genotypes is
obtained the collective power is markedly improved compared to a partial STR
profile despite the characteristic that SNPs, as binary polymorphisms, have much
![Page 160: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/160.jpg)
Resultados y Discusión
133
lower informativeness per locus. In fact the increased power of SNP sets to
differentiate individuals compared to MiniFiler™ STRs is evident from a
comparison of complete profiles for each marker set. The eight STRs of
MiniFiler™ give an average random match probability of 6.5 x 10-11 for African
Americans and 8.2 x 10-11 for Europeans (source: AB product information)
compared to 1.0 x 10-18 and 3.7 x 10-21 as equivalent values for the 52 SNPs
(source: SNPforID online allele frequency browser: http://bioinformatics.
cesga.es/snpforid/search.php).
The 34plex ancestry informative set was not used in the paternity analysis since
these SNPs were chosen to give little or no variability amongst individuals from the
same population-group. However information about likely population of origin may
be useful in the analysis of multiple deceased individuals particularly when applied
to the identification of mass disaster victims. For this reason it is important to use
the opportunity to assess the 34plex SNP set with challenging DNA cases and to
test the informativeness for ancestry if partial data is obtained [9]. Using a
Bayesian classification system imbedded within an interpretative web-portal
(http://mathgene.usc.es/snipper/) to derive a probability of European, African or
East Asian ancestry, expressed as –log likelihoods, (i.e. a smaller value is more
suggestive of ancestry), indicated the 34plex profile from the femur was 164 billion
times more likely to be European in origin than African and 44 billion times more
likely European than East Asian (considering the training sets and the population
grouping managed by snipper). The statistical values obtained from the Bayesian
analysis are outlined in Table 3.
To gauge the reliability of the 52plex SNP results in the absence of reference
genotypes from the deceased, the observed number of heterozygotes was
compared to an expected number estimated from a population sample of NW
Spain listed in the SNPforID frequency browser. The Auto1 and 2 profiles showed
21 of 52 heterozygous SNPs compared to an expected 24 heterozygotes based
on a 46% heterozygosity estimate for NW Spain. This was interpreted as
indicating an absence of allele dropout in the SNP profiles obtained from the
femur. Although there were insufficient loci in the small-amplicon STR sets to
allow the same check to be realistically made with the STR profiles these evidently
showed lower heterozygosity than allele frequencies would suggest. An alternative
approach to assessing allele dropout is to estimate the expected exclusion rate
![Page 161: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/161.jpg)
Resultados y Discusión
134
from the markers used and in the case of the SNP set this is 99.98% in Europeans
[8]. Therefore the lack of exclusions in our analyses suggests an absence of allele
dropout.
4. Discussion A clear difference in typing performance between short and standard
amplicon length markers is evident in the DNA analyses we have described. It is
likely from the circumstances of the case that the DNA extracted was severely
degraded as a result of the combined processes of decomposition and heat-
induced degradation. Considerable effort was made when originally designing the
SNPforID autosomal SNP sets [8, 9] to create multiplexes producing amplicons
below a 120bp size limit (average and range for the 52plex: 88bp, 59-115bp and
for the 34plex: 86bp, 61-117bp) and the SNP typing results reported here suggest
that this has provided marker sets uniformly robust in the analysis of highly
degraded DNA. The reduced length STR markers sets all provided genotypes
from degraded DNA when none could be obtained with standard length
amplicons. Although it is inappropriate to draw conclusions from the performance
of individual STRs in a single case, generally those amplifying above a size
ranging from 150-180bp appear to fail more readily in these analyses. A recent
study led to the recommendation that short-amplicon STR products should aim to
be smaller than 150bp to ensure a proper sensitivity [2]. In our analysis the
amelogenin peaks of MiniFiler™ showed a degree of size related imbalance in
contrast to the other heterozygous locus of D2S1338 suggesting stochastic effects
between allele pairs might complicate the interpretation of peak patterns from
larger loci or from those with broader allele size ranges (e.g. FGA) when typing
very degraded DNA. Furthermore FGA in MiniFiler™ and D16S539 in mini-SGM
both showed peaks with good signal strength that were not within the ladder size
bins.
One problem that can limit the proper assessment of different marker sets in real
casework is the inability to control for allele dropout when analyzing identification
cases based solely on bodily remains. Without a reference profile the paternity
index for a surviving relative provides a statistical likelihood for the DNA evidence
that both individuals are related as claimed and in this case the failure to detect
![Page 162: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/162.jpg)
Resultados y Discusión
135
any exclusion in the 52 SNPs, coupled with a heterozygosity that is a reasonable
match to the population as a whole gives persuasive evidence that the SNP
profiles we obtained from the femur represent the true genotypes of the deceased.
Although the possibility of SNP allele dropout cannot be completely ruled out, the
mini-sequencing reaction used for the SNP typing does not show detectable
differences in amplification efficiency – only imbalance in peak heights related to
variation in dye signal strength and extension efficiency between alleles of the
same SNP. Furthermore although the background baseline signal can be higher
with some DNA extracts from degraded sources these extra bands are always
observed to occupy positions outside the size bins used to identify each extension
product.
The low informativeness of SNPs individually has been a factor that has hampered
their widespread adoption amongst the forensic community as first-choice markers
for degraded DNA analysis. However this characteristic becomes largely irrelevant
if full SNP profiles can be reliably obtained from highly degraded material using
large-scale multiplexes and simple, easily adopted genotyping systems.
Furthermore when degraded DNA fails as template for standard STR
amplifications or gives only partial genotypes from short-amplicon STR sets that
extend beyond ~150bp in size, SNPs offer clear advantages to the forensic
practitioner. Acknowledgment Two grants from the Xunta de Galicia PGIDIT06PXIB208079PR and
PGIDTIT06PXIB228195PR given to AS and MVL, respectively, a grant from the
Fundación de Investigación Médica Mutua Madrileña awarded to AS and a grant
of the Ministerio de Educación y Ciencia (BIO2006-06178) given to MVL
supported this project.
![Page 163: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/163.jpg)
Resultados y Discusión
136
References
[1] D.T. Chun, J. Drabek, K.L. Opel, J.M. Butler, B.R. McCord, A study on the effects of degradation and template concentration on the amplification efficiency of the STR Miniplex primer sets, J. Forensic Sci. 49 (2004) 733-740.
[2] L.A. Dixon, A.E. Dobbins, H.K. Pulker, J.M. Butler, P.M. Vallone, M.D. Coble,
W. Parson, B. Berger, P. Grubwieser, H.S. Mogensen, N. Morling, K. Nielsen, J.J. Sanchez, E. Petkovski, Á. Carracedo, P. Sanchez-Diz, E. Ramos-Luis, M. Brion, J.A. Irwin, R.S. Just, O. Loreille, T.J. Parsons, D. Syndercombe-Court, H. Schmitter, B. Stradmann-Bellinghausen, K. Bender, P. Gill, Analysis of artificially degraded DNA using STRs and SNPs - results of a collaborative European (EDNAP) exercise, Forensic Sci. Int. 164 (2006) 33-44.
[3] P. Wiegand, M. Kleiber, Less is more - length reduction of STR amplicons
using redesigned primers, Int. J. Legal Med. 114 (2001) 285-287. [4] J.M. Butler, Y. Shen, B.R. McCord, The development of reduced size STR
amplicons as tools for analysis of degraded DNA, J. Forensic Sci. 48 (2003) 1054-1064.
[5] P. Gill, An assessment of the utility of single nucleotide polymorphisms (SNPs)
for forensic purposes, Int. J. Legal Med. 114 (2001) 204-211. [6] B. Sobrino, M. Brión, Á. Carracedo Á, SNPs in forensic genetics: a review on
SNP typing methodologies, Forensic Sci. Int. 154 (2005) 181-194. [7] C. Lalueza-Fox, J. Bertranpetit, J.A. Alcover, N. Shailer, E. Hagelberg,
Mitochondrial DNA from Myotragus balearicus, an extinct bovid from the Balearic Islands, J. Exp. Zool. 288 (2000) 56-62.
[8] J.J. Sánchez, C. Phillips, C. Børsting, K. Balog, M. Bogus, M. Fondevila, C.D.
Harrison, E. Musgrave-Brown, A. Salas, D. Syndercombe-Court, P.M. Schneider, Á. Carracedo, N. Morling, A multiplex assay with 52 single nucleotide polymorphisms for human identification, Electrophoresis 27 (2006) 1713-1724.
[9] C. Phillips, A. Salas, J.J. Sánchez, M. Fondevila, A. Gómez-Tato, J. Álvarez-
Dios, M. Calaza, M. Casares de Cal, D. Ballard, M.V. Lareu, Á. Carracedo, The SNPforID Consortium: inferring ancestral origin using a single multiplex assay of autosomal ancestry-informative marker SNPs, Forensic Sci. Int. Genet. 1 (2007) 273-280.
[10] M.D. Coble, J.M. Butler, Characterization of new miniSTR loci to aid analysis of
degraded DNA, J. Forensic Sci. 50 (2005) 43-53. [11] C.R. Hill, M.C. Kline, J.J. Mulero, R.E. Lagace, C.W. Chang L.K. Hennessy
J.M. Butler, Concordance study between the AmpFlSTR MiniFiler PCR amplification kit and conventional STR typing kits, J. Forensic Sci. 52 (2007) 870-873.
![Page 164: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/164.jpg)
Resultados y Discusión
137
Table 1. Genotyping success using SNP multiplexes (shown as total loci
genotyped)
SNP multiplex Total loci
Classical extraction
Ancient DNA extraction
52plex PCR + Auto1 extension (23plex) 23 21 21 52plex PCR + Auto2 extension (29plex) 29 26 28 dedicated 23plex PCR + SBE 23 20 23 dedicated 29plex PCR + SBE 29 26 29 34plex AIMs 34 31 34
![Page 165: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/165.jpg)
Resultados y Discusión
138
Table 2. Genotyping success using short-amplicon STR. Individual genotypes are
shown for ancient DNA extraction only, listed from shortest to longest first allele.
Results in brackets represent peaks in reference positions but with signal strength
between 30-50 RFU, these genotypes were not used in paternity calculations. OL:
off ladder peaks outside of reference position.
STR multiplex Locus Ladder allele range Size range Femur Daughter MiniFiler™ CSF1PO 6-15 88-124 10 10 D16S539 5/8-15 91-119 - 9,13 amelogenin X-Y 104/109 X(Y) XX D13S317 8-15 106-134 11 8,11 D2S1338 15-28 123-175 16,21 21 D18S51 7-27 128-208 16 12,16 FGA 17-33.2/53.2 151-213/293 OL 23,28 D7S820 6-15 153-189 - 8,12 D21S11 24-38 190-250 (24,29) 27,29 Mini-NC01 D22S1045 8/10-19 74-109 16 16 D10S1248 9-19 83-123 14,16 14,16 D14S1434 9-16 85-106 14 14 Mini-SGM TH01 3-14 58-102 7,9.3 6,9.3 D16S539 3-17 70-126 (OL,10) 9,13 D2S1338 15-30 94-154 - 21 D18S51 5-29 101-197 - 12,16 amelogenin X-Y 124/130 XY XX FGA 17-33.2/53.2 141-207/287 - 23,28
![Page 166: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/166.jpg)
Resultados y Discusión
139
Table 3. Classification probabilities for SNP profile from femur using the SNPforID
34-SNP ancestry indicative marker set. Ancestry assignment is based on a three
population-group comparison and 120 sample training-set from each group for the
classification algorithm. Likelihood of SNP profile denotes the probability of the
individual ancestry matching that of the training set (the lowest -log likelihood
value equates to the highest probability).
Training set for calculation
-log likelihood of SNP profile
Likelihoods (as exponentials)
Likelihood ratio
Probability expressed as a verbal predicate
European 41.1095 1.401E-18 African 66.9353 8.518E-30
Eur not Afr: 1.644E+11
164 billion times more likely European than African
European 41.1095 1.401E-18 Asian 65.6296 3.144E-29
Eur not Asn: 4.456E+10
44 billion times more likely European than Asian
Asian 65.6296 3.144E-29 African 66.9353 8.518E-30
Asn not Afr: 3.69
![Page 167: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/167.jpg)
Resultados y Discusión
140
Figure legend Figure 1. Photograph of the femur as received at the laboratory prior to cleaning and DNA extraction.
![Page 168: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/168.jpg)
Resultados y Discusión
141
Figure 2. Genotype results obtained from the femur using the ancient DNA extraction protocol. A. AmplSTR® MiniFiler™ STR set, B. SNPforID Auto1 23plex SNP set using a dedicated 23plex PCR, C. NIST Mini-NC01 STR set, D. SNPforID Auto2 29plex SNP set (dedicated 29plex PCR), E. NIST Mini-SGM STR set, F. SNPforID 34plex ancestry indicative marker SNP set. Solid-colour peaks denote identified genotypes except off-ladder (OL) peaks at FGA (plot A) and D16S539 (E) . Solid peaks of STR sets A, C, E are above a pre-determined minimum signal intensity of 50 RFU, solid peaks of SNP sets B, D, F are those within +/- 0.5bp of pre-determined size positions.
A B
C D
E F
![Page 169: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/169.jpg)
![Page 170: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/170.jpg)
Resultados y Discusión
143
III.2: CHALLENGING DNA: ASSESSMENT OF A RANGE OF
GENOTYPING APPROACHES FOR HIGHLY DEGRADED
FORENSIC SAMPLES
M Fondevila, C Phillips, N Naverán, M Cerezo, A Rodríguez, R Calvo, LM
Fernández, Á Carracedo and MV Lareu
(International Congress Series, in press)
![Page 171: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/171.jpg)
![Page 172: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/172.jpg)
Resultados y Discusión
145
Elsevier Editorial System(tm) for Forensic Science International: Genetics
Manuscript Draft
Manuscript Number: FSIGEN-D-07-00461
Title: Challenging DNA: assessment of a range of genotyping approaches for
highly degraded forensic samples
Advances en Forensic Genetics, 12. Ed. Niels Morling. Elsevier. In press
Keywords: STRs; degraded DNA; short-amplicon STR analysis; SNP typing
Corresponding Author: Christopher Phillips
First Author: Manuel Fondevila
Order of Authors: Manuel Fondevila; Christopher Phillips; Nuria Naverán; Maria
Cerezo; Amelia Rodríguez; Raquel Calvo; Luis M Fernández; Ángel Carracedo;
Maria V Lareu
![Page 173: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/173.jpg)
Resultados y Discusión
146
Challenging DNA: assessment of a range of genotyping approaches for highly degraded forensic samples
M Fondevila, C Phillips*, N Naverán, M Cerezo, A Rodríguez, R Calvo, LM
Fernández, A Carracedo and MV Lareu
Institute of legal Medicine, University of Santiago de Compostela, Spain
*Communicating author: e-mail [email protected]
Keywords: STRs; degraded DNA; short-amplicon STR analysis; SNP typing
Abstract: It is common in forensic casework to encounter highly degraded DNA
samples from a variety of sources. In this category bone and teeth samples are
often the principal source of evidential material for criminal investigations or
identification of long-deceased individuals. In these circumstances standard STRs
are prone to fail due to their long amplicon sizes (since DNA becomes
progressively more fragmented as it degrades). To successfully resolve such
cases alternative markers can be used and until recently the only other tool
available was mitochondrial DNA, which despite being more resistant to
degradation, is much less informative. A rapidly developing approach to analyzing
degraded DNA is the typing of loci from short amplicon PCR products based on
markers such as mini-STRs and autosomal SNPs. We have performed an
analysis of several cases with naturally degraded DNA using established STRs
plus mini-STRs and autosomal SNPs in order to make an objective comparison of
the performance of each method using challenging DNA. The main aim was to
establish the benefits and drawbacks of each marker set to help the practitioner
choose the DNA analysis method most suited to the circumstances of each case.
![Page 174: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/174.jpg)
Resultados y Discusión
147
Introduction.
It is common to encounter highly degraded DNA samples in a criminal
investigation or the identification of long-deceased individuals. Most forensic
laboratories have experienced situations where the DNA is so degraded that
normal PCR amplification gives inconclusive results. The quality of genotyping
depends largely on the degradation processes the sample has been exposed to
and these affect typing success in different ways: agents can affect the DNA
structure itself through
the action of nucleases or oxidative damage, while indirectly, the inhibitory effects
of co-extracted agents such as humic acid or degradation by-products can hinder
the PCR reaction. The extent of the degradation process depends on two factors:
time and environmental conditions [1]. Degradative processes accumulate with
time while environmental conditions (temperature, humidity, pH, soil chemistry)
modify the rate and aggressiveness of degradation. Both factors interact in a
complex way so there is no direct correlation between time since death/deposition
of material and the extent of degradation, making it very difficult to set specific
rules for the treatment of any one sample. Fortunately several short-amplicon
genotyping approaches have been recently developed specifically for the analysis
of degraded DNA. This study compares the performance of established and novel
genotyping methods in a range of challenging cases with naturally degraded DNA.
Materials and methods.
We analyzed 15 separate skeletal samples from submitted case-work, in a
range of conditions, each assessed from the performance of standard STR typing.
All cases originated from NW region of Spain: characterized by high annual
rainfall, mild temperatures, and organic–rich, acidic soil. Surviving relatives were
analyzed to obtain reference profiles when available. Prior to DNA extraction,
bones or teeth were thoroughly cleaned with a scalpel/sandpaper. Except for the
most degraded samples, extraction was based on the phenol-chloroform method
with Centricon® column purification. For the most degraded material we used a
second method based on the ancient DNA protocol of Lalueza-Fox et al. [2]
modified to enhance DNA yield. All extracts were quantified with the real-time PCR
![Page 175: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/175.jpg)
Resultados y Discusión
148
Quantifiler® human DNA kit (Applied Biosystems: AB). An internal PCR control
(IPC) in each Quantifiler® reaction identifies material containing PCR inhibitors.
Standard STR typing comprised AmpFlSTR Identifiler® (AB) and PowerPlex16
(Promega) with extract dilutions: neat, 1 in 2, 1/4, 1/8 and 1/16 in tandem PCRs.
Two mini-STR sets were: MiniNC01, developed at NIST [3], and AmpFlSTR
MiniFiler® (AB). SNP typing consisted of two assays: the SNPforID 52plex human
identification SNP set [4] and the SNPforID 34plex population informative AIM-
SNP set [5]. Both sets use an initial PCR followed by a multiplexed primer
extension (52plex comprises tandem 23 and 29plex extension reactions). SNP
assays used undiluted DNA samples throughout.
Results.
Table 1 outlines quantification data and % genotyping success from each
sample. The most significant findings came from a comparison of genotyping
success with data from the Quantifiler® IPC. IPC values higher than 28 indicate
the presence of inhibitors which themselves can affect the quantification, so
values obtained in these circumstances are less indicative of the actual DNA
levels in an extract. Furthermore, values suggesting high DNA concentrations do
not often equate to sufficient quantities of intact high molecular weight target to
ensure successful PCR of standard STRs. We countered inhibitory effects by
diluting extracts so although less DNA was applied, inhibition was reduced. Most
samples gave complete profiles with each multiplex once inhibition reducing
methods were applied. Table 1 shows that simple dilution of the extract is, in
nearly all cases, enough to enhance the genotyping success rate suggesting that
inhibitors play a critical role in reducing PCR efficiency in severely degraded
samples. However long amplicon systems (leftmost in Table 1) appear to be more
affected by PCR inhibitors, either due to a lower initial undegraded target
concentration, a less efficient DNA polymerization, or both. In contrast SNP typing
shows relative immunity from PCR inhibition effects since these systems are likely
to benefit from a higher initial concentration of intact target plus more efficient
(shorter) polymerization steps. If amplicon length is an important factor with or
without inhibition control then the success rate should be expected to rise as
amplicon size diminishes. This was observed with the standard amplicon STRs,
![Page 176: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/176.jpg)
Resultados y Discusión
149
since Powerplex16 showed the highest overall failure rate. This trend continued as
the degree of degradation rose, and longer Identifiler® loci failed to amplify
(amplicons up to 380bp) followed by MiniFiler® (amplicon up to 300bp). The
performance of mini-STR loci between 100-300bp does not differ markedly,
however STR products below 100bp, notably those of MiniNC01 (all amplicons
<120bp) appear to be resistant to the most aggressive degradation. in the
samples of this study. It can also be suggested that a small-scale triplex PCR
using amplicons much shorter than average is likely to be more efficient when
intact target DNA is at low levels in the extract. In comparison SNP multiplexes
clearly do not need to be small-scale in scope to achieve efficient amplification of
highly degraded DNA. An additional advantage of the SNP assays developed by
SNPforID is that the genotyping reaction is separated from the initial PCR so
amplicons of similar length, often much shorter than 100bp, can be combined with
ease. The above findings suggest that for most degraded material standard STR
typing methods will suffice if inhibition is properly assessed and controlled prior to
PCR. However a further level of degradation, characterized by extremely
aggressive environmental conditions over long periods of time can present the
most challenging analyses. This applies to two femurs we analyzed: 78p03 was
from a 35y internment in a tomb with warm, damp, acid conditions, both epiphyses
were missing and the bone had a loose, sawdust form with extensive mould
growth; 70-06 was from skeletal remains half buried for 10y in forest soil (damp,
acid and organic-rich conditions) that were discovered after a severe forest fire
which badly charred the remaining tissue/bone surfaces. High molecular weight
DNA was absent from samples and all standard STRs failed, together with most
mini-STR loci. In contrast, successful amplification of the shortest amplicon mini-
STRs and all SNP multiplexes indicated that short, fragmented DNA was present
in enough quantity for efficient PCR of these systems. Run in parallel for these
samples; the standard protocol DNA extracts amplified poorly compared to those
from the ancient DNA protocol (respectively: 22.2% vs. 44% success with
MiniFiler® and 85% vs. 100% with SNP typing). The ancient DNA extraction
method had a major impact on DNA recovery and typing success for MiniNC01
and autosomal SNPs. Improved DNA yield with the ancient DNA protocol also
helped to control inhibition in all systems by allowing greater levels of dilution.
![Page 177: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/177.jpg)
Resultados y Discusión
150
Conclusions.
An optimum analysis method for degraded DNA can be chosen between
standard STRs and short amplicon STRs combined with SNP typing depending on
several key factors: the likely state of degradation, initial visual exploration of the
sample upon receipt, volume of extract obtained and quantification results,
particularly IPC values detected. Generally DNA fragments up to 300bp should be
present (even in low concentration), and these can be successfully amplified with
any approach if inhibition is properly managed. Our analysis of two cases with
extremely degraded material indicates that SNPs and small-scale mini-STR
assays amplifying DNA from extraction procedures optimized for both yield and
inhibition, offer the best approach.
References. [1] J Burger, S Hummel, B Herrmann, W Henke (1999) Electrophoresis 20:1722–
1728
[2] C Lalueza-Fox, J Bertranpetit, JA Alcover, N Shailer, E Hagelberg (2000) J.
Exp. Zool. 288:56–62
[3] D Michael, M Coble, JM Butler (2005) J. Forensic Sci. 50:43–53.
[4] JJ Sanchez, C Phillips, C Børsting, K Balogh, M Bogus, M Fondevila, CD
Harrison, E Musgrave-Brown, A Salas, D Syndercombe-Court, PM Schneider,
A Carracedo, N Morling (2006) Electrophoresis 27:1713–1724
[5] C Phillips, A Salas, JJ Sanchez, M Fondevila, A Gómez-Tato, J Álvarez-Dios,
M Calaz, M Casares de Cal, D Ballard, MV Lareu MV, Á Carracedo, The
SNPforID Consortium (2007) Forensic Sci. Int. Genetics: accepted for
publication
![Page 178: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/178.jpg)
Resultados y Discusión
151
Table 1. Genotyping success of 15 cases involving challenging DNA, with extracts
in order of increasing success rate using Powerplex16 (this assay comprises
longest overall amplicon sizes). Values for each multiplex denote % success as
proportion of full genotypes observed in undiluted extract (inhibition) and at
optimum dilution (corrected). Multiplexes arranged in ascending order left to right
of total genotyping success. ND = not determined, IPC = internal PCR control.
![Page 179: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/179.jpg)
![Page 180: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/180.jpg)
Resultados y Discusión
153
III.3: PATTERNS OF DNA DAMAGE IN ATAPUERCA’S BRONZE
AGE POPULATION
Nuria Naverán, Carles Lalueza-Fox, María Lourdes Sampietro, María Martinón-
Torres, José María Bermúdez de Castro, María Victoria Lareu, Antonio Salas,
Ángel Carracedo
(Manuscript in preparation)
![Page 181: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/181.jpg)
![Page 182: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/182.jpg)
Resultados y Discusión
155
PATTERNS OF DNA DAMAGE IN ATAPUERCA’S BRONZE AGE
POPULATION
Nuria Naverán1, Carles Lalueza-Fox2, María Lourdes Sampietro3, María
Martinón-Torres4, José María Bermúdez de Castro4, María Victoria Lareu1,
Antonio Salas1, Ángel Carracedo1
1Unidad de Genética, Instituto de Medicina Legal, Universidad de Santiago de
Compostela, San Francisco s/n, Santiago de Compostela, Galicia 15782, Spain 2Unitat d’Antropologia, Dept. de Biologia Animal, Facultat de Biologia, Universitat
de Barcelona, 08028 Barcelona, Spain 3Unitat de Biologia Evolutiva, Facultat de Ciències de la Salut i de la Vida,
Universitat Pompeu Fabra, 08003 Barcelona, Spain 4Centro Nacional de Investigación Sobre la Evolución Humana, Avenida de la Paz
28, 09004 Burgos, Spain
Correspondence: Nuria Naverán, Unidad de Genética, Instituto de Medicina
Legal, Universidad de Santiago de Compostela, San Francisco s/n, 15782
Santiago de Compostela, Spain
E-mail: [email protected]
Fax:+34-98-1580336
Abbreviations: HVS, hypervariable segment; mtDNA, mitochondrial DNA; Ct, cycle threshold parameter
Keywords: ancient DNA; Atapuerca; Hotspots; mtDNA; post-mortem damage
![Page 183: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/183.jpg)
Resultados y Discusión
156
Post-mortem damage, involving strand breaks and cross-linking of the
double-strand DNA and spurious DNA nucleotide changes, represents one of the
main drawbacks to obtaining reliable DNA sequences from an ancient specimen.
In this paper we have analyzed sequence variation within mitochondrial DNA
(mtDNA) sequences from an ancient population of Bronze Age from Atapuerca
(Spain) to explore the patterns of DNA damage present in samples recovered from
relatively warm environments.
The data indicates that the high temperature and humidity of the Atapuerca
mountain range seems to have seriously damaged the DNA. Our results indicate
that DNA quantification (less than 1,000 initial copies of template DNA is likely to
produce irreproducible results) is crucial to monitor artefacts.
The data from this study indicates that ancient DNA results must be treated with
caution, and we strongly suggest that some techniques should be applied
systematically in ancient DNA studies in order to filter out those artefacts that
frequently pass unnoticed during lab monitoring.
![Page 184: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/184.jpg)
Resultados y Discusión
157
1. Introduction The aim of the present study was to apply ancient DNA techniques to
retrieve mitochondrial DNA (mtDNA) sequences from the Bronze Age Atapuerca’s
Mountain range (Spain). The Cave of El Mirador opens on to the most meridional
slope of the Mountain range of Atapuerca, a region widely known in the scientific
literature by its important prehistoric archaeo-paleontological deposits.
The archaeological excavations of El Mirador Cave, initiated in 1999, has
allowed the documentation of a Holocene stratigraphic succession of 2.5 meters in
height, consisting of both Neolithic and Bronze Age levels.
Six stratigraphic levels, labelled MIR1 to MIR6, were differentiated. The presence
of human remains was been documented within MIR3 and MIR4. Part of these
bones were dispersed in the different occupation surfaces, thus apparently outside
their original context. During the excavation of MIR4, an intentional accumulation
was documented, formed by about 200 human remains, belonging to a minimum
of six individuals.
The El Mirador inhumation is chronologically located in the Middle or Late
Bronze Age, with some remains corresponding to individuals of the Old Bronze
Age. Radiometric 14C dating of the samples identified them as approximately
3,400 years old [1,2].
2. Material and methods 2.1 Samples
Nineteen teeth recovered from 11 mandibles (labelled from ATA1 to
ATA11) were used for DNA extraction, both because the relatively impervious
outer enamel layer provides a degree of protection from contaminating DNA
sources, and because it has been demonstrated previously that teeth yield higher
amounts of DNA than bone in many environments [3,4].
In Santiago de Compostela University one tooth from every mandible was
analyzed, except for ATA7 and ATA5 from which two teeth from each mandible
were examined. Samples ATA1, ATA2, ATA3, ATA4, ATA6 and ATA11 were sent
for replication to the Pompeu Fabra University in Barcelona.
The teeth were washed with bleach and ethanol. Fungible material was
autoclaved and UV light was used for 30 minutes to eliminate possible external
contaminants. Since we were working with museum material, we avoided drilling
![Page 185: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/185.jpg)
Resultados y Discusión
158
the teeth samples completely in order to preserve the pieces. Therefore, the
pieces were cut transversely and powder derived from the dentine and pulp cavity
was taken from inside of each tooth.
All DNA-preparation and DNA-extraction methods followed strict aDNA-specific
requirements, such as dedicated ancient DNA laboratories and the use of
coveralls, face masks and sterile gloves [5,6].
2.2 DNA extractions
DNA was extracted from approximately 10 mg of bone following the phenol-
chloroform method described in [7]. The sample was powdered and decalcified
overnight with 10ml of 0.5M EDTA pH 8.0 at 37ºC; after centrifugation, the
supernatant was removed, and the remaining sample was incubated overnight at
50ºC with 8.5 ml of water, 1ml 5% SDS, 0.5 ml 1M Tris-HCl pH 8.0 and 50 µl of
1mg/ml Proteinase K.
After incubation, the digest was extracted three times, first with phenol, second
with phenol-chloroform and third with chloroform, and the aqueous phase was
concentrated by dialysis centrifugation using Centricon Centrifugal Filter Devices
(Amicon, Millipore).
Extraction and amplifications controls were used in each step of the analysis,
adopting the standard precautions of ancient DNA studies.
2.3 DNA quantification
DNA quantification has become an essential analysis that is aimed at
ensuring the quality of PCR-based studies that are performed on templates that
have initial low copy number and/or contain highly damaged DNA [8-10]. This is
because in vitro nucleotide misincorporations could also have a significant impact
on the accuracy of mitochondrial DNA (mtDNA) sequence analyses if PCR-
amplifications start from very few copies or even single DNA molecules. This
scenario could be further complicated if samples are also subjected to
degradation, to base pair modification, or to different contamination levels.
Therefore, the estimation of the number of human DNA template molecules by
real-time quantitative PCR is very useful tool with which to assess the quality of
the ancient extracts. Some authors [11] suggest that any quantification assay
would be valid only for each specific primer pair; in particular, due to degradation
![Page 186: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/186.jpg)
Resultados y Discusión
159
of the endogenous DNA, different quantities of different length fragments would be
present in a ancient DNA extract.
The human mtDNA assay was designed not only for quantification purposes,
but also to evaluate the DNA degradation state by targeting two different fragment
sizes (107 and 278 bp) within the HVS1 region. This additional information
(number of copies in each size category) is very helpful to evaluate the
authenticity of some DNA sequencing results. Since ancient DNA is fragmented,
the amplification efficiency should be inversely correlated with the length of
amplification [5].
The number of copies was calculated from the molecular weight of the
fragments using Avogadro’s number (6.0223x1023) and the DNA concentration.
We undertook PCR on the two different fragment sizes within the hypervariable
region I (HVS1) of the mtDNA control region.
The primer sequences for the small fragment were: L16001-
ACCATTAGCACCCAAAGCTAAGA; H16065-GCGGTTGTTGATGGGTGAGT,
while for the long fragment: L16088-TCACCCATCAACAACCGCTAT; H16344-
GGGACGAGAAGGGATTTGACT [12]. A standard for use in the reaction to enable
absolute quantification was synthesised through the PCR amplification and
subsequent purification and quantification of a 667bp human HVS1 fragment. This
fragment included the two amplicons (107 and 278 bp) targeted by two-colour 5’
nuclease assay. Probes and the PCR conditions used are as described in [8].
The cycle threshold parameter (Ct) was determined by the SDS software
(Applied Biosystems) as the fractional cycle number at which the fluorescence
passes the fixed threshold setting.
2.4 DNA amplifications and sequencing
The study carried out in the laboratory of Santiago de Compostela was
replicated in the laboratory of the Universidad Pompeu Fabra of Barcelona.
In the Santiago de Compostela laboratory, PCR amplifications were
performed in 25 µl reactions with 1 to 4 µl of extract to check the inhibition, 2.5 U
Taq Polimerase and 1x buffer (Invitrogen), 0.16 mg/ml BSA, 1.5 mM MgCl2, 0.2
mM dNTPs and 0.2 µM of each primer; the PCR profile was 36 cycles of 95º for 10
sec, 58º for 30 sec and 72º for 30 sec, with a first denaturation step of 95º for 1
min and 15º for 10 min for final extension.
![Page 187: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/187.jpg)
Resultados y Discusión
160
In the Barcelona laboratory, PCR amplifications were performed in 25 µl reactions
with 1 µl of extract, 1 U Taq Polimerase and 1x Buffer (Ecogen), 2 mg/ml BSA, 2.5
mM MgCl2, 0.25 mM dNTPs and 1 µM of each primer; the PCR profile was 40
cycles of 94º for 1 min, 50º for 1 min and 72º for 1 min, with a first denaturation
step of 94º for 5 min.
Several negative controls (in the extraction and PCR controls without template)
were added to each PCR reaction. No positive controls were used at any step of
the amplification process. No amplification products were obtained in the negative
controls for extraction and amplification. Thus, there was no external evidence for
contamination during this research.
PCR products were visualised on 1.6% low-melting point agarose gels, and the
appropriate bands were excised from the gel, melted at 65º for 20 min, eluted in
100-150 µl of sterile water and subjected to a second PCR.
In the Santiago de Compostela lab, the second PCR was performed as with
the first PCR reaction, while in Barcelona, the PCR conditions were slightly
different: 35 cycles of 94º for 45 sec, 50º for 45 sec and 72º for 1 min, with a first
denaturation step of 95º for 30 seconds with limiting primers and MgCl2.
Several sets of overlapping primers (Data no shown) were used to amplify 400
bp of the HVS-I region, between positions 15,997 and 16,401 [13].
Sequencing was performed on both strands. We used Rhodamina Termination Kit
(Applied Biosystems) with 2.5 µl of purified PCR product. The sequences were
purified through ethanol precipitation, and the fragments were analyzed using an
ABI 3100 DNA Sequencer (Applied Biosystems).
2.5 Plasmid Cloning
PCR products were cloned in Santiago de Compostela using the TOPO TA
Cloning Kit (Invitrogen) according to the supplier’s instructions. Screening of white
recombinant colonies was accomplished by PCR, transferring the colonies into a
25 µl reaction mix with 1x buffer, 1.5 mM MgCl2, 0.2 µM of each primer (M13
forward and reverse universal primers), 0.2 µM of each dNTP, and 2.5 U of Taq
Polymerase. After 10 min at 94ºC, 30 cycles of PCR (1 min at 95ºC, 1 min at
55ºC, 1 min at 72ºC) with a final extension of 10 min at 72ºC; were carried out,
and clones with an insert of the expected size were identified by polyacrylamide
![Page 188: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/188.jpg)
Resultados y Discusión
161
gel electrophoresis (T9, C5). After purification of these PCR products with
Centricon Centrifugal Filter Devices (Amicon, Millipore), a volume of 2.5 µl was
sequenced as above.
SureClone Ligation Kit (Amersham Pharmacia) was used to clone the PCR
products in Barcelona. Cells were grown in LB medium, plated on IPTG/5-bromo-
4-chloro-3-indolyl B-D-galactoside (X-Gal) agar plates and incubated overnight at
37ºC. White colonies (containing the insert) were transferred to PCRs and
sequenced.
3. Results DNA concentration was estimated for each sample by Real Time PCR,
indicating that the extracts contained low concentration of highly degraded DNA.
Figure 1 shows the standards and the samples. The data indicates that the
template copy number within the ancient samples is much lower than the lowest
standard (1,200 molecules). Furthermore, for a significant proportion of the
samples (75%) we could not detect amplification signals for the longer fragment.
This further indicates the high levels of degradation of the DNA.
Samples from skeletons ATA1 - ATA11 were studied in the Santiago de
Compostela laboratory. The direct sequences were acceptable although contained
suspicious heteroplasmies which required clarification through subsequent cloning
reactions.
In the Barcelona laboratory, samples ATA1-ATA4, ATA6 and ATA11 were
replicated using larger amplicons, and smaller fragments when necessary The
direct sequences obtained were of low quality, and therefore was necessary to
clone every fragment. Between six and ten clones were sequenced for each
fragment. Although some contained the correct insert, a large number of clones
also contained DNA fragments showing high homology with different species such
as Mus musculus, Drosophila Melanogaster, Pseudomonas aeruginosa,
Arabidopsis thaliana, Caenorhabditis elegans, Rattus norvegicus, and also a 190
bp fragment of Macaca fuscata that was previously analyzed in Barcelona’s
laboratory.
![Page 189: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/189.jpg)
Resultados y Discusión
162
In some clones, we observed sequences of several primer repetitions in tandem,
arranged in different ways, in the reverse and in the forward sense.
In general, all these results clearly pointed to a suboptimum preservation of
the DNA samples.
Ancient DNA sequences are prone to erroneous sequence content due to the
phenomena of nucleotide misincorporations; the cloning of PCR products reveals
a higher presence of these changes than in PCR products from modern DNA
extracts. Hansen has described post mortem damage derived transitions into two
groups, termed “Type 1” (adenine guanine/thymine cytosine) and “Type 2”
(cytosine thymine /guanine adenine) in response to the innate uncertainty as
to the original causes of the miscoding lesions [14]. In earlier studies it has been
argued that the different transition types are due to only two modifications, Type 1
caused by Adenine deamination to hypoxanthine [15] and Type 2 caused by
Cytosine deamination to Uracil [10,15]. However, two recent studies using data
generated on the 454 parallel pyrosequencer have modified these views,
indicating that Type 1 damage events are exceedingly rare, and observed
phenotypes of Type 1 damage are likely derived from PCR errors. Furthermore,
although it was recently argued that Type 2 damage can be explained through
both the deamination of Cytosine to Uracil, and an as yet undescribed modification
of Guanine to an Adenine analogue [16,17], even more recent studies have
confirmed the original hypothesis, that Cytosine to Uracil changes are the sole
cause [18]. Table 1 displays the counts of type 1 and type 2 transitions observed
in this study, and the relation between them. As identified previously [15] transition
type 2 predominant among the observations (73%). The number of transitions and
transversions observed in each sample is also displayed. Also in accordance with
previous observations [10,15,16,19-21] transitions constitute the majority of the
damage (up to, ~90%), with transversions representing only ~10%.
The number and kind of singletons and consistent substitutions (CS) observed in
the clones (according to the definition of Hofreiter [10]) are shown in Table 2. CS
have been explained as those mistakes caused by damaged DNA molecules;
what it is a common phenomenon when the number of starting molecules is very
low [10]. Therefore the PCR starts from only one or a few molecules that are likely
![Page 190: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/190.jpg)
Resultados y Discusión
163
to be damaged. On the other hand, singletons are caused in the DNA molecules
by errors produced in the latest cycles of the PCR or by the cloning process.
TS type 2, C to T, is the most frequent in our data; showing us that the
lesion affecting cytosine residues is very likely to be deamination [16,17].
We also observed a large number of T to C changes, while the complementary
change (A to G) was not observed. As recent studies have suggested that such
Type 1 transitions are likely to be PCR artefacts, and not damage [16,17] these
are unlikely to be derived from damage.
Gilbert [15] has compared the distribution of post mortem damage events
with in vivo mutational hotspots from a number of studies to indicate that some
similarities exist between the positions that undergo damage and mutation. The
nucleotide changes that were modified in the clones analyzed in our data are
shown in Table 3. We have compared these variants with the mutational spectra
provided by Gilbert [15] based on a compilation of aDNA studies and with the
modern DNA mutational spectra described by Bandelt [22]. We observed that the
majority of positions listed by Gilbert [15] with high post-mortem mutation rate are
in good agreement with the known hypermutable sites known for modern human
populations.
The Hotspots positions describe in Bandelt [22] agree with positions with
positions where we observe a lot of damage. Positions that Gilbert does not find,
are founded in the actual work and one of those with very significant changes that
is also presented by Bandelt like Hotspot.
It is also found a region with low post-mortem damage rate, LDR1 [21]. And the
region that shows a larger number of changes is between positions 16126 to
16362; which is the more informative region of HVS-1.
4. Discussion
The presence of post-mortem damage in ancient DNA limits our ability to
obtain DNA of reasonable quality from ancient specimens. Some damage, such as
hydrolytic deamination and depurination does not block the replication action of
the polymerase, and therefore can be detected among cloned sequences [23].
![Page 191: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/191.jpg)
Resultados y Discusión
164
Alternate kinds of damage involve baseless sites, breaks and cross-links in the
double-strand DNA molecule that leads to enzymatic replication inhibition [24].
Such damages interfere to different extents with common PCR procedures used in
aDNA studies [25].
Although controversial, the quantification of ancient extracts can provide an
estimate of the quality of DNA extracts from ancient samples. The Real-Time PCR
assay yielded very low molecules (and only positive results for the short fragment),
which is congruent with the notorious presence of damages among the
sequences.
The possibility of unknown impurities in the ancient samples that could produce
inhibition in the PCR reaction and the spurious emergence of damage patterns
cannot be excluded; however, the inclusion of a dilution series of the extracts did
not improve the amplification efficiency of the samples to any observable extent.
Therefore, we conclude from the Real-Time PCR results that the low DNA level in
our samples is a result of their poor preservation condition.
It has been suggested that when the initial template quantity is >1,000
copies, post-mortem damage rates are unlikely to bias the results [23,26].
However, when few DNA templates initiate a PCR, the resulting sequences are
likely to contain artefacts and several repetitions become necessary.
Although more than one independent PCR was performed to verify the
sequence, the heterogeneity of the sequences presents in the clones show us the
difficulty of obtaining the real sequence of our samples.
When the clones are analyzed and the changes are counted, a bias to
cytosine deamination is observed. Postmortem damage may explain many
unusual results obtained from ancient human remains such as the sequences of
Lake Mungo in [27].
In ATA11 we saw C to T changes that were described together in Feldhofer 1
(16107, 16111 and 16112) [23], these substitutions were reproducible, however,
there are several reasons why these positions should be regarded with caution,
they have been observed neither in the others Neandertal mtDNA sequences nor
in mtDNA sequences from contemporary humans. One explanation given [28] is
![Page 192: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/192.jpg)
Resultados y Discusión
165
that they may represent deaminated cytosine residues resulting in nucleotide
misincorporation during PCR.
In vivo observations indicate that mutational transitions occur at rates
approximately thirty times higher than transversions [29]. However in our study the
observed rate is only ten times bigger. This might be explained as “in vivo” many
damage events that potentially lead to mutations are repaired, altering the
resulting spectrum. As expected, the following consistent substitutions (positions
that appear consistently in clones) were detected in our samples: C T/G A
and T C. Meanwhile the singletons do not follow any observable pattern, with a
range of potential changes being observed among them.
The mutation spectra detected in our samples fits well (especially for hotspots)
with the one previously observed by others using ancient DNA [21] or observed in
natural populations [22]. And also these positions appear in works like cancer,
where most of the tumor-associated changes are common human polymorphisms
and mutational hotspots [30]. It has been suggested that the variation in rates of
damage is related to DNA secondary and tertiary structure [31], and it is possible
that the same sites might also be susceptible to post-mortem damage [21].
Cross-links between reducing sugars and amino groups were shown to
exist in aDNA samples [32]. That was seen when it was possible to amplify DNA
sequences thanks to the use of a chemical agent that breaks the cross-links, N-
phenacylthiazolium bromide (PTB) [33]. This is another phenomena to take into
account, probably the low success in our PCRs is due to the existence of inter or
intramolecular cross-links that avoid the amplification. Another explanation of such
number of damage positions that agree very well with hotspots is that our DNA
extracts could have a mutagenic effect under PCR [34].
It is generally assumed that cold and dry conditions are the most favourable
for DNA preservation. But in places where the temperatures are too high it is
shown the impossibility of retrieving DNA. Cooper suggests that pre-Holocene
hominid material from most southern European and northern African areas will be
unsuitable for molecular analyses [35]. Gilbert argues that the rate-determining
step in DNA degradation is hydrolytic depurination; processes such as dehydration
or encapsulation may retard this process, while others such as oxidation or
![Page 193: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/193.jpg)
Resultados y Discusión
166
wetting/drying cycles would accelerate DNA damage [36]. They are not the only
ones who express an opinion about this topic, it is generally agreed [37-39] that
the state of conservation is strongly correlated with the temperature of the site.
Although our samples are situated in the Holocene, only 3,500 YBP; the high
temperatures and the humidity of this mountain range of Atapuerca, do not appear
suitable for the preservation of good quality DNA. Not everybody agrees with this,
recently a couple of papers appeared [40,41] where DNA results were reported
from this archaeological site. In one of those, the samples were 300,000 years old
[40], which seems amazing in comparison to the results of this present work. It
could be that the technique (very short PCR product) that they used was better to
obtain the DNA and/or the conditions of the buried site of those old samples were
different and therefore suitable for recovering the DNA.
![Page 194: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/194.jpg)
Resultados y Discusión
167
5. References
[1] S. Moral del Hoyo La cueva de el Mirador: La edad de Bronce en la sierra
de Atapuerca, Ediciones Sierra de Atapuerca.
[2] J.M. Vergés, E. Allué, D.E. Angelucci, A. Cebriá, C. Díez, M. Fontanals, A.
Manyanós, S. Montero, S. Moral, M. Vaquero and J. Zaragoza La sierra de
Atapuerca durante el Holoceno: Datos preliminares sobre las ocupaciones
de la Edad de Bronce en la Cueva de el Mirador (Ibeas de Juarros,
Burgos), Trabajos de Prehistoria 59 No.1 (2002) 107-126.
[3] K. Kurosaki, T. Matsushita and S. Ueda Individual DNA identification from
ancient human remains, Am. J. Hum. Genet. 53(3) (1993) 638-643.
[4] H. Oota, N. Saitou, T. Matsushita and S. Ueda A genetic study of 2,000-
year-old human remains from Japan using mitochondrial DNA sequences,
Am. J. Phys. Anthropol. 98(2) (1995) 133-145.
[5] S. Pääbo, H. Poinar, D. Serre, V. Jaenicke-Desprès, J. Hebler, N. Rohland,
M. Kuch, J. Krause, L. Vingilant and M. Hofreiter Genetic Analyses From
Ancient DNA, Annu. Rev. Genet. 38 (2004) 645-679.
[6] A. Cooper and H. Poinar Ancient DNA: Do it right or not at all, Science 289
(2000) 1139.
[7] C. Lalueza-Fox, J. Bertranpetit, J.A. Alcover, N. Shailer and E. Hagelberg
Mitochondrial DNA from Myotragus balearicus, an extinct bovid from the
Balearic Islands, Journal of experimental zoology (Mol Dev Evol) 288
(2000) 56-62.
[8] A. Alonso, P. Martín, C. Albarrán, P. García, O. García, L. Fernández de
Simón, J. García-Hirschfeld, M. Sancho, C. De la Rúa and J. Fernández-
Piqueras Real-time PCR designs to stimate nuclear and mitochondrial DNA
copy number in forensic and ancient DNA studies, Forensic Science
International 139 (2004) 141-149.
[9] A. Alonso, P. Martín, C. Albarrán, P. García, D. Primorac, O. García, L.
Fernández de Simón, J. García-Hirschfeld, M. Sancho and J. Fernández-
Piqueras Specific Quantification of Human Genomes from Low Copy
Number DNA Samples in Forensic and Ancient DNA Studies, Croatian
Medical Journal 44 (2003) 273-280.
![Page 195: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/195.jpg)
Resultados y Discusión
168
[10] M. Hofreiter, V. Jaenicke, D. Serre, A.v. Haeseler and S. Pääbo DNA
sequences from multiple amplifications reveal artefacts induced by cytosine
deamination in ancient DNA, Nucleic Acids Research 9, No. 23 (2001)
4793-4799.
[11] M.T.P. Gilbert, H.-J. Bandelt, M. Hofreiter and I. Barnes Assessing ancient
DNA studies, TRENDS in Ecology and Evolution 20 (2005) 541-544.
[12] M.L. Sampietro, D. Caramelli, O. Lao, F. Calafell, D. Comas, M. Lari, B.
Agustí, J. Bertranpetit and C. Lalueza-Fox The genetics of the Pre-Roman
iberian peninsula: a mtDNA study of ancient iberians, Annals of Human
Genetics 69 (2005) 1-14.
[13] S. Anderson, A.T. Bankier, B.G. Barrell, M.H.L. De Brujin, A.R. Coulson, J.
Drouin, I.C. Eperon, D.P. Nierlich, B.A. Roe, F. Sanger, P.H. Schreier,
A.J.H. Smith, R. Staden and I.G. Young Sequence and organization of the
human mitochondrial genome, Nature 290 (1981) 457 - 465.
[14] A.J. Hansen, E. Willerslev, C. Wiuf, T. Mourier and P. Arctander Statistical
evidence for miscoding lesions in ancient DNA templates, Molecular
Biology & Evolution 18 (2) (2001) 262-265.
[15] M.T.P. Gilbert, A.J. Hansen, E. Willerslev, L. Rudbeck, I. Barnes, N.
Lynnerup and A. Cooper Characterization of Genetic Miscoding Lesions
Caused by Postmortem Damage, Am. J. Hum. Genet. 72 (2003) 48-61.
[16] M. Stiller, R.E. Green, M. Ronan, J.F. Simons, L. Du, W. He, M. Egholm,
J.M. Rothberg, S.G. Keats, N.D. Ovodov, E.E. Antipina, G.F. Baryshnikov,
Y.V. Kuzmin, A.A. Vasilevski, G.E. Wuenschell, J. Termini, M. Hofreiter, V.
Jaenicke-Despres and S. Paabo Patterns of nucleotide misincorporations
during enzymatic amplification and direct large-scale sequencing of ancient
DNA, Proc Natl Acad Sci U S A 103 (2006) 13578-13584.
[17] M.T.P Gilbert, J. Binladen, W. Miller, C. Wiuf, E. Willerslev, H. Poinar, J.E.
Carlson, J.H. Leebens-Mack and S.C. Schuster Recharacterization of
ancient DNA miscoding lesions: insights in the era of sequencing-by-
synthesis, Nucleic Acids Res 35 (2007) 1-10.
[18] P. Brotherton, P. Endicott, J.J. Sanchez, M. Beaumont, R. Barnett, J. Austin
and A. Cooper Novel high-resolution characterization of ancient DNA
reveals C > U-type base modification events as the sole cause of post
mortem miscoding lesions, Nucleic Acids Res (2007).
![Page 196: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/196.jpg)
Resultados y Discusión
169
[19] M.T.P. Gilbert, R.C. Janaway, D.J. Tobin, A. Cooper and A.S. Wilson
Histological correlates of post mortem mitochondrial DNA damage in
degraded hair, Forensic Sci Int 156 (2006) 201-207.
[20] J. Binladen, C. Wiuf, M.T.P. Gilbert, M. Bunce, R. Barnett, G. Larson, A.D.
Greenwood, J. Haile, S.Y. Ho, A.J. Hansen and E. Willerslev Assessing the
fidelity of ancient DNA sequences amplified from nuclear genes, Genetics
172 (2006) 733-741.
[21] M.T.P. Gilbert, E. Willerslev, A.J. Hansen, I. Barnes, L. Rudbeck, N.
Lynnerup and A. Cooper Distribution Patterns of Postmortem Damage in
Human Mitochondrial DNA, Am. J. Hum. Genet. 72 (2003) 32 - 47.
[22] H.-J. Bandelt, L. Quintana-Murci, A. Salas and V. Macaulay The Fingerprint
of Phantom Mutations in Mitochondrial DNA data, Am. J. Hum. Genet. 71
(2002) 1150-1160.
[23] M. Krings, A. Stone, R.W. Schmitz, H. Krainitzki, M. Stoneking and S.
Pääbo Neandertal DNA sequences and the origin of modern humans, Cell
90 July 11 (1997) 19-30.
[24] S. Pääbo, R.G. Higuchi and A.C. Wilson Ancient DNA and the polymerase
chain reaction, The Journal of Biological Chemistry 264 No.17 (1989) 9709-
9712.
[25] M. Cipollaro, U. Galderisi and G. Di Bernardo Ancient DNA as a
multidisciplinary experience, Journal of Cellular Physiology 202 (2005) 315-
322.
[26] O. Handt, M. Krings, R. Ward and S. Pääbo The retrieval of ancient human
DNA sequences, Am. J. Hum. Genet. Aug;59(2) (1996) 368-376.
[27] G.J. Adcock, E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J.
Peacock and A. Thorne Mitochondrial DNA sequences in ancient
Australians: Implications for modern human origins, PNAS 98 (2001) 537-
542.
[28] R.W. Schmitz, D. Serre, G. Bonani, S. Feine, F. Hillgruber, H. Krainitzki, S.
Pääbo and F.H. Smith The Neandertal type site revisited: Interdisciplinary
investigations of skeletal remains from the Neander Valley, Germany,
PNAS 99 No.20 (2002) 13342-13347.
![Page 197: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/197.jpg)
Resultados y Discusión
170
[29] H.J. Bandelt, Q.P. Kong, M. Richards and V. Macaulay Estimation of
mutation rates and coalescence time: some caveats, Berling: Springer-
Verlag 18 (2006).
[30] A. Vega, A. Salas, E. Gamborino, M.J. Sobrido, V. Macaulay and A.
Carracedo mtDNA mutations in tumors of the central nervous system reflect
the neutral evolution of mtDNA in populations, Oncongene 23(6) (2003)
1314-1320.
[31] E. Heyer, E. Zietkiewicz, A. Rochowski, V. Yotova, J. Puymirat and D.
Labuda Phylogenetic and familial estimates of mitochondrial substitution
rates: study of control region mutations in deep-rooting pedigrees, Am. J.
Hum. Genet. 69 (2001) 1113-1126.
[32] H.N. Poinar, M. Hofreiter, W.G. Spaulding, P.S. Martin, B.A. Stankiewicz,
H. Bland, R.P. Evershed, G. Possnert and S. Pääbo Molecular coproscopy:
Dung and diet of the extinct ground sloth Nothrotheriops shastensis,
Science 281 (1998) 402-406.
[33] S. Vasan, X. Zhang, A. Kapurniotu, J. Bernhagen, S. Teichberg, J. Basen,
D. Wagle, D. Shih, I. Terlecky, R. Bucala, A. Cerami, J. Egan and P. Ulrich
An agent cleaving glucose-derived protein crosslinks in vitro and in vivo,
Nature Julio 18; 382 (6588) (1996) 275-278.
[34] C.M. Pusch and L. Bachmann Spiking of Contemporary Human Template
DNA with Ancient DNA Extracts Induces Mutations Under PCR and
Generates Nonauthentic Mitochondrial Sequences, Molecular Biology &
Evolution 21(5) (2004) 957-964.
[35] A. Cooper, H.N. Poinar, S. Pääbo, J. Radovic, A. Debénath, M. Caparrós,
C. Barroso-Ruiz, J. Bertranpetit, C. Nielsen-Marsh, R. Hedges and B.
Sykes Neandertal Genetics, Science 277 (1997) 1021-1025.
[36] M.T.P. Gilbert, I. Barnes, M.J. Collins, C. Smith, J. Eklund, J. Goudsmit, H.
Poinar and A. Cooper Long-Term Survival of Ancient DNA in Egypt:
Response to Zink and Nerlich (2003), American Journal of Physical
Anthropology 128 (2005) 110-114; discussion 115-118.
[37] M. Höss, P. Jaruga, T.H. Zastawny, M. Dizdaroglu and S. Pääbo DNA
damage and DNA sequences retrieval from ancient tissues, Nucleic Acids
Research 24, No. 7 (1996) 1304-1307.
![Page 198: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/198.jpg)
Resultados y Discusión
171
[38] I. Marota, C. Basile, M. Ubaldi and F. Rollo DNA Decay Rate in Papyri and
Human Remains From Egyptian Archaeological Sites, American Journal of
Physical Anthropology 117 (2002) 310-318.
[39] H.N. Poinar, M. Hoss, J.L. Bada and S. Pääbo Amino acid racemization
and the preservation of ancient DNA, Science 272(5263) (1996) 864-866.
[40] C. Valdiosera, N. Garcia, L. Dalen, C. Smith, R.D. Kahlke, K. Liden, A.
Angerbjorn, J.L. Arsuaga and A. Gotherstrom Typing single polymorphic
nucleotides in mitochondrial DNA as a way to access Middle Pleistocene
DNA, Biol Lett 2 (2006) 601-603.
[41] C. Anderung, A. Bouwman, P. Persson, J.M. Carretero, A.I. Ortega, R.
Elburg, C. Smith, J.L. Arsuaga, H. Ellegren and A. Gotherstrom Prehistoric
contacts over the Straits of Gibraltar indicated by genetic analysis of Iberian
Bronze Age cattle, Proc Natl Acad Sci U S A 102 (2005) 8431-8435.
![Page 199: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/199.jpg)
Resultados y Discusión
172
TA
BLE
1: Sa
mpl
es
TC
“T
ype
1”a
TC
“T
ype
2”b
Typ
e 2
/ Typ
e 1c
TC
d T
Ve
TC
/TV
f R
ange
Si
ze
Num
ber
of
clon
es
Num
ber
of
nucl
eotid
es
anal
yzed
ATA
1-a
1 (1
.15%
) 0
(0%
) 0
1 0
0 16
055–
1614
2 87
2
174
ATA
1-b
6 (3
.12%
) 12
(6.2
5%)
2 18
3
6 16
209–
1640
1 19
2 8
1536
ATA
2-a
2 (2
.30%
) 0
(0%
) 0
2 1
2 16
055–
1614
2 87
2
174
ATA
2-b
5 (2
.6%
) 11
(5.7
3%)
2.2
16
2 8
1620
9–16
401
192
6 11
52
ATA
3 0
(0%
) 4
(2%
) 0
4 3
1.33
16
209–
1640
1 19
2 4
768
ATA
4 1
(0.5
2%)
0 (0
%)
0 1
0 0
1620
9–16
401
192
1 19
2
ATA
6 4
(2%
) 5
(2.6
%)
1.25
9
0 0
1620
9–16
401
192
3 57
6
ATA
11-a
2
(2.3
%)
7 (8
%)
3.5
9 1
9 16
055–
1614
2 87
2
174
ATA
11-b
2
(1.1
%)
23 (1
2%)
11.5
25
0
0 16
209–
1640
1 19
2 4
768
ATA
11-c
2
(1.2
5%)
11 (6
.87%
) 5.
5 13
3
4.33
16
121–
1628
1 16
0 11
17
60
ATA
11-d
10
(6.8
%)
22 (1
5%)
2.2
32
1 32
16
254–
1640
1 14
7 13
19
11
Tot
al
35
(27%
)
95
(73%
) 2.
71
130
(90.
28%
)
14
(9.7
2%)
9.28
91
85
![Page 200: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/200.jpg)
Resultados y Discusión
173
TABLE 1:
a Total number of transitions of type 1 b Total number of transitions of type 2 c Type 2: type 1 transition ratio d Total number of transitions (TC) observed in overall clones of each PCR
amplification.
e Total number of transversions (TV) observed in overall clones of each PCR
amplification.
f Transitions : transversion ratio (TC/TV).
![Page 201: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/201.jpg)
Resultados y Discusión
174
TABLE 2: Singletons and Consistent substitutions
Type 1 Type 2
MUTATION A G T G A G T C A T T A C A G T C G G C C T G A TOTAL
SINGLETONS 3 0 9 13 2 3 1 0 5 1 21 7 65
(22) (28)
CS 0 0 0 6 0 0 0 0 0 0 15 1 22
(6) (16)
Table 2 shows the number of each possible substitution type that was observed
among the clones. While the majority of substitutions are Type 1 and Type 2, a
small number of other types are observed. For CS (consistent substitutions) type 2
is the sole type observed
![Page 202: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/202.jpg)
Resultados y Discusión
175
Table 3: Mutations and damage rates
HVS-I Base Position ATA Gilbert Bandelt16052G 1 16065A 1 16067T 1 16107T 1 16110A 1 4 16111T 1 * 16112T 1 16126C 2 3 * 16134T 1 16159G 1 16183C 1 16186T 1 * 16189C 1 1 * 16192T 2 1 * 16210G 2 16223T 4 4 * 16236T 1 16237G 1 16239G 1 * 16243A 1 16244A 1 16247G 1 16255A 1 * 16261T 1 * 16270T 2 4 * 16274A 1 * 16275T 1 16276G 1 16278T 3 2 * 16280C 1 16284G 1 16285G 1 16291T 1 * 16292T 4 * 16294T 2 2 * 16296T 1 * 16304C 2 * 16310A 1 16311C 1 * 16320T 1 * 16321T 1 16322G 1 16335T 1 * 16341A 1 16343C 1 16352C 1 * 16356C 1 * 16360T 1 * 16362C 2 * 16366T 1 16369A 1 16370A 1 16380C 1 16391A 1
![Page 203: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/203.jpg)
Resultados y Discusión
176
Table 3: Mutations and damage rates
Comparison between the present data (ATA) and the data compiled from two
different kind of papers:
A) Gilbert et al. (2003): data that consist of post-mortem damage DNA obtained
from 37 samples. Their results were standardized onto a quartile scale of 1-4 (1 =
lowest, 4 = highest), excluding invariant sites. Sites with consistently high mutation
rates have an score of 3 or 4.
B) Bandelt et al. (2002): hot spots observed in population data concerning the
sequence range 16051–16365.
The present data is based on a compilation of every position that appears different
to CRS (not only consistent changes but also singletons).
ATA results are also standardized as in Gilbert’s paper.
![Page 204: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/204.jpg)
Resultados y Discusión
177
FIGURE 1: Real-Time PCR results
The quantification by Real-Time PCR was performed to samples, ATA1 – ATA4,
ATA6 and ATA11. The figure shows the standard curve, where the black squares
are the standards and the red crosses are the samples. The standards are from
120,000,000 to 1,200 molecules and the samples are very distant from them.
![Page 205: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/205.jpg)
![Page 206: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/206.jpg)
Resultados y Discusión
179
III.4: MTDNA STUDY OF PERUVIAN MUMMIES FROM THE
“ANDEAN SANCTUARIES” IN THE INCA PERIOD
Naverán N, Endicott P, Sampietro ML, Willerslev E, Lalueza-Fox C, Cooper A
(Manuscript in preparation; this is a draft, we are waiting for permission to publish
it. The order of the authors is not definitive, more people were implied in this work
and should be on it)
![Page 207: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/207.jpg)
![Page 208: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/208.jpg)
Resultados y Discusión
181
MtDNA Study of Peruvian mummies from the “Andean sanctuaries” in the Inca period.
Naverán N1, Endicott P2, Sampietro, ML3, Eske Willerslev4, Lalueza-Fox C5, Cooper A2,6
1Unidad de Genética, Instituto de Medicina Legal, Universidad de Santiago de Compostela, San
Francisco s/n, Santiago de Compostela, Galicia 15782, Spain 2Henry Wellcome Ancient
Biomolecules Centre, Department of Zoology, University of Oxford, Oxford; 3Unitat de Biologia
Evolutiva, Facultat de Ciències de la Salut i de la Vida, Universitat Pompeu Fabra, 08003
Barcelona, Spain; 4 Centre for Ancient Genetics, University of Copenhagen, Univeristetsparken 15,
DK-2100, Denmark; 5 Unitat d’Antropologia, Dept. de Biologia Animal, Facultat de Biologia,
Universitat de Barcelona, 08028 Barcelona, Spain; 6School of Earth and Environmental Sciences,
University of Adelaide, Darling Building DP 418, SA 5005, Australia
ABSTRACT
Over the past two decades, detailed studies of mtDNA have increased our
understanding of the history and population genetics of Native American
populations but America is still the continent from which we have the least
information. Ancient DNA studies can help to resolve this mystery, although it is a
problematic science because of the many obstacles that it has to pass through.
Here we analyzed the mtDNA Control Region (HVSI and HVSII) of fourteen pre-
Columbian mummies from the Inca period (1197-1572 A.D.). All the sequences
found fall within the A2, B2 and C1 Native American haplogroups, which are
widely distributed around the American continent. We present the critical
parameters to succeed in retrieving ancient DNA such as Cytosine deamination
which is the main miscoding lesion in aDNA. Using Uracil N-glycosylase, these
substitutions (C/G T/A) are dramatically reduced. We present the results of the
DNA quantitation with and without the use of this enzyme, seen how in some
samples the number of molecules is dramatically reduced.
![Page 209: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/209.jpg)
Resultados y Discusión
182
INTRODUCTION Fortuitous discoveries and secret excavations, have been carried out in
Peru and other South American countries in what has been termed the “Andean
Sanctuaries of High Mountain”, some of them with really spectacular connotations
keeping in mind the great altitude in which they are located. The Inca Empire
(1197 – 1572 A.D.) was the largest empire in pre-Columbian America. Arising from
the highlands of Peru, from 1438 to 1533, the Incas used a variety of methods,
from conquest to peaceful assimilation, to incorporate into their empire a large
portion of western South America, centered on the Andean mountain ranges,
including large parts of modern Ecuador, Peru, western and south central Bolivia,
northwest Argentina, north and north-central Chile, and southern Colombia. In the
time of the Incas, the relationship between man and nature was represented in all
the magic religious beliefs that explained their reason of being in this world. The
most valuable offerings for the Inca, were the human sacrifices carried out in the
highest summits of the Andeans. One of these offerings is the well known
“Mummy Juanita”, better known in English as "The Ice Maiden", a 15th-century
Inca mummy of a 12 to 14 year-old girl who died sometime between 1440 and
1450 AD. She was discovered in Ampato Mountain (southern Peru) in 1995.
We collected human samples from three different places in Peru; Arequipa,
Cuzco and Puno. The samples were found frozen in the mountains at altitude
between 5,000 to 7,000 metres. These places are SaraSara Mountain, Misti
Volcano, Ampato, Kusikancha and Molino – Chilacacho. In these places they were
found graves with human offering accompanied by their paraphernalia, conformed
by ceremonial Inca ceramic, plates and wooden glasses, textiles, and figurines. A
global preservation of the tissues suggests that the bodies suffered a drying
process and slow freezing. However because of the height and the dry weather
their tissues were not susceptible to bacterial infection and therefore there was
little decomposition.
Here we studied the mitochondrial hypervariable region, HVSI and HVSII,
and different SNPs located in the mitochondrial genome (Anderson et al. 1981), to
investigate the haplogroups of these people prior to European contact.
![Page 210: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/210.jpg)
Resultados y Discusión
183
MATERIALS AND METHODS Samples
A total of fourteen samples, different kinds of tissue from each sample,
were study (Table 1). The samples were collected from the Andes Mountains
where they were frozen. The samples are from three different places in Peru;
Cuzco, Puno and Arequipa (Figure 1). The aim of this work was obtain DNA of the
same mummy from different kinds of tissue and to compare the quality and
quantity of the DNA. In Oxford, bone, hair and teeth were analyzed, meanwhile in
Barcelona only bone and skin.
Extraction
Ancient human DNA studies are extremely problematic because of the
extreme risk of contamination of samples and laboratories with modern human
material, and it is critically important that a number of criteria be followed (Table 2)
(Cooper and Poinar 2000). We used a physically isolated, dedicated aDNA
laboratory in the University of Oxford, the Henry Wellcome Ancient Biomolecules
Centre (ABC).
Bone and tooth were washed with bleach and distilled water. Bone was
powered directly although teeth were not entirely used; we used only the inside of
the tooth following the method described by Tom Gilbert (Gilbert et al. 2003). Hair
was submerged in water and SDS 10% for washing and then was cut in small
pieces and boiled with water for 5 minutes to dissolve it.
DNA was extracted using ancient DNA extraction techniques as described
in (Cooper and Poinar 2000; Barnes et al. 2002). The samples were decalcified
overnight with 10 ml 0.5M EDTA pH 8.0 at room temperature, after centrifugation,
the supernatant was removed, and the remaining sample was incubated overnight
at 50ºC with 0.5 ml of 5% SDS and 5 ml of master mix which contents 0.35 ml 1M
Tris-HCl pH 8.0, 0.35 ml of NaCl2, 0.35 ml of PTB (Vasan et al. 1996), DTT,
Proteinase K and water up to 35 ml. After incubation, the digest was extracted
three times; the first two with phenol and the last one with chloroform, and the
![Page 211: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/211.jpg)
Resultados y Discusión
184
aqueous phase was concentrated by dialysis centrifugation using Amicon Ultra-30
centrifugal filter (Millipore). Extraction procedures were performed in an isolated
pre-PCR area. Proper extraction and amplifications controls were used in each
step of the analysis, adopting the standard precautions of ancient DNA studies
(Cooper and Poinar 2000; Hofreiter et al. 2001b; Pääbo et al. 2004).
Amplifications and Cloning
All PCR setup took place in an ancient DNA laboratory in the Ancient
Biomolecules Centre, where no other molecular research occurs. Post – PCR
procedures were conducted in the physically distant Department of Zoology.
Contamination was monitored through the use of multiple extraction and PCR
control blanks, and consistent results were obtained for repeated extractions and
amplifications. We used a first amplification of 105 bp in HVSI using the
followed primers L16209 and H16313 using between 2 and 5 µl of DNA. All the
sequences amplified and therefore we tried with two bigger fragments for HVSI,
L16209 and H16382 and L16055 and H16218 (Table 3). For HVSII we used a
small fragment of 129 bp with the primers, L127 and H255 and two bigger
fragments with the primers, L127 and H405; L34 and H255 (Table 3). PCR
amplifications were performed in 25 µL reactions with 1 - 5 µL of extract, 1.25 U
Hi-Fi Polimerase (Invitrogen) and 1x Buffer, 1.2 mg/mL BSA, 2 mM MgCl2, 0.25
mM dNTPs and 1 µM of each primer; the PCR profile was 40 cycles of 94º for 45
sec, 58º for 45 sec and 68º for 1 min and 30 sec, with a first denaturation step of
94º for 1 min and 30 sec. Some of these fragments needed to reamplify, and for
them, the weak band was cut in a low-melting point agarose 2% gel and melted at
65º for 20 min, eluted in 20-30 µL of sterile water and subjected to a second PCR.
The second PCR had the followed conditions; 1.25U of Taq Polimerase, 1x Buffer,
5 mM MgCl2, 0.25 mM dNTPs and 0.1 µM of each primer. The PCR profile was 35
cycles of 94º for 45 sec, 55º for 45 sec and 72º for 1 min 30 sec, with a first
denaturation step of 94º for 2 min and a final extension of 72º for 10 min.
All the PCR products were cloned by using the TOPO TA Cloning Kit
(Invitrogen) according to the supplier’s instructions. Screening of white
recombinant colonies was accomplished by PCR, transferring the colonies into a
![Page 212: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/212.jpg)
Resultados y Discusión
185
12.5 µl reaction mix with 1x buffer, 5 mM MgCl2, 0.1 µM of each primer (M13
forward and T7 reverse universal primers), 0.25 µM of each dNTP. And 1.25 U of
Taq Polymerase. After 2 min at 94ºC, 30 cycles of PCR (45 sec at 94ºC, 45 sec at
56ºC, 45 sec at 72ºC) with a final extension of 10 min at 72ºC.
UNG treatment
Hofreiter et al. (2001a) have demonstrated in an experiment of ancient
animal bones and teeth that deoxyuridine residues are a frequent miscoding
lesion in DNA. This results in the incorrect determination of nucleotide sequences
from paleontological and archaeological remains. One of the most common forms
of hydrolytic DNA damage in living organisms is deamination, which is particularly
rapid for cytosine, these results in the conversion of cytosine to uracil. Such
deamination results in modified residues which are read as deoxythymidine
residues by the Taq polymerase and therefore result in G A misincorporations.
Consequently, C T and G A transitions are seen. A good way to see if our
samples had this kind of damage is the uses of the enzyme Uracil N-Glycosylase
(UNG) from E.coli. This enzyme removes uracil from DNA (Lindahl 1993) leaving a
site without base that would be hydrolysed resulting in a strand break. Thus, UNG
treatment is expected to eliminate the number of C/G T/A substitutions if these
are due to cytosine deamination.
We have used the enzyme directly in the PCR, the conditions are the same
as above but adding this new reactive in a quantity of 0.25U in a final volume of
25µL. And two new steps were added to the PCR program, a first one of 10
minutes at 40ºC and a second one of 10 minutes at 95º. After the addition of
MgCl2 and experimental template DNA, the incubation at 40ºC allow AmpErase
uracil N-glycosylase to excise uracil from DNA product. The followed incubation at
95ºC is necessary to cleave the abasic dU-containing PCR product and to
inactivate the UNG.
![Page 213: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/213.jpg)
Resultados y Discusión
186
DNA Sequencing
After purification of these PCR products in plate (Montage® PCR Plate;
Millipore), PCR products were directly sequenced with the ABI Big Dye Terminator
chemistry and the sequence profile was, a first step of 95º during 1 min, and 25
cycles of 95º for 10 sec, 50º for 5 sec and 60º for 2 min with a final extension of
20º for 5 min. The sequence products were precipitate by alcoholic precipitation
and resolved on Applied BioSystems 3100 DNA Sequencer.
9bp deletion and restriction enzymes
To type our samples is not only necessary to sequence HVSI and HVSII but
it is a correspondence between markers and the hypervariable region. Therefore
we needed to see other markers in the mitochondrial DNA. We have studied two
different SNPs and one deletion, this allow us to include every sample in the
Amerindian haplogroups A, B and C (Torroni et al. 1993). Each cluster can be
characterized by a specific mtDNA marker: the 9-bp deletion in the COII/tRNAlys
region, a HaeIII restriction site at nucleotide position 663 of the reference
sequence (Anderson et al. 1981) and for checking the position 13,262 we have
used the AluI restriction enzyme (Macaulay et al. 1999).
Only one extraction of every sample was used for the experiment and the
PCRs were performed under the same conditions as first PCRs (above) but
always with UNG treatment; therefore, we have used the same program as we
have explained above. Following the PCR, all the products were checked in an
4% agarose gel which run at 75 volt during 1 hour; except in the case of the 9-bp
deletion (Wrischnik et al. 1987) that the agarose gel was 5% and run during 2
hours. This was necessary to see the differences between samples that differ only
between 9 bp. Once we can see the bands we proceeded to use the enzymes; 5µl
of PCR product were treat with 10U of restriction enzyme and 2µl of 1x restriction
buffer in 20µl of final volume for 1 hour at 37º with a final step of 80º during 20’.
We have used the pBluescript II SK (+) as a positive control to ensure that the
reaction worked. The results were visualized in a 4% agarose gel; for HaeIII two
bands are expected of 88 bp and 79 bp and for AluI other two bands of 88 bp and
55 bp.
![Page 214: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/214.jpg)
Resultados y Discusión
187
Real-Time PCR
One criterion of authenticity to follow in ancient DNA studies (Cooper and
Poinar 2000) is quantifying the starting number of molecules. Extractions with less
than 1,000 molecules (Pääbo et al. 2004) are less reliable and a larger number of
PCRs has to be done to produce an acceptable sequence. If a large number of
molecules are present, and only one type of DNA sequence is expected, there is
no need to perform several amplifications since consistent changes are extremely
unlikely to occur. If fewer molecules are present, several amplifications are
needed. The quantification has gained great importance not only in ancient DNA
but also in forensic studies. To know the number of molecules is important to
decide if our DNA is suitable for nuclear or mitochondrial DNA analysis and to
adjust the number of microlitres in every PCR (Alonso et al. 2003).
We have chosen one of the two general fluorogenic methods to monitor the
real-time progress of the PCR. It was that one that measure the Taq polymerase
activity with double-Stranded DNA binding dye chemistry (SYBR® Green I Dye)
(Higuchi et al. 1993). Direct detection of PCR product is monitored by measuring
the increase in fluorescence caused by the binding of SYBR Green dye to double-
stranded (ds) DNA. To measure the DNA, we have used an absolute quantitation
that compares the lowest threshold cycle (Ct) of an unknown sample against a
standard curve with known copy numbers. A primer optimization was taken place
before the experiments with and without BSA. The purpose of the below
procedure is to determine the minimum primer concentrations giving the Ct and
maximum ∆Rn while minimizing non-specific amplification. We have used a
standard of 61bp (5’-aacaaacctacccacccttaacagtacatagtacataaagccatttaccgtacata
gcaca-3’) and was run three times in every experiment with dilutions from 106 to
50 copies. 300nM of each primer; 16290F (5’-aacaaacctacccacccttaac-3’) and
16340R (5’-tgtgctatgtacggtaaatggc-3’) was used and 2µl of 10mg/ml of BSA in a
final volume of 25µL. To know if we have inhibition problems we ran the samples
diluted in order to allow us to observe their behaviour. The samples were run twice
and diluted 1:2, 1:4 and 1:8. When the results were poor the experiment was
repeated using not only these dilutions but also the original and the dilution 1:16. It
is not only important to know the number of initial molecules, but also to know the
![Page 215: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/215.jpg)
Resultados y Discusión
188
number of undamaged molecules. Accordingly, we have performed the
experiments with and without AmpErase® uracil-N-glycosylase (UNG) treatment
(Applied Biosystems).
As explained above, UNG treatment removes any uracil produced by cytosine
deamination, and therefore removes every damaged molecule that is not suitable
for amplification.
We have used 1U of enzyme per 100µL of PCR mix following the supplier’s
instructions.
RESULTS UNG treatment
In Table 5 we can see the sequences the mtDNA control region HVSI and
HVSII. The present table shows the results with UNG and without UNG treatment.
In Barcelona’s lab this experiment was also replicated but there were no changes
(no positions changed) ; this result cannot be explained satisfactorily as we can
see in the phylogenetical explanation all the results with UNG obtained in Oxford
are better explained in the Native American context.
The Barcelona lab did not have any control to see if the UNG enzyme was working
properly and also if we look at sample Amp2 in table 5, we can see how hair
extraction gave the same sequence as bone extraction using UNG but not without
it. The abnormal behaviour of Barcelona’s enzyme can thus be explained as an
incorrect working of it. But as we do not know this for sure we have tried to explain
all the sequences and see which one was better fitted into the Americas.
The enzyme Uracil N-Glycosylase removes uracil from DNA, thus UNG
treatment is expected to eliminate the number of C/G T/A substitutions if these
are due to cytosine deamination.
Then we can see how positions 366 and 389 from KK1 (table 5); positions 16176,
16274 and 16362 from MC6 and position 16270 from MC7 disappeared.
Something unusual that happened when we used this treatment, was that
positions 16288 from Amp2 and 16362 from MC6 also disappeared; but these are
not changes C/G T/A but a T C change. It was impossible to find these
results in the bibliography and we have two possible explanations; either this is
![Page 216: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/216.jpg)
Resultados y Discusión
189
due to the original position in the sequence was a C but suffered a deamination
and then the position described by Anderson (a T) appears again or the UNG is
not working as we expected. But seeing our results the likely explanation is the
first one.
9bp and restriction enzymes
The restriction enzymes and deletion results are shown in table 5. The 9bp
deletion defines the haplogroup B and the reaction succeed with 12 of 14
samples; the samples that failed were Mist1 and Amp4, and we have removed
these from the study. Although the sample KK2 from Cuzco was a successful
result, the band was very weak. We found a total of 50% of haplogroup B.
The enzyme 663-HaeIII defines haplogroup A, and we have the same results as
with 9bp deletion, the same two samples failed and KK2 worked but the band was
very weak. A total of 16.5% of haplogroup A was found with this enzyme.
Haplogroup C is defined by 13262-AluI , in this case only one sample failed to
amplify, Mist 1; Amp4 worked although the band is very weak as with KK2. After
the incubation with the enzyme we could see that Amp4 has not the restriction
site. With this enzyme we have two samples (KK2 and MC3) which have both
possibilities, and it seems that we have two types of molecules one with, and one
without the restriction site. One possible explanation could be that the enzyme
didn’t finish cutting when the denaturation step took place. However, this does not
seem likely because the experiment was performed with more samples and with a
positive control, with a very high number of copies and with a completed cutting
process; consequently, we have to discard this hypothesis.
A more plausible hypothesis is the probability that those samples were
contaminated, such that we can see two different haplotypes. In the case of KK2
could it be possible, because we have found different sequences, although no C
haplotype was found. But in the case of MC3 this is unusual, because in no PCR
was found another different sequence. If we follow the results that we have with
HVSI and HVSII, the sample should have the restriction site. The explanation of
contamination is not very plausible here.
But apart from this case, we can say that the restriction enzymes corroborate
those results that we have from HVSI and HVSII. Those two samples that failed
![Page 217: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/217.jpg)
Resultados y Discusión
190
when we amplified HVSI and HVSII also failed with the restriction enzymes
(although mist1 worked with 13262-AluI) and the other sample that amplified HVSI
and HVSII (KK2) with so many sequences is also corroborated with the restriction
enzymes, having more than one sequence. For these reasons, we exclude it from
further discussion.
Real-Time PCR
The results of real-time PCR experiments are shown in the table 4, where
we can see that the number of templates is very different in each sample and in
each kind of tissue. In the table are shown the experiments performed with and
without UNG treatment. Meanwhile the quantification of every tissue of each
sample was performed without UNG treatment, only one tissue of every sample
was done with UNG. The number of starting molecules between samples is very
different. Some samples seem to have a huge number of molecules, an unusual
occurrence in ancient DNA, in which copy number is typically low. In Figure 2 we
can see the samples and the number of starting copies before and after the UNG
treatment. Although there is no clear pattern, we can say that in general the best
number of templates is associated with tooth extraction (figure 3), then bone
extraction, and lastly hair extraction, which in general is not very good. In hair
extraction, apart from the MC1 extraction which had 5,000 initial molecules, the
other extractions were below 1,000 molecules, suggesting that the results are less
reliable (Pääbo et al. 2004).
All the experiments were performed with dilutions to see the level of inhibition. In
general we didn’t find any problem and all the dilutions worked well. Only in cases
where the number of molecules was bigger in bigger dilutions, the experiments
were repeated using a larger number of dilutions and the original, to see the
behaviour. This included the two samples that were removed from this study
because they failed in the amplifications or their results were poor. Amp4 and
Mist1 were repeated several times to confirm the results that were obtained. Both
samples had inhibition problems where the dilutions 1:8 were larger than dilution
1:2 or the original (figure 4). The molecular behaviour in every experiment was
different and so we present these data as approximate numbers of molecules,
because it is impossible to provide exact numbers.
![Page 218: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/218.jpg)
Resultados y Discusión
191
Two other samples which present inhibition problems are those ones from Cuzco,
KK1 (bone and tooth) and KK2 (bone). The experiments were repeated to ensure
the inhibition was correct.
In last column of table 4 we can see the lost percentage, denoting the
percentage of damage due to the cytosine deamination. This percentage varies
between 0% and 90%. This means that is no clear pattern of damage, with no
apparent difference existing even among samples obtained from different
locations. Some extracts seemed to have no damage at all, while other extracts
reached 90% damage. In the present study we discarded two of fourteen samples,
Amp4 and Mist 1, both of which were from Arequipa. The number of started
molecules without UNG is 200, and therefore very low. After the UNG treatment,
the number of molecules disappears almost completely. The poor molecular
behaviour of these samples was totally predictable if we see one of the
authenticity criteria (Pääbo et al. 2004). But if we have a look to another sample
how it is KK1 from Cuzco which number of molecules is even lower than the
previous samples, then we have to wait the same behaviour; but this does not
occur. Not only we have different PCRs of the same tissue but even we have
different extractions of different tissues (bone and tooth). The data seem to be
very solid and the real-time experiments were repeated several times to ensure
that the experiment did not fail. The behaviour of every dilution in the experiment
was normal, and therefore it does not mean that this sample has inhibition
problems.
Another example is the other sample of Cuzco; KK2 which seems to have a lot of
starting molecules with and without the UNG treatment, but the results are in
general very poor. We have different sequences and different haplogroups were
found in HVSI, HVSII, Restriction Enzymes and 9bp deletion. As we can see
above, one extraction of this sample (bone) showed inhibition problems and it was
difficult to have any result. But anyway, the results were confused and therefore
we put this sample out of the anthropological study.
With these results we can see that although DNA quantification is important
for predicting the molecular behaviour of samples, it is not a definitive method to
discard any sample, because sometimes our predictions failed and samples that
![Page 219: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/219.jpg)
Resultados y Discusión
192
we would have discard by real-time, then present consistent results. Other
samples, for which we are expecting good results, fail.
Phylogenetic Analysis
The different haplotypes are shown in table 5. We did not have any new
sequence but all the sequences were found in Native Americans at some point.
Our samples are included in haplogroups A2, B2 and C1 with a predominance of
haplogroup B.
Although every sample was found previously, some of those present one position
not described before; some are due to a very unstable positions as for example
when position 16189 is a C instead of T generates an unstable position in 16183,
and although every sequence that has a polymorphism in position 16189 carries
the polymorphism in 16183 we are not taken this last position into account when
we are trying to interpret the results.
Not only the results with UNG were analyzed but also without UNG for seeing if
the sequences with and without UNG have sense.
Position 16168 in sample Sara Sara, as well in MC5, is only found in one
haplotipe in Peru in one Quechua sample (Corella et al. 2007). In Amp2 both
sequences are possible and then it is difficult to say if position 16288 is damage
due to cytosine deamination. Sample KK1 has the position 16292 that is difficult to
find, it is associated to haplogroup D in Peruvian people (Corella et al. 2007); also
position 200 in HVSII is a weird position, but they are presented in every clone
and therefore we are sure that it is in the sequence. The rest of the sequence is
found in Northern America and in one haplotype of South America (Torroni et al.
1993) and also in (Moraga et al. 2000) associated to Chilean aboriginal
population.
In MC1 position 16381 does not match very well with its haplotype but apart from
that one it is well known in South America. MC2 is found in South America also
with only one step mutation at position 16344, that was found associated to C2 in
Starikovskaya et al. (2005) just up to Mongolian in Asia. Ward found it in an
ancient DNA study of remains from Pacific Northwest of America but associated
with a different linage (Ward et al. 1991).
![Page 220: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/220.jpg)
Resultados y Discusión
193
MC4 is also a Native American sequence; position 16304 is probably an unstable
position which it was found in different context in the western of United States
(Kolman and Tuross 2000), in the Chilean aboriginal population (Moraga et al.;
Moraga et al. 2000) and as well in the pacific northwest of America (Ward et al.
1991). It is always associated to different positions. MC5 was included in
haplogrupo B2 although there are similar haplotypes in the east of Asia (Torroni et
al. 1993).
Meanwhile sample MC6 with UNG in Oxford belongs to Native Americans (Torroni
et al. 1993) also with the position 16362 that disappeared (Moraga et al. 2005),
but as it is explained above we think that it belongs to the real sequence. The
sequence without UNG or with UNG in Barcelona is also possible but associated
with Koreans (Zhang et al. 2005) and with Taiwanese (Torroni et al. 1993).
We have another sample with different positions with and without UNG; MC7. With
UNG is more likely than without UNG. Position 16270 which is found in Andean
populations but associated to haplogroup A, not B (Moraga et al. 2001) or in the
Chilean population but not with the others polymorphisms (Moraga et al. 2000),
although it appears in Mexico population with positions 16189 and 16217 but also
with the positions 16129 and the 16248 that are not in the present sequence
(Green et al. 2000).
Discussion
UNG treatment
Deoxyuridine residues are a frequent miscoding lesion in DNA; these are
due to cytosine deamination. When the Taq polymerase finds this deoxyuridine
residue it is read as deoxythymidine residue and therefore results in G A
misincorporations. These substitutions can reach high proportions among the
molecules amplified. Thus the interpretation of the sequence is going to be wrong,
but if the template is treated with Uracil N-glycosylase, these substitutions are
dramatically reduced (Hofreiter et al. 2001a).
In Table 5 we have the sequences with and without this treatment both in
Oxford and in Barcelona. As we can see no changes are seen in Barcelona’s lab.
This could be explained as abnormal working of this enzyme as no control was
![Page 221: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/221.jpg)
Resultados y Discusión
194
used to verify it. Similarly, the sequences obtained in Oxford with the UNG
treatment match better in the Amerindian context.
A lot of changes C/G T/A are removed in the sequences as we expected
but another unexpected result was found. Two changes T C were also
removed. This is not what we expected, as the enzyme only has the property of
remove the deoxyuridine residues; and then a possible explanation is that the
original position in the sequence was a C but suffered a deamination and then the
position described by Anderson (a T) appears again. As the enzyme was working
properly in the rest of the sequences we do not expect inappropriate behaviour
like this.
Real-Time PCR
Every sample has a different molecular behaviour; we saw neither any
difference among places nor among different kind of tissues.
The best extraction in number of molecules is tooth extraction, then bone
extraction and last hair extraction which number of molecules is almost less than
1000. Some authors (Gilbert et al. 2004) defend that the best extraction is that one
from hair because its decontamination is better than other kinds of tissue. But we
have seen that in general the number of molecules is very low, and if hair is
compared with bone and tooth, then it might be suggested that it is not the best
tissue for DNA studies.
Our samples had a good molecular behaviour, which was seen looking at the
behaviour of the dilutions in the Real-time PCR experiments. The number of
molecules decreased when the dilution increased. We had problems only with four
samples; two of them (Amp4 and Mist1) were excluded briefly because they failed
to amplified in the PCRs or the sequences were totally different, and another one
(KK2) was excluded when we saw different results in every part of mitochondrial
genome studied (HVSI, HVSII, 9bp deletion and restriction enzymes).
There is not any significance relationship between tissue and quantity of damage;
each sample has a different quantity of damage and it seems to be independent of
the tissue.
We have found samples that with and without UNG treatment have a very low
copy of molecules, which it means that the data are not very reliable, but the
![Page 222: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/222.jpg)
Resultados y Discusión
195
results were duplicated with other PCRs and other extractions having consistent
results. And therefore we can conclude that the quantification of the samples is
important to know a bit more about them, but it is not a reliable guide for
determining whether or not to discard a sample.
Although other authors (Alonso et al. 2004) use a more specific technique to
quantify the number of molecules, such as TaqMan Probes (Applied Biosystems),
we believe that it is not necessary to know exactly the number of molecules
because we consider this technique as being an approximate guide for predicting
the behaviour of our DNA but not a good method to determine whether or not to
discard a sample.
Phylogenetic Analysis
There is a discussion if the haplogroups represented in America are due to
separate founding populations (Torroni et al. 1992; Lalueza-Fox et al. 2002), or if
they represent the variation within a single founding population (Bonatto and
Salzano 1997; Stone and Stoneking 1998; Moraga et al. 2000).
A lot of works probe that humans entered the Americas in more than one,
temporally distinct, population movement (Torroni et al. 1993).
Something more clear is, the different haplotypes we can see in America are due
to not many haplotypes were present in the initial colonizer of the New World from
Asia and probably a severe bottleneck during colonization reduced the amount of
diversity present in Native Americans (Wallace et al. 1995).
Torroni et al. (1993) confirmed, trying to find the founders haplogroups of America,
that all Native American mtDNAs fall into four distinct haplogroups (A-D). There is
also evidence for a fifth haplogroup, X, which is less prevalent.
For finding the founder haplotype, he was looking for that mutations that were
shared by all haplotypes of the same haplogrupo and if these mutations were
originated in Asia, they have to be presented in the mtDNA pool of modern Asians
and Siberians. And then he found that all Native American group A haplotypes are
defined by an A to G transition at np 663 which creates an HaeIII site gain at that
position and the D-loop sequences are defined by a T residue at np 16290 and an
A residue at np 16319. Group B haplotypes are distinguished by the 9bp deletion
occurring between np 8272-8289 and D-loop sequences usually show two C
![Page 223: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/223.jpg)
Resultados y Discusión
196
residues at np 16189 and np 16217. Amerind group C haplotypes are
characterized by an A to G transition at np 13263 and creates an AluI site at np
13262 and D-loop group C sequences are characterized by a C residue at 16298
and a T residue at np 16327.
Consequently, these mutations must have arisen in Asia and were carried to the
Americas with the founding mtDNAs. This indicates that the haplogroup
divergence of the Native American populations occurred since they arrived in the
Americas. Therefore, Native American D-loop variation, like the restriction site
variation, probably arose after Native Americans became separated from Asia.
The genetic data show that the American continent is very homogenous, although
a geographic structure in the mtDNA, especially in the haplogroup distribution and
haplotype patterning, can be observed. Most of the individual tribes lack
haplotypes from at least one of these groups (Torroni et al. 1993). The frequencies
of the four major mtDNA lineages differ latitudinally and show a marked gradient
from north to south; the general pattern along the continent is an increase of the C
and D haplogroups to the south, parallel to a decrease in the A haplogroup
frequency (Lalueza-Fox et al. 2002).
Isolation and drift have shaped the genetic composition of the Amerindian
populations to the point that there is considerable variation between adjacent
tribes along the continent, especially in the haplogroup frequency distribution.
Some groups show an absence of either one or another haplogroup.
The present studio shows the samples among those four mayor
haplogroups found in Native Americans.
Three different populations of Peru were studied and in all of three, haplogroup D
has disappeared. The principal one is haplogroup B (58%), following for C (25%)
and A (17%) (Figure 5). Although haplogroup B is the most represented, the
unique sample we have in Cuzco belongs to haplogroup A. Meanwhile haplogroup
C is only presented in Puno where haplogroup A does not appear.
It is difficult to find an agreement with the data showed so far. Torroni et al. (1993)
show that in South America the most important haplogroup is D following by C, B
and A (in order). For (Lalueza-Fox et al. 2001) the frequency of the A linage is
11.8% in South America and for the C haplogroup is 20.2% and similar for the D
haplogroup. And other (Moraga et al. 2005) found haplogroup D in only a 3.3% in
![Page 224: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/224.jpg)
Resultados y Discusión
197
the Northern of Chile and haplogroup tends to increase; which it is very similar to
our data.
We did not find the haplogroup D and C is not the mayor group. The
present work is not very representative due to the small number of samples, only
eleven, but it is more in concordance with the work of (Lewis et al. 2005), they find
haplogroup B the mayor haplogroup in an Andean population, although is followed
by haplogroup D, and we do not find it in our results. Moraga et al. (2001) find
similar results as us in a study of mummies from North of Chile. Moraga explains
that although the studies with a few number of samples can not be very accurate;
the huge different shows in the frequencies, if we compare with modern
populations, can be explained by the long time pass, the possible movements
from the high plateau and the population decrease since the arrival of the
European people. It is hard to explain this due to the small sample size, such as
those generally obtained in ancient DNA studies, but it could be explained by
bottleneck or by genetic drift.
Lewis et al. (2005) say that all the Andean populations had high levels of diversity
and a close genetic relationship to each other.
Although our sequences match in the Amerindian context, haplogroups A2,
B2 and C1 are purely Native American, they are very widely distributed around the
whole continent. Further studies of the coding region would be necessary to say
anything else about these three populations but also the sequences that we have
to compare are very poor. America is still the continent from which we have the
least information about the sequence variation of entire mtDNAs (Bravi et al.
2007). Additional analyses, both modern and ancient, are therefore needed to
help obtain a more precise picture of the colonization of this area.
![Page 225: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/225.jpg)
Resultados y Discusión
198
References Alonso A, Martín P, Albarrán C, García P, García O, Fernández de Simón L,
García-Hirschfeld J, Sancho M, De la Rúa C, Fernández-Piqueras J (2004) Real-time PCR designs to stimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies. Forensic Science International 139:141-149
Alonso A, Martín P, Albarrán C, García P, Primorac D, García O, Fernández de
Simón L, García-Hirschfeld J, Sancho M, Fernández-Piqueras J (2003) Specific Quantification of Human Genomes from Low Copy Number DNA Samples in Forensic and Ancient DNA Studies. Croatian Medical Journal 44:273-280
Anderson S, Bankier AT, Barrell BG, De Brujin MHL, Coulson AR, Drouin J,
Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJH, Staden R, Young IG (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457 – 465
Barnes I, Matheus P, Shapiro B, Jensen D, Cooper A (2002) Dynamics of
Pleistocene Population Extinctions in Beringian Brown Bears. Science 295:2267 – 2270
Bonatto SL, Salzano FM (1997) A single and early migration for the peopling of
the Americas supported by mitochondrial DNA sequence data. Proc Natl Acad Sci USA 94:1866-1871
Bravi C, Salas A, Coble MD, Kong QP, Perego UA, Torroni A, Bandelt HJ (2007)
The phylogeny of Native American complete mtDNA sequences: implications for evolutionary and disease studies. In preparation
Cooper A, Poinar H (2000) Ancient DNA: Do it right or not at all. Science 289:1139 Corella A, Bert F, Perez-Perez A, Gene M, Turbon D (2007) Mitochondrial DNA
diversity of the Amerindian populations living in the Andean Piedmont of Bolivia: Chimane, Moseten, Aymara and Quechua. Ann Hum Biol 34:34-55
Gilbert MTP, Willerslev E, Hansen AJ, Barnes I, Rudbeck L, Lynnerup N, Cooper
A (2003) Distribution Patterns of Postmortem Damage in Human Mitochondrial DNA. Am J Hum Genet 72:32 – 47
Gilbert MTP, Wilson S, Bunce M, Hansen AJ, Willerslev E, Shapiro B, Higham
TFG, Richards MP, O'Connell TC, Tobin DJ, Janaway RC, Cooper A (2004) Ancient mitochondrial DNA from hair. Current Biology 14 No12:R463-464
Green LD, Derr JN, Knight A (2000) mtDNA affinities of the peoples of North-
central Mexico. Am J Hum Genet 66:989-998
![Page 226: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/226.jpg)
Resultados y Discusión
199
Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: real-time monitoring of DNA amplifications reactions. Biotechnology (N Y) 11(9):1026-1030
Hofreiter M, Jaenicke V, Serre D, Haeseler Av, Pääbo S (2001a) DNA sequences
from multiple amplifications reveal artefacts induced by cytosine deamination in ancient DNA. Nucleic Acids Research 9, No. 23:4793-4799
Hofreiter M, Serre D, Poinar H, Kuch M, Pääbo S (2001b) Ancient DNA. Nature
Genetics 2:353 – 359 Kolman CJ, Tuross N (2000) Ancient DNA analysis of human populations.
American Journal of Physical Anthropology 111:5-23 Lalueza-Fox C, Calderón FL, Calafell F, Morera B, Bertranpetit J (2001) MtDNA
from extinct Tainos and the peopling of the Caribbean. Annals of Human Genetics 65:137-151
Lalueza-Fox C, Gilbert MTP, Martínez-Fuentes AJ, Calafell F, Bertranpetit J
(2002) Mitochondrial DNA from Pre-Columbian ciboneys from Cuba and the prehistoric colonization of the Caribbean. American Journal of Physical Anthropology 121:97-108
Lewis CM, Tito RY, Lizárraga B, Stone AC (2005) Land, language, and loci:
mtDNA in Native Americans and the genetic history of Peru. American Journal of Physical Anthropology 127(3):351-360
Lindahl T (1993) Instability and decay of the primary structure of DNA. Nature Apr
22;362(6422):709-715 Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R,
Bonné-Tamir B, Sykes B, Torroni A (1999) The Emerging Tree of West Eurasian mtDNAs: A Synthesis of Control-Region Sequences and RFLPs. Am J Hum Genet 64:232-249
Moraga M, Aspillaga E, Santoro C, Standen V, Carvallo P, Rothhammer F (2001)
Análisis de ADN mitocondrial en momias del norte de Chile avala la hipótesis de origen amazónico de las poblaciones andinas. Revista chilena de historia natural 74 No. 3:719-726
Moraga M, Santoro CM, Standen VG, Carvallo P, Rothhammer F (2005)
Microevolution in prehistoric Andean populations: chronologic mtDNA variation in the desert valleys of northern Chile. Am J Phys Anthropol 127:170-181
Moraga ML, Rocco P, Miquel JF, Nervi F, Llop E, Chakraborty R, Tothhammer F,
Carvallo P (2000) Mitochondiral DNA polymorphisms in Chilean aboriginal populations: implicatioons for the peopling of the southern cone of the continent. American Journal of Physical Anthropology 113:19-29
![Page 227: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/227.jpg)
Resultados y Discusión
200
Pääbo S, Poinar H, Serre D, Jaenicke-Desprès V, Hebler J, Rohland N, Kuch M, Krause J, Vingilant L, Hofreiter M (2004) Genetic Analyses From Ancient DNA. Annu Rev Genet 38:645-679
Starikovskaya EB, Sukernik RI, Derbeneva OA, Volodko NV, Ruiz-Pesini E,
Torroni A, Brown MD, Lott MT, Hosseini SH, Huoponen K, Wallace DC (2005) Mitochondrial DNA diversity in indigenous populations of the southern extent of Siberia, and the origins of native americans haplogroups. Annals of Human Genetics 69:67-89
Stone AC, Stoneking M (1998) mtDNA analysis of a prehistoric Oneota population:
Implications for the peopling of the New World. Am J Hum Genet 62:1153-1170
Torroni A, Schurr TG, Cabell MF, Brown MD, Neel JV, Larsen M, Smith DG, Vullo
CM, Wallace DC (1993) Asian affinities and continental radiation of the four founding native American mtDNAs. Am J Hum Genet 53:563-590
Torroni A, Schurr TG, Yang C-C, Szathmary EJ, Williams RC, Schanfield MS,
Troup GA, Knowler WC, Lawrence DN, Weiss KM, Wallace DC (1992) Native American mitochondrial DNA analysis indicates that the amerind and the Nadene populations were founded by two independent migrations. Genetics 130:153-162
Vasan S, Zhang X, Kapurniotu A, Bernhagen J, Teichberg S, Basen J, Wagle D,
Shih D, Terlecky I, Bucala R, Cerami A, Egan J, Ulrich P (1996) An agent cleaving glucose-derived protein crosslinks in vitro and in vivo. Nature Julio 18; 382 (6588):275-278
Wallace DC, Lott MT, Brown MD, Huoponen K, Torroni A (1995) Report of the
committee on human mitochondrial DNA. In: Cuticchia AJ (Ed) Human gene mapping 1995: A Compendium Baltimore: Johns Hopkins University Press:910-954
Ward R, Frazier BL, Dew-Jager K, Pääbo S (1991) Extensive mitochondrial
diversity within a single Amerindian tribe. Proc Natl Acad Sci USA 88:8720-8724
Wrischnik LA, Higuchi R, Stoneking M, Erlich HA, Arnheim N, Willson AC (1987)
Length mutations in human mitochondrial DNA: direct sequencing of enzymatically amplified DNA. Nucleic Acids Research 15 Number 2:529-542
Zhang Y, Xu Q, Cui H, Cui Y, Lin H, Kim K, Lee J (2005) Haplotype diversity in
mitochondrial DNA hypervariable region I, II and III in a Korean ethnic group from northeast China. Forensic Sci Int 151:299-301
![Page 228: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/228.jpg)
Resultados y Discusión
201
Peru State Specific location Sample Kind of Sample
Arequipa Sara Sara Sar1 Bone, Tooth, Hair, Skin
Arequipa Ampato Amp2 2 Bones, Hair
Arequipa Ampato Amp3 Bone
Arequipa Ampato Amp4 Hair
Arequipa Misti Mist1 Tooth
Cuzco Kusikancha KK1 2 Bones, Tooth
Cuzco Kusikancha KK2 Bone, Tooth
Puno Molino-Chilacacho MC1 Hair, 2 Bones
Puno Molino-Chilacacho MC2 Tooth, Bone
Puno Molino-Chilacacho MC3 Tooth
Puno Molino-Chilacacho MC4 Tooth
Puno Molino-Chilacacho MC5 Tooth
Puno Molino-Chilacacho MC6 2 Bones
Puno Molino-Chilacacho MC7 Bone
Table 1: Samples, Kind of tissue and Origin
![Page 229: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/229.jpg)
Resultados y Discusión
202
CRITERIA Comments
Criterion 1 Isolation of work areas
All the work was done in two different buildings. The first one, the Henry
Wellcome Ancient Biomolecules centre, where the extractions and first
PCRs were done, is separated by 5 minutes walk from the second one,
Department of zoology, where the rest of experiments were performed. In
this way we can be sure that the first one is DNA-free because researchers
are not allowed to enter the facility if they have previously entered a building
featuring molecular biological research on the same day.
Criterion 2
Negative control extractions and amplifications
It was used negative controls in every stage of extraction and amplification
to ensure that it was not any contaminant. When the negatives were
positives, they were sequenced to see which kind or where the
contamination was from.
Criterion 3
Appropriate molecular behaviour
All the samples accepted in this studio had an appropriate molecular
behaviour. The first PCR fragment was always a small one and in a great
number of samples a second bigger one was done with successful. That
samples which failed in the second one or even in the first one, were that
ones which number of starting molecules was very low.
Criterion 4
Repeated amplifications from the same or several extracts
We performed a work to ensure that every PCR was repeated and a big
fragment of overlapping was done. All the samples which PCRs were not
reproduced were removed from this studio.
Only four of twelve samples had only one kind of tissue extracted, the rest
has at least two tissues, where sequences are repeated.
Criterion 5 Cloning of products
Every PCR was cloned except the restriction enzymes products which were
directly analyzed by agarose gels.
Criterion 6 Independent replication
Five specimens of a total of twelve were replicated in Pompeu Fabra
University in Barcelona (Spain). The criterion was that samples that had a
different sequence between previous studies were replicated to be sure of
these new positions.
Criterion 7 Biochemical preservation
Although we did not use any experiment to see the biochemical
preservation like collagen or amino acid racemisation, the samples were
found in the Andes Mountains what means that were totally frozen and
therefore we assumed that their preservation was good enough as we could
see with our good results.
Criterion 8 Quantification
We have used a Real-Time quantification using a SYBER-Green method, to
quantify the number of starting templates in the reaction.
We did a comparative experiment performing two experiments with and
without UNG treatment to see the damage due to cytosine deamination.
Table 2: Authenticity criteria (Cooper and Poinar 2000) used in aDNA studies
![Page 230: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/230.jpg)
Resultados y Discusión
203
mtDNA region studied Primers Primer Sequence (5’ – 3’)
HVSI
HVSII
L16055 L16209 H16218 H16260 H16313 H16382 L034 L127 H255 H405
GAAGCAGATTTGGGTACCAC CCATGCTTACAAGCAAG TGTGTGATAGTTGAGGGTTG TTGGTATCCTAGTGGGTGAGG CTATGTACGGTAAATGGCTTTATG TGGTCAAGGGACCCCTATCT GAGCTCTCCATGCATTTGGT GAGCACCCTATGTCGCAGTA TCTGTGTGGAAAGTGGCTGT TTTTGGCGGTATGCACTTTT
Restriction Enzyme and mitochondrial position
Primers Primer Sequence (5’ – 3’)
HaeIII site 663 9bp deletion COII/tRNAlys AluI site 13263
L00577 H00743 L08188 H08366 L13176 H13320
GTTTATGTAGCTTACCTCCTC GATCGTGGTGATTTAGAGGGT AGCAAACCACAGTTTCATGC TTTCACTGTAAAGAGGTGTTGG AGGCGCTATCACCACTCTGT GCAGGAATGCTAGGTGTGGT
Table 3: Primers for mtDNA typing
![Page 231: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/231.jpg)
Resultados y Discusión
204
Sara Sara Bone 900Hair 800Tooth 10.000 10.000 0%
Amp2 Bone 10.000 12.000 16,50%Hair 700
Amp3 Bone 5.000 6.000 16,50%Amp4 Hair 25 200 87,50%Mist1 Tooth 40 200 80%KK1 Bone 10 100 90%
Tooth 200KK2 Bone 100
Tooth 3.000 5500 45,50%MC1 Bone 1.000 1000 0%
Hair 5000MC2 Bone 3.000 3.000 0%
Tooth 14000MC3 Tooth 500 1500 66,50%MC4 Tooth 10.000 44000 77,25%MC5 Tooth 20.000 40000 50%MC6 Bone 7.500 20000 62,50%MC7 Bone 5.500 14000 60%
% of lostSample ExtractionWith UNG
(Number of copies)
Without UNG (Number of
copies)
Table 4: Real-Time PCR results.
In this table is shown every sample and all the resulting extractions. All the different extractions of every sample were quantified by real-time PCR without UNG treatment; meanwhile only one extraction of every sample was quantified with UNG treatment. We can see in the “% of lost” column how much DNA we are losing after the UNG treatment; what it means the percentage of damage due to the cytosine deamination.
![Page 232: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/232.jpg)
Resultados y Discusión
205
Sara
Sar
aBon
eN.
D.22
4N.
D.21
5 26
3 30
9+CC
315
.1C
N.D.
N.D.
N.D
N.D.
223
278
[162
09-1
6382
]N.
D.N.
D.N.
D.N.
D.N.
D.
N.D.
224
311
[162
09-1
6382
]N.
D.N.
D.N.
D.N.
D.N.
D.
Toot
h16
8 18
3C 1
89 2
1716
8 18
3C 1
89 2
1773
263
309
+CC
315.
1CN.
D.-
+-
R (S
kin)
N.D.
168
183C
189
[16
131-
1621
1]N.
D.N.
D.N.
D.N.
D.N.
D.B2
Am
p2Bo
ne18
3C 1
89 2
1718
3C 1
89 2
17 2
8873
143
263
315
.1C
143
179C
263
315
.1C
-+
-Ha
irN.
D.18
3C 1
89 2
17N.
D.N.
D.N.
D.N.
D.N.
D.
R (B
one)
N.D.
183C
189
[161
31-1
6211
]N.
D.N.
D.N.
D.N.
D.N.
D.B2
Am
p3Bo
ne11
1 22
3 29
0 31
9 36
211
1 22
3 29
0 31
9 36
264
73
146
153
183
215
235
263
309.
1C 3
15.1
C18
3 21
5 23
5 26
3 30
9.1C
315
.1C
+-
-A2
Am
p41
Hair
N.D.
rCRS
[162
09-1
6313
]N.
D.N.
D.-
Mis
t11
Toot
hN.
D.25
6 27
0 [1
6209
-163
13]
N.D.
N.D.
N.D.
N.D.
N.D.
KK1
Bone
111
129
223
290
292
319
362
111
129
223
290
292
319
362
64 7
3 14
6 15
3 20
0 23
5 26
3 31
014
6 15
3 20
0 23
5 26
3 31
0 36
6 38
9+
--
Toot
hN.
D.22
3 29
0 29
2 [1
6089
-163
13]
N.D.
N.D.
N.D.
N.D.
N.D.
R (B
one)
N.D.
111
129
223
290
292
319
362
N.D.
N.D.
N.D.
N.D.
N.D.
A2KK21
Bon
eN.
D.25
6 27
0 29
1 [1
6209
-163
13]
N.D.
153
195
225
226
263
N.D.
N.D.
N.D
N.D.
181G
189
196
213
[16
055-
1621
8]N.
D.N.
D.-
-+/
-N.
D.22
3 27
8 [1
6209
-163
13]
N.D.
N.D.
N.D.
N.D.
N.D.
MC1
Bone
223
298
325
327
381
223
298
325
327
381
73 1
52 2
49de
l 263
290
-291
del 3
09.1
C 31
5.1C
152
249d
el 2
63 2
90-2
91de
l 309
.1C
315.
1C-
-+
Hair
N.D.
223
298
325
[160
55-1
6313
]N.
D.N.
D.N.
D.N.
D.N.
D.
R (B
one)
N.D.
223
298
325
327
381
N.D.
N.D.
N.D.
N.D.
N.D.
C1M
C2
Bone
183C
189
223
298
325
327
344
183C
189
223
298
325
327
344
73 1
85 2
49de
l 263
290
-291
del 3
09.1
C 31
5.1C
185
249d
el 2
63 2
90-2
91de
l 309
.1C
315.
1C-
-+
Toot
hN.
D.18
3C 1
89 2
23 2
98 [1
6055
-163
13]
N.D.
N.D.
N.D.
N.D.
N.D.
C1M
C3
Toot
h22
3 29
8 32
5 32
7rC
RS [1
6127
-163
13]
73 1
52 2
49de
l 263
290
-291
del 3
09.1
C 31
0.1C
315
.1C
N.D.
--
+/-
C1M
C4
Toot
h18
3C 1
89 2
17 3
0418
3C 1
89 2
17 3
0473
263
309
.1C
315.
1CN.
D.-
+-
B2M
C5
Toot
h16
8 17
2 18
3C 1
89 2
1716
8 17
2 18
3C 1
89 2
1773
185
263
309
+CC
315.
1C 3
48N.
D.-
+-
B2M
C6
Bone
183C
189
217
176
183C
189
217
274
319
362
73 2
04 2
63 3
15.1
C20
4 26
3 31
5.1C
-+
-R
(Bon
e)21
7 27
4 31
9 36
2 [1
6209
-164
01]
176
183C
189
217
274
319
362
N.D.
N.D.
N.D.
N.D.
N.D.
B2M
C7
Bone
183C
189
217
183C
189
217
270
73 2
28 2
63 3
09+C
C 31
5.1C
228
263
309+
CC 3
15.1
C-
+-
B2
Sam
ple
Extra
ctio
nHV
I (W
ith U
NG)
(16-
--) [
1605
5-16
382]
HGHV
II (W
ith U
NG) [
34-4
05]
HVII
(With
out U
NG) [
127-
405]
Hae I
II 66
3
Toot
h
HVI (
With
out U
NG)
(16-
--) [
1605
5-16
382]
9bp
Dele
tion
8272
/828
9Al
uI
13
262
Hai
r
Tabl
e 5: S
eque
nce
Resu
lts
HVSI
and
HVS
II re
sults
with
and
with
out U
NG tr
eatm
ent a
nd re
strict
ion e
nzym
es a
nd 9
bp d
eletio
n. (N
.D.)
Not D
eter
mine
d. (1 )T
hese
sam
ples
were
rem
oved
from
this
study
. In
squa
re b
rack
ets
([]) t
he s
eque
nce
rang
e is
indica
ted
for t
he H
VI a
nd H
VII;
the
gene
ral
posit
ions a
re in
the
main
squa
re, if
any
sequ
ence
yield
ed a
small
frag
men
t the
sequ
ence
rang
e ar
e be
side
the
sequ
ence
. (+)
mea
nsth
e pr
esen
ce o
f the
dele
tion
or th
at th
e re
strict
ion e
nzym
e fo
und
the
cut p
lace
in th
e se
quen
ce m
eanw
hile
(-) m
eans
the
oppo
site.
HG
is th
e ha
plogr
oup
and
R th
e sa
mple
that
was
sent
to B
arce
lona
to re
plica
te.
![Page 233: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/233.jpg)
Resultados y Discusión
206
Figure 1: Map of Peru and South America
Situation of the three different places in Peru (red circles) where the samples are from. Arequipa = 5 Samples; Cuzco = 2 Samples; Puno = 7 Samples
0
10000
20000
30000
40000
50000
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Samples
Cop
y N
umbe
r
non UNGUNG
Figure 2: Comparison between number of starting molecules with and without UNG treatment based on the Real-Time PCR results. Samples: 1.Sara Sara, 2.Amp2, 3.Amp3, 4.Amp4, 5.Mist1, 6.KK1, 7.KK2, 8.MC1, 9.MC2, 10.MC3, 11.MC4, 12.MC5, 13.MC6, 14.MC7
![Page 234: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/234.jpg)
Resultados y Discusión
207
Extraction vs Number of Templates
0
10000
20000
30000
40000
50000N
umbe
r of T
empl
ates
Bone Hair Tooth
Figure 3: Relation between kind of sample and number of templates. We can see the relation between every kind of tissue; bone, hair and tooth and the number of molecules. All these data is referenced to the non-UNG experiments.
Figure 4: Amplification plot of samples MC2 (upper) and Mist1 (lower). Example of inhibition, the first one is referenced to tooth extraction of MC2; red is dilution 1:2, green is 1:4 and blue is 1:8. This is a normal behaviour where the number of copies decrease when the dilution increase. But in the second one, tooth extraction of Mist1, the behaviour is not the normal. We can see how dilution 1:2 (red) has a lower number of molecules than dilutions 1:4 (green) and 1:8 (blue). And also we can see how low the number of molecules is in the second one.
![Page 235: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/235.jpg)
Resultados y Discusión
208
Figure 5: Haplogroups distribution The upper box represents the three populations of Native Americans (Puno, Cuzco and Arequipa) and the quantity of each haplogroup. The lower figure shows the haplogroups distribution of the total of the Peru samples of the present study.
![Page 236: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/236.jpg)
Resultados y Discusión
209
III.5: ANCIENT DNA FROM COPROLITES REVEAL PRE-CLOVIS
HUMAN PRESENCE IN NORTH AMERICA
M. Thomas P. Gilbert, Dennis L. Jenkins, Nuria Naverán, Juan J. Sanchez,
Anders Götherstrom, Michael Hofreiter, Philip Francis Thomsen, Thomas F.G.
Higham, Jonas Binladen, Eske Willerslev
(Submitted to Science. Second round revision, under editorial consideration)
![Page 237: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/237.jpg)
![Page 238: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/238.jpg)
Resultados y Discusión
211
Ancient DNA from Coprolites Reveal Pre-Clovis Human Presence
in North America
M. Thomas P. Gilbert1, Dennis L. Jenkins2, Nuria Naveran3, Juan J. Sanchez4,
Anders Götherstrom5, Michael Hofreiter6, Philip Francis Thomsen1, Thomas F.G.
Higham7, Jonas Binladen1, Eske Willerslev1*
1Centre for Ancient Genetics, University of Copenhagen, Universitetsparken 15,
2100 Copenhagen, Denmark.
2Museum of Natural and Cultural History, 1224 University of Oregon, Eugene,
Oregon 97403-1224, USA.
3Instituto de Medicina Legal, Facultad de Medicina, University of Santiago de
Compostela, San Francisco s/n 15782, Santiago de Compostela, Spain.
4National Institute of Toxicology and Forensic Science, Canary Islands delgation,
38320 Tenerife, Spain.
5Department of Evolutionary Biology, Uppsala University, Norbyvagten 18D,
74236 Uppsala, Sweden.
6Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103
Leipzig, Germany.
7 Research Laboratory for Archaeology and the History of Art, Dyson Perrins
Building, South Parks Road, Oxford, OX1 3QY, UK.
*Corresponding author: E-mail: [email protected]
![Page 239: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/239.jpg)
Resultados y Discusión
212
Abstract
The first colonization of the Americas by humans remains a contentious topic, with
different theories as to when it happened and by whom. These theories can be
simplistically divided into two classes, those that argue for a first migration
associated with the appearance of the Clovis complex ca. 11-10.8 thousand
radiocarbon (14C) years ago (Clovis-first), versus those that argue for older entries.
Here, we reveal the presence of coprolites from the Paisley Caves in south-central
Oregon dating back as far as 12.3 thousand 14C years before present. The
coprolites, containing human mitochondrial DNA reveal that humans carrying
mitochondrial DNA of the Native American founding haplogroups A and B were
present in North America over 1000 14C years before the earliest evidence of
Clovis technology. Thus, our findings strongly argue for human presence in North
America prior to the Clovis complex and reject the Clovis-first theory for peopling
of the Americas.
![Page 240: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/240.jpg)
Resultados y Discusión
213
The timing, route, and origin of the first human migration into the
Americas remain contentious topics. Some researchers have used archaeological
or genetic evidence to argue for a settlement 30 thousand years ago or earlier (1,
2). However, the most widely accepted dates of occupation relate to the Clovis
complex ca. 11-10.8 thousand radiocarbon years before present (14C ka B.P.), a
distinct technology that may have originated and spread throughout North America
in as little as 200 calendar (cal.) years (3). The oldest directly dated human
osteological remains are no more than 11-11.5 14C ka B.P. (3, 4) and appear to be
congruent with the “Clovis-first” model for colonization of the Americas (i.e. the
Clovis complex represents the tangible remains of America’s first colonists (5)).
However, this migration theory is complicated by the discovery of Monte Verde, an
archeological site in southern Chile that predates Clovis by over 1000 14C years
(6). Although no human remains have been recovered from the site, based on
radiocarbon dates obtained directly from recovered artifacts, Monte Verde has
become generally accepted as being pre-Clovis in age. In light of this, and under
the assumption that humans first entered the Americas by either land or sea from
Siberia via Beringia (the Pleistocene aged land bridge between northeastern
Siberia and northwestern North America), it seems likely that humans predating
Clovis must have been present in North America as well. This is supported by
evidence from genetic studies of contemporary Siberian and Native American
populations that suggest a pre-Clovis entry 20-15 ka cal. B.P. (7). While a number
of pre-Clovis occupation sites have been reported from North America, their age
and cultural origins remain controversial due to the lack of directly dated human
remains or artifacts (8).
Here, we present the first direct evidence of pre-Clovis human presence in
North America, through the genetic identification and profiling of endogenous
human DNA in coprolites dating back to ca. 12.3 14C ka B.P. which were
excavated at the Paisley 5 Mile Point Caves in south-central Oregon (Fig 1a). The
caves are wave-cut shelters located on the highest shoreline of Pluvial Lake
Chewaucan, which once filled the Summer Lake-Chewaucan-Lake Abert basins.
As the lake fell within the last 17 14C ka B.P. (9) the caves were exposed to
sedimentary accumulation and soon began filling with Aeolian transported silt and
sand, gravels, roof spalls, and organics (bones, dung, botanics, and artifacts)
deposited by humans and animals. Sheltered from moisture, these extremely dry
![Page 241: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/241.jpg)
Resultados y Discusión
214
deposits contain perishable human artifacts; threads of sinew and plant fibers,
hide, basketry, cordage, and wood as well as animal bones and diverse kinds of
feces, in an unbroken stratigraphic sequence spanning the late Pleistocene and
Holocene.
It has been conventionally argued that the long-term survival of ancient
DNA (aDNA) is inversely correlated with temperatures of preservation (10).
However, this model, based on measurements of depurination rates in dissolved
DNA (11), has proved overly simplistic (12). Under dry, thermally stable
conditions, such as those of the desert caves where many North American
coprolites are preserved, DNA survival may greatly exceed theoretical predictions
(13). Previous studies have reproducibly demonstrated that short fragments of
authentic mitochondrial (mtDNA) can be obtained from coprolites of the North
American ground sloth (Nothrotheriops shastensis) excavated from sites that are
environmentally similar to that of the Paisley 5 Mile Point Caves and dating back
as far as 29.2 14C ka B.P. (13-15). Additionally, mtDNA sequences derived from
humans and their diet have been obtained from coprolites recovered from desert
caves dating to approximately 2.4 14C ka B.P. (16). With this in mind, we
investigated the possibility of endogenous DNA survival in 14 Paisley Cave
coprolites that morphologically appear human.
In the initial screening, the coprolites were all found positive for human
mtDNA (17). This result is by no means surprising as the coprolites had been
excavated under less than sterile conditions and are thus likely to contain DNA of
the excavators (18, 19). Although all of the coprolites contained single nucleotide
polymorphisms (SNPs) diagnostic to European populations (consistent with
contamination), six samples also reproducibly showed detectable levels of SNPs
diagnostic to Native American founding mtDNA haplogroups (Hgs) A or B (17).
The absence of Native American mtDNA in the remaining 8 samples may be due
to differences in DNA survival across specimens, due to the coprolites being non-
human, or more likely, due to the ratio of contaminant to endogenous DNA being
too great for endogenous mtDNA detection using the applied techniques.
Ancient DNA results have often been challenged as deriving from
contamination of samples during the analysis in the genetic laboratories or during
the excavation process (18, 19). To exclude laboratory-based contamination, the
Hgs A and B results were independently confirmed using several DNA typing and
![Page 242: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/242.jpg)
Resultados y Discusión
215
sequencing methods (17) in multiple laboratories (Copenhagen, Denmark,
Uppsala, Sweden and Leipzig, Germany) (Table 1). To ensure that the Hgs A and
B results are not explained through contamination at time of excavation, we
mitotyped 55 individuals that had been present at the site during any phase of the
multi-year excavations. Additionally, we mitotyped the 12 researchers in the
principal aDNA laboratory (17). This was performed regardless of whether an
individual played an active role in the excavation or in the genetic analysis of the
coprolites (for example, although 55 people were present at the archaeological
site during the two seasons of excavations, only 14 were actively involved in the
excavation of the six coprolites reported here, and only two of these could have
come in contact with all six specimens). The results show that none of the
individuals tested are likely sources of the Hgs A and B mtDNA (17). As the
coprolites had been stored in sealed plastic bags from the time of excavation until
the genetic analyses were undertaken, it is exceedingly difficult to explain the
results by other sources of post excavation contamination. The results of the
control tests therefore suggest that sample handling and laboratory contamination
can be excluded as the source of the Native American Hgs A and B mtDNA
sequences.
Leaching of DNA from younger to older stratigraphic layers has been
demonstrated to be problematic in relatively wet, temperate cave environments
(20). Although the stratigraphic sections in the Paisley Caves are dry, and the
coprolites were recovered at different locations within the caves (Fig. 1b), we
performed additional tests to investigate whether leaching may have occurred.
Wood rat (predominantly Neotoma leporillus) fecal pellets are a major constituent
of the strata in the Paisley 5 Mile Point Caves, and are found in direct contact with
the coprolites (Table S1). We therefore tested the six human coprolites for
Neotoma mtDNA to investigate whether there was any evidence for DNA leaching.
To account for any unknown differences in the Neotoma species that had
inhabited the caves in the past, we used primers designed to amplify mtDNA from
all members of the genus (17). The results revealed that all six of the coprolites
that tested positive for Hgs A and B mtDNA contained no PCR amplifiable
Neotoma mtDNA. The result is in agreement with empirical and theoretical
evidence suggesting that free water is required for DNA leaching to take place (12,
![Page 243: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/243.jpg)
Resultados y Discusión
216
18, 20). As such, we exclude sample cross contamination as a likely explanation
of our results.
Intriguingly, three of the six coprolites were found to contain canid 16s
mtDNA. One sample contained mtDNA with high similarity to red fox (Vulpes
vulpes, 1 substitution difference), one with coyote mtDNA (Canis latrans, 1 substitution difference) and the last with mtDNA derived from either domestic dog
or wolf (Canis familiaris or Canis lupus, 100% match), respectively (Table 1). This
could suggest that humans ate canids, canids visiting the caves ate or urinated on
human feces, or canids ate humans. Regardless, the endogenous human DNA
sequences recovered would still be as old as the coprolites themselves.
Importantly, two of the oldest specimens did not produce any canid DNA and are
therefore of direct human origin.
Accelerator mass spectrometry (AMS) radiocarbon dating of a camelid
astragalus to 12.314C ka B.P in the stratum associated with three of the oldest
human coprolites initially suggested that they too might be older than 12 14C ka
B.P (Fig. 1b). To ensure reliable age estimates of the coprolites themselves, the
five oldest specimens were blind test submitted for direct dating by AMS at two
independent laboratories; Beta Analytic Inc. (Florida, USA), and the Oxford
Radiocarbon Accelerator Unit (University of Oxford, UK). Although each
laboratory used different methodologies (17), all specimens except one (sample
1294-PC-5/6B-40), produced consistent dates, ranging from approximately 1.3 to
12.4 14C ka B.P. with three of the coprolites predating Clovis in age (Table 1, Fig.
2). The conventional radiocarbon ages BP are demonstrably older (by c. 1kyr)
than the earliest range of AMS dated Clovis sites in North America (3) and
therefore will remain so regardless of future changes to the radiocarbon calibration
curve for the period.
In conclusion, we found that at least 6 of the 14 Paisley 5 Mile Point Caves
coprolites investigated contain authentic ancient Native American mtDNA.
Furthermore, three of the coprolites (originating from humans belonging to mtDNA
Hgs A and B) predate the Clovis complex (as currently documented (3)) by more
than 1000 14C years (ca. 12.2-12.3 14C ka B.P., Table 1, Fig. 2). The findings have
several important implications in regard to current understandings of peopling of
the Americas. First, the data reveal that humans were present in North America
ca. 1.3 14C ka before the earliest evidence of Clovis (3) eliminating the “Clovis
![Page 244: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/244.jpg)
Resultados y Discusión
217
First” model for the earliest colonization of North America from serious further
consideration. Second, in contrast to traditional views, the interior ice-free corridor
that is believed to have opened ca. 11-11.5 14C ka B.P. (21) is unlikely to have
been the first entrance route to areas south of Beringia. It seems more likely that
the first immigration into the Americas took advantage of some kind of “coastal
corridor” by 13 14C ka B.P. (22), or occurred prior to the Last Glacial Maximum ca.
18 14C ka B.P. when the Cordilleran and Laurentide ice sheets coalesced,
blocking interior migration routes (21). Finally, our results demonstrate that HgA
and HgB, common among Native American populations in northern and western
North America of today, were already to be found in America by 12.1 and 12.3 14C
ka B.P., respectively.
![Page 245: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/245.jpg)
Resultados y Discusión
218
References and Notes 1. J. A. Eshleman, R. S. Malhi, D. Glenn Smith, Evol. Anthropol. 12, 7-18 (2003).
2. P. C. Orr, Prehistory of Santa Rosa Island (1968). Santa Barbara
Museum of Natural History, Santa Barbara, California.
3. M. R. Waters, T. W. Stafford Jr., Science 315, 1122 (2007).
4. J. M. Adovasio, D. R. Pedler, in Entering America: Northeast Asia and Beringia
before the Last Glacial Maximum, D. B. Madsen, Ed. (Univ. Utah Press, Salt
Lake City, 2004), chap. 5.
5. E. J. Dixon, Quaternary Sci. Rev. 20, 301 (2001).
6. T. D. Dillehay, Sci. Am. 251, 106 (1984).
7. T. G. Shurr, Ann. Rev. Anthropol. 33, 551 (2004).
8. A. C. Roosevelt, J. Douglas, L. Brown, in The First Americans: The Pleistocene
Colonization of the New World, N. G. Jablonski, Ed. (Memoirs California
Academy Sciences, San Francisco, 2002), vol. 27, chap. 7.
9. J. M. Licciardi. J. Quaternary Sci. 16, 545 (2001).
10. C. I. Smith et al. Nature 410, 771 (2001).
11. T. Lindahl, B. Nyberg. Biochemistry 11, 3610 (1972).
12. A. J. Hansen, et al. Genetics 173, 1175 (2006).
13. H. N. Poinar, et al. Curr Biol. 13, 1150 (2003).
14. H. N. Poinar, et al. Science 281, 402 (1998).
15. M. Hofreiter et al. Mol. Ecol. 9, 1975-1984 (2000).
16. H. N. Poinar et al. Proc. Natl. Acad. Sci. USA 98, 4371-4322 (2001).
17. Supplementary Online Material.
18. E. Willerslev, A. Cooper, Proc. Biol. Sci. 272, 3-16 (2005).
19. M. T. P. Gilbert, H. –J. Bandelt, M. Hofreiter, I. Barnes. Trends Ecol. Evol. 20,
541-544 (2005).
![Page 246: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/246.jpg)
Resultados y Discusión
219
20. J. Haile et al. Mol. Biol. Evol. 24, 982-989 (2007).
21. D. B. Madsen, in Entering America: Northeast Asia and Beringia before the
Last Glacial Maximum, D. B. Madsen, Ed. (Univ. Utah Press, Salt Lake City,
2004), chap. 1.
22. J. M. Erlandson. in The First Americans: The Pleistocene Colonization of the
New World, N. G. Jablonski, Ed. (Memoirs California Academy Sciences, San
Francisco, 2002), vol. 27, chap. 4.
23. P. J. Reimer et al. Radiocarbon 46, 1029-1058 (2004).
24. C. Bronk Ramsey, Radiocarbon 43, 355-363 (2001).
25. K. K. Andersen et al. Quaternary Sci Rev 25, 3246-3257 (2006).
26. A. Svensson et al. Quaternary Sci Rev 25, 3258-3267 (2006).
![Page 247: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/247.jpg)
Resultados y Discusión
220
Table 1. Mitochondrial DNA and dating results.
Sample mtDNA AMS dates (Conventional 14C years BP) Cave Figure
1bg
Hg 16Se Site of Replication
Beta Analytic Inc.
Oxford University
1294-PC-5/7D-4 Ba C.latrans Uppsala Not tested 1,308±28 5 1
1374-PC-1/2A-28 Bb Uppsala 6,640±40 6,608±35 1
1294-PC-5/6B-40 Bb C.lupus/
familiarisf Uppsala 10,050±50 10,965±50 5 2
1294-PC-5/6B-50 Ac V.vulpes Uppsala 12,260±60 12,140±70 5 3
1294-PC-5/7C-31 Bd Uppsala /
Leipzig 12,290±60 12,345±55 5 4
1374-PC-5/5D-31 Bb Uppsala 12,400±60 12,275±55 5 5
Table 1. Mitochondrial DNA haplogroups identified using different techniques
across laboratories: aCopenhagen SNaPshot, Uppsala Pyrosequenced, Uppsala
cloned and sequenced, bCopenhagen SNaPshot, Copenhagen cloned, Uppsala
Pyrosequenced, Uppsala cloned and sequenced, cCopenhagen SNaPshot,
Uppsala Pyrosequenced, dCopenhagen SNaPshot, Uppsala Pyrosequenced,
Leipzig cloned and sequenced. For more details see (17). eCanid sequences
detected using generic mammalian mtDNA 16s primers. fSequences are
indistinguishable over this genetic marker. gSample identification in Figure 1b.
![Page 248: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/248.jpg)
Resultados y Discusión
221
Figure 1
Figure 1. Geographical and stereographical information of Paisley 5 Mile Point
Caves. (a). Location of Oregon in the United States (insert) and the location of
Paisley 5 Mile Point Caves in Oregon. (b) Horizontal, vertical, and stratigraphic
distributions of human coprolites and dated camelid astragalus in Cave 5
excavations. Sample 1374-PC-1/2A-28 (Table 1) was excavated from another
cave (Cave 1, not shown).
![Page 249: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/249.jpg)
Resultados y Discusión
222
Figure 2
Figure 2. Calibrated radiocarbon determinations from the Paisley 5 Mile Point
Caves obtained using INTCAL04 (23) and the OxCal4.0 software (24). The
calibrated age ranges are compared against the GICC05 d13C icecore record of
Andersen et al. (25) and Svensson et al. (26). Mean dates for Clovis sites reported
by Waters and Stafford (3) are included for comparison. The calibrated results for
Paisley Caves shows that they fit within the Last Glacial Interstadial, ~1000 cal
years prior to the earliest Clovis determinations. The figure shows that these
Clovis determinations sit immediately prior to the onset of Greenland Stadial 1
(Younger Dryas).
![Page 250: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/250.jpg)
Resultados y Discusión
223
Supplementary Online Material
Site and sample description
Human coprolites (desiccated feces) were recovered from the Paisley 5 Mile Point
Caves (Fig. 1a, main article) (35LK3400) in south-central Oregon, USA (Fig. 1a,
main article), by the University of Oregon archaeological field school in 2002 and
2003 (Table S1). The cave deposits are firm, poorly to moderately sorted, mixes of
Aeolian sandy-silt matrix with occasional subangular to angular pebble and cobble
clasts of igneous rock. The Pleistocene deposits range in depth below the modern
surface from 150 to >300 centimeters. Macrobotanical remains, rodent (wood rat,
most likely Neotoma leporillus) fecal pellets, and naturally deposited bone
constitute major components of the deposits within which Pleistocene faunal
elements (camelid, horse, bison, and pika) and associated cultural materials
(human feces, perishable artifacts, and stone tools) were found. The presence of
canid bones—coyote and possibly gray wolf, dog, and fox—attests to the use of
the caves as dens when they were not occupied by humans.
The contemporaneity of Late Pleistocene megafauna and cultural remains in the
Paisley 5 Mile Point Caves has been established by radiocarbon dating. AMS 14C
dating applied to bone collagen of a camelid astragalus (probably Camelops) and
a horse phalange produced dates of 12,300±40 14C B.P. (15,340-12,170 calendar
years (cal. B.P.)) and 11,130±40 14C B.P. (13,190-12,290 cal. B.P.), respectively
(Table S2). Late Pleistocene cultural remains dated by the AMS method include
the six human coprolites (see below), sewing threads made of animal sinew and
plant fibers, charred food tissues, and braided sagebrush rope (Table S2). These
items date between 10,050±50 14C B.P. (ca. 11,560 cal. BP) and 12,400±60 14C
B.P. (ca. 14,340 cal. B.P.). Verification of the oldest AMS dates was obtained by
replication of the dating process by two independent laboratories (Beta Analytic,
Inc., Miami, Florida, USA and the Oxford Radiocarbon Accelerator Unit,
University of Oxford), resulting in the matched pairs of dates in Table S2.
Support for the radiocarbon dating was also obtained by obsidian hydration (OH)
dating (S1, S2) of 136 specimens from across the site. A hydration rate of 2.2
![Page 251: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/251.jpg)
Resultados y Discusión
224
µ²/1000 yrs. was developed for cool, dry, cave interior site deposits based on the
association of 13 OH measurements with a stratigraphically sealed 12,000 year old
(calibrated age) hearth associated with a braided sagebrush rope in Cave 2.
Application of this OH rate to four specimens recovered from Late Pleistocene
deposits containing megafaunal remains in Cave 5 indicates the OH specimens
are stratigraphically consistent and that they match the calibrated radiocarbon
ages with which they are associated very well.
Genetic analyses of coprolite samples Fourteen coprolite samples were initially analyzed for survival of DNA in
Copenhagen (Table S3). Genetic testing for human DNA was performed as
detailed below. Samples that were identified as containing Native American
mitochondrial DNA (mtDNA) were independently replicated in one or two
laboratories; Ancient DNA Laboratory, Department of Evolutionary Biology,
University of Uppsala (Sweden) and the Ancient DNA Laboratory, Max Planck
Institute for Evolutionary Anthropology, Lepizig (Germany). Various genetic
techniques were used to identify human DNA, including conventional PCR
followed by molecular cloning and sequencing, pyrosequencing, and multiplex
PCR with minisequencing. The results from all Native American DNA positive
samples are confirmed in at least 2 laboratories, using at least 2 techniques (Table
1, main article).
Initial DNA extractions and genetic analyses, University of Copenhagen DNA was extracted initially from all the samples in Copenhagen, following the
method of Willerslev et al. (S3). Approximately 0.1g of coprolite was used per
sample.
It is very likely that all excavated coprolites are contaminated with modern human
DNA, as little specific control beyond collection with gloves, trowel, or tweezers
were taken to prevent contamination at time of excavation. Furthermore, DNA
from feces (whether ancient or modern) is characteristically highly degraded (S4,
S5), limiting analyses to short fragments of up to a few hundred base-pairs in size.
We therefore adopted an initial screening strategy to enable the rapid identification
of samples that were likely to contain mtDNA characteristic of Native American
![Page 252: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/252.jpg)
Resultados y Discusión
225
haplogroups. This was achieved using a multiplex PCR and minisequencing as in
Sanchez et al. (S6, S7). Although many ancient DNA (aDNA) studies characterize
human Haplogroups (Hg) using the HVR1 region of the mtDNA D-loop, we did not
take this approach because i) the fragments amplified would probably be limited to
partial sections, and ii) partial fragments containing partial SNP profiles can be
indicative of a number of Hgs. Therefore, we chose to target Hg specific SNPs that
are located in the mitochondrial coding region.
Marker Choice
Each one of the 5 SNPs chosen is diagnostic of one of the 5 founding Native
American haplogroups; A, B, C, D, and X (e.g. S8), The SNPs are as follows
(position with reference to the Cambridge Reference Sequence, (S9)). Haplogroup
A, 663 A→G (S10); Haplogroup B, 8281 9bp deletion (S11); Haplogroup C, 9545
A→G (S12); Haplogroup D, 5178 C→A (S13); Haplogroup X, 6221 T→C (S14). All
these SNPs are routinely employed in studies used to characterize the
haplogroups within Native American remains (e.g. S15-S18). In order to
corroborate the results we additionally performed minisequencing analysis of the
sites 10400, 10873 and 12705. SNPs at these positions define mitochondrial
haplogroups M, N and R respectively, and provide additional support for the 5
Native American haplogroups that derive from them.
Although haplogroups A, B, C, D and X may also be found in other non-Native
American populations, and supposedly Native American-specific lineages of the
above haplogroups exist (e.g. Hg A2 and B2; (S11, S19)), we chose to use SNPs
that are diagnostic of the mother haplogroups. This was to specifically ensure
against the possibilities that either the derived haplotypes arose post settling of
the Americas at a time point younger than our samples, or that additional variation
existed among the early populations that has been lost since. Furthermore, we
argue that even in the absence of diagnosis of the samples down to a
contemporary Native American haplotype, the presence of haplogroups A, B, C, D
or X among our samples, and its absence in all potential sources of modern DNA
contamination, clearly suggest that the coprolites are derived from Native
Americans. However, we do note that over the complete mtDNA genome the
![Page 253: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/253.jpg)
Resultados y Discusión
226
apparently Native American derived lineages contain several SNPs that separate
them from other A and B lineages (A2 SNPs at np 8027, 12007, 16111 (S19), and
B2 SNPs at np 146, 3547, 4977, 6473, 9950, 1117; (S11)). In future studies it will
be interesting to investigate whether the oldest samples studied here contain all
the derived SNPs, or if in contrast they represent transition groups.
Multiplex SNP assay Multiplex PCR was performed in a reaction volume of 25 µl containing 1x Platinum
Taq High Fidelity PCR buffer (Invitrogen), 2 mM MgSO4, 200 mM of each dNTP, 1
µM of each primer (Table S4), and 1U Platinum Taq HiFi DNA polymerase
(Invitrogen). Thermal cycling program was: denaturation at 94 oC for 2 minutes
followed by 40 cycles of 94 oC for 30 s, 60 oC for 30 s and 68 oC for 45 s, followed
by 6 minutes at 68 oC.
Excess primers and dNTPs were removed by addition of 1 µl (1 U/µl) shrimp
alkaline phosphatase and 0.02 µl (10 U/µl) Exonuclease I (Amersham Pharmacia
Biotech) to 2.5 µl PCR product and incubating the mixture at 37 oC for 30 min
followed by 75 oC for 15 min.
Minisequencing reactions were performed in 8 µl with 1 µl purified PCR product, 4
µl SNaPshot reaction mix(Applied Biosystems), 0.8 µl minisequencing primer mix
(0.2 mM of each minisequencing primer, see Table S5) and 2.2 µl Milli-Q water.
The minisequencing primer mix was diluted in 160 mM ammonium sulphate
(Sigma-Aldrich) to minimize primer-dimer artifacts. Excess nucleotides were
removed by addition of 1 µl (1 U/µl) shrimp alkaline phosphatase to the
minisequencing mix and incubation at 37 oC for 30 minutes followed by 75 oC for
15 minutes. Two µl of minisequencing product were mixed with 18 µl of Hi-Di
formamide (Applied Biosystems) and 0.1 µl GeneScan-120 Liz internal size
standard (Applied Biosystems), and analyzed by capillary electrophoresis using
ABI Prism 3130 Genetic Analyzers with 34 cm capillary arrays and POP-7 polymer
(Applied Biosystems).
Samples were analyzed sequentially using GeneScan and Genotyper software.
Analysis parameters for GeneScan were set to a minimum peak height of 120 rfu
for blue, 60 rfu for green and 30 rfu for red, yellow and orange. The results were
![Page 254: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/254.jpg)
Resultados y Discusión
227
scrutinized both visually and numerically. For full methodological and theoretical
details, please refer to elsewhere (S6, S7).
The initial results suggested that although all 14 coprolite samples contained
human DNA (Table S3) (as expected due to contamination arising during initial
excavation), only 6 of the samples contained DNA belonging to either Hgs A or B
(as indicated in table 1). To confirm the identity of these Hgs the SNPs were re-
PCRd in singleplex PCR reactions, and either cloned and sequenced in
Copenhagen, or pyrosequenced in Uppsala. Furthermore, all 6 candidate Native
American coprolite samples were sent to at least 1 independent laboratory for
further confirmation (as detailed later).
PCR amplification and cloning of potential Native American haplogroup
SNPs, Copenhagen
Singleplex PCR amplification of the Hg A and B SNPs were amplified for 40 cycles
in 25µl PCR reactions using 0.2U of the enzyme Amplitaq Gold (Applied
Biosystems), 200µM mixed dNTPs, 2.5mM MgCl2, and primers L08272/H08328
(Haplogroup B, 96/87 bp product, primer annealing temperature 60°C) or
L00654/H00686 (Haplogroup A, 78bp, primer annealing temperature 60°C). For
primer sequences refer to Table S4.
Amplicons that were cloned in Copenhagen were cloned using the Topo TA
cloning kit (Invitrogen) following the manufacturer’s guidelines. Prior to
sequencing, PCR was performed directly on insert-positive colonies using the
manufacturer’s vector specific primers M13F and M13R. PCR products were
assayed for correct size on 2% agarose gels, then purified and sequenced using
BigDye 3.1 chemistry (Applied Biosystems).
Assay for canid DNA
It can be difficult to discriminate between human and canid archaeological
coprolites due to similarities in coprolite morphology and content. Therefore the six
coprolites that tested positive from Native American DNA were also screened for
![Page 255: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/255.jpg)
Resultados y Discusión
228
canid DNA, using generic mammalian primers that target a short (133-141 bp,
taxon dependent) fragment of the mitochondrial 16s gene (S20). PCR
amplifications were performed as above, with an annealing temperature of 52°C.
Positive PCR reactions were cloned and sequenced as described above. The
cloned sequences were identified using conventional BLAST searches of
GENBANK (http://www.ncbi.nlm.nih.gov/), revealing the coyote, fox, and dog/wolf
sequences in three of the coprolites as discussed in the main text (main text Table
1). Due to the non-specific nature of the primers, various non-canid sequences
were also recovered (P.F. Thomsen, unpublished data). These likely represent
components of the sources’ diets, and will be discussed in future publications.
Contamination controls
DNA degradation to sub-analytical levels is a universal challenge facing aDNA
studies. Such degradation is known to correlate loosely with thermal energy (S21),
thus under conventional models relatively warm environments such as the Paisley
5 Mile Point Caves might initially be viewed as suspect environments for DNA
survival. However, other studies have demonstrated that mtDNA remains PCR
amplifiable in desiccated American ground sloth (Nothrotheriops shastensis)
coprolites that date back as far as 29.2 14C ka B.P. (S22). This indicates that at
least some degree of protection is conferred to the DNA against degradation in
such environments, and as such DNA survival in the relatively younger coprolites
studied here is not surprising.
All ancient human DNA studies are susceptible to contamination from modern
sources of DNA. As the coprolites were not excavated under sterile conditions, it is
important to rule out modern contaminant DNA sequences as a potential source of
error. As the samples were all excavated from undisturbed sediments, and have
been stored in sealed containers since, the only potential sources for
contamination with modern DNA are at the archaeological site, or in the genetic
laboratories. Therefore, we obtained hair samples from 67 people that were
involved either with the archaeological site or in the Copenhagen DNA laboratory
in order to ensure that the amplified SNPs specific to Hgs A and B could not derive
from these modern sources. At this point we highlight that, although all those
![Page 256: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/256.jpg)
Resultados y Discusión
229
mentioned above were genetically typed, the majority of those at the site were not
actively involved in the excavation or analysis of the Native American coprolites,
thus it is highly improbable that they could be a source of contamination.
DNA was extracted from the hairs following Gilbert et al. (S23). DNA extracts were
PCR amplified using 3 sets of primers, designed to amplify a 328 (319 if deletion
present) bp fragment surrounding the haplogroup B specific 9bp deletion between
np 8271-8281, a 246bp fragment surrounding the haplogroup A specific 663 A→G
SNP and the near-complete Hypervariable 1 region (between np 16055-16410)
respectively. PCRs were performed in 25µl reactions as detailed above, with an
annealing temperature of 56°C, using primers L16055/H16410 (HVR1, (S24)),
8070F/8398R (Hg B) and 549F/795R (Hg A) (Table S4).
The results of the typing are shown in Table S6. The combined HVR1 and coding
region data indicates that no person involved in the study belongs to Hg A or B.
However, we noted that the mtDNA sequence of one of the archaeologists
(Individual 30, Table S6), who we identified as belonging to Hg K based on the
HVR1 sequence, did contain the 9bp deletion characteristic of Hg B. This deletion
has previously been sporadically reported in a small number of non-Hg B
sequences, including Hg K (c.f. S25). Due to this result we took specific steps to
rule out the excavator as a source of contamination in the ancient samples (even
though the archaeologist had not been in direct contact with the coprolites). This
was achieved by investigating for the presence of a T→C SNP at np 16224 that is
uniquely characteristic of individual 30, in all the Hg B positive coprolite samples.
This was performed both in Copenhagen and Uppsala to provide double
confirmation.
PCR on the DNA extracts used primers 16206F/16346R. The PCR enzyme and
conditions were as detailed above, although with an annealing temperature of
56°C. Successfully amplified products were cloned and sequenced in
Copenhagen (as detailed above), or pyrosequenced in Uppsala. Although this
PCR fragment is longer than those used to type the A and B coding region SNPs
(96bp and 87bp, respectively), we argue that this would not affect the results as
![Page 257: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/257.jpg)
Resultados y Discusión
230
our aim was the typing of modern contaminant DNA (if present). Furthermore, the
control fragment is similar in length to that of the putative canid sequences
(140bp). Our results indicated that no extracts yielded the 16224 SNP diagnostic
of individual 30, thus it is very unlikely that the 9bp-deletion amplified form the
coprolites can also be explained through contamination by this individual.
Controls against inter-sample DNA leaching
It has recently been reported that in some (wet temperate) burial environments
DNA may leach between stratigraphic layers (S26). We believe that a number of
arguments suggest this is not a problem within our study. First, the environment
within the caves is dry, with little evidence of water presence at any time during
the history (water could not have repeatedly saturated the deposits without
destroying the coprolites, threads, and flesh adhering to the camel bones found
within the caves). In the absence of free water, it remains difficult to propose a
likely mechanism through which DNA might be transferred between samples.
Second, the Native American positive samples are spatially distant from each
other within the caves (Figure 1b, main article). While 5 of the coprolites were
recovered from the same cave 5, they are separated spatially over an area of
approximately 8m2, by as much as 2.5 to 3 meters, ranging from units 7C and 7D
(to the left) to 6B (to the right) (Figure 1b, main article). Vertically, they span a
maximum of 230 cm (-70 cm in Unit 7D to -300 cm in Unit 6B).
While the above renders it exceedingly difficult to envisage cross-contamination
between the samples in the burial environment, to completely rule this out we
performed an additional genetic test to investigate for any evidence of cross-
contamination as follows.
One of the main components of the burial environment is wood rat coprolite (most
likely Neotoma lepidus). As such, all the human coprolites have been in close
proximity with wood rat coprolite, and if DNA leaching had occurred we could
reasonably expect the presence of wood rat DNA within the human coprolites. To
test this we attempted to PCR amplify a short (82bp) fragment of the mtDNA
cytochrome-b from all 14 coprolites using primers Lepidus_f and Lepidus_r (Table
![Page 258: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/258.jpg)
Resultados y Discusión
231
S4). To ensure against the possibility that the wood rat species was one different
to that representative of the geographic area today, the primers were designed
using the dataset of Edwards and Bradley (S27) to be generic to the Neotoma
genus. PCR conditions were as described above, with an annealing temperature
of 56°C. The PCRs indicate no evidence of wood rat DNA within the DNA extracts,
thus suggest that DNA leaching is not a factor within this burial environment.
Independent replication, Uppsala
Cloning of PCR products is often used to monitor haplotypes of mixed origin in
ancient DNA extracts. While amplicons containing DNA from more than one
source may be identified with cloning, the method has the drawback that such
large numbers of clones need to be sequenced to identify proportions of different
haplotypes that it is practically impossible (S28). Pyrosequencing provides an
alternative approach. The method is based on real time sequence identification,
measuring light emitted via enzymatic reactions when bases are incorporated. As
the proportion of light is directly correlated to the amount of bases incorporated, it
is possible to detect relative proportions of different haplotypes based on
diagnostic bases with the addition of proportional allele quantification as
implemented in the pyrosequencing software (S29, S30). The method has proven
useful in forensic casework as well as in aDNA studies (S31, S32). Extraction and
amplification in Uppsala was designed to prepare the material for relative
quantification with pyrosequencing.
Replication was performed on 5 of the coprolites identified in Copenhagen as
containing Hg A or B sequences. DNA was extracted with a column based method
that relies on the binding properties of silica to DNA (S33). One important change
was made to the protocol. After Proteinase k-EDTA incubation, an equal volume of
2M K2HPO4 (neutralized to pH 7 with phosphoric acid) was added to the reaction,
bringing the K2HPO4 concentration to 1M. Thereafter the sample was incubated
for 24 hours at 55°C before washing it though a filter column. One sample (1374-
PC-1/2A-28) initially did not yield any amplifiable DNA. However, further
purification using a ‘fishing’ technique that utilizes biotinylated primers and
magnetic separation (S34) enabled subsequent PCR amplification.
![Page 259: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/259.jpg)
Resultados y Discusión
232
DNA was PCR amplified using the primers detailed in Table S4 spanning
diagnostic mutations, and an internal pyrosequencing primer (Table S4) was used
to further increase specificity. The amplicons were analyzed for Haplogroup A, B,
non A-B content, and for the substitution at np 16,224 T→C SNP that is diagnostic
of the potentially problematic modern handler (individual 30, Table S6, for the
reasons as detailed above). The Hg A and B assays were performed
independently four times per coprolite, while the 16,224 SNP was analyzed twice
per sample. The non A-B content was regarded as modern contaminating DNA
while the lack of the 16,224 substitution was regarded indicative for modern
individual 30 not having contaminated the samples. Secondary structures of
template DNA, dimers, and other types of artifacts can sometimes create
backgrounds interpreted as results, although this background is generally lower
than 5%. To investigate if there could be artifacts interpreted as the native
American haplogroups A and B, 20 animal remains that had been extensively
handled by various researchers with European origin (thus, contaminated with
human DNA, but not with Hg A or B) were extracted, amplified, and typed in a
similar fashion as the Native dung samples. None of the non-human controls
produced a background similar to the Native haplogroups higher than 2% (the
minimum level for detection using pyrosequencing) (Table S7). As such, there is
no evidence of any native American DNA in these control specimens, indicating
that the Native American DNA results are extremely unlikely to have arisen due to
contamination during the extraction of the samples. The pyrosequencing results
on the coprolites however produced results that were in direct agreement with the
findings from Copenhagen (Table S7). Allelic quantification of the Native American
alleles indicates that the percent of Native American mtDNA amplified in each
reaction varied by extract, although in general was above 50%, and in many cases
above 98% (Table S7).
To further support the pyrosequencing results, amplicons were cloned and
sufficient numbers of clones were sequenced to identify the Native American
haplogroups. Cloning was performed using JM109 competent cells and pGEM ®-
T Vector System II cloning kit (Promega), according to the manufacturer's
instructions. Recombinant colonies were further screened with PCR. The colonies
were transferred into a 25 µl reaction mix containing the following in final
![Page 260: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/260.jpg)
Resultados y Discusión
233
concentrations: 1 x PCR buffer, 2.5 mM MgCl2, 1.5 U AmpliTaq Gold® (all from
Applied Biosystems), 200 µM of each dNTP and 0.2 µM of M13 forward and
reverse universal primers. Thermal cycling conditions were: pre-incubation for 10
min at 95°C, followed by 35 cycles of 30 s at 94°C, 30 s at 50°C, 30 s at 72°C.
Clones with an insert of the expected size were identified by agarose-gel
electrophoresis. PCR products were sequenced in forward and reverse directions.
The samples were cleaned with ExoSAP-IT® (USB Corporation) according to the
manufacturer’s instructions. Sequencing was performed using the DYEnamic®
cycle sequencing kit (Amersham Biosciences), with the primers shown in Table
S4. The fragments were analyzed on a MegaBACE 1000® (Amersham
Biosciences). Obtained nucleotide sequences were aligned manually using the
BioEdit software and compared to GenBank sequences. Independent replication, Leipzig
Independent replication (PCR amplification and cloning of DNA sequence around
the Hg A and B specific SNPs) performed in Leipzig was undertaken as in
Copenhagen.
Accelerator Mass Spectrometry (AMS) Initial AMS dating of the coprolites was performed commercially by Beta Analytic
Inc. (Florida, USA) using their in house protocols. Details of the technique used
can be obtained from the company web site (www.radiocarbon.com).
Due to the importance of accurately dating the coprolites, sub samples of the 6
Native American coprolites were sent for independent dating at the Oxford
Radiocarbon Accelerator Unit (ORAU), University of Oxford. Radiocarbon
determinations obtained from the ORAU are shown in Table S2. The samples are
all plant matter extracted using tweezers from bulk coprolite material. The
extracted material was treated using an acid base acid sequence (1M HCl at
80°C, followed by 0.2M NaOH at 80°C and then 1M HCl once again), interspersed
between each step with ultra-high purity water rinses. Then treated material was
then bleached using 5.0% (w:vol) NaOCl at pH 3 and 80°C for approximately 30
minutes, before being rinsed and dried. Pretreated material was weighed into pre-
![Page 261: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/261.jpg)
Resultados y Discusión
234
cleaned tin capsules and directly combusted in a Roboprep CHN elemental
analyzer interfaced with a Europe 20-20 mass spectrometer. The CO2 generated
was graphitized by catalytic reduction of CO2 onto iron in an excess hydrogen
atmosphere. The Oxford AMS radiocarbon method and instrumentation is reported
by Bronk Ramsey et al. (S35).
![Page 262: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/262.jpg)
Resultados y Discusión
235
Supplemental References
S1. I. Friedman, Science 159:878-880 (1968).
S2. I. Friedman, F. Trembour, Am. Antiquity 48:544-547 (1983).
S3. E. Willerslev et al. Science 300, 791-795 (2003).
S4. H. Poinar et al. Science 281, 402-406 (1998).
S5. B. E. Deagle, J. P. Eveson, S. N. Jarman, Front. Zool. 3, 11 (2006).
S6. J. J. Sanchez et al. Forensic Sci. Int. 137, 74-84 (2003).
S7. J. J. Sanchez et al. Electrophoresis 27, 1713–1124 (2006).
S8. P. Forster, R. Harding, A. Torroni, H. -J. Bandelt H-J, Am. J. Hum. Genet. 59,
935-945 (1996).
S9. S. Anderson et al. Nature 290, 457-465 (1981).
S10. A. C. Stone, M. Stoneking, Am. J. Phys. Anthropol. 92, 463-71 (1993).
S11. L. A. Wrischnik et al. Nucleic Acids Res. 15, 529–542 (1987).
S12. E. B. Starikovskaya et al. Ann. Hum. Genet. 69, 67-89 (2005).
S13. R. L. Parr, S. W. Carlyle, D. H. O'Rourke Am. J. Phys. Anthropol. 99, 507-
518 (1996).
S14. M. Reidla et al. Am. J. Hum. Genet. 73, 1178–1190 (2003).
S15. A. C. Stone, M. Stoneking, Am. J. Hum. Genet. 62, 1153–1170 (1998).
S16. D. A. Demarchi, G. M. Panzetta-Dutari, S. E. Colanonio, A. J. Marcellino
Hum. Biol. 73, 757-582 (2001).
S17. A. González-Olivier, L. Márquez-Morfin, J. C. Jiminéz, A. Torre-Blanco, Am.
J. Phys. Anthropol. 116, 230-235 (2001).
S18. M. Moraga et al. Am. J. Phys. Anthropol. 127, 170 – 181 (2004).
S19. W. A. Silva et al. Am. J. Hum. Genet. 71, 187-192 (2002).
S20. P. G. Taylor, Mol. Biol. Evol. 13, 283-285 (1996).
S21. T. Lindahl, Nature 392, 709-715 (1993).
![Page 263: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/263.jpg)
Resultados y Discusión
236
S22. M. Hofreiter et al. Mol. Ecol. 9, 1975-1984 (2000).
S23. M. T. P. Gilbert et al. Curr. Biol. 14, R463-464 (2004).
S24. O. Handt, M. Krings, R. H. Ward, S. Pääbo, Am. J. Hum. Genet. 59, 368-376
(1996).
S25. D. M. Behar et al. Am J Hum Genet 78, 487-497 (2006).
S26. J. Haile et al. Mol. Biol. Evol. 24, 982-989 (2007).
S27. C. W. Edwards, R. D. Bradley, Mol. Phyl. Evol. 25, 489-500 (2002).
S28. M. A. Bower et al. Nucleic Acids Res. 33, 2549-2556 (2005).
S29. J. D. Gruber, P. B. Colligan, J. K. Wolford, Hum. Genet. 110, 395-401 (2002).
S30. B. P. Neve et al. Biotechniques 32, 1138-1142 (2002). proportional allele
quantification as implemented in the pyrosequencing software (S27, S28).
S31. A. Götherström et al. Proc. Biol. Sci. 272, 2345-2350 (2005).
S32. H. Malmström et al. Mol. Biol. Evol. 24, 998-1004 (2007).
S33. D. Y. Yang et al. Am. J. Phys. Anthropol. 105, 539-543 (1998).
S34. C. Anderung et al. Proc Natl Acad Sci U S A. 102, 8431-8435 (2005).
S35. C. Bronk Ramsey, T. F. G. Higham, P. Leach P, Radiocarbon 46, 17-24
(2004).
S36. P. J. Reimer et al. Radiocarbon 46, 1029-1058 (2004).
![Page 264: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/264.jpg)
Resultados y Discusión
237
Table S1. Details on soils and location of six Native American mtDNA positive
coprolites within the Paisley 5 Mile Point Caves
Table S2. Late Pleistocene radiocarbon and obsidian hydration dates from the
Paisley 5 Mile Point Caves (35 LK 3400).
14C Dating ID# Conventional 14C Age
Calibrated age ranges (cal yrs BP)
(95.4% prob.) δ13C (‰) Material O.H. Dates
Beta-2134231 10,050±50 11819 - 11319 -14.7 Human dung 11,820 OxA-16376 10,965±50 13030 - 12839 -23 Human dung Beta-182920 10,160±60 12075 - 11411 -22.6 Processed edible tissues 11,820 Beta-195908 10,290±40 12355 - 11835 -24 Sagebrush rope Beta-171938 10,550±40 12731 - 12393 -25 Grass threads 12,770 Beta-213425 10,690±60 12846 - 12424 -20.4 Human dung Beta-185942 11,130±40 13121 - 12934 -25.2 Horse, 2nd phalange Beta-2164742 12,260±60 14480 - 13941 -25.6 Human dung OxA-16495 12,140±70 14156 - 13821 -25 Human dung
Beta-2134263 12,290±60 14591 - 13990 -25.4 Human dung 14,770 OxA-16497 12,345±55 14695 - 14052 -24.5 Human dung Beta-172663 12,300±40 14498 - 14016 -20.7 Camelid astragalus Beta-2134244 12,400±60 14826 - 14125 -18.4 Human dung 16,910 OxA-16498 12,275±55 14505 - 13971 -16.6 Human dung
For correlation between Dating ID# and Sample # for the six positively identified
Native American samples, see Table S3. Radiocarbon dates calibrated using the
INTCAL04 dataset of Reimer et al. (S36).
Specimen Cave Unit Level Depth/Elevation Stratum Soil description
1374-PC-5/5D-31 5 5D 31 -205 to 215/96.55 1B Light brown sandy silt with gravels, some rat feces and vegetation
1294-PC-5/6B-40 5 6B 40 -245 to 250/96.2 1A Medium brown, loose, small pebbles, some compact rat midden
1294-PC-5/6B-50 5 6B 50 -295 to 300/95.7 1A Compact rat midden
1294-PC-5/7D-4 5 7D 4 -70/98.3 8B/9 Medium brown to gray, partially charred rat midden (feces, botanics), some rock, gravel, sand, silt
1294-PC-5/7C-31 5 7C 31 -200 to 205/96.95 1B Highly organic (rat midden), gravel base, calcium carbonate on gravels
1374-PC-1/2A-28 1 2C 28 -190 to 195/97.05 4 Light brown/yellow Mt. Mazama tephra, 5-10% rounded pebbles, some darker brown sand
![Page 265: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/265.jpg)
Resultados y Discusión
238
Table S3. Sample identification numbers.
aAll samples contained evidence of non-Native American human mtDNA
sequences. No samples contained evidence of cross contamination from
surrounding wood rat (Neotoma genus) coprolites
Sample mtDNAa Dating ID# (where relevant) Beta Analytic ORAU 1294-PC-5/7D-4 Native American OxA-16377 1294-PC-2/3C-19 Beta-213429 1374-PC-1/2A-28 Native American Beta-213428 OxA-16496 1294-PC-5/6B-40 Native American Beta-213423 OxA-16376 1294-PC-5/6B-50 Native American Beta-216474 OxA-16495 1294-PC-5/7C-31 Native American Beta-213426 OxA-16497 1294-PC-5/10D-8 Beta-213427 1374-PC-5/5B-25 1374-PC-2/1A-12 1374-PC-2/1A-13 1374-PC-5/5D-31 Native American Beta-213424 OxA-16498 1294-PC-2/3C-16 1294-PC-1/4C-23 1294-PC-5/7D-12
![Page 266: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/266.jpg)
Resultados y Discusión
239
Tabl
e S4
. Mito
chon
dria
l reg
ion
info
rmat
ion
and
prim
er s
eque
nces
for P
CR
reac
tions
.
Spec
ifici
tyFo
rwar
d
prim
erSe
quen
ce (5
’3’
)R
ever
se
prim
erSe
quen
ce (5
’3’
)A
mpl
icon
size
(bp)
mtD
NA
SN
P
test
edH
uman
L0
8272
G
GC
CC
GTA
TTTA
CC
CTA
TAG
CA
C
H08
328
G
AG
GTG
TTG
GTT
CTC
TTA
ATC
TTTA
AC
96
or 1
05
8281
(9bp
del
) H
uman
L0
5164
C
AC
CA
CG
AC
CC
TAC
TAC
TATC
TCG
H
0518
3 G
GA
TGG
AA
TTA
AG
GG
TGTT
AG
TCA
T 67
51
78
Hum
an
L095
32
CA
CTC
CA
GC
CTA
GC
CC
CTA
C
H09
578
GA
GTG
GG
AC
TTC
TAG
GG
GA
TTT
87
9545
H
uman
L0
0654
C
AC
ATC
AC
CC
CA
TAA
AC
AA
ATA
GG
T H
0068
6 G
GG
ATG
CTT
GC
ATG
TGTA
ATC
T 78
66
3 H
uman
L0
6206
C
CC
CG
CA
TAA
AC
AA
CA
TAA
GC
H
0623
2 A
CTA
TAG
CA
GA
TGC
GA
GC
AG
GA
GTA
71
62
21
Hum
an
8070
F C
ATG
AG
CTG
TCC
CC
AC
ATT
A
8398
R
GG
TGG
GC
CA
TAC
GG
TAG
TATT
32
0 or
329
82
81 (9
bp d
el)
Hum
an
549F
C
AA
CC
AA
AC
CC
CA
AA
GA
CA
C
795R
A
GG
CTA
AG
CG
TTTT
GA
GC
TG
246
663
Hum
an
206F
A
AG
TAC
AG
CA
ATC
AA
CC
CTC
34
6R
AA
GTA
CA
GC
AA
TCA
AC
CC
TC
141
1622
4 N
eoto
ma
sp.
Neo
tom
a_F
CC
TTA
CA
GG
CC
TATT
CC
TAG
CC
N
eoto
ma_
R
ATC
TCG
GC
AA
ATG
TGG
GTT
A
82
--
Hum
ana
L082
72A
s abo
veH
0829
4TA
ATG
CTA
AG
TTA
GC
TTTA
CA
GTG
G69
or 6
0 82
81 (9
bp d
el)
Hum
ana,
bL0
8275
C
CG
TATT
TAC
CC
TATA
GC
AC
CC
C
Hum
ana
L006
54A
s abo
veH
0066
6C
TTA
CTA
AG
AG
CTA
ATA
GA
AA
G58
66
3 H
uman
a,b
L006
57
ATC
AC
CC
CA
TAA
AC
AA
ATA
GG
TTTG
H
uman
aL1
6205
CC
CA
CC
CC
ATG
CTT
AC
AA
H16
233
TGG
AG
TTG
CA
GTT
GA
TGTG
TGA
67
16
224
Hum
ana,
bH
(S)1
6230
TGC
AG
TTG
ATG
TGTG
ATA
G
a Use
d du
ring
Upp
sala
repl
icat
ion
b Seq
uenc
ing
prob
e us
ed d
urin
g U
ppsa
la p
yros
eque
ncin
g
![Page 267: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/267.jpg)
Resultados y Discusión
240
Tabl
e S5
. Min
iseq
uenc
ing
prim
ers.
mtD
NA
SN
Ps
mtD
NA
hapl
ogro
up
assi
gned
Prim
er
nam
eSe
quen
ce (5
’3’
) aPr
imer
size
Nuc
leot
ides
dete
cted
Det
ectio
n
orie
ntat
ionb
Anc
estr
alde
rive
d
alle
lesc
9545
C
95
45sn
R
ctct
ctct
ctct
ctct
ctct
TTG
GG
GG
CC
AG
TGC
CC
36
T
C o
r A
Rev
erse
A
G
663
A
0066
3snF
tc
tctc
tctc
tctc
tCC
CA
TAA
AC
AA
ATA
GG
TTTG
GTC
CT
40
AG
Forw
ard
AG
6221
X
06
221s
nF
ctct
ctct
ctct
ctct
ctct
CA
AC
ATA
AG
CTT
CTG
AC
TCTT
AC
C
44
TC
Forw
ard
TC
8281
(9bp
del
) B
08
281_
9snR
tct
ctct
ctct
ctct
ctct
ctct
ctct
CTT
TAC
AG
TGG
GC
TCTA
GA
GG
GG
GT
52
AG
Rev
erse
T
Cd
5178
D
05
178s
nR
tctc
tctc
tctc
tctc
tctc
tctc
tctc
tctG
GA
ATT
AA
GG
GTG
TTA
GTC
ATG
TTA
56
G
TR
ever
se
CA
a 5’ n
on-b
indi
ng s
eque
nce
iden
tifie
d us
ing
low
er c
ase
lette
rs, 3
’ seq
uenc
e sp
ecifi
c se
quen
ce id
entif
ied
usin
g ca
pita
l let
ters
. b Th
e
orie
ntat
ion
with
res
pect
to
the
Cam
brid
ge R
efer
ence
Seq
uenc
e. c A
nces
tral
sequ
ence
is
cons
ider
ed t
he C
ambr
idge
Ref
eren
ce
Seq
uenc
e (S
9).
d Anc
estra
l T is
firs
t ba
se o
f 9b
p se
quen
ce t
hat
is d
elet
ed in
Hg
B in
divi
dual
s. I
n de
rived
Hg
B in
divi
dual
s, t
he
dete
cted
nuc
leot
ide
is th
e fir
st n
ucle
otid
e af
ter t
he d
elet
ion.
![Page 268: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/268.jpg)
Resultados y Discusión
241
Tabl
e S6
. Res
ults
from
the
mtD
NA
typi
ng o
f the
67
mod
ern
poss
ible
sou
rces
of c
onta
min
atio
n In
divi
dual
Lo
catio
n H
VR1
re
gion
seq
uenc
ed (1
6---)
* A
snp
(663
A-G
) B
del
etio
n (8
271-
8281
9bp
del
etio
n)
Nuc
leot
ide
posi
tions
in H
VR1
regi
on th
at d
iffer
from
the
Cam
brid
ge R
efer
ence
Seq
uenc
e (1
6---)
* 1
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
144A
2
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
069T
126
T 3
A
rcha
eolo
gica
l Site
14
5-35
0
Not
-A
N
ot-B
183A
189
C 2
13A
216
G 3
04C
4
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
CR
S**
5
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
179T
221
T 35
6C
6
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
29
8C
7
DN
A la
b
05
5-41
0
Not
-A
N
ot-B
167T
223
T 35
6C
8
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
31
1C
9
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
10
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
06
9T 1
26C
186
T 11
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
162G
12
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
129A
223
T 39
1A
13
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
22
4C 2
56T
311C
14
A
rcha
eolo
gica
l Site
05
5-31
4
Not
-A
N
ot-B
CR
S**
15
D
NA
lab
055-
410
N
ot-A
Not
-B
23
9G
16
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
12
6C 2
94T
296T
304
C
17
DN
A la
b
05
5-41
0
Not
-A
N
ot-B
311C
18
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
CR
S**
19
D
NA
lab
055-
410
N
ot-A
Not
-B
22
3T 2
24C
234
T 31
1C
20
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
11
3T 1
72T
21
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
22
DN
A la
b
05
5-41
0
Not
-A
N
ot-B
CR
S**
23
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
304C
24
D
NA
lab
055-
410
N
ot-A
Not
-B
12
9A 1
69T
172C
189
C
25
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
93
C 1
36A
241
G
26
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
14
0C 2
93G
311
C
27
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
36
2C
28
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
14
6G 3
42C
29
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
069T
126
C 1
45A
193
T 27
8T 3
44T
30**
*
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
'B' d
elet
ion
pres
ent
129A
224
C 3
11C
31
A
rcha
eolo
gica
l Site
08
8-38
6
Not
-A
N
ot-B
144C
189
C 2
70T
31
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
18
9C 1
93.1
C
32
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
12
6C
33
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
23
1C 2
61T
34
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
22
3T 3
25C
362
C
34
Arc
haeo
logi
cal S
ite
170-
410
N
ot-A
Not
-B
22
3T 3
25C
362
C
35
DN
A la
b
11
4-35
1
Not
-A
N
ot-B
182A
183
A 1
89C
223
T 25
5A 2
78T
36
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
12
6C 1
45A
172
C 1
92T
222T
261
T 37
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
183C
189
C 1
93.1
C
37
Arc
haeo
logi
cal S
ite
089-
386
N
ot-A
Not
-B
18
3C 1
89C
291
T 38
A
rcha
eolo
gica
l Site
11
7-35
1
Not
-A
N
ot-B
189C
263
Y 28
8Y
39
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
22
4C 3
11C
39
A
rcha
eolo
gica
l Site
08
2-41
0
Not
-A
N
ot-B
223T
311
C
40
Arc
haeo
logi
cal S
ite
137-
378
N
ot-A
Not
-B
22
3T 2
56T
270T
41
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
126C
194
T 19
6T 3
04C
42
D
NA
lab
055-
410
N
ot-A
Not
-B
30
4C
43
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
25
7C
44
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
16
2G 2
09C
45
A
rcha
eolo
gica
l Site
14
3-29
7
Not
-A
N
ot-B
216G
46
A
rcha
eolo
gica
l Site
07
1-41
0
Not
-A
N
ot-B
124C
304
C 3
11C
47
A
rcha
eolo
gica
l Site
11
6-35
0
Not
-A
N
ot-B
129C
181
G 1
82C
183
C 1
89C
260
T 48
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
CR
S**
49
A
rcha
eolo
gica
l Site
11
5-31
0
Not
-A
N
ot-B
278T
50
D
NA
lab
055-
410
N
ot-A
Not
-B
22
3T 2
92T
315T
362
C
![Page 269: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/269.jpg)
Resultados y Discusión
242
Indi
vidu
al
Loca
tion
HVR
1
regi
on s
eque
nced
(16-
--)*
A s
np (6
63 A
-G)
B d
elet
ion
(827
1-82
81 9
bp d
elet
ion)
N
ucle
otid
e po
sitio
ns in
HVR
1 re
gion
that
diff
er fr
om th
e C
ambr
idge
Ref
eren
ce S
eque
nce
(16-
--)*
51
Arc
haeo
logi
cal S
ite
093-
382
N
ot-A
Not
-B
12
9A 1
89C
291
T 51
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
129A
183
C 1
89C
193
.1C
inse
rtion
52
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
126C
218
T 28
7T 2
94T
296T
304
C
53
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
19
2T 3
04G
311
C
54
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
17
2C 2
23T
311C
391
A
55
DN
A la
b
05
5-41
0
Not
-A
N
ot-B
298C
56
D
NA
lab
055-
410
N
ot-A
Not
-B
26
3C
57
DN
A la
b
05
5-41
0
Not
-A
N
ot-B
298C
58
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
69T
126C
145
A 1
72C
192
T 33
0T 3
61T
59
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
60
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
61
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
09
2C 1
40C
293
G 3
11C
62
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
256T
270
T 29
6Y 3
99G
63
A
rcha
eolo
gica
l Site
05
5-41
0
Not
-A
N
ot-B
126C
292
T 29
4T
64
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
19
3C
65
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
66
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
67
Arc
haeo
logi
cal S
ite
055-
410
N
ot-A
Not
-B
C
RS
**
Not
es
*Num
berin
g is
with
refe
renc
e to
the
Cam
brid
ge R
efer
ence
Seq
uenc
e (S
. And
erso
n et
al.
Nat
ure
290,
457
-465
(198
1))
**C
RS
= s
eque
nce
iden
tical
to th
e C
ambr
idge
Ref
eren
ce S
eque
nce
over
regi
on s
eque
nced
***In
divi
dual
30
(hig
hlig
hted
in re
d) s
how
ed th
e 9b
p de
letio
n ch
arac
teris
tic o
f HgB
. How
ever
indi
vidu
al 3
0 w
as ru
led
out a
s a
poss
ible
sou
rce
of c
onta
min
atio
n th
roug
h ta
rget
ting
his/
her s
peci
fic 1
6224
T-C
tran
sitio
n in
the
copr
olite
s, a
s de
taile
d in
the
supp
lem
enta
ry m
ater
ial
![Page 270: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/270.jpg)
Resultados y Discusión
243
Table S7. Pyrosequencing results
Percentage of targeted mtDNA SNP in DNA extract, in comparison to modern contaminant human DNA
Sample Hg A (663G)a Hg B (8281 9bp deletion) b 16,224C c
1294-PC-5/6B-40 <2% 38% to 97% <2%
1294-PC-5/6B-50 13% to 41% <2% Na
1374-PC-1/2A-28 <2% 48% to >98% <2%
1294-PC-5/7D-4 <2% 50% to >98% <2% Cop
rolit
es
1294-PC-5/7C-31 <2% >98% <2%
Ono1 <2% <2% Na
Ono2 <2% <2% Na
Ono3 <2% <2% Na
Ono4 <2% <2% Na
Ono5 <2% <2% Na
Ono6 <2% <2% Na
Ono7 <2% <2% Na
Ono8 <2% <2% Na
Vul1 <2% <2% Na
Vul2 <2% <2% Na Vul3 <2% <2% Na Vul4 <2% <2% Na Cat1 <2% <2% Na Cat2 <2% <2% Na Cat3 <2% <2% Na Cat4 <2% <2% Na Cat5 <2% <2% Na Cat6 <2% <2% Na Cat7 <2% <2% Na
Non
Hum
an C
ontr
olsd
Cat8 <2% <2% Na
The pyrosequencing software performs quantification on the different alleles within the DNA
extract extract. The haplogroup A and B SNPs were pyrosequenced from four independent PCR
products. The 16,224 SNP was pyrosequenced from 2 independent PCR products. The range of
measured percentages of the SNPs diagnostic of the Native American mtDNA haplogroups Aa
and Bb, plus the SNP indicative of archaeologist#30c, the modern potential alternative source of
the 8281 9bp deletion are shown. The sensitivity of pyrosequencing is such that it can detect
alleles present at a frequency of >2%. Therefore, when alleles are not detected their frequencies
are indicated as <2%. dNon human control extractions are as follows: Ono and Vul series = DNA
extracts from Peruvian non human Pleistocene large mammals bones, Cat series = DNA extracts
from Swedish medieval cattle bones.
![Page 271: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/271.jpg)
![Page 272: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/272.jpg)
IV. Conclusiones
![Page 273: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/273.jpg)
![Page 274: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/274.jpg)
Conclusiones
247
• In order to succeed in getting DNA from the extract, we need to know the
conditions that the sample has been exposed to. In general, we saw that an
increase in temperature and digestion time with previous decalcification (if we
are working with bone or teeth), highly improve the quality of the DNA.
• The quantification of molecules is of great importance not only in ancient
DNA but also in forensic studies. Knowing the number of molecules is
important for deciding how to use our DNA in further studies. The best
methods are those that use Real-Time PCR technology and we find that the
SYBER-Green method, which is cheaper than others (such as TaqMan
Probes) although less accurate, is enough for predicting the behaviour of our
DNA. Although quantification of samples is important, it is not a reliable guide
for determining whether or not to discard a sample.
• It does not matter how old the samples are, the most important thing is where
they have been buried; temperature, pH and humidity are the critically
important factors in determining how degraded and damaged our DNA is
going to be. Lower temperatures and absence of water are the best
conditions for preserving DNA although this does not mean that in other
conditions, retrieval of good quality DNA is impossible.
• In order of the number of templates we saw that the best kind of sample was
tooth followed by bone and hair. But there is not any significant relationship
between tissue and quantity of damage.
• Human paleofecal remains represent a source of ancient DNA that
significantly complements and may in some cases be superior to that from
skeletal tissue.
• In order to enable the rapid identification of samples that were likely to
contain the DNA of interest we used the SNaPshot technique. Doing this
allowed a faster and less expensive identification of promising samples.
![Page 275: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/275.jpg)
Conclusiones
248
• As occurs in living cells, the number of transitions is clearly higher than the
number of transversions; however, “in vivo” this ratio is about 30:1 while in
our ancient samples it is about 10:1. This difference could be explained if we
assume that, “in vivo”, many of these changes are repaired or filtered out by
some still unknown biological mechanism.
• We have observed an overrepresentation of transitions from C to T in our
clones; therefore, a bias to cytosine deamination is inferred. Although with
our experiments we cannot see if the type II changes are due to the cytosine
or guanine deamination. These kind of changes are more prevalent than type
I transition whether or not these last changes are due to real damage.
• As the cytosine desamination is the most frequent miscoding lesion in DNA,
the use of Uracil N-glycosylase is highly recommended. Substitutions type II
(C/G T/A) are dramatically reduced, improving the probability of having the
real sequence.
• Positions observed as hotspots in our samples match quite well with those
identified in post-mortem damage. Moreover, many of these changes have
been described as mutation hotspots in human populations and as mtDNA
instabilities in diseases like cancer.
• Although our sequences from Peru match in the Amerindian context,
haplogroups A2, B2 and C1 are purely Native American, they are very widely
distributed around the whole continent. Further studies of the coding region
would be necessary to say anything else about these three populations.
America is still the continent from which we have the least information about
the sequence variation of entire mtDNAs. Additional analyses, both modern
and ancient, are therefore needed to help obtain a more precise picture of
the colonization of this area.
![Page 276: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/276.jpg)
Conclusiones
249
• Our data reveal that humans were present in North America ca. 1.3 14C ka
before the earliest evidence of Clovis eliminating the “Clovis First” model for
the earliest colonization of North America from serious further consideration.
• In contrast to traditional views, the interior ice-free corridor that is believed to
have opened ca. 11-11.5 14C ka B.P. is unlikely to have been the first
entrance route to areas south of Beringia. It seems more likely that the first
immigration into the Americas took advantage of some kind of “coastal
corridor” by 13 14C ka B.P. or occurred prior to the Last Glacial Maximum ca.
18 14C ka B.P. when the Cordilleran and Laurentide ice sheets coalesced,
blocking interior migration routes.
• Our results demonstrate that HgA and HgB, common among Native
American populations in northern and western North America of today, were
already to be found in America by 12.1 and 12.3 14C ka B.P., respectively.
![Page 277: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/277.jpg)
![Page 278: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/278.jpg)
V. Bibliografía
![Page 279: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/279.jpg)
![Page 280: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/280.jpg)
Bibliografía
253
Adcock GJ, Dennis ES, Easteal S, Huttley GA, Jermiin LS, Peacock WJ, Thorne A (2001) Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. PNAS 98:537-542
Alonso A, Andelinovic S, Martin P, Sutlovic D, Erceg I, Huffine E, de Simon LF,
Albarran C, Definis-Gojanovic M, Fernandez-Rodriguez A, Garcia P, Drmic I, Rezic B, Kuret S, Sancho M, Primorac D (2001) DNA typing from skeletal remains: evaluation of multiplex and megaplex STR systems on DNA isolated from bone and teeth samples. Croat Med J 42:260-266
Alonso A, Martín P, Albarrán C, García P, García O, Fernández de Simón L,
García-Hirschfeld J, Sancho M, De la Rúa C, Fernández-Piqueras J (2004) Real-time PCR designs to stimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies. Forensic Science International 139:141-149
Alonso A, Martín P, Albarrán C, García P, Primorac D, García O, Fernández de
Simón L, García-Hirschfeld J, Sancho M, Fernández-Piqueras J (2003) Specific Quantification of Human Genomes from Low Copy Number DNA Samples in Forensic and Ancient DNA Studies. Croatian Medical Journal 44:273-280
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon
IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457-465
Anderung C, Bouwman A, Persson P, Carretero JM, Ortega AI, Elburg R, Smith C,
Arsuaga JL, Ellegren H, Gotherstrom A (2005) Prehistoric contacts over the Straits of Gibraltar indicated by genetic analysis of Iberian Bronze Age cattle. Proc Natl Acad Sci USA 102:8431-8435
Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N
(1999) Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23:147
Anensen H, Provan F, Lian AT, Reinertsen S-HHS, Ueno Y, Matsuda A, Seeberg
E, Bjelland S (2001) Mutations induced by 5-formyl-2'-deoxyuridine in Escherichia coli include base substitutions that can arise from mispairs of 5-formyluracil with guanine, cytosine and thymine. Mutation Research 476:99-107
Austin JJ, Ross AJ, Smith AB, Fortey RA, Thomas RH (1997) Problems of
reproducibility--does geologically ancient DNA survive in amber-preserved insects? Proc Biol Sci 264:467-474
Awadalla P, Eyre-Walker A, Smith JM (1999) Linkage disequilibrium and
recombination in hominid mitochondrial DNA. Science 286:2524-2525
![Page 281: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/281.jpg)
Bibliografía
254
Baker LE, McCormick WF, Matteson KJ (2001) A silica-based mitochondrial DNA extraction method applied to forensic hair shafts and teeth. J Forensic Sci 46:126-130
Bandelt HJ, Herrnstadt C, Yao YG, Kong QP, Kivisild T, Rengo C, Scozzari R,
Richards M, Villems R, Macaulay V, Howell N, Torroni A, Zhang YP (2003) Identification of Native American founder mtDNAs through the analysis of complete mtDNA sequences: some caveats. Ann Hum Genet 67:512-524
Bandelt HJ, Kong QP, Parson W, Salas A (2005) More evidence for non-maternal
inheritance of mitochondrial DNA? J Med Genet 42:957-960 Bandelt HJ, Kong QP, Richards M, Macaulay V (2006) Estimation of mutation
rates and coalescence time: some caveats. Berlin: Springer-Verlag 18 Bandelt HJ, Quintana-Murci L, Salas A, Macaulay V (2002) The Fingerprint of
Phantom Mutations in Mitochondrial DNA data. Am J Hum Genet 71:1150-1160
Barnes I, Matheus P, Shapiro B, Jensen D, Cooper A (2002) Dynamics of
Pleistocene population extinctions in Beringian brown bears. Science 295:2267-2270
Beauval C, Maureille B, Lacrampe-Cuyaubère F, Serre D, Peressinotto D, Bordes
J-G, Cochard D, Couchoud I, Dubrasquet D, Laroulandie V, Lenoble A, Mallyce J-B, Pasty S, Primault J, Rohland N, Pääbo S, Trinkaus E (2005) A late Neandertal femur from Les Rochers-de-Villeneuve, France. PNAS 102 No.20:7085-7090
Beckman RA, Mildvan AS, Loeb LA (1985) On the fidelity of DNA replication:
manganese mutagenesis in vitro. Biochemistry 24(21):5810-5817 Behar DM, Metspalu E, Kivisild T, Achilli A, Hadid Y, Tzur S, Pereira L, Amorim A,
Quintana-Murci L, Majamaa K, Herrnstadt C, Howell N, Balanovsky O, Kutuev I, Pshenichnov A, Gurwitz D, Bonne-Tamir B, Torroni A, Villems R, Skorecki K (2006) The matrilineal ancestry of Ashkenazi Jewry: portrait of a recent founder event. Am J Hum Genet 78:487-497
Binladen J, Wiuf C, Gilbert MTP, Bunce M, Barnett R, Larson G, Greenwood AD,
Haile J, Ho SY, Hansen AJ, Willerslev E (2006) Assessing the fidelity of ancient DNA sequences amplified from nuclear genes. Genetics 172:733-741
Bonatto SL, Salzano FM (1997) A single and early migration for the peopling of
the Americas supported by mitochondrial DNA sequence data. Proc Natl Acad Sci USA 94:1866-1871
![Page 282: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/282.jpg)
Bibliografía
255
Bower MA, Spencer M, Matsumura S, Nisbet RER, Howe CJ (2005) How many clones need to be sequenced from a single forensic or ancient DNA sample in order to determine a reliable consensus sequence? Nucleic Acids Research 33 No. 8:2549-2556
Bravi C, Salas A, Coble MD, Kong QP, Perego UA, Torroni A, Bandelt HJ (2007)
The phylogeny of Native American complete mtDNA sequences: implications for evolutionary and disease studies. In preparation
Brotherton P, Endicott P, Sanchez JJ, Beaumont M, Barnett R, Austin J, Cooper A
(2007) Novel high-resolution characterization of ancient DNA reveals C > U-type base modification events as the sole cause of post mortem miscoding lesions. Nucleic Acids Res
Brown MD, Hosseini SH, Torroni A, Bandelt HJ, Allen JC, Schurr TG, Scozzari R,
Cruciani F, Wallace DC (1998) mtDNA haplogroup X: An ancient link between Europe/Western Asia and North America? Am J Hum Genet 63:1852-1861
Brown WM, George M, Jr., Wilson AC (1979) Rapid evolution of animal
mitochondrial DNA. Proc Natl Acad Sci U S A 76:1967-1971 Burger J, Hummel S, Hermann B, Henke W (1999) DNA preservation: a
microsatellite-DNA study on ancient skeletal remains. Electrophoresis 20:1722-1728
Burger J, Rosendahl W, Loreille O, Hemmer H, Eriksson T, Gotherstrom A, Hiller
J, Collins MJ, Wess T, Alt KW (2004) Molecular phylogeny of the extinct cave lion Panthera leo spelaea. Mol Phylogenet Evol 30:841-849
Butler JM, Shen Y, McCord BR (2003) The development of reduced size STR
amplicons as tools for analysis of degraded DNA. J Forensic Sci 48:1054-1064
Cann RL, Stoneking M, Wilson AC (1987) Mitochondrial DNA and human
evolution. Nature 325:31-36 Cano RJ, Poinar HN, Pieniazek NJ, Acra A, Poinar GO, Jr. (1993) Amplification
and sequencing of DNA from a 120-135-million-year-old weevil. Nature 363:536-538
Caramelli D, Lalueza-Fox C, Condemi S, Longo L, Milani L, Manfredini A, de Saint
Pierre M, Adoni F, Lari M, Giunti P, Ricci S, Casoli A, Calafell F, Mallegni F, Bertranpetit J, Stanyon R, Bertorelle G, Barbujani G (2006) A highly divergent mtDNA sequence in a Neandertal individual from Italy. Curr Biol 16:R630-632
![Page 283: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/283.jpg)
Bibliografía
256
Caramelli D, Lalueza-Fox C, Vernesi C, Lari M, Casoli a, Mallegni F, Chiarelli B, Dupanloup I, Bertranpetit J, Barbujani G, Bertorelle G (2003) Evidence for a genetic discontinuity between Neandertals and 24,000-year-old anatomically modern Europeans. PNAS 100 No.11 May 27:6593-6597
Carlyle SW, Parr RL, Hayes MG, O'Rourke DH (2000) Context of maternal
lineages in the Greater Southwest. Am J Phys Anthropol 113:85-101 Chung DT, Drabek J, Opel KL, Butler JM, McCord BR (2004) A study on the
effects of degradation and template concentration on the amplification efficiency of the STR Miniplex primer sets. J Forensic Sci 49:733-740
Cipollaro M, Galderisi U, Di Bernardo G (2005) Ancient DNA as a multidisciplinary
experience. Journal of Cellular Physiology 202:315-322 Clayton TM, Whitaker JP, Maguire CN (1995) Identification of bodies from the
scene of a mass disaster using DNA amplification of short tandem repeat (STR) loci. Forensic Sci Int 76:7-15
Coble MD, Butler JM (2005) Characterization of new miniSTR loci to aid analysis
of degraded DNA. J Forensic Sci 50:43-53 Cooper A (1994) Ancient DNA sequences reveal unsuspected phylogenetic
relationships within New Zealand wrens (Acanthisittidae). Experientia Jun 15; 50(6):558-563
Cooper A, Drummond AJ, Willerslev E (2004) Ancient DNA: Would the real
Neandertal please stand up? Current Biology 14:R431-R433 Cooper A, Lalueza-Fox C, Anderson S, Rambaut A, Austin J, Ward R (2001)
Complete mitochondrial genome sequences of two extinct moas clarify ratite evolution. Nature 409:704-707
Cooper A, Mourer-Chauvire C, Chambers GK, von Haeseler A, Wilson AC, Paabo
S (1992) Independent origins of New Zealand moas and kiwis. Proc Natl Acad Sci USA 89:8741-8744
Cooper A, Poinar HN (2000) Ancient DNA: Do it right or not at all. Science
289:1139 Cooper A, Poinar HN, Pääbo S, Radovic J, Debénath A, Caparrós M, Barroso-
Ruiz C, Bertranpetit J, Nielsen-Marsh C, Hedges R, Sykes B (1997) Neandertal Genetics. Science 277:1021-1025
Corella A, Bert F, Perez-Perez A, Gene M, Turbon D (2007) Mitochondrial DNA
diversity of the Amerindian populations living in the Andean Piedmont of Bolivia: Chimane, Moseten, Aymara and Quechua. Ann Hum Biol 34:34-55
![Page 284: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/284.jpg)
Bibliografía
257
Demarchi DA, Panzetta-Dutari GM, Colantonio SE, Marcellino AJ (2001) Absence of the 9-bp deletion of mitochondrial DNA in pre-Hispanic inhabitants of Argentina. Hum Biol 73:575-582
DeSalle R, Gatesy J, Wheeler W, Grimaldi D (1992) DNA sequences from a fossil
termite in Oligo-Miocene amber and their phylogenetic implications. Science 257:1933-1936
Dixon LA, Dobbins AE, Pulker HK, Butler JM, Vallone PM, Coble MD, Parson W,
et al. (2006) Analysis of artificially degraded DNA using STRs and SNPs--results of a collaborative European (EDNAP) exercise. Forensic Sci Int 164:33-44
Doda JN, Wright CT, Clayton DA (1981) Elongation of displacement-loop strands
in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc Natl Acad Sci USA 78:6116-6120
Eckert KA, Kunkel TA (1990) High fidelity DNA synthesis by the Thermus
aquaticus DNA polymerase. Nucleic Acids Research 18 No.3:3739-3743 Edwards CW, Bradley RD (2002) Molecular systematics of the genus Neotoma.
Mol Phylogenet Evol 25:489-500 Endicott P, Gilbert MTP, Stringer C, Lalueza-Fox C, Willerslev E, Hansen AJ,
Cooper A (2003) The Genetic Origins of the Andaman Islanders. Am J Hum Genet 72:178-184
Eshleman JA, Malhi RS, Smith DG (2003) Mitochondrial DNA studies of Native
Americans: conceptions and misconceptions of the population prehistory of the Americas. Evolutionary Anthropology 12:7-18
Excoffier L, Yang Z (1999) Substitution rate variation among sites in mitochondrial
hypervariable region I of humans and chimpanzees. Molecular Biology & Evolution 16 (10):1357-1368
Forster P, Harding R, Torroni A, Bandelt HJ (1996) Origin and evolution of Native
American mtDNA variation: a reappraisal. Am J Hum Genet 59:935-945 Gilbert MTP, Binladen J, Miller W, Wiuf C, Willerslev E, Poinar H, Carlson JE,
Leebens-Mack JH, Schuster SC (2007) Recharacterization of ancient DNA miscoding lesions: insights in the era of sequencing-by-synthesis. Nucleic Acids Res 35:1-10
Gilbert MTP, Cuccui J, White W, Lynnerup N, Titball RW, Cooper A, Prentice MB
(2004a) Absence of Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague victims. Microbiology 150:341-354
Gilbert MTP, Janaway RC, Tobin DJ, Cooper A, Wilson AS (2006) Histological
correlates of post mortem mitochondrial DNA damage in degraded hair. Forensic Sci Int 156:201-207
![Page 285: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/285.jpg)
Bibliografía
258
Gilbert MTP, Bandelt H-J, Hofreiter M, Barnes I (2005a) Assessing ancient DNA studies. TRENDS in Ecology and Evolution 20:541-544
Gilbert MTP, Barnes I, Collins MJ, Smith C, Eklund J, Goudsmit J, Poinar H,
Cooper A (2005b) Long-Term Survival of Ancient DNA in Egypt: Response to Zink and Nerlich (2003). American Journal of Physical Anthropology 128:110-114; discussion 115-118
Gilbert MTP, Hansen AJ, Willerslev E, Rudbeck L, Barnes I, Lynnerup N, Cooper
A (2003a) Characterization of Genetic Miscoding Lesions Caused by Postmortem Damage. Am J Hum Genet 72:48-61
Gilbert MTP, Shapiro B, Drummond AJ, Cooper A (2005c) Post-mortem DNA
damage hotspots in Bison (Bison bison) provide evidence for both damage and mutational hotspots in human mitochondrial DNA. Journal of Archaeological Science 32:1053-1060
Gilbert MTP, Willerslev E, Hansen AJ, Barnes I, Rudbeck L, Lynnerup N, Cooper
A (2003b) Distribution Patterns of Postmortem Damage in Human Mitochondrial DNA. Am J Hum Genet 72:32 – 47
Gilbert MTP, Wilson S, Bunce M, Hansen AJ, Willerslev E, Shapiro B, Higham
TFG, Richards MP, O'Connell TC, Tobin DJ, Janaway RC, Cooper A (2004b) Ancient mitochondrial DNA from hair. Current Biology 14 No12:R463-464
Gill P (2001) An assessment of the utility of single nucleotide polymorphisms
(SNPs) for forensic purposes. Int J Legal Med 114:204-210 Gill P, Ivanov PL, Kimpton C, Piercy R, Benson N, Tully G, Evett I, Hagelberg E,
Sullivan K (1994) Identification of the remains of the Romanov family by DNA analysis. Nat Genet 6:130-135
Golenberg EM, Giannasi DE, Clegg MT, Smiley CJ, Durbin M, Henderson D,
Zurawski G (1990) Chloroplast DNA sequence from a miocene Magnolia species. Nature 344:656-658
Gonzalez-Oliver A, Marquez-Morfin L, Jimenez JC, Torre-Blanco A (2001)
Founding Amerindian mitochondrial DNA lineages in ancient Maya from Xcaret, Quintana Roo. Am J Phys Anthropol 116:230-235
Gotherstrom A, Anderung C, Hellborg L, Elburg R, Smith C, Bradley DG, Ellegren
H (2005) Cattle domestication in the Near East was followed by hybridization with aurochs bulls in Europe. Proc Biol Sci 272:2345-2350
Green LD, Derr JN, Knight A (2000) mtDNA affinities of the peoples of North-
central Mexico. Am J Hum Genet 66:989-998
![Page 286: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/286.jpg)
Bibliografía
259
Green RE, Krause J, Ptak SE, Briggs AW, Ronan MT, Simons JF, Du L, Egholm M, Rothberg JM, Paunovic M, Paabo S (2006) Analysis of one million base pairs of Neanderthal DNA. Nature 444:330-336
Greenberg J, Turner C, Zegura S (1986) The settlement of the Americans: a
comparison of the linguistic, dental, and genetic evidence. Current Anthropology 27:477-497
Greenwood AD, Capelli C, Possnert G, Pääbo S (1999) Nuclear DNA sequences
from late Pleistocene megafauna. Molecular Biology & Evolution 16 (11):1466-1473
Greenwood AD, Pääbo S (1999) Nuclear insertion sequences of nitochondrial
DNA predominate in hair but not in blood of elephants. Molecular Ecology 8:133-137
Gruber JD, Colligan PB, Wolford JK (2002) Estimation of single nucleotide
polymorphism allele frequency in DNA pools by using Pyrosequencing. Hum Genet 110:395-401
Gutiérrez G, Sánchez D, Marín A (2002) A reanalysis of the ancient mitochondrial
DNA sequences recovered from Neandertal bones. Molecular Biology & Evolution 19(8):1359-1366
Hagelberg E, Goldman N, Lio P, Whelan S, Schiefenhovel W, Clegg JB, Bowden
DK (1999) Evidence for mitochondrial DNA recombination in a human population of island Melanesia. Proc Biol Sci 266:485-492
Hagelberg E, Sykes B, Hedges R (1989) Ancient bone DNA amplified. Nature
342:485 Hagelberg E, Thomas MG, Cook CE, Jr., Sher AV, Baryshnikov GF, Lister AM
(1994) DNA from ancient mammoth bones. Nature 370:333-334 Haile J, Holdaway R, Oliver K, Bunce M, Gilbert MTP, Nielsen R, Munch K, Ho
SY, Shapiro B, Willerslev E (2007) Ancient DNA chronology within sediment deposits: are paleobiological reconstructions possible and is DNA leaching a factor? Mol Biol Evol 24:982-989
Handt O, Höös M, Krings M, Pääbo S (1994a) Ancient DNA: methodological
challenges. Experientia Jun 15:50(6):524-529 Handt O, Krings M, Ward R, Pääbo S (1996) The retrieval of ancient human DNA
sequences. Am J Hum Genet Aug;59(2):368-376 Handt O, Richards M, Trommsdorff M, Kilger C, Simanainen J, Georgiev O, Bauer
K, Stone A, Hedger R, Schaffner W, Utermann G, Sykes B, Pääbo S (1994b) Molecular Genetic Analyses of the Tyrolean Ice Man. Science 264 17 June:1775-1778
![Page 287: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/287.jpg)
Bibliografía
260
Hansen AJ, Mitchell DL, Wiuf C, Paniker L, Brand TB, Binladen J, Gilichinsky DA, Ronn R, Willerslev E (2006) Crosslinks rather than strand breaks determine access to ancient DNA sequences from frozen sediments. Genetics 173:1175-1179
Hansen AJ, Willerslev E, Wiuf C, Mourier T, Arctander P (2001) Statistical
evidence for miscoding lesions in ancient DNA templates. Molecular Biology & Evolution 18 (2):262-265
Hassanin A (2002) Ancient specimens and DNA contamination: a case study from
the 12S rRNA gene sequence of the "Linh Duong" bovid (Pseudonovibos spiralis). Naturwissenschaften 89:107-110
Heyer E, Zietkiewicz E, Rochowski A, Yotova V, Puymirat J, Labuda D (2001)
Phylogenetic and familial estimates of mitochondrial substitution rates: study of control region mutations in deep-rooting pedigrees. Am J Hum Genet 69:1113-1126
Higuchi R, Bowman B, Freiberger M, Ryder O, Wilson AC (1984) DNA sequences
from the quagga, an extinct member of the horse family. Nature 312(5991):282-284
Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: real-
time monitoring of DNA amplifications reactions. Biotechnology (NY) 11(9):1026-1030
Hofreiter M, Jaenicke V, Serre D, Haeseler Av, Pääbo S (2001a) DNA sequences
from multiple amplifications reveal artefacts induced by cytosine deamination in ancient DNA. Nucleic Acids Research 9, No. 23:4793-4799
Hofreiter M, Poinar HN, Spaulding WG, Bauer K, Martin PS, Possnert G, Pääbo S
(2000) A molecular analysis of ground sloth diet through the last glaciation. Molecular Ecology 9:1975-1984
Hofreiter M, Serre D, Poinar H, Kuch M, Pääbo S (2001b) Ancient DNA. Nature
Genetics 2:353 – 359 Höss M, Dilling A, Currant A, Paabo S (1996) Molecular phylogeny of the extinct
ground sloth Mylodon darwinii. Proc Natl Acad Sci USA 93:181-185 Höss M, Jaruga P, Zastawny TH, Dizdaroglu M, Pääbo S (1996) DNA damage
and DNA sequences retrieval from ancient tissues. Nucleic Acids Research 24, No.7:1304-1307
Höss M, Paabo S, Vereshchagin NK (1994) Mammoth DNA sequences. Nature
370:333
![Page 288: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/288.jpg)
Bibliografía
261
Jackson PJ, Hugh-Jones ME, Adair DM, Green G, Hill KK, Kuske CR, Grinberg LM, Abramova FA, Keim P (1998) PCR analysis of tissue samples from the 1979 Sverdlovsk anthrax victims: the presence of multiple Bacillus anthracis strains in different victims. Proc Natl Acad Sci USA 95:1224-1229
Jehaes E, Toprak K, Vanderheyden N, Pfeiffer H, Cassiman J-J, Brinkmann B,
Decorte R (2001) Pitfalls in the analysis of mitochondrial DNA from ancient specimens and the consequences for forensic DNA analysis: the historical case of the putative heart of Louis XVII. Int J Legal Med 115:135-141
Jobling MA, Gill P (2004) Encoded evidence: DNA in forensic analysis. Nat Rev
Genet 5:739-751 Kaestle FA, Smith DG (2001) Ancient mitochondrial DNA evidence for prehistoric
population movement: the Numic expansion. Am J Phys Anthropol 115:1-12
Kemp BM, Malhi RS, McDonough J, Bolnick DA, Eshleman JA, Rickards O,
Martinez-Labarga C, Johnson JR, Lorenz JG, Dixon EJ, Fifield TE, Heaton TH, Worl R, Smith DG (2007) Genetic analysis of early holocene skeletal remains from Alaska and its implications for the settlement of the Americas. Am J Phys Anthropol 132:605-621
Kolman CJ, Sambuughin N, Bermingham E (1996) Mitochondrial DNA analysis of
Mongolian populations and implications for the origin of New World founders. Genetics 142:1321-1334
Kolman CJ, Tuross N (2000) Ancient DNA analysis of human populations.
American Journal of Physical Anthropology 111:5-23 Krause J, Dear PH, Pollack JL, Slatkin M, Spriggs H, Barnes I, Lister AM,
Ebersberger I, Paabo S, Hofreiter M (2006) Multiplex amplification of the mammoth mitochondrial genome and the evolution of Elephantidae. Nature 439:724-727
Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, Von Haeseler A,
Grossschmidt K, Possnert G, Paunovic M, Pääbo S (2000) A view of Neandertal genetic diversity. Nature Genetics 26 (2) Oct:144-146
Krings M, Geisert H, Schmitz RW, Krainitzki H, Pääbo S (1999) DNA sequence of
the mitochondrial hypervariable region II from the Neandertal type specimen. Proc Natl Acad Sci USA 96:5581-5585
Krings M, Stone A, Schmitz RW, Krainitzki H, Stoneking M, Pääbo S (1997)
Neandertal DNA sequences and the origin of modern humans. Cell 90 July 11:19-30
Kunichika K, Hashimoto Y, Imoto T (2002) Robustness of hen lysozyme monitored
by random mutations. Protein Engineering 15 No.10:805-809
![Page 289: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/289.jpg)
Bibliografía
262
Kurosaki K, Matsushita T, Ueda S (1993) Individual DNA identification from ancient human remains. Am J Hum Genet 53(3):638-643
Kuznetsov GV, Kulikov EE, Petrov NB, Ivanova NV, Lomov AA, Kholodova MV,
Poltaraus AB (2001) The "Linh Duong" Pseudonovibos Spiralis (Mammalia, Artiodactyla) is a new buffalo. Naturwissenschaften 88:123-125
Lalueza-Fox C (1996) Mitochondrial DNA haplogroups in four tribes from Tierra
del Fuego-Patagonia: Inferences about the peopling of the Americas. Hum Biol 68(6):853-871
Lalueza-Fox C (1998) Missatges del passat. Edicions Bromera Lalueza-Fox C (2005) Genes de Neandertal. Editorial Síntesis, SA Lalueza-Fox C, Bertranpetit J, Alcover JA, Shailer N, Hagelberg E (2000)
Mitochondrial DNA from Myotragus balearicus, an extinct bovid from the Balearic Islands. Journal of experimental zoology (Mol Dev Evol) 288:56-62
Lalueza-Fox C, Calderón FL, Calafell F, Morera B, Bertranpetit J (2001) MtDNA
from extinct Tainos and the peopling of the Caribbean. Annals of Human Genetics 65:137-151
Lalueza-Fox C, Gilbert MTP, Martínez-Fuentes AJ, Calafell F, Bertranpetit J
(2002a) Mitochondrial DNA from Pre-Columbian ciboneys from Cuba and the prehistoric colonization of the Caribbean. American Journal of Physical Anthropology 121:97-108
Lalueza-Fox C, Pérez-Pérez A, Prats E, Cornudella L, Turbón D (1997) Lack of
founding Amerindian mitochondrial DNA lineages in extinct Aborigines from Tierra del Fuego-Patagonia. Human Molecular Genetics 6 No.1:41-46
Lalueza-Fox C, Sampietro ML, Gilbert MTP, Castri L, Facchini F, Pettener D,
Bertranpetit J (2004) Unravelling migrations in the steppe: mitochondrial DNA sequences from ancient central Asians. Proc Biol Sci 271:941-947
Lalueza-Fox C, Samprieto ML, Caramelli D, Puder Y, Lari M, Calafell F, Martínez-
Maza C, Bastir M, Fortea J, De la Rasilla M, Bertranpetit J, Rosas A (2005) Neandertal evolutionary genetics: mitochondrial DNA data from the Iberian Peninsula. Molecular Biology & Evolution 22(4):1077-1081
Lalueza-Fox C, Shapiro B, Bover P, Alcover JA, Bertranpetit J (2002b) Molecular
phylogeny and evolution of the extinct bovid Myotragus balearicus. Mol Phylogenet Evol 25:501-510
Lareu MV, Salas A (1999) Mitochondrial DNA analysis in forensic genetics.
Handbook of Analyticl Separatio Vol 6 "Forensic Sciences" MJ Bogusz (ed) Elsevier Science Amsterdam
![Page 290: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/290.jpg)
Bibliografía
263
Lell JT, Sukernik RI, Starikovskaya YB, Su B, Jin L, Schurr TG, Underhill PA, Wallace DC (2002) The dual origin and Siberian affinities of Native American Y chromosomes. Am J Hum Genet 70:192-206
Lewis CM, Tito RY, Lizárraga B, Stone AC (2005) Land, language, and loci:
mtDNA in Native Americans and the genetic history of Peru. American Journal of Physical Anthropology 127(3):351-360
Lindahl T (1993a) Instability and decay of the primary structure of DNA. Nature
362:709-715 Lindahl T (1993b) Recovery of antediluvian DNA. Nature 365 Oct 21:700 Lindahl T, Nyberg B (1972) Rate of depurination of native deoxyribonucleic acid.
Biochemistry 11:3610-3618 Longo M, Berninger M, Hartley J (1990) Use of uracil DNA glycosylase to control
carry-over contamination in polymerase chain reactions. Gene 93(1):125-128
Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R,
Bonné-Tamir B, Sykes B, Torroni A (1999) The Emerging Tree of West Eurasian mtDNAs: A Synthesis of Control-Region Sequences and RFLPs. Am J Hum Genet 64:232-249
Malmström H, Svensson EM, Gilbert MTP, Willerslev E, Götherström A, Holmlund
G (2007) More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA. Mol Biol Evol 24:998-1004
Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, et
al. (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-380
Margulis L, Olendzenski L, Afzelius BA (1990) Endospore-forming filamentous
bacteria symbiotic in termites: ultrastructure and growth in culture of Arthromitus. Symbiosis 8:95-116
Marota I, Basile C, Ubaldi M, Rollo F (2002) DNA Decay rate in papyri and human
remains from egyptian archaeological sites. American Journal of Physical Anthropology 117:310-318
Merriwether DA, Hall WW, Vahlne A, Ferrell RE (1996) mtDNA variation indicates
Mongolia may have been the source for the founding population for the New World. Am J Hum Genet 59:204-212
Meyer S, Weiss G, Von Haeseler A (1999) Pattern of nucleotide substitution and
rate heterogeneity in the hypervariable region I and II of human mtDNA. Genetics 152 July:1103-1110
![Page 291: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/291.jpg)
Bibliografía
264
Mishmar D, Ruiz-Pesini E, Brandon M, Wallace DC (2004) Mitochondrial DNA-like sequences in the nucleus (NUMTs): insights into our African origins and the mechanism of foreign DNA integration. Hum Mutat 23:125-133
Moraga M, Aspillaga E, Santoro C, Standen V, Carvallo P, Rothhammer F (2001)
Análisis de ADN mitocondrial en momias del norte de Chile avala la hipótesis de origen amazónico de las poblaciones andinas. Revista chilena de historia natural 74 No. 3:719-726
Moraga M, Santoro CM, Standen VG, Carvallo P, Rothhammer F (2005)
Microevolution in prehistoric Andean populations: chronologic mtDNA variation in the desert valleys of northern Chile. Am J Phys Anthropol 127:170-181
Moraga ML, Rocco P, Miquel JF, Nervi F, Llop E, Chakraborty R, Tothhammer F,
Carvallo P (2000) Mitochondiral DNA polymorphisms in Chilean aboriginal populations: implicatioons for the peopling of the southern cone of the continent. American Journal of Physical Anthropology 113:19-29
Moral del Hoyo S La cueva de el Mirador: La edad de Bronce en la sierra de
Atapuerca. Ediciones Sierra de Atapuerca Mulligan CJ, Hunley K, Cole S, Long JC (2004) Population genetics, history, and
health patterns in native americans. Annu Rev Genomics Hum Genet 5:295-315
Mullis K, Faloona F (1987) Specific synthesis of DNA in vitro via a polymerase-
catalyzed chain reaction. Methods Enzymol 155:335-350 Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H (1986) Specific enzymatic
amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 51 Pt 1:263-273
Neve B, Froguel P, Corset L, Vaillant E, Vatin V, Boutin P (2002) Rapid SNP allele
frequency determination in genomic DNA pools by pyrosequencing. Biotechniques 32:1138-1142
Njoroge FG, Monnier VM (1989) The chemistry of the Maillard reaction under
physiological conditions: a review. Prog Clin Biol Res 304:85-107 Noonan JP, Coop G, Kudaravalli S, Smith D, Krause J, Alessi J, Chen F, Platt D,
Paabo S, Pritchard JK, Rubin EM (2006) Sequencing and analysis of Neanderthal genomic DNA. Science 314:1113-1118
Noonan JP, Hofreiter M, Smith D, Priest JR, Rohland N, Rabeder G, Krause J,
Detter C, Pääbo S, Rubin EM (2005) Genomic sequencing of pleistocene cave bears. Science 309:597-599
![Page 292: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/292.jpg)
Bibliografía
265
Noro M, Masuda R, Dubrovo IA, Yoshida MC, Kato M (1998) Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes. J Mol Evol 46:314-326
Oota H, Saitou N, Matsushita T, Ueda S (1995) A genetic study of 2,000-year-old
human remains from Japan using mitochondrial DNA sequences. Am J Phys Anthropol 98(2):133-145
Orlando L, Darlu P, Toussaint M, Bonjean D, Otte M, Hanni C (2006) Revisiting
Neandertal diversity with a 100,000 year old mtDNA sequence. Curr Biol 16:R400-402
Ovchinnikov IV, Götherström A, Romanoval GP, Kharitonov VM, Lidén K,
Goodwin W (2000) Molecular analysis of Neandertal DNA from the northern Caucasus. Nature 404:490-493
Pääbo S (1985) Molecular cloning of Ancient Egyptian mummy DNA. Nature
314(6012):644-645 Pääbo S (1989) Ancient DNA: Extraction, characterization, molecular cloning and
enzymatic amplification. Proc Natl Acad Sci USA 86 March:1939-1943 Pääbo S, Gifford JA, Wilson AC (1988) Mitochondrial DNA sequences from a
7000-year old brain. Nucleic Acids Research 16 No.20:9775-9787 Pääbo S, Higuchi RG, Wilson AC (1989) Ancient DNA and the polymerase chain
reaction. The Journal of Biological Chemistry 264 No.17:9709-9712 Pääbo S, Irwin DM, Wilson AC (1990) DNA Damage promotes jumping between
templates during enzymatic amplification. The Journal of Biological Chemistry 265 No.8:4718-4721
Pääbo S, Poinar H, Serre D, Jaenicke-Desprès V, Hebler J, Rohland N, Kuch M,
Krause J, Vingilant L, Hofreiter M (2004) Genetic Analyses From Ancient DNA. Annu Rev Genet 38:645-679
Paabo S, Wilson AC (1988) Polymerase chain reaction reveals cloning artefacts.
Nature 334:387-388 Pakendorf B, Stoneking M (2005) Mitochondrial DNA and human evolution. Annu
Rev Genomics Hum Genet 6:165-183 Parr RL, Carlyle SW, O'Rourke DH (1996) Ancient DNA analysis of Fremont
Amerindians of the Great Salt Lake Wetlands. Am J Phys Anthropol 99:507-518
![Page 293: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/293.jpg)
Bibliografía
266
Phillips C, Salas A, Sanchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M, Ballard D, Lareu MV, Carracedo A (2007) Inferring ancestral origin using a single multiplex assay of autosomal ancestry - informative marker SNPs. Forensic Sci Int Genetics: accepted for publication
Poinar H, Kuch M, McDonald G, Martin P, Paabo S (2003) Nuclear gene
sequences from a late pleistocene sloth coprolite. Curr Biol 13:1150-1152 Poinar HN, Hofreiter M, Spaulding WG, Martin PS, Stankiewicz BA, Bland H,
Evershed RP, Possnert G, Pääbo S (1998) Molecular coproscopy: Dung and diet of the extinct ground sloth Nothrotheriops shastensis. Science 281:402-406
Poinar HN, Hoss M, Bada JL, Pääbo S (1996) Amino acid racemization and the
preservation of ancient DNA. Science 272(5263):864-866 Poinar HN, Kuch M, Sobolik KD, Barnes I, Stankiewicz BA, Kuder T, Spaulding
WG, Bryant VM, Cooper A, Pääbo S (2001) A molecular analysis of dietary diversity for three archaic Native Americans. PNAS 98 No.8 April10:4317-4322
Poinar HN, Stankiewicz BA (1999) Protein preservation and DNA retrieval from
ancient tissues. Proc Natl Acad Sci USA 96 July:8426-8431 Pusch CM, Bachmann L (2004) Spiking of Contemporary Human Template DNA
with Ancient DNA Extracts Induces Mutations Under PCR and Generates Nonauthentic Mitochondrial Sequences. Molecular Biology & Evolution 21(5):957-964
Reidla M, Kivisild T, Metspalu E, Kaldma K, Tambets K, Tolk HV, Parik J, et al.
(2003) Origin and diffusion of mtDNA haplogroup X. Am J Hum Genet 73:1178-1190
Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C, et al.
(2000) Tracing European Founder Lineages in the Near Eastern mtDNA Pool. Am J Hum Genet 67:1251-1276
Rickards O, Martinez-Labarga C, Lum JK, De Stefano GF, Cann RL (1999)
mtDNA history of the Cayapa Amerinds of Ecuador: detection of additional founding lineages for the Native American populations. Am J Hum Genet 65:519-530
Rohland N, Hofreiter M (2007) Comparison and optimization of ancient DNA
extraction. Biotechniques 42:343-352 Rompler H, Rohland N, Lalueza-Fox C, Willerslev E, Kuznetsova T, Rabeder G,
Bertranpetit J, Schoneberg T, Hofreiter M (2006) Nuclear gene indicates coat-color polymorphism in mammoths. Science 313:62
![Page 294: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/294.jpg)
Bibliografía
267
Samprieto ML, Caramelli D, Lao O, Calafell F, Comas D, Lari M, Agustí B, Bertranpetit J, Lalueza-Fox C (2005) The genetics of the Pre-Roman iberian peninsula: a mtDNA study of ancient iberians. Annals of Human Genetics 69:1-14
Sanchez JJ, Borsting C, Hallenberg C, Buchard A, Hernandez A, Morling N (2003)
Multiplex PCR and minisequencing of SNPs--a model with 35 Y chromosome SNPs. Forensic Sci Int 137:74-84
Sanchez JJ, Endicott P (2006) Developing multiplexed SNP assays with special
reference to degraded DNA templates. Nature Protocols 1:1370-1378 Sanchez JJ, Phillips C, Borsting C, Balogh K, Bogus M, Fondevila M, Harrison
CD, Musgrave-Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N (2006) A multiplex assay with 52 single nucleotide polymorphisms for human identification. Electrophoresis 27:1713-1724
Santos SE, Ribeiro-Dos-Santos AK, Meyer D, Zago MA (1996) Multiple founder
haplotypes of mitochondrial DNA in Amerindians revealed by RFLP and sequencing. Ann Hum Genet 60:305-319
Schmitz RW, Serre D, Bonani G, Feine S, Hillgruber F, Krainitzki H, Pääbo S,
Smith FH (2002) The Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. PNAS 99 No.20:13342-13347
Schneider PM, Seo Y, Rittner C (1999) Forensic mtDNA hair analysis excludes a
dog from having caused a traffic accident. Int J Legal Med 112:315-316 Schurr T (2004) The peopling of the New World: Prespectives from molecular
anthropology. Annu Rev Anthropol 33:551-583 Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merriwether DA, Lawrence DN,
Knowler WC, Weiss KM, Wallace DC (1990) Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. Am J Hum Genet 46:613-623
Schurr TG, Sherry ST (2004) Mitochondrial DNA and Y chromosome diversity and
the peopling of the Americas: evolutionary and demographic evidence. Am J Hum Biol 16:420-439
Schwartz M, Vissing J (2002) Paternal inheritance of mitochondrial DNA. N Engl J
Med 347:576-580 Seielstad M, Yuldasheva N, Singh N, Underhill P, Oefner P, Shen P, Wells RS
(2003) A novel Y-chromosome variant puts an upper limit on the timing of first entry into the Americas. Am J Hum Genet 73:700-705
![Page 295: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/295.jpg)
Bibliografía
268
Serre D, Langaney A, Chech M, Teschler-Nicola M, Paunovic M, Mennecier P, Hofreiter M, Possnert G, Pääbo S (2004) No evidence of neandertal mtDNA contribution to early modern humans. PLoS Biology 2:313-317
Shapiro B, Drummond AJ, Rambaut A, Willson MC, Matheus P, Sher AV, Pybus
OG, et al. (2004) Rise and fall of the Beringian Steppe Bison. Science 306:1561 – 1565
Silva WA, Jr., Bonatto SL, Holanda AJ, Ribeiro-Dos-Santos AK, Paixao BM,
Goldman GH, Abe-Sandes K, Rodriguez-Delfin L, Barbosa M, Paco-Larson ML, Petzl-Erler ML, Valente V, Santos SE, Zago MA (2002) Mitochondrial genome diversity of Native Americans supports a single early entry of founder populations into America. Am J Hum Genet 71:187-192
Smith CI, Chamberlain AT, Riley MS, Cooper A, Stringer CB, Collins MJ (2001)
Neanderthal DNA. Not just old but old and cold? Nature 410:771-772 Sobrino B, Brion M, Carracedo A (2005) SNPs in forensic genetics: a review on
SNP typing methodologies. Forensic Sci Int 154:181-194 Stanford D, Bradley B (2000) The Solutrean solution. Sci Am Discov Archeol 2:54-
55 Starikovskaya EB, Sukernik RI, Derbeneva OA, Volodko NV, Ruiz-Pesini E,
Torroni A, Brown MD, Lott MT, Hosseini SH, Huoponen K, Wallace DC (2005) Mitochondrial DNA diversity in indigenous populations of the southern extent of Siberia, and the origins of native americans haplogroups. Annals of Human Genetics 69:67-89
Stiller M, Green RE, Ronan M, Simons JF, Du L, He W, Egholm M, Rothberg JM,
Keats SG, Ovodov ND, Antipina EE, Baryshnikov GF, Kuzmin YV, Vasilevski AA, Wuenschell GE, Termini J, Hofreiter M, Jaenicke-Despres V, Paabo S (2006) Patterns of nucleotide misincorporations during enzymatic amplification and direct large-scale sequencing of ancient DNA. Proc Natl Acad Sci U S A 103:13578-13584
Stone AC, Stoneking M (1993) Ancient DNA from a pre-Columbian Amerindian
population. Am J Phys Anthropol 92:463-471 Stone AC, Stoneking M (1998) mtDNA analysis of a prehistoric Oneota population:
Implications for the peopling of the New World. Am J Hum Genet 62:1153-1170
Stoneking M (2000) Hypervariable sites in the mtDNA control region are
mutational hotspots. Am J Hum Genet 67:1029-1032 Svetlov V, Cooper TG (1998) Efficient PCR-based random mutagenesis of sub-
genic (100bp) DNA fragments. Yeast 14:89-91
![Page 296: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/296.jpg)
Bibliografía
269
Taanman JW (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1410:103-123
Tapper DP, Clayton DA (1981) Mechanism of replication of human mitochondrial
DNA. Localization of the 5' ends of nascent daughter strands. The Journal of Biological Chemistry 256 No.10:5109-5115
Tattersall I, Schwartz JH (1999) Hominids and hybrids: the place of Neanderthals
in human evolution. Proc Natl Acad Sci U S A 96:7117-7119 Taubenberger JK, Reid AH, Krafft AE, Bijwaard KE, Fanning TG (1997) Initial
genetic characterization of the 1918 "Spanish" influenza virus. Science 275:1793-1796
Taylor PG (1996) Reproducibility of ancient DNA sequences from extinct
Pleistocene fauna. Mol Biol Evol 13:283-285 Thomas RH, Schaffner W, Wilson AC, Paabo S (1989) DNA phylogeny of the
extinct marsupial wolf. Nature 340:465-467 Torroni A, Schurr TG, Cabell MF, Brown MD, Neel JV, Larsen M, Smith DG, Vullo
CM, Wallace DC (1993a) Asian affinities and continental radiation of the four founding native American mtDNAs. Am J Hum Genet 53:563-590
Torroni A, Schurr TG, Yang C-C, Szathmary EJ, Williams RC, Schanfield MS,
Troup GA, Knowler WC, Lawrence DN, Weiss KM, Wallace DC (1992) Native American mitochondrial DNA analysis indicates that the amerind and the Nadene populations were founded by two independent migrations. Genetics 130:153-162
Torroni A, Sukernik RI, Schurr TG, Starikorskaya YB, Cabell MF, Crawford MH,
Comuzzie AG, Wallace DC (1993b) mtDNA variation of aboriginal Siberians reveals distinct genetic affinities with Native Americans. Am J Hum Genet 53:591-608
Tully G, Sullivan KM, Nixon P, Stones RE, Gill P (1996) Rapid detection of
mitochondrial sequence polymorphisms using multiplex solid-phase fluorescent minisequencing. Genomics 34:107-113
Tully LA, Levin BC (2000) Human mitochondrial genetics. Biotechnol Genet Eng
Rev 17:147-177 Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-
Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ (2000) Y chromosome sequence variation and the history of human populations. Nat Genet 26:358-361
![Page 297: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/297.jpg)
Bibliografía
270
Valdiosera C, Garcia N, Dalen L, Smith C, Kahlke RD, Liden K, Angerbjorn A, Arsuaga JL, Gotherstrom A (2006). Typing single polymorphic nucleotides in mitochondrial DNA as a way to access Middle Pleistocene DNA. Biol Lett 2(4):601-3
Vasan S, Zhang X, Kapurniotu A, Bernhagen J, Teichberg S, Basen J, Wagle D,
Shih D, Terlecky I, Bucala R, Cerami A, Egan J, Ulrich P (1996) An agent cleaving glucose-derived protein crosslinks in vitro and in vivo. Nature Julio 18; 382 (6588):275-278
Vega A, Salas A, Gamborino E, Sobrido MJ, Macaulay V, Carracedo A (2003)
mtDNA mutations in tumors of the central nervous system reflect the neutral evolution of mtDNA in populations. Oncongene 23(6):1314-1320
Vergés JM, Allué E, Angelucci DE, Cebriá A, Díez C, Fontanals M, Manyanós A,
Montero S, Moral S, Vaquero M, Zaragoza J (2002) La sierra de Atapuerca durante el Holoceno: Datos preliminares sobre las ocupaciones de la Edad de Bronce en la Cueva de el Mirador (Ibeas de Juarros, Burgos). Trabajos de Prehistoria 59 No.1:107-126
Vigilant L, Pennington R, Harpending H, Kocher TD, Wilson AC (1989)
Mitochondrial DNA sequences in single hairs from a southern African population. Proc Natl Acad Sci U S A 86:9350-9354
Wall J, Kim S (2007) Inconsistencies in Neanderthal genomic DNA sequences.
PLoS Genetics e175.eor doi:1371/journal.pgen.0030175.eor. Wallace DC, Garrison K, Knowler WC (1985) Dramatic founder effects in
Amerindian mitochondrial DNAs. Am J Phys Anthropol 68:149-155 Wallace DC, Lott MT, Brown MD, Huoponen K, Torroni A (1995) Report of the
committee on human mitochondrial DNA. In: Cuticchia AJ (Ed) Human gene mapping 1995: A Compendium Baltimore: Johns Hopkins University Press:910-954
Ward R, Frazier BL, Dew-Jager K, Pääbo S (1991) Extensive mitochondrial
diversity within a single Amerindian tribe. Proc Natl Acad Sci USA 88:8720-8724
Waters MR, Stafford TW, Jr. (2007) Redefining the age of Clovis: implications for
the peopling of the Americas. Science 315:1122-1126 Wiegand P, Kleiber M (2001) Less is more - length reduction of STR amplicons
using redesigned primers. Int J Legal Med 114:285-287 Willerslev E, Cooper A (2005) Ancient DNA. Proc R Soc B 272:3-16 Willerslev E, Hansen AJ, Binladen J, Brand TB, Gilbert MTP, Shapiro B, Bunce M,
Wiuf C, Gilichinsky DA, Cooper A (2003) Diverse plant and animal genetic records from Holocene and Pleistocene sediments. Science 300:791-795
![Page 298: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/298.jpg)
Bibliografía
271
Willerslev E, Hansen AJ, Christensen B, Steffensen JP, Arctander P (1999) Diversity of Holocene life forms in fossil glacier ice. Proc Natl Acad Sci USA 96 July:8017-8021
Willerslev E, Hansen AJ, Poinar HN (2004) Isolation of nucleic acids and cultures
from fossil ice and permafrost. Trends Ecol Evol 19:141-147 Woodward SR, Weyand NJ, Bunnell M (1994) DNA sequence from Cretaceous
period bone fragments. Science 266:1229-1232 Wrischnik LA, Higuchi R, Stoneking M, Erlich HA, Arnheim N, Willson AC (1987)
Length mutations in human mitochondrial DNA: direct sequencing of enzymatically amplified DNA. Nucleic Acids Research 15 Number 2:529-542
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR (1998) Technical note:
improved DNA extraction from ancient bones using silica-based spin columns. Am J Phys Anthropol 105:539-543
Zhang Y, Xu Q, Cui H, Cui Y, Lin H, Kim K, Lee J (2005) Haplotype diversity in
mitochondrial DNA hypervariable region I, II and III in a Korean ethnic group from northeast China. Forensic Sci Int 151:299-301
Zink A, Haas CJ, Reischl U, Szeimies U, Nerlich AG (2001) Molecular analysis of
skeletal tuberculosis in an ancient Egyptian population. J Med Microbiol 50:355-366
Zischler H, Hoss M, Handt O, von Haeseler A, van der Kuyl AC, Goudsmit J
(1995) Detecting dinosaur DNA. Science 268:1192-1193; author reply 1194
![Page 299: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/299.jpg)
![Page 300: DNA ANTIGUO, METODOLOGÍA Y DAÑOS MOLECULARES. …](https://reader030.vdocuments.pub/reader030/viewer/2022012414/616e38295722206e91174306/html5/thumbnails/300.jpg)