-
저작자표시-비영리-동일조건변경허락 2.0 대한민국
이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게
l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. l 이차적 저작물을 작성할 수 있습니다.
다음과 같은 조건을 따라야 합니다:
l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건을 명확하게 나타내어야 합니다.
l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다.
저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다.
이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.
Disclaimer
저작자표시. 귀하는 원저작자를 표시하여야 합니다.
비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.
동일조건변경허락. 귀하가 이 저작물을 개작, 변형 또는 가공했을 경우에는, 이 저작물과 동일한 이용허락조건하에서만 배포할 수 있습니다.
http://creativecommons.org/licenses/by-nc-sa/2.0/kr/legalcodehttp://creativecommons.org/licenses/by-nc-sa/2.0/kr/
-
의학박사학위논문
Expression of Oncogenes and Changes of the Liver and Bile Ducts in Cholangiocarcinoma of Syrian Golden Hamsters Induced by Clonorchis
sinensis and N-Nitrosodimethylamine
간흡충 감염 과 N-Nitrosodimethylamine에 의한 햄스터의 담관암에서 발암관련 유전자 발현과 관련
인자의 변동양상
2013 년 2 월
서울대학교 대학원
의학과 기생충학전공 Md. Hafiz Uddin
-
-i-
Abstract
Expression of Oncogenes and Changes of the Liver and Bile Ducts in Cholangiocarcinoma of Syrian Golden Hamsters Induced by Clonorchis
sinensis and N-Nitrosodimethylamine
Md. Hafiz Uddin
Parasitology and Tropical Medicine
The Graduate School
Seoul National University
Clonorchis sinensis has been reclassified as group-I bio-carcinogen for
cholangiocarcinoma (CCA) in humans by IARC in 2009, however, the
mechanism of carcinogenesis is little known. The present study investigated
CCA mechanism in hamster model by means of imaging, histopathology,
immunohistochemical analysis, and expression of oncogenesis related genes.
The experimental animals were divided into 4 groups: uninfected control
(Ctrl.), C. sinensis (Cs), N-Nitrosodimethylamine (NDMA), and C. sinensis
with NDMA (Cs+NDMA). The body weight of hamsters in every week and
liver and spleen weight at necropsy were measured. Abdominal
ultrasonography (USG) of all hamsters and magnetic resonance imaging
(MRI) of randomly selected hamsters were performed at every 2 weeks up to
16th week of infection. After 4, 8, 12, and 16 weeks animals were sacrificed
and investigated. USG detected first mass-forming lesion (MFL) in the
-
-ii-
Cs+NDMA group at 6th week and 77.3% of overall prevalence at 16th week of
infection. The MFLs were consistent and increased in size during the follow-
up examination. MRI recognized same MFLs with USG, but recovered a cyst
in the Cs+NDMA group at the 6th week. Findings by both USG and MRI of
the Ctrl. and NDMA groups were non-specific throughout the experiment.
The Cs+NDMA group hamsters underwent significant loss of body weight
(24.8%) and gain of the liver (88.6%) and spleen (255.2%) weight. Thin
slicing of the liver confirmed 100% prevalence of MFLs in the Cs+NDMA
group with an intensity of 10.92 ± 5.76. Semiquantitative histopathology (as
% of total tissue area) revealed severe inflammation (34.3% ± 3.6%),
proliferation of bile ducts (11.4% ± 2.1%), periductal fibrosis (11.2% ±
1.9%), and abscess (8.7% ± 3.13 %) in the Cs group. In the Cs+NDMA group
the above histopathological findings were present moderately but showed
intrahepatic CCA of well (21.8% ± 1.5 %), moderate (13.3% ± 1.3%), and
poorly (10.8% ± 1.3%) differentiated types. The CCA mass was packed with
collagen fibers, mainly of type I. Immunohistochemisty against proliferative
cell nuclear antigen (PCNA) found strong positive reaction in the Cs+NDMA
group. The metaplastic changes of bile duct epithelial cell to mucin secreting
cell was 7 times higher and mitotic figures were significantly increased in the
Cs+NDMA group. Real-time PCR and western blot analysis showed
dysregulation of a number of genes/proteins. A novel oncogene for CCA
called gankyrin was upregulated, CDK4 and p16INK4 genes were
overexpressed but, p53 gene and RB protein were downregulated in the tumor
-
-iii-
tissue. In conclusion, CCA in hamsters may develop in hamster model after 6
weeks of infection with weight loss and hepato-splenomegaly. The mass can
be monitored by USG and MRI. Upregulation of oncogene gankyrin, CDK4,
and downregulation of p53 gene and RB protein may play an important role
in the process of carcinogenesis of CCA in the C. sinensis-NDMA mediated
hamster model. Excessive mRNA expression of p16INK4 and increased
PCNA may be marker candidates for CCA in clonorchiasis.
Key words: Cholangiocarcinoma, Clonorchis sinensis, N-
Nitrosodimethylamine, Hamster, Histopathology, Gene expression
Student number: 2009-30777
-
-iv-
List of Tables
Table 1. Groups and numbers of hamsters … 8
Table 2. Oncogenesis related genes targeted primer pairs … 13
Table 3. Qualitative histopathological findings of the liver and
gallbladder by USG … 18
-
-v-
List of Figures
Fig. 1. Proposed etiopathogenetic mechanism of
cholangiocarcinogenesis showing interactions between
etiological agents and cholangiocyte response to injury (Sandhu
et al., 2007).
… 4
Fig. 2. Experimental design for the development of cholangiocarcinoma
in Syrian golden hamsters in association with C. sinensis (Cs)
and N-Nitrosodimethylamine (NDMA).
… 9
Fig. 3. Abdominal ultrasonography (USG) from 0–16 weeks of
infection at every 2 weeks interval.
… 25
Fig. 4. Abdominal magnetic resonance imaging (MRI) from 2–16
weeks of infection at every 2 weeks interval in randomly
selected hamsters of different groups.
… 26
Fig. 5. Weight and length of different organs of hamster at necropsy. … 27
Fig. 6. Mass-forming lesion’s (MFL) prevalence, intensity and gross
view.
… 28
Fig. 7. H&E staining of the liver sections in different groups of
hamsters (x100).
… 29
-
-vi-
Fig. 8. Masson’s trichrome, Sirius red and proliferative cell nuclear
antigen (PCNA) staining of liver tissue in different groups of
hamsters after 16 weeks of infection (x100).
… 30
Fig. 9. Semiquantitative non-neoplastic histopathological changes in
different groups of hamsters.
… 31
Fig. 10. Semiquantitative neoplastic histopathological changes in
different groups of hamsters.
… 32
Fig. 11. Cellular changes among the groups of hamsters. … 33
Fig. 12. Real-time PCR using SYBR Green I DNA binding dye. … 34
Fig. 13. Relative expression of oncogenesis related genes by real-time
PCR.
… 35
Fig. 14. Relative expression of oncogenesis related proteins by western
blot analysis.
… 36
Fig. 15. Relative expression of oncogenesis related genes/proteins by
real-time PCR and/or western blot analysis (A) and (A) a
simplified signal transduction pathway (dotted lines has been
affected in the present study).
… 37
-
-vii-
List of Abbreviations and Symbols
CCA Cholangiocarcinoma
Cs Clonorchis sinensis
Cs+NDMA C. sinensis with N-Nitrosodimethylamine
GB Gallbladder
MFL Mass-forming lesion
MRI Magnetic Resonance Imaging
NDMA N-Nitrosodimethylamine
ppm Parts per million
ROS Reactive Oxygen Species
RNS Reactive Nitrogen Species
T1WI T1 weighted image
T2WI T2 weighted image
USG Ultrasonography
°C Degree Celsius
-
-viii-
Contents
Introduction…………………………………………………… 1
Materials and Methods………………………………………… 6
Results…………………………………………………………. 16
Discussion……………………………………………………… 38
References……………………………………………………… 46
Abstract in Korean……………………………………………… 58
Acknowledgement……………………………………………… 61
-
-1-
Introduction
In a worldwide population of 6 billion, in the year 2000, approximately 10
million cancers were diagnosed, and there were an estimation of 6.2 million
cancer deaths (Schottenfeld et al., 2005). About 13% of all human deaths in
2007 was due to cancer (World Health Organization: WHO, 2006) and
estimated as 7.6 million (American Cancer Society, 2007), which was 1.4
million more than that of the year 2000. Cancer affects people at all ages and
its risk increases with age (Cancer Research UK, 2007). Cancer mortality has
a proportionate cause of 12% global deaths. The three cancer sites
contributing to the highest proportions of cancer deaths are the lungs (17.8%),
stomach (10.4%), and liver (8.8%) (Ferlay et al., 2001; Parkin, 2001; Pisani et
al., 2002; Pisani et al., 1999; Shin et al., 1996).
Liver cancer is one of the most common cancers in Southeast Asia and
the death rate among Koreans has been reported as one of the highest in the
world (Jemal et al., 2010). In the etiology of primary liver cancer, three major
types (hepatocellular carcinoma, cholangiocarcinoma (CCA), miscellaneous
tumors) may be considered (Shin et al., 1996). Among primary liver cancer,
CCA accounts for more than 20% of liver cancer in Busan, Korea (Jung et al.,
1993). CCA is known to be associated with heavy infestation by liver fluke,
Opisthorchis viverrini and Clonorchis sinensis (Watanapa and Watanapa,
2002). The liver fluke, C. sinensis is widely distributed in East Asia with
some heavily endemic zones such as China, Taiwan, Vietnam, and the
-
-2-
Republic of Korea and recently included in the control programs of neglected
tropical diseases by WHO (Hong and Fang, 2012). C. sinensis, also known as
oriental or Chinese liver fluke, causes clonorchiasis, which is characterized by
hyperplasia and metaplasia in the intrahepatic bile duct epithelium. The
incidence of CCA is also correlated to the prevalence of C. sinensis infection
(Shin et al., 2005). CCA is a highly lethal malignant tumor arising from the
biliary tract epithelium (Olnes and Erlich, 2004) and notoriously difficult to
diagnose. It is usually fatal because of its typically late clinical presentation
and the lack of effective non-surgical therapeutic modalities (Ishak et al.,
1994). In 2009, based on different epidemiological data C. sinensis was
defined as group-I biocarcinogen to human for CCA by International Agency
for Research on Cancer (IARC) (Bouvard et al., 2009; Shin et al., 2010).
Although a large and compelling body of evidence links clonorchiasis and
CCA, the mechanism involves in this process is little known (Kim et al.,
2008).
Few studies have been carried out to understand the mechanism of
oncogenesis in C. sinensis. The array of mechanisms under which the
organism becomes oncogenic can be categorized within four general
processes: direct effects on signal transduction pathways in host cells, chronic
inflammation, changes in host physiology, and effects on other organism
(Watanapa and Watanapa, 2002). The second process, chronic inflammation
can cause by the presence of liver flukes which promotes neoplasia by
-
-3-
increasing probability of mutagenic events (a simplified mechanism showed
in Fig. 1). Genotoxic effects of reactive oxygen and nitrogen species (ROS,
RNS) plays an important role in the process of carcinogenesis (Butel, 2000;
Oliviera, 2007; Blaser and Atherton, 2004).
Oncogenesis is a multi-step process in which alternation of cell-cycle,
apoptosis, oncogene expression, tumor suppressor and angiogenesis related
genes are involved. Boonmars et al. (2008) showed changes in apoptosis
related genes in hamster opisthorchiasis model. Boonmars et al. (2009)
showed an alternation of genes expression of retinoblastoma protein (RB)
pathway in same opisthorchiasis model. Angiogenesis related gene expression
was studied by Yang et al. (2009) in 7,12-Dimethylbenz(a)anthracene
(DMBA)-induced oral carcinogenesis in hamsters. There are a few works
have done regarding synergistic effect of C. sinensis and N-
nitrosodimethylamine (NDMA) for development of CCA in hamster model.
A number of studies showed that animals infected with C. sinensis alone did
not develop CCA (Wykoff, 1958; Bhamarapravati et al., 1978; Lee et al.,
1978a,b; Min and Han, 1985). However, CCA was successfully introduced in
Syrian golden hamsters by C. sinensis with a hepatocarcinogen, NDMA at
sub carcinogenic level (Lee et al., 1997). This is the only established CCA
animal model for C. sinensis. NDMA can be found in diverse consumable
items of human specially fermented or cured meat, fish, beers, and
tobacco smoke (Najm et al., 2001). Thus humans infected with C. sinensis are
-
-4-
Fig. 1. Proposed etiopathogenetic mechanism of cholangiocarcinogenesis
showing interactions between etiological agents and cholangiocyte response
to injury (Sandhu et al., 2007).
-
-5-
always at risk of developing CCA. Therefore it is a crying need to find out the
impact of C. sinensis and NDMA at molecular level to reveal the mechanism
of oncogenesis.
The present study was investigated the development of CCA by imaging,
histopathological and immunohistochemical observation in infected hamsters.
The cell proliferation, cell-cycle, apoptosis, tumor suppressor and
angiogenesis related genes or proteins expression were analyzed to
understand the mechanism of oncogenesis in C. sinensis and NDMA
mediated CCA in Syrian golden hamster.
-
-6-
Materials and Methods
1. Collection of metacercariae
Metacercariae were collected from naturally infected freshwater fish
Pseudorasbora parva. The fish flesh was digested in a 0.5% pepsin solution
with HCl and C. sinensis metacercariae were isolated under a
stereomicroscopic identification (Choi et al., 2004).
2. Experimental design
A total of 70 male Syrian golden hamsters (Mesocricetus auratus) of 4-5
weeks old were divided randomly into 4 groups. Group I (Ctrl.) included 15
hamsters as uninfected control, Group II (Cs) included 15 hamsters which
received 30 metacercariae of C. sinensis, Group III (NDMA) included 15
hamsters which were allowed to drink NDMA in drinking water, and Group
IV (Cs+NDMA) included 25 hamsters which received both metacercariae and
NDMA. The hamsters of the respective groups were infected with
metacercariae by intra-gastric intubation and received NDMA at a
concentration of 12.5 ppm in drinking water for 8 weeks ad libitum. The
hamsters were subjected to abdominal ultrasonography (USG) at every 2
weeks from baseline to the 16th week of infection and MRI done from 2nd-16th
weeks of infection in randomly selected hamsters. After 4, 8, 12 and 16 weeks,
the hamsters were sacrificed and investigated for the pathological and
-
-7-
molecular changes. The grouping and experimental design are summarized in
Table 1 and Fig. 2.
3. Measurement of weight
Body weights of all hamsters were measured in every week and weight of the
liver and spleen were measured at necropsy with an electronic balance
(Sartorius, Germany).
4. Ultrasonographic examination
All hamsters were subjected to high resolution abdominal ultrasonography
(USG; iU22, Philips Healthcare, Aandover, USA) with L15-7io linear
transducer probe (7-15 MHz) after every 2 weeks from baseline to the 16th
week of infection under general anesthesia throughout the study period to see
the development of any mass-forming lesion (MFL) in the liver. A mixture of
xylazine (10mg/kg; Bayer, Korea) and zoletil-50 (30mg/kg, Virbac, France)
were used for anesthesia. The anesthetic solution was injected into the thigh
muscle.
5. Magnetic resonance imaging
Randomly selected hamsters from different groups were subjected to
abdominal magnetic resonance imaging (MRI; Magnetom Trio (3T) Siemens)
at every alternate week from 2-16 weeks after infection under general
anesthesia for better observation of MFL in the liver. Contrast solution (Primo
-
-8-
Table 1. Groups and numbers of hamsters
Groups No. of hamsters
I. Uninfected control (Ctrl.) 15
II. C. sinensis (Cs) 15
III. N-Nitrosodimethylamine (NDMA) 15
IV. C. sinensis with NDMA (Cs+NDMA) 25
-
-9-
Fig. 2. Experimental design for the development of cholangiocarcinoma in
Syrian golden hamsters in association with C. sinensis (Cs) and N-
Nitrosodimethylamine (NDMA). The hamster received NDMA with drinking
water (Mc: metacercariae of C. sinensis).
-
-10-
-vist, Bayer, Korea, 1.3 ml/kg) was injected directly to the heart
(intraventricular bolus injection) using 26 gauze needle with ultrasonographic
guidance. A mixture of xylazine and zoletil-50 were used for anesthesia as
used in USG. Axial T1-weighted image (volumetric interpolated breath-hold
examination (VIBE); matrix size 256×123; slice thickness 0.7 mm), T2-
weighted image (respiratory triggered turbo spine echo (TSE); matrix size
256×177; slice thickness 0.7 mm), were performed to detect any anatomical
or pathological changes in the liver, GB and bile duct.
6. Gross observation at necropsy
The livers of hamsters from all groups were observed grossly for the presence
of any MFLs. After external observation and keeping the sample (about 100
mg) for RNA from the hilar region, rest of the liver was kept in neutral
buffered formalin (10%) for the hardening of the tissues. The fixed and
hardened tissues were subjected to 2-4 mm manual slicing for the presence of
any MFL inside the liver. Mean intensity or intensity of MFLs was calculated
as mean number of MFLs in the positive liver as below.
Intensity = Total No. of MFLs
No. of hamsters positive for MFL
7. Histopathology
A portion of the hilar tissues from the left, median and right lobes of each
liver after fixation in neutral buffered formalin (buffered 10% formaldehyde,
pH: 7.2) were prepared for histopathological analysis. Paraffin sections of 4
-
-11-
µm thickness were processed for routine hematoxylin and eosine (H&E)
staining. For semiquantitative analysis, histopathological findings were
expressed as percentage of total histological section area.
Masson’s trichrome staining was also performed in randomly selected
slides for the visualization of collagen fiber. Briefly, formalin fixed tissue
section was refixed in Bouin’s solution for 1 h at 56ºc after deparaffinization
and rehydration. Slides were stained with weigert’s iron hematoxylin solution
and Biebrich scarlet-acid fuchsin solution for about 10 minutes followed by
phosphomolybdic-phosphotungstic acid solution and aniline blue staining.
After differentiation in 1% acetic acid slides were mounted through
dehydration steps.
For better visualization of type I collagen fiber randomly selected sections
were subjected to Sirius red staining. In brief, rehydrated slides were stained
for 8 minutes with haematoxyline and putted under running tap water for 10
minutes. Then Sirius red Solution A was applied for 1 hour followed by
washing with 0.5% acidic water. Red stained fibers were counted as collagen
fibers.
8. Immunohistochemistry
To detect the proliferative cell nuclear antigen, immunohistochemisty
procedure was carried out using Histomouse MAX kit (Zymed laboratories,
Invitrogen immunodetection). The antigen was retrieved through incubation
-
-12-
with citrate buffer (pH = 6) at 100°C in a water bath for about 1 hour. At
primary antibody application step, PCNA monoclonal antibody (Clone IPO-
38, Cat#10004805, Cayman Chemical) was used. The 3-amino-9-
ethylcarbazole (AEC) was utilized for the production of red colour with HRP
conjugated secondary antibody.
9. RNA extraction and cDNA preparation
A portion of the liver tissue from the hilar region of the livers of all hamsters
groups were snap frozen in liquid nitrogen and stored in it for the extraction
of RNA. Total RNA was isolated using RNeasy plus mini kit (Cat# 74134,
Qiagen, Germany) according to the manufacturer instructions. Reverse
transcription of 3 µg of total RNA were done by Maxim RT premix (Korea)
cDNA synthesis kit. The cDNAs were kept at -70ºC until use.
10. Analysis of gene expression by Real-Time PCR Assay
The primer pairs for gankyrin was self designed using primer BLAST of
NCBI and the following genes Akt/PKB, BAX, RB1, p53, p16INK4, and
CDK4 as well as housekeeping gene glyceraldehydes-3-phosphate
dehydrogenase (GAPDH) were used based on the published sequence in the
Gene Bank and published journal articles showed in Table 2 (Boonmars et al.,
2008; Boonmars et al., 2009; Boonmars et al., 2010; Yang et al., 2009;
Kitahashi et al., 2004). SYBR Green I (Applied Biosystem) DNA binding dye
was used as fluorophore. After PCR amplification melting curve analysis
-
-13-
Table 2. Oncogenesis related genes targeted primer pairs for real-time PCR
Genes Sequences
Upper line: forward primer 5’-3’
Bottom line: reverse primer 5’-3’
Gene Bank
accession
Gankyrin TGTCTAAGGTCTGCAACCTGGCCT
AGCATGCCCAGTGTAATGCTGTTC
-
Akt/PKB CCCTTCTACAACCAGGACCA
ATACACATCCTGCCACACGA
M94355.1
BAX AGCTGCAGAGGATGATTGCT
CTCTCGGAGGAAGTCCAGTG
AJ582075.1
RB1 CAGATGGTGTGTAATAGTGACCGA
TTTTTCAGGGGCTTGGGAG
GQ246228
p53 AAGGCGATAGTTTGGCTCCT
CTGGGGTCTTCCAGTGTGAT
Y08900
p16INK4
GCAACACCCAAGTAGCCAGAC
CGCCAGAGTTTCCAAGAAGCC
AF292567
CDK4 CACCCTCGTGTTTGAGCATA
GTTTTCTGGTTTCAGGTCTCGG
GQ246229
GAPDH GACATCAAGAAGGTGGTGAAGCA
CATCAAAGGTGGAAGAGTGGGA
U10983
-
-14-
were performed to verify the PCR product. The standard curve was prepared
for the determination of PCR efficiency. Before real-time PCR, all of the
reactions were confirmed as single band in agarose gel electrophoresis by
conventional PCR. Single band was also observed after real-time PCR as
well. Gene expressions were calculated using 2-ΔΔCT (Livak) method.
11. Western blot analysis
To determine the oncogenesis related protein levels in the hamster tissue,
proteins were extracted according to the conventional method. Briefly, about
100 mg of the tissue was taken from each sample and grounded to a powdery
preparation with liquid nitrogen. Needle homogenization was performed. The
samples then underwent a process of 10 minutes homogenization and/or
sonication in the presence of tissue protein extracting solution (lysis buffer
containing 50 mmol/L Tris-Cl (pH 8.0), 150 mmol/L NaCl, 0.1% SDS, 100
μg/ml PMSF, 2 μg/ml aprotinin, 2 μg/ml leupeptin, and 1% NP40), cooling on
ice for 30 minutes, and centrifugation at 14,000 g for 5 minute at 4°C and the
supernatant fluid were collected.
Proteins were separated (80 µg/lane) by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (10% SDS-PAGE). The sample
concentration of proteins were determined previously by BCA protein assay
(Pierce, Thermo Scientific) using Nanodrop-1000 (Thermo Scientific)
according to manufacturer instruction. After electrophoresis, the proteins
-
-15-
were electro-transferred to polyvinylidene fluride (PVDF) membranes,
blocked in 5% non-fat milk for 1 h at room temperature (RT) and washed
with PBST (PBS with 0.1% Tween), and probed with following primary
antibodies: CDK4 (C-22: SC-260, Santa Cruz Biotechnology Inc.), Akt1 (C-
20: SC-1618, Santa Cruz), p53 (FL-393: SC-6243, Santa Cruz), RB (C-15:
SC-50, Santa Cruz), VEGF (A-20: SC-152, Santa Cruz), and E2F1 (C-20:
SC-193, Santa Cruz). Actin (I-19: SC-1616, Santa Cruz) and GAPDH (V-18,
SC-20357, Santa Cruz) used as control. The membranes were then incubated
with horseradish peroxidase-conjugated 1:4000 dilution of anti-rabbit (81-
6120, Zymax) or 1:2000 dilution of anti-goat (P-0449, Dako) secondary
antibody and the blot were treated with enhanced chemiluminescence reagent
(WEST-ZOL Plus Kit, iNtRON Biotechnology) and exposed to X-ray film.
The images were obtained by transmission scanner with the internal control of
the actin and GAPDH protein levels and relative quantitative analysis was
carried out based on the photo density ratio with ImageJ software of NIH.
11. Data analysis and statistics
Data obtained from the experiment were analyzed by Microsoft Excel (Ed.
2007, USA), GraphPad Prism 5 and SPSS-19 statistical software.
Comparisons of results were performed using a Student’s t-test. P values
-
-16-
Results
1. Monitoring the progression of CCA
(1) Abdominal ultrasonography (USG)
In USG, all hamsters of the control group showed normal shape, size and
echogenicity of the liver and gallbladder (GB). Hamsters in the Cs and
Cs+NDMA groups had enlarged liver with cirrhotic change and intrahepatic
bile duct dilatation. GB wall thickening and echogenic debris were commonly
observed in both groups. The cirrhotic appearances of the liver were more
prominent in Cs+NDMA group. First mass-forming lesion (MFL) appeared as
early as the 6th week of infection in the Cs+NDMA group (Fig. 3). The MFLs
in the liver were observed in 77.3% hamsters of the Cs+NDMA group after
16th week of infection as revealed by USG (Table 3). The MFLs were
consistent or increased in size and number among USG evaluations in the
Cs+NDMA group. Fig. 3 showed mass-forming lesions in different lobes of
the hamster liver in the Cs+NDMA group starting from the 6th week upto 16th
week. In the NDMA group, most of the hamsters showed coarse echogenicity
of the liver parenchyma but no bile duct dilatation. There were no distinctive
differences observed after 16 weeks compared to control group.
Hepatomegaly and GB wall thickening were observed almost equally in
both Cs (90% and 40% respectively) and Cs+NDMA group (100% and 37.5%
respectively). However, echogenic debris, cystic changes and GB inner
-
-17-
echogenic debris were more prevalent in the Cs+NDMA group (100%, 91.7%
and 62.5% respectively) (Table 3).
(2) Abdominal MRI
MRI of randomly selected hamsters from different groups showed normal
liver in the control group. In the Cs group, extensive dilatation of bile ducts
was observed but there were no MFL observed by contrast enhanced scans
(Fig. 4). In the NDMA group, MRI did not show any definite abnormalities
compared to control. On the contrary extensive dilatation of the bile duct was
noted in all of the liver lobes and multiple T2 high signal intensity area in the
Cs+NDMA group. Many of them were eventually enhanced when contrast
media was administered (Fig. 4). MRI also confirmed the first MFL and a
complicated cyst at the 6th week of infection in the Cs+NDMA group. The Cs
group restricted to ductal dilatation even after 16 weeks of infection (Fig. 4).
2. Gross findings at necropsy
(1) Body weight measurement
Significant reduction (26.8%) of body weight was observed in the Cs+NDMA
group (120.27 ± 8.2; P < 0.001) compared to the control group (160.54 ±
13.83) after 16 weeks of the study. The Cs group also showed significant
weight loss (21.6%) (128.65 ± 13.08; P < 0.001) whereas no significant
difference was observed in the NDMA group (149.32 ± 9.79; P = 0.081)
-
-18-
Table 3. Qualitative histopathological findings of the liver and GB by USG
Gro
ups
Mas
s for
min
g
Cys
tic c
hang
es (%
)
Ech
ogen
ic d
ebri
s
W
orm
(%)
Lym
ph n
odes
(%)
Hep
atom
egal
y (%
)
GB
wal
l thi
cken
ing
G
B in
ner
echo
geni
c
Control 0 0 0 0 0 0 0 0
Cs 0 50 10 30 20 90 40 0
NDMA 6.7 0 0 0 0 0 0 0
Cs+NDMA 77.3 91.7 100 12.5 29.2 100 37.5 62.5
-
-19-
relative to the control (Fig. 5A).
(2) Measurements of the liver and spleen
The liver weight in the control group measured 5.97 ± 0.86 gm whereas the
Cs group showed an average of 8.04 ± 1.45 gm. The NDMA group showed
similar weight (6.79 ± 1.27 gm) of the liver as the control. The highest liver
weight was observed in the Cs+NDMA group (11.32 ± 1.53 gm) which was
highly significant as well (Fig. 5B). Liver weight in the control group was
3.69% ± 0.54% of the body weight in average. However, it was 6.79% ±
1.37%, 4.41% ± 0.69% and 11.32% ± 0.86% in the Cs, NDMA and
Cs+NDMA groups respectively (Fig. 5C). The liver weight increased about 2
times in the Cs group and 3 times in the Cs+NDMA group compared to the
body weight suggesting hepatomegaly in the Cs and Cs+NDMA groups. The
weight gain of the liver was 88.6% in Cs+NDMA group. Increase of the liver
weight in NDMA group was insignificant. Spleen weight difference between
the control and the Cs groups as well as the control and the Cs+NDMA
groups were highly significant (P < 0.001). The heaviest spleen weight (0.52
± 0.22 g) was observed in the Cs+NDMA group suggesting splenomegaly
(Fig. 5D). The spleen weight percentages to the body weight were also
increased in the Cs and Cs+NDMA groups about 2 and 4 times respectively
(Fig. 5E). The spleen was gained about 255.2% weight in Cs+NDMA group.
Average spleen length in the control group was 34.67 ± 0.99 mm where as it
was 47.28 ± 1.29 mm in the Cs+NDMA group (Fig. 5F). Thus the increase of
-
-20-
length was 21.9%. Gross view of the spleen is displayed in Fig. 5G for visual
comparison.
(3) Mass-forming lesions (MFLs) in the liver
The prevalence of MFL in the Cs group was 33.3% and in the NDMA group
23.1%, but all hamsters (100%) of the Cs+NDMA group showed single or
multiple MFLs. The intensity of MFLs in the Cs group was 1.0 ± 0, NDMA
group 1.33 ± 0.58 whereas in the Cs+NDMA group it was 10.92 ± 5.76
distributed among the lobes of the liver (left lobe: 3.71 ± 2.31; median lobe:
3.46 ± 1.93; right lobe: 2.58 ± 2.24 and caudate lobe: 1.17 ± 1.37) (Fig. 6A,
6B). At necropsy all of the livers were photographed and representative livers
are summarized in Fig. 6C. The livers of the control and the NDMA groups
were normal in gross appearance. However, the livers of the Cs and
Cs+NDMA groups showed dilated biliary tree, blackish coloration and
cirrhotic appearance. Fig. 6D showed 2-4 mm sections of the formalin fixed
liver. Ultrasonographic monitoring helped to find out some tumors which
were not visible in the liver externally at necropsy (Fig. 6E).
3. Histopathological findings
(1) H&E staining of histopathological slides
The histopathology of the control group showed normal appearance of
hepatocytes, cholangiocytes and hepatic triad. No inflammatory cells were
accumulated in the control group. However, severe inflammation, bile duct
-
-21-
proliferation, periductal fibrosis were common in the Cs group. The NDMA
group showed almost normal appearance. Bile duct proliferation,
cholangiofibrosis, metaplasia and different grades of adenocarcinoma were
evident in the Cs+NDMA group. Representative H&E stained histological
features from 4-16 weeks are presented in Fig. 7.
(2) Collagen staining
The Masson’s trichrome staining recognized dense collagen fibers around the
bile ducts in the Cs and Cs+NDMA groups. Trace amount of collagen was
found in the control and NDMA group around the biliary triad (Fig. 8). Sirius
red staining showed traces of type I collagen around the blood vessel and bile
duct, periductal and bridging collagen in the Cs group and dense fibers around
the bile ducts in the Cs+NDMA group forming fibrous stroma of CCA tissues
(Fig. 8).
(3) Immunohistochemistry against proliferative cell nuclear antigen
(PCNA)
Among 4 groups of hamsters, only the Cs+NDMA group showed strong
positive reaction with PCNA antibody. Proliferative cell nuclear antigen
(PCNA) was mostly accumulated in and around the MFL which was
confirmed as cholangiocarcinoma by histopathology (Fig. 8).
-
-22-
(4) Semiquantitative histopathological findings in different groups
No measurable histopathological changes were observed in the control group.
The Cs group showed significantly higher level of inflammation (34.3% ±
3.6% tissue area), bile duct hyperplasia (11.4% ± 2.1% tissue area), periductal
fibrosis (11.2% ± 1.9% tissue area), abscess (8.68 ± 3.1% tissue area),
however, no neoplastic change was observed. In the NDMA group, very low
quantity of inflammation (2.3% ± 0.8%), bile duct hyperplasia (1.0% ± 0.3%),
cholangiofibrosis (1.4% ± 1.3%) were observed (Fig. 9). Inflammation was
significantly higher in the Cs group than that in the Cs+NDMA group (Fig.
9A). Higher level of bile duct hyperplasia, periductal fibrosis, and abscess
were also observed in the Cs group than in the Cs+NDMA group (Fig. 9B,
9C, 9E respectively). Egg granuloma and cholangiofibrosis did not show any
significant difference between the Cs and Cs+NDMA groups (Fig. 9D, 9F
respectively).
(5) Grading of CCA
CCAs originated in the Cs+NDMA group were categorized in well,
moderately, and poorly differentiated types (Fig. 10). In average, CCA was
found in about 46.0% of total tissue area of the Cs+NDMA group. Among
CCAs, well differentiated CCA (WDC) was most prevalent and observed in
21.8% ± 1.5% of total tissue area. Moderately differentiated CCA (MDC) was
found in 13.3% ± 1.3% of total tissue area and poorly differentiated CCA
-
-23-
(PDC) was detected in 10.8% ± 1.3% of tissues (Fig. 10A). Beside this, one
hamster of the NDMA group showed well and moderately differentiated CCA
restricted in a very limited area (0.5% ± 0.5% and 0.03% ± 0.3%
respectively).
(6) Histopathological changes at cellular level
The metaplastic conversion of bile duct epithelial cells to mucin secreting
cells was not observed in the control group. The Cs and NDMA groups
showed 8.4 ± 3.1 and 9.6 ± 5.6 metaplastic cells respectively while the
Cs+NDMA group showed 56.4 ± 7.9 metaplastic cells per histological tissue
section (Fig. 11A, 11B). Mitotic figures observed in the Cs, NDMA, and
Cs+NDMA groups were 4.3 ± 1.3, 0.3 ± 0.1 and 22.9 ± 2.3 per histological
section respectively (Fig. 11C, 11D). Hepatic cell nuclear/glycogen inclusion
was rare in the normal (2 ± 0.2) and Cs (1.7 ± 0.5) groups, however, it was
15.8 ± 1.4 in the NDMA and 5.2 ± 0.5 in the Cs+NDMA group when
observed in 10 high power fields (HPF) (Fig. 11E, 11F). Bile cell nuclear
inclusion frequently appeared in the Cs+NDMA group (1.7 ± 0.7) compared
to the Cs (0.5 ± 0.3) and NDMA groups (0.03 ± 0.03) (Fig. 11G, 11H).
4. Oncogenesis related genes/proteins expression
Relative expression of mRNA by real-time PCR (Fig. 12) showed that
gankyrin, CDK4, BAX and RB1 genes were overexpressed in the Cs+NDMA
hamster’s liver tumor tissues. Gene p53 was downregulated both in tumor
-
-24-
(Cs+NDMA-T) and adjacent normal tissues (Cs+NDMA-N) but upregulated
in the NDMA, and remained same in the Cs group. CDK4 inhibitor gene
p16INK4 also showed upregulation in the tumor and adjacent normal tissues
as well as in the Cs group but remained same in the NDMA group. Increase
of p16INK4 in Cs+NDMA group was almost 40 folds which was highly
significant (P < 0.001). Though Akt/PKB showed slight upregulation but it
was not significant (Fig. 13).
In western blot analysis, goat actin, GAPDH, Akt1 and rabbit CDK4, p53,
RB, VEGF and E2F1 primary antibodies cross-reacted with hamster
counterparts (Fig. 14). Both p53 and RB proteins were found underexpressed
in the Cs+NDMA group, however, CDK4 and Akt1 increased. The increase
of CDK4 and decrease of p53 and RB were statistically significant. No
significant changes were observed in E2F1 or VEGF (Fig. 14). Upregulated,
downregulated, and unchanged genes/proteins listed in Fig. 15A. A simplified
signal transduction pathway introduced the interaction of genes/proteins in
Fig. 15B. The present study found that several interactions between proteins
have affected indicated as dotted lines in the diagram (Fig. 15B).
-
Fig. 3. Abdominal ultrasonography (USG) from 0-16 weeks of infection at every
2 weeks interval. First mass-forming lesion (arrows) found to appear after 6
weeks of infection in Cs+NDMA group. Gall bladder (GB) frequently showed
worms (asterisk). Arrow head indicates complicated cyst and chevron indicates
ductal dilatation.
Ctrl.
6
wee
ks
4
wee
ks
2
wee
ks
0
wee
k
1
6 w
eeks
1
2 w
eeks
10 w
eeks
8 w
eeks
Cs
NDMA
Cs+NDMA
GB GB
GB GB
GB GB
GB GB GB
GB
GB GB
-25-
-
Fig. 4. Abdominal magnetic resonance imaging (MRI) from 2-16 weeks of
infection at every 2 weeks interval in randomly selected hamsters of different
groups. MRI also detected mass-forming lesion (arrows) and cyst as early as 6
weeks after infection. GB indicates gall bladder; arrow head, cysts and
chevron, ductal dilatations.
Ctrl.
6
wee
ks
4 w
eeks
2
wee
ks
16
wee
ks
12 w
eeks
10
wee
ks
8 w
eeks
Cs
NDMA
Cs+NDMA
Not Done Not Done Not Done
Not Done Not Done Not Done
Not Done
GB
GB
GB GB
GB
GB GB
GB GB
GB GB GB
GB GB
-26-
-
70
90
110
130
150
170
0 4 8 12 16
Body
wei
ght
(gm
)
Weeks
Control Cs NDMA Cs+NDMA
Fig. 5. Weight and length of different organs of hamster at necropsy. A, Body
weight; B, Liver weight; C, Percentage of liver weight to body weight; D,
Spleen weight; E, Percentage of spleen weight to body weight; F, Spleen
length; and G, Gross spleen (1-4 represents 4 hamster groups respectively; Bar
= 10 mm).
0
5
10
15
Live
r w
eigh
t (g
m)
A
B
D
F
C
E
G
0
5
10
15 %
of l
iver
wei
ght
(gm
) *
0
0.2
0.4
0.6
0.8
Sple
en w
eigh
t (g
m)
* 0
0.1 0.2 0.3 0.4 0.5 0.6
% o
f spl
een
w
eigh
(gm
)
25
35
45
55
Sple
en le
ngth
(mm
) *
1 2 3 4
† †
† † †
†
† †
† †
† †
-27-
-
Fig. 6. Mass-forming lesion’s (MFL) prevalence, intensity and gross view. A,
Prevalence; B, Intensity; C, Gross view of liver after 16 weeks of infection (1-
4 represents 4 hamster groups respectively); D, Serial section (2-4 mm) of
10% formalin fixed liver showing MFL (arrows); E, MFL observed after
sectioning gross liver which was not visible from outside (Bar = 5 mm).
0
5
10
15
20
No.
of m
ass
form
ing
lesi
on
0
25
50
75
100
Prev
alen
ce o
f MFL
(%)
A †
1 2
3 4
B
C D
E
†
-28-
-
Fig. 7. H&E staining of the liver sections in different groups of hamsters
(x100). Normal hepatic cells and biliary triad observed in control group,
proliferated bile duct, periductal fibrosis, inflammatory cells observed in Cs
group, NDMA group showed normal biliary triad where as Cs+NDMA group
showed highly proliferated bile cells in a fibrous stroma leading to CCA.
16
wee
ks
12
wee
ks
8 w
eeks
4
wee
ks
Ctrl.
Cs
NDMA
Cs+NDMA
-29-
-
Fig. 8. Masson’s trichrome, Sirius red and proliferative cell nuclear antigen
(PCNA) staining of liver in different groups of hamsters after 16 weeks of
infection (x100). Control and NDMA liver showed traces of collagen fibers
(blue and red for Masson’s trichrome and Sirius red staining respectively)
around the biliary triad artery, C. sinensis infected group showed collagen
fibers around the bile duct, however, dense collagen fibers observed in
Cs+NDMA group. PCNA was strongly positive for Cs+NDMA group.
Ctrl.
Cs
NDMA
Cs+NDMA
PCN
A
S
iriu
s re
d
M
asso
n’s
tri
chro
me
-30-
-
Fig. 9. Semiquantitative non-neoplastic histopathological changes in different
groups of hamsters. A, inflammation; B, bile duct hyperplasia; C, periductal
fibrosis; D, egg granuloma; E, abscess; F, cholangiofibrosis. Significantly
higher level of inflammation, bile duct hyperplasia, periductal fibrosis, and
abscess observed in Cs group compared to NDMA and Cs+NDMA groups.
% o
f tot
al ti
ssue
s ar
ea
% o
f tot
al ti
ssue
s ar
ea
% o
f tot
al ti
ssue
s ar
ea
A B
C D
E F
Ctrl. Cs NDMA Cs+NDMA Ctrl. Cs NDMA Cs+NDMA
*
*
† †
† †
†
†
† †
†
-31-
-
Fig. 10. Semiquantitative neoplastic histopathological changes in different
groups of hamsters (A). WDC, well differentiated CCA; MDC, moderately
differentiated CCA; and PDC, poorly differentiated CCA. All forms of
CCA observed in Cs+NDMA group. Histopathological views of CCA
(x400): B, WDC; C, MDC; and D, PDC. Nuclear polymorphism of bile
cells noted in Fig. B.
% o
f tot
al ti
ssue
s
WDC MDC PDC
A B
C D
-32-
-
Fig. 11. Cellular changes among the groups of hamsters. A-B, Mucin secreting
cell metaplasia; C-D, mitotic figures; E-F, hepatic cell nuclear/glycogen
inclusion; G-H, bile cell nuclear/glycogen inclusion (histological section’s
original magnification x400). Significant increase of mucin secreting cells and
mitotic figures are noted in Cs+NDMA group. HPF = high power field.
† †
No.
of c
ells
/ se
ctio
n N
o. o
f cel
ls/
sect
ion
No.
of c
ells
/10
HPF
N
o. o
f cel
ls/
10 H
PF B A
D C
F E
H G
† †
†
† † †
†
-33-
-
A
B
C M N 1 2 3 4 5 6 7
Fig. 12. Real-time PCR using SYBR Green I DNA binding dye. A,
amplification curve with negative RT product; B, melting peak chart of same
amplified sample; and C, agarose gel electrophoresis of same PCR product for
the confirmation of single bands (M = 100 bp molecular DNA marker, N = -
RT negative control, 1-7 samples).
-34-
N
N
Samples
Samples
-
Fig. 13. Relative expression of oncogenesis related genes by real-time PCR.
Significant changes in the expression of gankyrin, p16INK4, CDK4, p53
genes observed in the tumor tissues (Cs+NDMA-T).
0
1
2
3
0
10
20
30
40
50
0
5
10
15
20
0
1
2
3
Gankyrin p16INK4
CDK4 p53
*
* *
†
*
*
* * *
*
0
1
2
3
4
0
2
4
6
8
0
1
2
3
4
BAX Akt/PKB
RB1
* *
*
*
Fold
cha
nges
of m
RNA
exp
ress
ion
rela
tive
to
GA
PDH
-35-
-
Fig. 14. Relative expression of oncogenesis related proteins by western blot
analysis. To determine the band density NIH ImageJ software were used. Top
left figure showed the western blot (WB) bands of representative proteins.
0
1
2
3
0
1
2
3
0
1
2
3
0
1
2
3
0
1
2
3
0
1
2
3
CDK4
p53
Akt1
RB
E2F1 VEGF
* * *
†
Rela
tive
expr
essi
on o
f pro
tein
s co
mpa
red
to A
ctin
and
GA
PDH
43
34
62
53
110
42
60
Ctr
l.
Cs
N
DM
A
Cs+
ND
MA
KDa
Actin
CDK4
Akt1
p53
RB
VEGF
E2F1
GAPDH 37
Rela
tive
expr
essi
on o
f pro
tein
s co
mpa
red
to A
ctin
and
GA
PDH
WB bands
-36-
-
Groups Upregulation Downregulation Unchanged
Cs Gankyrin
p16INK4
RB VEGF
E2F1
NDMA Akt/PKB
p53
BAX
VEGF
E2F1
Cs+NDMA Gankyrin
p16INK4
CDK4
BAX
Akt1
RB
p53
VEGF
E2F1
Regulation of genes in different groups of hamster
relative to the control group
Fig. 15. Relative expression of oncogenesis related genes/proteins by real-time
PCR and/or western blot analysis (A). B, Simplified signal transduction
pathway showing the interaction of proteins (dotted lines has been affected
in the present study).
A
-37-
Gene regulation
Cell proliferation
p53
E2F
CDK4
RB
Gankyrin
Apoptosis
p16
Bad
Akt/PKB
B G
anky
rin
-
-38-
Discussion
CCA is a malignant disease of the biliary system which is difficult to
diagnose and mechanism little understood. In the present study, USG detected
MFLs as early as the 6th week of infection, which is novel in the CCA animal
model and showed a prevalence rate of 77.3% after 16 weeks. Enhanced MRI
supported the findings of USG. C. sinensis infection with or without NDMA
treatment caused significant weight loss in the animals accompanied with
hepatomegaly and splenomegaly. Whole liver examination through 2-4 mm
slicing detected CCA in all animals of the Cs+NDMA group thus the
prevalence reached as high as 100% which is also a novel finding.
Histopathology observed different kinds of non-neoplastic changes frequently
in the Cs and rarely in the NDMA group. On the other hand, different grades
of CCA were observed in the Cs+NDMA group, and well developed type
composed about 22% of total tissue area. CCA stroma largely consisted of
dense collagen fibers and abundant proliferative cell nuclear antigen (PCNA)
detected by immunohistochemistry. Gene expression analysis revealed a
newly upregulated oncogene gankyrin for CCA. Beside this, downregulation
of p53 gene, RB protein with the upregulation of CDK4 were also evident
from the current study.
In the present study, USG was able to distinguish the Cs and Cs+NDMA
groups from the control just after 2 weeks. After 4 weeks, all of the groups
were identifiable. The 1st MFL appeared at the 6th week in the Cs+NDMA
-
-39-
group which was confirmed as CCA at the 8th week by histopathology. At 16th
week single or multiple MFLs was observed in 77.3% hamsters of the Cs+
NDMA group. There were no studies in the present moment which detected
the CCA mass as early as the 6th week. A slightly similar study done only by
Plengsuriyakarn et al. (2012) using O. viverrini-NDMA mediated hamster
CCA model. They observed the hamsters after 20 weeks of infection by USG
and found sediments in GB, thickening of GB wall, and hypoechogenicity of
liver parenchyma cells in O. viverrini+NDMA group but MFLs was not
described. Consistently increased size of MFLs (Fig. 3) from the 6th week to
onward suggests the usefulness of USG for the diagnosis, prognosis and
monitoring of CCA. This finding also agrees with the study of Bloom et al.
(1999) which suggested USG for hepatocellular diseases and CCA. Other
findings like thickening and/or sedimentation of the gall bladder (GB) and
dilatation of bile duct were observed both in the Cs and Cs+NDMA groups.
These were more intense in the Cs+NDMA group which agreed with those of
Hong et al. (1994) and Plengsuriyakarn et al. (2012). Moreover, echogenic
debris and cystic changes frequently occurred in the Cs+NDMA group. Thus
USG is useful to determine the synergistic effect of Cs and NDMA in hamster
model.
MRI was used to monitor the progression of CCA and liver cancer both in
humans and animals (Ustundag and Bayraktar, 2008; Manfredi et al., 2004;
Vanderveen and Hussain, 2004; Petre et al., 1996). The current study used
MRI for the better visualization of the MFL and found in agreement with
-
-40-
USG. MRI detected MFL at the same 6th week, moreover, it has detected a
cyst in the Cs+NDMA group in addition. As time progressed the MFLs took
the lobulated shape which was observed by a number of studies previously
done on humans (Hwang et al., 2012; Maetani et al., 2001; Vilgrain et al.,
1997; Choi et al., 1995). As the CCA grew along the intrahepatic bile duct it
had a tendency to form satellite tumors resulting lobulated shape (Lim, 2003).
Hypointensed areas were observed in T2WI in both Cs and Cs+NDMA
hamsters in the present study. Such hypointensed area reflected the
complexity of fibrosis (Maetani et al., 2001). The difference of hypointensity
may be due to the level of fibrosis around the bile ducts or tumor tissues.
Minimal rim-enhancement of MFL agreed with findings of Hwang et al.
(2012). Therefore the present study suggests use of both USG and MRI for
the detection of cancerous lesions as suggested previously by Kuroki-Suzuki
et al. (2011).
Loss of body weight was measured as an assessment of disease
progression. Among the 4 groups, the highest weight loss was observed
(24.8%) in the Cs+NDMA group. Such weight loss may be related with the
progression of CCA (Nourissat et al., 2010; Chen et al., 2010). The present
study observed moderate hepatomegaly and splenomegaly in the Cs group
and severe in the Cs+NDMA group. In Cs+NDMA group, 88.6% weight of
the liver and 255.2% weight of spleen were increased. Hepatomegaly and
splenomegaly with the infection of the liver fluke was reported in previous
studies as well (Kaewpitoon et al., 2008; Lee et al., 1993). The hepatomegaly
-
-41-
must have been an outcome of inflammation, collagen deposition, and
neoplasm. The splenomegaly might be caused by hepatomegaly.
The Syrian golden hamster is the only known model of CCA by C.
sinensis. One previous study (Lee et al., 1994) detected CCA in about 73%
hamsters infected with C. sinensis after 13 weeks along with NDMA
administration, however, in present study CCA developed in all hamsters of
Cs+NDMA group after 16 weeks. There are several reasons for this different
finding, most importantly, the duration, dose of NDMA and number of C.
sinensis metacercariae. Lee et al. (1994) treated hamsters for 4 weeks with a
dose of 15 ppm NDMA instead of 8 weeks with 12.5 ppm NDMA. The
author also used a lower dose of metacercariae. In the present investigation,
beside higher dose of metacercariae and longer period of NDMA treatment, a
2-4 mm slicing of the formalin fixed liver had increased the prevalence rate of
CCA. One hamster of the NDMA group developed CCA in a tiny portion of
the liver (0.57 % of total tissue area). Though the average area of CCA is
negligible it suggested that there is a possibility of developing CCA in
NDMA treated group if the 12.5 ppm dose continued for 8 weeks and the
hamsters is kept for 16 weeks or more. The intensity of MFLs in the present
study was 10.92 ± 5.76 in the Cs+NDMA group which was not described in
any earlier studies (Plengsuriyakarn et al., 2012; Songserm et al., 2009; Lee et
al., 1994; Lee et al., 1993). Thus a dose of 30 C. sinensis metacercariae and
12.5 ppm NDMA for 8 weeks can cause 100% CCA in Syrian goldern
hamster.
-
-42-
Histopathological findings confirmed CCA in all hamsters of Cs+NDMA
group and 1 hamster of NDMA group. Grading of CCA in the present study
revealed well differentiated in 21.8% ± 1.5%, moderately differentiated in
13.3% ± 1.3%, and poorly differentiated type in 10.8% ± 1.3% of total tissue
area of the Cs+NDMA group. The present hamster model is promising to
develop CCA of various differentiations. In the Cs group, C. sinensis caused
inflammation, bile duct hyperplasia, periductal fibrosis, egg granuloma,
metaplasia and cholangiofibrosis. Those findings were compatible with
descriptions of previous studies (Hong and Fang, 2012). The Cs group also
showed papillary biliary hyperplasia with no neoplastic lesion which was
regarded as typical histological feature in C. sinensis infection of humans
(Kim et al., 1999). Papillary biliary hyperplasia was found in 60% surgical
cases by Jung et al. (2008). Inflammation was severe comprising 34.3% ±
3.6% of total tissue area in the Cs group, but it was 4.9% ± 0.5% in the
Cs+NDMA group. Other histopathological aspects such as bile duct
hyperplasia, periductal fibrosis, egg granuloma were also found in less intense
in the Cs+NDMA group than in the Cs group. In the NDMA group, very little
histopathological changes occurred. A similar finding observed in case of O.
viverrini infection with nitrosamine (Boonmars et al., 2009; Kakar and
Burgart, 2005). At earlier stage of infection, both Cs and Cs+NDMA groups
showed such type of pathogenicity almost equally as revealed by imaging and
histopathology. However, due to the synergistic effect of C. sinensis and
NDMA, the hyperplastic and fibrotic portion around the bile duct gradually
-
-43-
changed into adenocarcinoma like appearance. This type of synergism is
evident from nitrosamine and fluke infections (Thamavit et al., 1987, 1993;
Lee et al., 1993; Flavel and Lucas, 1983). The immuno-suppressive behavior
of neoplastic cells might be responsible for less inflammation around it. This
may be a topic of further study.
Masson’s trichrome staining was used previously to detect metastasis of
colon carcinoma to the liver as well as myofibroma (Ichihara et al., 2010;
Chang and Kessler, 2008). In the present study, abundant collagen fibers were
observed in and around the CCA tissue. Among the collagen fibers, type I
was abundant as revealed by Sirius red staining. Abundance of type I collagen
also observed in squamous cell carcinoma and liver fibrosis (Martins et al.,
2003; Li et al., 2009). This finding suggests that the composition of CCA
stroma largely consists of collagen fibers specially type I.
In the present study, the number of metaplastic cells in the tissue sections
increased about 7 times more in the Cs+NDMA group than in the Cs group
and about 5 times more than in the NDMA group. The mitotic figure is one of
the important characteristics of carcinogenic tissue. In the present study, 22 ±
2.3 mitotic figures were observed per histologic section in the Cs+NDMA
group while it was only 4.3 ± 1.4 per section in the Cs group suggesting the
synergistic nature of Cs and NDMA. Mitotic figures suggest the abundance of
PCNA. Present study observed a strong positive reaction against PCNA
antibody in and around the tumor tissue. This type of strong positivity of
PCNA was also observed in case of hamster buccal pouch cancer (Nagini et
-
-44-
al., 2009). Thus PCNA may be a candidate marker molecule of CCA in
clonorchiasis patients. It should be evaluate further.
Several studies showed the involvement of several oncogenesis related
genes in O. viverrini and NDMA mediated CCA in hamster model (Wu et al.,
2011; Boonmars et al., 2010; Boonmars et al., 2008; Loilome et al., 2006;
Sithithaworn et al., 2002). In the present study, a novel oncogene for CCA
named gankyrin was upregulated in the Cs+NDMA group tumor tissue,
however, it was unchanged in adjacent normal tissue. The upregulation of
gankyrin is evident from different type of cancer including endometrial
carcinoma, breast cancer and colo-rectal cancer (Zhang et al., 2012; Zhen et
al., 2012; Tang et al., 2010). Apoptosis related genes, Akt/PKB and BAX were
found to be upregulated in early infection with O. viverrini, a closely related
parasite of C. sinensis (Boonmars et al., 2008). However, there were no data
regarding long term infection. The present study showed increased expression
of BAX after 16 weeks of infection. Tumor suppressor genes, RB1 and
p16INK4 were downregulated in earlier studies with O. viverrini (Boonmars
et al., 2009). In contrast, both RB1 and p16INK4 were upregulated in the
Cs+NDMA group of the present study. However, expression of RB protein
was significantly decreased in western blot analysis, which suggested possible
mutation in RB1 gene or break down of RB protein after expression. Such
mutated RB gene can cause overexpression of p16INK4 (Witkiewicz et al.,
2011; Sasaki et al., 2012). Study also suggests association of gankyrin with
the degradation of RB protein (Li et al., 2011). Overexpression of p16INK4
-
-45-
was also observed in cervical intraepithelial neoplasia (Jentschke et al., 2012).
Gene p53 plays an important role in both tumor suppression and apoptosis.
Previous studies found the more expression of p53 in case of early infection
of O. viverrini (Boonmars et al., 2008; Nagini et al., 2009; Boonmars et al.,
2008). After long term infection with C. sinensis and NDMA treatment, p53
gene was downregulated in this study. Beside p53 gene, cell cycle related
gene CDK4 was upregulated significantly. Western blot analysis of proteins
Akt1, CDK4 and p53 were compatible with mRNA expression by real-time
PCR.
At present it can be concluded that MFLs appear as early as 6 weeks
after infection and combination of USG and MRI is helpful to monitor the
disease progression in the hamster model. C. sinensis alone or with NDMA
causes significant weight loss and hepato-splenomegaly. A slightly higher
dose of C. sinensis and 2-4 mm manual slicing of fixed liver can increase the
rate of CCA in hamster model. Non neoplastic changes caused by C. sinensis
replaced with CCA as time progressed. The CCA stroma mostly characterized
by the presence of collagen fibers, mucin secreting cells, mitotic figures and
PCNA. Upregulated oncogene gankyrin and cell cycle related gene CDK4
with dowregulated tumor suppressor gene p53 and RB protein plays an
important role in the process of cholangiocarcinogenesis. Excessive mRNA
expression of p16INK4 and increased PCNA may be useful marker candidates
for diagnosis or prognosis of CCA in clonorchiasis.
-
-46-
References
American Cancer Society (2007) Report sees 7.6 million global 2007 cancer
deaths. Reuters. http://www.reuters.com/article/healthNews/idUSN-
16330649 20071217
Bhamarapravati N, Thamavit W, Vajrasthira S (1978) Liver changes in
hamsters infected with a liver fluke of man, Opisthorchis viverrini.
Am Soc Trop Med Hyg 27:787-94
Blaser MJ, Atherton J (2004) Helicobacter pylori persistence: biology and
disease. J Clin Invest 113:321–33
Bloom CM, Langer B, Wilson SR (1999) Role of US in the detection,
characterization, and staging of cholangiocarcinoma. Radiographics
19:1199-218
Boonmars T, Srirach P, Kaewsamut B, Srisawangwong T, Pinlaor S, Pinlaor
P, Yongvanit P, Sithithaworn P (2008) Apoptosis-related gene
expression in hamster opisthorchiasis post praziquantel treatment.
Parasitol Res 102:447–55
Boonmars T, Wu Z, Boonjaruspinyo S, Pinlaor S, Nagano I, Takahashi Y,
Kaewsamut B, Yongvanit P (2009) Alterations of gene expression of
RB pathway in Opisthorchis viverrini infection-induced
cholangiocarcinoma. Parasitol Res 105:1273–81
-
-47-
Boonmars T, Wu Z, Boonjaruspinyo S, Puapairoj A, Kaewsamut B, Nagano
I, Pinlaor S, Yongvanit P, Wonkchalee O, Juasook A, Sudsarn P,
Srisawangwong T (2011) Involvement of c-Ski oncoprotein in
carcinogenesis of cholangiocacinoma induced by Opisthorchis
viverrini and N-nitrosodimethylamine. Pathol Oncol Res 17:219-27
Bouvard V, Baana R, Straifa K, Grosse Y, Secretan B, El Ghissassi F,
Benbrahim-Tallaa L, Guha N, Freeman C, Galichet L, Cogliano V
(2009) A review of human carcinogens – part B: biological agents.
Lancet Oncol 10:321–2
Butel J (2000) Viral carcinogenesis: revelation of molecular mechanisms and
etiology of human disease. Carcinogenesis 21:405–26
Cancer Research UK (2007) UK cancer incidence statistics by age.
http://info.cancerresearchuk.org/cancerstats/incidence/age/. Retrieved
2007-06-25
Chang JY, Kessler HP. (2008) Masson trichrome stain helps differentiate
myofibroma from smooth muscle lesions in the head and neck
region. J Formos Med Assoc. 107:767-73
Chang KW, Mangold KA, Hubchak S, Laconi S, Scarpelli DG (1994)
Genomic p53 mutation in a chemically induced hamster pancreatic
ductal adenocarcinoma. Cancer Res 54:3878-83
Chen SP, Peng LN, Lin MH, Lai HY, Hwang SJ, Chen LK (2010) Evaluating
probability of cancer among older people with unexplained,
unintentional weight loss. Arch Gerontol Geriatr. 50 Suppl 1:S27-9
http://www.ncbi.nlm.nih.gov/pubmed?term=Chang%20JY%5BAuthor%5D&cauthor=true&cauthor_uid=18926943http://www.ncbi.nlm.nih.gov/pubmed?term=Kessler%20HP%5BAuthor%5D&cauthor=true&cauthor_uid=18926943http://www.ncbi.nlm.nih.gov/pubmed/18926943http://www.ncbi.nlm.nih.gov/pubmed/20171452http://www.ncbi.nlm.nih.gov/pubmed/20171452http://www.ncbi.nlm.nih.gov/pubmed/20171452
-
-48-
Choi BI, Han JK, Shin YM, Baek SY, Han MC (1995) Peripheral
cholangiocarcinoma: comparison of MRI with CT. Abdom
Imaging 20: 357–60
Choi D, Hong ST, Li S, Chung BS, Lim JH, Lee SH (2004) Bile duct changes
in rats reinfected with Clonorchis sinensis. Korean J Parasitol 42:7-17
Ferlay J, Bray F, Pisani P, Parkin DM, Ferlay J (2001) Globocan 2000:
Cancer Incidence, Mortality and Prevalence Worldwide. IARC
Cancer Base No. 5. Lyon, Fr.: IARC
Flavell DJ, Lucas SB (1983) Promotion of nitrosodimithylamine initiated bile
duct carcinogenesis in the hamster by the human liver fluke,
Opisthorchis viverrini. Carcinogenesis 4:927-30
Hong ST, Fang Y (2012) Clonorchis sinensis and clonorchiasis, an
update. Parasitol Int 61:17-24
Hong ST, Park KH, Seo M, Choi BI, Chai JY, Lee SH (1994) Correlation of
sonographic findings with histopathological changes of the bile ducts
in rabbits infected with Clonorchis sinensis. Korean J
Parasitol 32:223-30
Hwang J, Kim YK, Park MJ, Lee MH, Kim SH, Lee WJ, Rhim HC
(2012) Differentiating combined hepatocellular
and cholangiocarcinoma from mass-forming
intrahepatic cholangiocarcinoma using gadoxetic acid-enhanced
MRI. J Magn Reson Imaging 36:881-9
http://www.ncbi.nlm.nih.gov/pubmed?term=Hong%20ST%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20KH%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Seo%20M%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Choi%20BI%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Chai%20JY%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20SH%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed/7834239http://www.ncbi.nlm.nih.gov/pubmed/7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20YK%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20MH%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20SH%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20WJ%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Rhim%20HC%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed/22730271
-
-49-
Ichihara H, Funamoto K, Matsushita T, Matsumoto Y, Ueoka R (2010)
Histological bioanalysis for therapeutic effects of hybrid liposomes
on the hepatic metastasis of colon carcinoma in vivo. Int J
Pharm 394:174-8
Ishak KG, Anthony PP, Sobin LH (1994) Histological typing of tumours of
the liver. In: WHO International Histological Classification of
Tumors. Berlin: Springer Verlag pp37–45
Jemal A, Center MM, DeSantis C, Ward EM (2010) Global patterns of cancer
incidence and mortality rates and trends. Cancer Epidemiol
Biomarkers Prev 19:1893-907
Jentschke M, Lange V, Soergel P, Hillemanns P (2012) Enzyme-linked
immunosorbent assay for p16(INK4a) - a new triage test for the
detection of cervical intraepithelialneoplasia? Acta Obstet Gynecol
Scand. doi: 10.1111/aogs.12032. [Epub ahead of print]
Jung MY, Shin HR, Lee CU, Sul SY, Lee SW, Park BC (1993) A study of
the ratio of hepatocellular carcinoma over cholangiocarcinoma and
their risk factors. J Pusan Med Assoc 29:29-37
Jung KT, Hong SM, Lee KT, Lee JG, Choi SH, Heo JS, Choi DW, Choi D,
Lim JH (2008) Intraductal papillary neoplasm of the bile duct
associated with Clonorchis sinensis infection. Virchows Arch
453:589-98
http://www.ncbi.nlm.nih.gov/pubmed?term=Ichihara%20H%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Funamoto%20K%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Matsushita%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Matsumoto%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Ueoka%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed/20471463http://www.ncbi.nlm.nih.gov/pubmed/20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Jentschke%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Lange%20V%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Soergel%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Hillemanns%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed/23072258http://www.ncbi.nlm.nih.gov/pubmed/23072258
-
-50-
Kaewpitoon N, Kaewpitoon SJ, Pengsaa P (2008) Opisthorchiasis in
Thailand: review and current status. World J Gastroenterol 14:2297-
302
Kakar S and Burgart LJ (2005) Tumors of the biliary system. Curr Diagn
Pathol 11:34-43
Kim KH, Kim CD, Lee HS, Lee SJ, Jeen YT, Chun HJ, Song CW, Lee SW,
Um SH, Choi JH, Ryu HS, Hyun JH (1999) Biliary papillary
hyperplasia with clonorchiasis resembling cholangiocarcinoma. Am J
Gastroenteron 94:514-7
Kim YJ, Choi MH, Hong ST, Bae YM (2008) Proliferative effect of
excretory/secretory products from Clonorchis sinensis on the human
epithelial cell line HEK293 via regulation of the transcription factor
E2F1. Parasitol Res 102:411-7
Kitahashi T, Tsujiuchi T, Satoh K, Ohtsuki K, Konishi Y and Tsutsumi M
(2004) Aberrant transcription of FHIT gene in intrahepatic
cholangiocellular carcinomas induced by N-nitrosobis(2-
oxopropyl)amine in hamsters. Exp toxicol pathol 56:153-7
Kuroki-Suzuki S, Kuroki Y, Nasu K, Nagashima C, Machida M, Muramatsu
Y, Moriyama N (2011) Pancreatic cancer screening employing
noncontrast magnetic resonance imaging combined with
ultrasonography. Jpn J Radiol 29:265-71
Lee JH, Rim H J, Sell S (1997) Heterogeneity of the ‘oval-cell’ response in
the hamster liver during cholangiocarcinogenesis following
http://www.ncbi.nlm.nih.gov/pubmed?term=Kaewpitoon%20N%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed?term=Kaewpitoon%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed?term=Pengsaa%20P%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed/18416453http://www.ncbi.nlm.nih.gov/pubmed/21607840http://www.ncbi.nlm.nih.gov/pubmed/21607840http://www.ncbi.nlm.nih.gov/pubmed/21607840
-
-51-
Clonorchis sinensis infection and dimethylnitrosamine treatment. J
Hepatol 26:1313–23
Lee JH, Rim HJ, Bak UB (1993) Effect of Clonorchis sinensis infection and
dimethylnitrosamine administration on the induction of
cholangiocarcinoma in Syrian golden hamsters. Korean J Parasitol
31:21-30
Lee SH, Shim JS, Lee SM, Chi JG (1978b) Studies on pathological changes
of the liver in albino rats infected with Clonorchis sinensis. Korean J
Parasitol 16:148-55
Lee YS, Lee SH, Chi JG (1978a) Ultrastructural changes of the hepatocytes
and biliary epithelia due to Clonorchis sinensis in guinea pigs.
Korean J Parasitol 16:188-102
Lee JH, Yang HM, Bak UB, Rim HJ (1994 ) Promoting role
of Clonorchis sinensis infection on induction of cholangiocarcinoma
during two-step carcinogenesis. Korean J Parasitol 32:13-8
Li J, Knobloch TJ, Kresty LA, Zhang Z, Lang JC, Schuller DE, Weghorst
CM (2011) Gankyrin, a biomarker for epithelial carcinogenesis, is
overexpressed in human oral cancer. Anticancer Res 31:2683-92
Li YL, Wu J, Wei D, Zhang DW, Feng H, Chen ZN, Bian H (2009)
Newcastle disease virus represses the activation of human hepatic
stellate cells and reverses the development of hepatic fibrosis in
mice. Liver Int 29:593-602
http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20HM%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Bak%20UB%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Rim%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed/8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Knobloch%20TJ%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Kresty%20LA%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Lang%20JC%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Schuller%20DE%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Weghorst%20CM%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Weghorst%20CM%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed/21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20YL%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Wu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Wei%20D%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20DW%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Feng%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Chen%20ZN%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Bian%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed/19192169
-
-52-
Lim JH (2003) Cholangiocarcinoma: morphologic classification according to
growth pattern and imaging findings. Am J Roentgenol 181:819-27
Loilome W, Yongvanit P, Wongkham C, Tepsiri N, Sripa B, Sithithaworn
P, Hanai S, Miwa M (2006) Altered gene expression in Opisthorchis
viverrini-associated cholangiocarcinoma in hamster model. Mol
Carcinog 45:279-87
Maetani Y, Itoh K, Watanabe C, Shibata T, Ametani F, Yamabe H, Konishi
J (2001) MR imaging of intrahepatic cholangiocarcinoma with
pathologic correlation. AJR Am J Roentgenol 176:1499–1507
Manfredi R, Barbaro B, Masselli G, Vecchioli A, Marano P (2004) Magnetic
resonance imaging of cholangiocarcinoma. Semin Liver Dis 24:155-
64
Martins GB, Reis SR, Silva TM (2003) Collagen type I expression in
squamous cell carcinoma of the oral cavity. Pesqui Odontol Bras
17:82-8
Min HK, Han WS (1985) Bile duct changes in albino rats experimentally
infected with Clonorchis sinensis. Ewha Med J 8:111-5
Nagini S, Letchoumy PV, A T, Cr R (2009) Of humans and hamsters: a
comparative evaluation of carcinogen activation, DNA damage, cell
proliferation, apoptosis, invasion, and angiogenesis in oral cancer
patients and hamster buccal pouch carcinomas. Oral Oncol 45:e31-7.
Najm I, Trussell RR (2001) NDMA Formation in Water and
Wastewater. Journal of American Water Works Association 93: 92–9
http://www.ncbi.nlm.nih.gov/pubmed?term=Loilome%20W%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Yongvanit%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Wongkham%20C%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Tepsiri%20N%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sripa%20B%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sithithaworn%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sithithaworn%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Hanai%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Miwa%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed/16550611http://www.ncbi.nlm.nih.gov/pubmed/16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Martins%20GB%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Reis%20SR%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Silva%20TM%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed/12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Nagini%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=Letchoumy%20PV%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=A%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=Cr%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed/19250857http://apps.awwa.org/WaterLibrary/showabstract.aspx?an=JAW_0053373http://apps.awwa.org/WaterLibrary/showabstract.aspx?an=JAW_0053373
-
-53-
Nourissat A, Bairati I, Samson E, Fortin A, Gélinas M, Nabid A, Brochet F,
Têtu B, Meyer F (2010) Predictors of weight loss during radiotherapy
in patients with stage I or II head and neck cancer. Cancer 116:2275-
83
Oliviera DE (2007) DNA viruses in human cancer: an integrated overview on
fundamental mechanisms of viral carcinogenesis. Cancer Lett
247:182–96
Olnes MJ, Erlich R (2004) A review and update on cholangiocarcinoma.
Oncology 66:167–79
Parkin DM (2001) Global cancer statistics in the year 2000. Lancet Oncol
2:533–43
Petré C, Ni Y, Marchal G, Yu J, Wevers M, Lauffer RB, Baert AL (1996)
Detection and characterization of primary liver cancer in rats by MS-
264-enhanced MRI. Magn Reson Med 35:532-9
Pisani P, Bray F, Parkin DM (2002) Estimates of the world-wide prevalence
of cancer for 25 sites in the adult population. Int J Cancer 97:72–81
Pisani P, Parkin DM, Bray F, Ferlay J (1999) Estimates of the worldwide
mortality from 25 cancers in 1990. Int J Cancer 83:18–29
Plengsuriyakarn T, Eursitthichai V, Labbunruang N, Na-Bangchang
K, Tesana S, Aumarm W, Pongpradit A, Viyanant V
(2012) Ultrasonography as a tool for monitoring the development and
progression of cholangiocarcinoma in Opisthorchis viverrini/
http://www.ncbi.nlm.nih.gov/pubmed/20187097http://www.ncbi.nlm.nih.gov/pubmed/20187097http://www.ncbi.nlm.nih.gov/pubmed?term=Petr%C3%A9%20C%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Ni%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Marchal%20G%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Yu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Wevers%20M%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Lauffer%20RB%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Baert%20AL%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed/8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Plengsuriyakarn%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Eursitthichai%20V%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Labbunruang%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Na-Bangchang%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Na-Bangchang%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Tesana%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Aumarm%20W%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Pongpradit%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Viyanant%20V%5BAuthor%5D&cauthor=true&cauthor_uid=22502719
-
-54-
dimethylnitrosamine-induced hamsters. Asian Pac J Cancer
Prev 13:87-90
Sandhu DS, Shire AM, Roberts LR (2007) Epigenetic DNA hypermethylation
in cholangiocarcinoma: potential roles in pathogenesis, diagnosis and
identification of treatment targets. Liver Int 28:12-27
Sasaki M, Matsubara T, Yoneda N, Nomoto K, Tsuneyama K, Sato
Y, Nakanuma Y (2012) Overexpression of enhancer of zeste homolog
2 and MUC1 may be related to malignant behaviour in intraductal
papillary neoplasm of the bile duct. Histopathology. doi:
10.1111/his.12016. [Epub ahead of print]
Schottenfeld D, Jennifer L, Beebe-Dimmer (2005) Advances in cancer
epidemiology: Understanding Causal Mechanisms and the Evidence
for Implementing Interventions. Annu Rev Public Health 26:37–60
Shin HR, Lee CU, Park HJ, Seol SY, Chung YM, Choi HC, Ahn YO,
Shigemastu T (1996) Hepatitis B and C Virus, Clonorchis sinensis for
the Risk of Liver Cancer: A Case-Control Study in Pusan, Korea. Int
J Epidemiol 25:933-40
Shin HR, Oh JK, Lim MK, Shin A, Kong HJ, Jung KW, Won YJ, Park S,
Park SJ, Hong ST (2010) Descriptive Epidemiology of
Cholangiocarcinoma and Clonorchiasis in Korea. J Korean Med Sci
25:1011-6
Shin HR, Won YJ, Jung KW, Kong HJ, Yim SH, Lee JK, Noh HI, Lee JK,
Pisani P, Park JG (2005) Nationwide cancer incidence in Korea,
http://www.ncbi.nlm.nih.gov/pubmed/22502719http://www.ncbi.nlm.nih.gov/pubmed/22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Sasaki%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Matsubara%20T%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Yoneda%20N%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Nomoto%20K%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Tsuneyama%20K%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Sato%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Sato%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Nakanuma%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed/23163606
-
-55-
1999–2001: First resulting using the national cancer incidence
database. Cancer Res Treat 37:325–31
Sithithaworn P, Ando K, Limviroj W, Tesana S, Pairojkul
C, Yutanawiboonchai W, Chinzei Y, Yoshida T, Sakakura T (2002)
Expression of tenascin in bile duct cancer of hamster liver by
combined treatment of dimethylnitrosamine with Opisthorchis
viverrini infections. J Helminthol 76:261-8
Songserm N, Prasongwattana J, Sithithaworn P, Sripa B, Pipitkool V
(2009) Cholangiocarcinoma in experimental hamsters with long-
standing Opisthorchis viverrini infection. Asian Pac J Cancer Prev
10:299-302
Srivatanakul P, Parkin DM, Jiang YZ (1991) The role of infection by
Opislhorchis viverrini. Hepatitis B virus, and aflatoxin exposure in