![Page 1: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/1.jpg)
Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben n-Alkanabbau des
Betaproteobakteriums Stamm HxN1
Dissertation zur Erlangung des
Grades eines Doktors der Naturwissenschaften
― Dr. rer. nat. ―
Dem Fachbereich Biologie/Chemie der
Universität Bremen
vorgelegt von
Kirsten Webner
Bremen 2012
![Page 2: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/2.jpg)
Die Untersuchungen zu der vorliegenden Doktorarbeit wurden von November 2008 bis
Januar 2012 am Max-Planck-Institut für marine Mikrobiologie in Bremen durchgeführt.
Erster Gutachter: Prof. Dr. Friedrich Widdel
Zweiter Gutachter: PD Dr. Jens Harder
Tag des Promotionskolloquiums: 16.03.2012
![Page 3: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/3.jpg)
Zusammenfassung
Das Betaproteobakterium Stamm HxN1 oxidiert n-Alkane einer Kettenlänge von C5 bis
C8 unter denitrifizierenden Bedingungen vollständig zu CO2. Die Aktivierung der
n-Alkane durch Addition an Fumarat wird vermutlich von dem Glycylradikalenzym
(1-Methylalkyl)succinat-Synthase katalysiert. Die (1-Methylalkyl)succinat-Synthase wird
von den mas Genen kodiert, die in Stamm HxN1 ein Operon aus sieben offenen
Leserahmen bilden.
Die in dieser Arbeit unternommenen Versuche die aus Stamm HxN1 gereinigte
(1-Methylalkyl)succinat-Synthase zu kristallisieren, blieben erfolglos. Es wurden
Anfangsstadien eines möglichen Proteinkristalls generiert, die jedoch für eine
Röntgenstrukturanalyse ungeeignet sind.
In dieser Arbeit wurde ein genetisches System für Stamm HxN1 entwickelt, mit dem
markierte Deletionsmutanten des Stammes hergestellt wurden. Durch die Deletion des
masD Gens, das die postulierte katalytische Untereinheit der (1-Methylalkyl)succinat-
Synthase kodiert, wurde ein zweites identisches mas Operon in Stamm HxN1
identifiziert. Die physiologische Charakterisierung der Mutante nach Deletion von masD
und masD´ bestätigte erstmals in vivo die Aktivierung von n-Alkanen unter anaeroben
Bedingungen durch die (1-Methylalkyl)succinat-Synthase. Die Deletion der masD Gene
verursachte polare Effekte auf die Transkription der benachbarten mas Gene, die die
kleinen Untereinheiten und die Aktivase der (1-Methylalkyl)succinat-Synthase kodieren.
Der Phänotyp wurde deshalb durch Komplementation mit dem gesamten mas Operon
wiederhergestellt.
Erste Hinweise auf die Regulation des anaeroben n-Alkanabbaus in Stamm HxN1
lieferten in dieser Arbeit durchgeführte Induktionsstudien auf verschiedenen
Wachstumssubstraten und Kohlenwasserstoffen. Es zeigte sich, dass die Induktion des
mas Operons durch n-Hexan auch in Gegenwart einer Carbonsäure oder eines Zuckers
als weitere verwertbare Kohlenstoffquelle stattfindet. Die Regulation erfolgt daher nicht
über Katabolitrepression. Des Weiteren wurde gezeigt, dass nicht nur die n-Alkane der
Kettenlänge von C5 bis C8, sondern auch länger- und kürzerkettige n-Alkane,
Cycloalkane, Aromaten und Alkohole als Induktoren der Expression des mas Operons
wirken. Die Induktion durch Kohlenwasserstoffe, die von Stamm HxN1 nicht vollständig
oder überhaupt nicht oxidiert werden, deutet auf die Regulation durch einen
unspezifischen Sensor hin.
![Page 4: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/4.jpg)
Summary
The betaproteobacterial strain HxN1 oxidizes n-alkanes with a chain length of C5 to C8
under denitrifying conditions completely to CO2. The n-alkanes are activated by addition
to fumarate. This reaction is presumably catalyzed by the glycyl radical enzyme
(1-methylalkyl)succinate synthase, whose encoding mas genes are organized in an
operon of seven open reading frames in strain HxN1.
In this study it was attempted to crystallize the (1-methylalkyl)succinate synthase, which
had been purified from strain HxN1. However, the obtained crystalline structures were
insufficient for X-ray analysis.
A genetic system for strain HxN1 that allowed the generation of deletion mutants of
strain HxN1 was developed in this thesis. The deletion of masD, which encodes the
postulated catalytic subunit of the (1-methylalkyl)succinate synthase, revealed the
presence of a second identical mas operon in strain HxN1. Following deletion of the
second masD gene, masD´, the physiological characterization of the ∆masD, ∆masD´
mutant confirmed in vivo the activation of n-alkanes under anaerobic conditions by the
(1-methylalkyl)succinate synthase. The deletion of the masD genes caused polar effects
onto the expression of the adjacent genes of the mas operon. The genes upstream and
downstream of masD encode the other subunits and the activating enzyme of the
(1-methylalkyl)succinate synthase. Therefore, the phenotype was restored by
complementation with the entire mas operon.
First hints regarding the regulation of the anaerobic n-alkane degradation in strain HxN1
were obtained in this thesis by investigating the induction of the mas operon by a set of
growth substrates and hydrocarbons. The induction of the mas operon by n-hexane was
not inhibited in the presence of a carboxylic acid or a sugar as second carbon source.
Thus, the mas operon is not regulated by catabolite repression. In addition, the range of
hydrocarbons, which induce the expression of the mas operon was analyzed. It was
shown that not only the growth substrates of strain HxN1, the n-alkanes from C5 to C8,
but also n-alkanes with a shorter or longer chain length, cyclic alkanes, aromatic
hydrocarbons and even alcohols induced expression. The induction of the mas operon
by several hydrocarbons, which are not a growth substrate for strain HxN1, points to the
regulation by an unspecific sensor.
![Page 5: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/5.jpg)
Inhaltsverzeichnis A Einleitung 1
1. Gesättigte Kohlenwasserstoffe 1
1.1 Systematik der Kohlenwasserstoffe 1
1.2 Physikalisch-chemische Eigenschaften und Reaktionen der Alkane 2
1.3 Entstehung und Vorkommen von Alkanen 4
2. Mikrobieller Abbau von n-Alkanen 7
2.1 Verfügbarkeit und Aufnahme von n-Alkanen 7
2.2 Aerober Abbau von n-Alkanen 7
2.3 Anaerober Abbau von n-Alkanen 8
3. Reaktionen, Proteine und Gene des anaeroben n-Alkanabbaus 10
3.1 n-Alkanaktivierung durch Addition an Fumarat 10
3.2 Glycyl- und SAM-Radikalenzyme 14
3.3 Benzylsuccinat- und (1-Methylalkyl)succinat-Synthase 16
3.4 Alternative anaerobe Aktivierungsmechanismen für n-Alkane 18
4. Stamm HxN1 als Modellorganismus für den anaeroben n-Alkanabbau 20
5. Zielsetzung der Arbeit 21
B Ergebnisse 22
1. Manuskript “Purification of the (1-methylalkyl)succinate synthase from 22
the Betaproteobacterium strain HxN1 revealed an unexpected fourth 22
subunit that is conserved in all investigated fumarate dependent 22
n-alkane activation enzymes” 23
2. Bericht “Attempts to crystallize (1-methylalkyl)succinate synthase 22
of strain HxN1 and alternative strategies for protein purification” 43
3. Manuskript “Identification of a second functional mas operon in the anaerobic 22
n-alkane degrader strain HxN1 by a newly developed genetic system” 63
4. Bericht “Construction and characterization of ∆masBCDE deletion 22
mutants of strain HxN1” 87
5. Manuskript “The (1-methylalkyl)succinate synthase of the n-alkane degrading 22
strain HxN1 is expressed under a wide range of carbon sources” 93
![Page 6: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/6.jpg)
C Gesamtübergreifende Diskussion und Ausblick 111
1. Die Bedeutung der (1-Methylalkyl)succinat-Synthase für den anaeroben 107
n-Alkanabbau 111
2. (1-Methylalkyl)succinat-Synthasen sind heterotetramere Glycylradikalenzyme 112
3. Verbreitung kataboler Gene in Kohlenwasserstoffabbauern 114
4. Regulation der mas Operone in Stamm HxN1 119
5. Ausblick: Kohlenwasserstoffabbauende Bakterien für die biologische 22
Sanierung 123
Referenzen für A und C 127
Danksagung 142
![Page 7: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/7.jpg)
1
A Einleitung 1. Gesättigte Kohlenwasserstoffe
Kohlenwasserstoffe sind organische Verbindungen, die ausschließlich aus Kohlenstoff
und Wasserstoff bestehen. Sie finden als Energiequelle, Lösungsmittel und Rohstoff der
chemischen Industrie Verwendung. Alle anderen organischen Verbindungen leiten sich
von ihnen ab, indem einzelne Wasserstoffatome durch funktionelle Gruppen ersetzt oder
interne Kohlenstoffmehrfachbindungen aufgebaut werden.
1.1 Systematik der Kohlenwasserstoffe
Anhand der Bindung zwischen zwei Kohlenstoffatomen werden Kohlenwasserstoffe
eingeteilt in gesättigte Kohlenwasserstoffe, die ausschließlich C–C Einfachbindungen
enthalten, ungesättigte Kohlenwasserstoffe, die mindestens eine Doppel- oder Dreifach-
bindung enthalten und aromatische Kohlenwasserstoffe, die konjugierte Doppel-
bindungen haben (Abb. 1).
Gesättigte Verbindungen sind Alkane, die als lineare n-Alkane oder ringförmige
Cycloalkane vorkommen und mit Alkylseitenketten substituiert sein können. n-Alkane mit
Alkylseitenketten werden als verzweigte Isoalkane bezeichnet. Die allgemeine
Summenformel für n-Alkane und Isoalkane lautet CnH2n+2, wobei für die Isoalkane n > 3
gilt. Das einfachste Alkan ist Methan (CH4). Eine Verlängerung um jeweils eine
Methylengrupppe (CH2) bildet die homologe Reihe der n-Alkane. Ab dem Butan (C4H10)
existiert für eine Summenformel mehr als eine Strukturformel, im Falle des Butans sind
dies die Konstitutionsisomere n-Butan und das verzweigte Isobutan (2-Methylpropan).
Cycloalkane haben die Summenformel CnH2n und bestehen aus mindestens drei
Kohlenwasserstoffen (n > 2). Auch sie bilden eine homologe Reihe, in dem das Molekül
um jeweils eine Methylengruppe verlängert wird.
Zu den ungesättigten Kohlenwasserstoffen gehören Alkene, als Verbindungen mit
Doppelbindungen, und Alkine, die Dreifachbindungen besitzen. Alkane, Alkene und
Alkine werden auch als aliphatische Kohlenwasserstoffe bezeichnet. Aromatische
Verbindungen enthalten mindestens einen aromatischen Ring mit konjugierten
Doppelbindungen. Dieser Benzolring ist bei Alkylbenzolen mit ein oder mehreren
Alkylseitenketten substituiert. Polyzyklische aromatische Kohlenwasserstoffe (PAK)
bestehen aus mehr als einem aromatischen Ring.
![Page 8: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/8.jpg)
Einleitung
2
n-Hexan 3-Hexen
3-Hexin
2-Methylpentan
Cyclohexan Methylcyclohexan
Benzol 2-MethylnaphthalinToluol
n-Hexan 3-Hexen
3-Hexin
2-Methylpentan
Cyclohexan Methylcyclohexan
Benzol 2-MethylnaphthalinToluol
Abb. 1 Strukturformeln von Kohlenwasserstoffen aus der Gruppe der n-Alkane (n-Hexan),
Isoalkane (2-Methylpentan), Cycloalkane (Cyclohexan, Methylcyclohexan), Alkene (3-Hexen),
Alkine (3-Hexin), Mono- (Benzol, Toluol) und Polyzyklischen Aromaten (2-Methylnaphthalin).
1.2 Physikalisch-chemische Eigenschaften und Reaktionen der Alkane
Die physikalisch-chemischen Eigenschaften von Alkanen sind abhängig von der
Molekülgröße. Die Dichte nimmt mit steigender molarer Masse zu (Abb. 2). Auch der
Aggregatzustand von n-Alkanen wird bestimmt durch die Molekülgröße. Kurzkettige
n-Alkane mit einer Kettenlänge von C1 bis C4 sind unter Normalbedingungen gasförmig.
Die n-Alkane von C5 bis C16 sind bei Raumtemperatur flüssig, während n-Alkane > C16
fest sind, da mit zunehmender Kettenlänge Schmelz- und Siedepunkte ansteigen
(Abb. 2). Je größer die Oberfläche des Moleküls ist, desto höher sind Schmelz- und
Siedepunkte, weil die van-der-Waals-Kräfte zwischen den einzelnen Molekülen stärker
sind (Vollhardt, 1990). Am Beispiel der Isomere des Hexans zeigt sich, dass die
verzweigten Isomere einen niedrigeren Siedepunkt als das unverzweigte n-Hexan
haben, weil sie eine geringere Oberfläche haben und die Moleküle sich nicht so dicht
zusammenlagern können wie die linearen n-Alkane (Abb. 2). Cyclohexan hingegen hat
einen höheren Siedepunkt als n-Hexan, weil in dem starren, symmetrischen zyklischen
System stärkere van-der-Waals-Kräfte wirken (Vollhardt, 1990). Die Löslichkeit von
![Page 9: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/9.jpg)
Einleitung
3
n-Alkanen in Wasser nimmt mit zunehmender Kettenlänge ab, da die Moleküle aufgrund
ihres zunehmenden hydrophoben Charakters unfähig sind, Wasserstoff-
Brückenbindungen auszubilden (Abb. 2).
n-Hex
an
2-Meth
ylpen
tan
3-Meth
ylpen
tan
2,2-D
imeth
ylbuta
n
2,3-D
imeth
ylbuta
n
Cycloh
exan
Sied
epun
kt [
°C ]
45
50
55
60
65
70
75
80
85
Anzahl der Kohlenstoffe im Molekül 1 2 3 4 5 6 7 8 9 10
Sie
depu
nkt [
°C
]
-200
-150
-100
-50
0
50
100
150
200
Anzahl der Kohlenstoffe im Molekül1 2 3 4 5 6 7 8 9 10
Dic
hte
[g m
l-1]
0,55
0,60
0,65
0,70
0,75
Anzahl der Kohlenstoffe im Molekül1 2 3 4 5 6 7 8 9 10
Lösl
ichk
eit [
g m
l-1]
0
10
20
30
40
50
60
70a)
c) d)
b)
n-Hex
an
2-Meth
ylpen
tan
3-Meth
ylpen
tan
2,2-D
imeth
ylbuta
n
2,3-D
imeth
ylbuta
n
Cycloh
exan
Sied
epun
kt [
°C ]
45
50
55
60
65
70
75
80
85
Anzahl der Kohlenstoffe im Molekül 1 2 3 4 5 6 7 8 9 10
Sie
depu
nkt [
°C
]
-200
-150
-100
-50
0
50
100
150
200
Anzahl der Kohlenstoffe im Molekül1 2 3 4 5 6 7 8 9 10
Dic
hte
[g m
l-1]
0,55
0,60
0,65
0,70
0,75
Anzahl der Kohlenstoffe im Molekül1 2 3 4 5 6 7 8 9 10
Lösl
ichk
eit [
g m
l-1]
0
10
20
30
40
50
60
70a)
c) d)
b)
Abb. 2 Physikalisch-chemische Eigenschaften von Alkanen. a) Dichte von n-Alkanen bei 20 °C,
Ausnahmen: Methan und Butan bei 0 °C, Ethan bei –100 °C, Propan bei –45 °C. b) Löslichkeit
von n-Alkanen in Wasser bei 25 °C. c) Siedepunkte von n-Alkanen. d) Siedepunkte der Isomere
des Hexans. Nach: Bell (1973); Weast (1990).
Alkane sind aufgrund der geringen Differenz der Elektronegativität (EN) zwischen einem
Kohlenstoffatom (EN = 2,55) und einem Wasserstoffatom (EN = 2,2) nahezu unpolar
(Vollhardt, 1990). Da keines der beiden Atome bei einer Dissoziation das bindende
Elektronenpaar komplett zu sich herüberziehen kann, werden C–H Bindungen in
Alkanen nicht heterolytisch in Ionen, sondern nur homolytisch gespalten. Bei der
homolytischen Spaltung wird das bindende Elektronenpaar gleichmäßig auf die
beteiligten Atome aufgeteilt und Radikale entstehen. Zur homolytischen Spaltung einer
chemischen Bindung wird Energie, die Bindungsdissoziationsenergie (∆H0), benötigt, die
je nach Art der Bindung und der miteinander verbundenen Atome einen
![Page 10: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/10.jpg)
Einleitung
4
charakteristischen Wert besitzt und von der Stabilität der gebildeten Radikale abhängig
ist (Vollhardt, 1990; Wilkes & Schwarzbauer, 2010). So beträgt die Bindungs-
dissoziationsenergie einer C–H Bindung im Methan 440 kJ mol–1, im Ethan 411 kJ mol–1
und an den primären C-Atomen des Propans 410 kJ mol–1 (Wilkes & Schwarzbauer,
2010). Generell nimmt die Bindungsdissoziationsenergie einer C–H Bindung vom
primären bis zum tertiären C-Atom ab (Tab. 1). Primär sind alle terminalen C-Atome in
n- und Isoalkanen, sekundär alle dazwischenliegenden C-Atome, von denen keine
Alkylseitenketten abzweigen, sowie die C-Atome in Cycloalkanen und tertiär die
C-Atome in Iso- oder Cycloalkanen, an denen eine Alkylseitenkette substituiert ist
(Abb. 3). Auch die Bindungsdissoziationsenergie einer C–C Einfachbindung ist abhängig
von der Energie der bei der
Homolyse entstehenden Radikale.
Für die Homolyse der C–C Bindung
des Ethans ist sie mit 377 kJ mol–1
am größten, da die entstehenden
primären Alkylradikale eine größere
Energie besitzen als sekundäre und
tertiäre Alkylradikale (Vollhardt,
1990). Die Bindungen in Alkanen
werden durch Pyrolyse oder
Verbrennung aufgebrochen. Bei der
Pyrolyse werden Alkane thermisch in
kleinere Fragmente zerlegt. Die
Verbrennung von Alkanen erfolgt
vollständig zu CO2 und Wasser.
Desweiteren sind Alkylradikale in der
Lage an Doppelbindungen zu
addieren (Vollhardt, 1990).
1.3 Entstehung und Vorkommen von Alkanen
1.3.1 Biologische Bildung
Alkane werden von Mikroorganismen, Pflanzen und Tieren gebildet. In Mikroorganismen
sind sie entweder ein Stoffwechselprodukt der Atmung oder ihre Funktion ist noch nicht
bekannt. Bei der Methanogenese durch Archaeen ist Methan das Produkt einer
energieliefernden Reaktion (Thauer, 1998). Schätzungen zufolge macht die mikrobielle
Methanproduktion bis zu 70% der Gesamtmenge an jährlich global produziertem Methan
Tab. 1 Bindungsdissoziationsenergien von C–H
Bindungen am primären, sekundären und tertiären
Kohlenstoffatom. Nach: Vollhardt (1990).
389tertiär
395,7sekundär
410primär
kJ mol–1Kohlenstoffatom
Abb. 3 Primäre (rot), sekundäre (blau) und tertiäre
(grün) Kohlenstoffatome im 3-Methylhexan.
Tab. 1 Bindungsdissoziationsenergien von C–H
Bindungen am primären, sekundären und tertiären
Kohlenstoffatom. Nach: Vollhardt (1990).
389tertiär
395,7sekundär
410primär
kJ mol–1Kohlenstoffatom
Abb. 3 Primäre (rot), sekundäre (blau) und tertiäre
(grün) Kohlenstoffatome im 3-Methylhexan.
![Page 11: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/11.jpg)
Einleitung
5
(500 bis 600 Teragramm) aus (McInerney et al., 2010). Neuere Untersuchungen
postulieren, basierend auf der Kohlenstoff-Isotopen-Zusammensetzung, die biologische
Bildung von Ethan und Propan aus Acetat in Tiefseesedimenten (Hinrichs et al., 2006).
Über die Mikroorganismen, welche diese Ethano- bzw. Propanogenese zur
Energiegewinnung betreiben, ist bisher jedoch nichts bekannt. Längerkettige n-Alkane
werden von einer Vielzahl an Bakterien, darunter u.a. Cyanobakterien, anaerobe
phototrophe Bakterien und Clostridien, sowie von Hefen und anderen Pilzen synthetisiert
(Ladygina et al., 2006). Möglicherweise halten intrazelluläre Kohlenwasserstoffe die
physikochemischen Eigenschaften der Plasmamembran aufrecht oder unterstützen die
Akkumulation hydrophober Substanzen in der Zelle, während extrazelluläre n-Alkane in
Pseudomonas fluorescens die Zelladhäsion und Zellaggregation regulieren (Ladygina et
al., 2006).
In Pflanzen und Tieren dienen Kohlenwasserstoffe meistens dem Schutz oder der
Interaktion mit anderen Organismen (Wackett, 2010). Vor kurzem wurde berichtet, dass
Pflanzen unter oxischen Bedingungen aus bisher unbekanntem Grund größere Mengen
an Methan emittieren (Keppler et al., 2006). Mit Ausnahme der Freisetzung des
Treibhausgases Methan durch methanogene Bakterien und Pflanzen ist die Menge an
biologisch produzierten und freigesetzten Alkanen gering.
1.3.2 Geologische Bildung
Die geologische Bildung von Kohlenwasserstoffen ist ein über große Zeitspannen
(5 bis 100 Millionen Jahre) stattfindender Prozess (Tissot & Welte, 1984). Im Wasser
absinkendes totes organisches Material (Plankton, Pflanzen) lagert sich als Sediment
auf dem Meeresboden ab. Die Biopolymere werden durch mikrobiologische Aktivität in
kleinere Fragmente zersetzt. Der mikrobielle Abbau findet nur in der obersten
Sedimentschicht, vorwiegend durchgeführt von anaeroben Bakterien, statt.
Methanogene Bakterien setzen hierbei Methan frei. Diese erste Phase der Zersetzung
der Biomasse wird Diagenese genannt (Tissot & Welte, 1984). Durch Sedimentation
weiterer Biomasse wird das schon abgelagerte Sediment bedeckt und mit zunehmender
Tiefe einem Druck- und Temperaturanstieg ausgesetzt, der in der Phase der Diagenese
zur Kondensation und Polymerisation der von den Mikroorganismen nicht genutzten
Komponenten zunächst zu Fulvo- und Huminsäuren führt. Durch weitere Kondensation
und den Verlust von funktionellen Gruppen werden hochkomplexe unlösliche Polymere,
Kerogen genannt, gebildet. Der nächste Zersetzungsschritt wird Katagenese genannt
(Tissot & Welte, 1984). Bedingt durch größere Tiefe und einen damit verbundenen
weiteren Druck- und Temperaturanstieg wird das Kerogen thermisch durch Spaltung von
![Page 12: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/12.jpg)
Einleitung
6
C–C Bindungen abgebaut, wobei Erdöl und Erdgas gebildet werden. Erdöl besteht aus
n-Alkanen, Iso- und Cycloalkanen und Aromaten, deren Zusammensetzung in Erdölen
verschiedener Fundorte variabel ist (Tissot & Welte, 1984). Erdgas besteht
hauptsächlich aus Methan, in geringeren Mengen kommen auch Ethan, Propan, Butan
und Isobutan vor (Tissot & Welte, 1984). Erdgas und Erdöl entweichen natürlicherweise
aus ihren Lagerstätten und werden ins Meer freigesetzt. Dies geschieht insbesondere im
Kontinentalschelf und in Gebieten, in denen Kontinentalplatten auseinanderdriften. Im
Golf von Mexiko kommen mehrere Hundert dieser natürlichen Austrittsstellen vor. In
noch größerer Tiefe werden durch einen weiteren Temperatur- und Druckanstieg
Methan, CO2 und fester Kohlenstoff gebildet. Dieser Prozess wird Metagenese genannt
(Tissot & Welte, 1984).
1.3.3 Anthropogene Freisetzung
Erdöl und Erdgas sind wichtige fossile Energieträger, die in großen Mengen gefördert
werden, um den steigenden Energiebedarf auf der Erde zu decken. Erdöl wird durch das
Anbohren natürlicher Erdöllagerstätten in den Meeren an die Oberfläche gefördert oder
aus dem Boden durch den Abbau von Ölsanden, wie beispielsweise in der kanadischen
Provinz Alberta, gewonnen. Durch die Förderung und den Transport von Öl, sowie durch
Unfälle wird Öl in die Umwelt freigesetzt. Wasser, das beim Abbau von Ölsanden
kontaminiert wird, verschmutzt Flüsse oder versickert im Grundwasser (Schindler, 2010).
Bei der Explosion der Ölplattform Deep Water Horizon im Golf von Mexiko im März 2010
traten ca. 780 Mio. Liter Öl aus (Atlas & Hazen, 2011). Die Havarie der Exxon Valdez
1989 vor der Küste Alaskas führte zur Freisetzung von 40 Mio. Liter Öl (Atlas & Hazen,
2011). Jüngstes Beispiel ist die Rena, die im Oktober 2011 vor der Küste Neuseelands
auf ein Riff aufgelaufen ist und Leck geschlagen hat.
Eine Möglichkeit zur Beseitigung der Ölkontamination ist die biologische Sanierung, bei
der die Fähigkeit von Bakterien zum Abbau von Kohlenwasserstoffen genutzt wird. Die
Unglücke der Exxon Valdez und der Deep Water Horizon führten zu einer deutlichen
Vermehrung der natürlicherweise vorkommenden kohlenwasserstoffabbauenden
Bakterien, da diese nun nicht mehr substratlimitiert waren (Prince, 1993; Hazen et al.,
2010). Diese Bakterien tragen zum Abbau der Kohlenwasserstoffe bei, solange ihnen
ein nutzbarer Elektronenakzeptor, wie z.B. Sauerstoff oder Sulfat, und ausreichend
Nährstoffe, insbesondere Stickstoff und Phosphor, zur Verfügung stehen (Prince,
2010b). Um die biologische Sanierung als alternative Maßnahme zur chemischen
Sanierung zukünftig besser nutzen zu können, ist es wichtig kohlenwasserstoff-
abbauende Bakterien zu erforschen.
![Page 13: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/13.jpg)
Einleitung
7
2. Mikrobieller Abbau von n-Alkanen
Alkane eignen sich aufgrund ihres hohen Energie- und Kohlenstoffgehaltes gut als
Energie- und Kohlenstoffquelle für Mikroorganismen. Zur Aktivierung dieser
reaktionsträgen Moleküle bedarf es aber spezieller Mechanismen. Mittlerweile ist eine
Vielzahl von Organismen beschrieben, die in der Lage sind n-Alkane zur
Energiegewinnung zu aktivieren und vollständig zu CO2 abzubauen.
2.1 Verfügbarkeit und Aufnahme von n-Alkanen
Aufgrund ihrer guten Löslichkeit in Wasser sind die gasförmigen n-Alkane (C1 bis C4) für
Bakterien leicht verfügbar (Abb. 2b). Sie gelangen vermutlich genauso wie H2, N2 und O2
durch freie Diffusion in die Zelle. Die Löslichkeit flüssiger und fester n-Alkane nimmt mit
zunehmender Kettenlänge immer weiter ab (Abb. 2b), so dass Bakterien Mechanismen
entwickeln mussten, um sich die n-Alkane verfügbar zu machen. Zu diesen
Mechanismen gehören die Adhäsion an die kohlenwasserstoffhaltige Phase mit
hydrophoben Zelloberflächenstrukturen oder die Sekretion von Emulgatoren oder
Tensiden, die die Verfügbarkeit des Substrates erhöhen (van Hamme et al., 2003;
Perfumo et al., 2010; Satpute et al., 2010). Durch Chemotaxis gelangen Bakterien in
räumliche Nähe ihrer Kohlenstoff- und Energiequelle. Für einige Stämme, die n-Alkane
oder Aromaten abbauen, wurde eine chemotaktische Antwort auf einen
Kohlenwasserstoff gezeigt und in einigen Fällen wurde auch der Chemorezeptor
identifiziert (Parales & Ditty, 2010). Aufgrund ihres hydrophoben Charakters diffundieren
n-Alkane frei durch die Cytoplasmamembran. Die äußere Membran von Gram-negativen
Zellen ist hingegen eine Barriere, die die Anwesenheit von Kanälen für den
Substrattransport durch sie hindurch erforderlich macht. In Aromatenabbauern wurden
Transportproteine für den aromatischen Kohlenwasserstoff Toluol identifiziert (Wang et
al., 1995).
2.2 Aerober Abbau von n-Alkanen
Neben Bakterien sind auch Hefen, Pilze und Algen in der Lage, n-Alkane unter aeroben
Bedingungen abzubauen (van Beilen et al., 2003). Der Sauerstoff dient nicht nur der
Aktivierung des inerten Kohlenstoffmoleküls sondern auch als terminaler
Elektronenakzeptor. Die n-Alkane werden durch die Hydroxylierung eines terminalen
oder subterminalen Kohlenstoffs unter Bildung eines primären oder sekundären Alkohols
aktiviert (Abb. 4) (Rojo, 2010a). Das zweite Sauerstoffatom wird zu H2O reduziert, wofür
ein Reduktionsmittel, z. B. NAD(P)H+H+, benötigt wird. Ein primärer Alkohol wird weiter
zu einem Aldehyd und anschließend zu einer Fettsäure oxidiert, die dann durch
![Page 14: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/14.jpg)
Einleitung
8
β-Oxidation abgebaut wird. Sekundäre Alkohole werden über ein Keton und einen Ester
zu einer Fettsäure und einem primären Alkohol abgebaut (Rojo, 2010a).
Abb. 4 Aktivierung von n-Hexan durch eine Oxygenase zum primären oder sekundären Alkohol.
Abhängig von der Kettenlänge des zu aktivierenden n-Alkans sind in Bakterien
verschiedene Enzymklassen für die Hydroxylierung der n-Alkane zuständig. Methan wird
von löslichen (sMMO) oder partikulären (pMMO) Methan-Monooxygenasen aktiviert
(Hanson & Hanson, 1996). Andere kurzkettige n-Alkane werden von Methan-
Monooxygenase ähnlichen Enzymen aktiviert (van Beilen & Funhoff, 2007).
Längerkettige n-Alkane werden von Cytochrom P450 Alkanhydroxylasen oder in der
Membran lokalisierten Alkanhydroxylasen aktiviert (van Beilen & Funhoff, 2005). Viele
Organismen besitzen mehrere Hydroxylasen mit überlappenden Substratspektren, um
ein großes Spektrum an n-Alkanen abbauen zu können (van Beilen & Funhoff, 2007).
Der aerobe n-Alkanabau ist u.a. in Pseudomonas putida Gpo1 eingehend charakterisiert
worden (van Beilen et al., 1994). Die benötigten Gene sind auf einem Plasmid kodiert.
Gen alkb kodiert eine in der Membran lokalisierte Monooxygenase (van Beilen et al.,
1994). Desweiteren werden für die Hydroxylierung der n-Alkane zwei Elektronen-
transferproteine, Rubredoxin und Rubredoxin-Reduktase, benötigt, die von alkG und
alkT kodiert werden (Rojo, 2010b). Die Rubredoxin-Reduktase transferiert Elektronen
über seinen Cofaktor FAD von NADH zum Rubredoxin, welches die Elektronen dann zur
Monooxygenase AlkB transferiert (van Beilen & Funhoff, 2007; Rojo, 2010a).
2.3 Anaerober Abbau von n-Alkanen
Lange Zeit wurde davon ausgegangen, dass eine Aktivierung von n-Alkanen aufgrund
ihrer geringen Reaktivität nur mithilfe von Sauerstoff als starkem Oxidationsmittel
möglich ist, wodurch eine funktionelle Gruppe ins Molekül eingefügt wird. Diese ist
notwendig für den Abbau von organischen Molekülen. Energetisch ist eine anaerobe
n-Alkanaktivierung möglich. Die Energie, die bei der Oxidation zu CO2 gewonnen wird,
ist abhängig vom Redoxpotential des jeweiligen Elektronenakzeptors. Mit Nitrat wird
![Page 15: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/15.jpg)
Einleitung
9
mehr Energie gewonnen als mit Sulfat. So wird bei der vollständigen Oxidation von
n-Hexan mit Nitrat als Elektronenakzeptor eine Energie von 492,8 kJ mol–1 Nitrat frei,
während es für die Oxidation von n-Hexan mit Sulfat nur 44,2 kJ mol–1 Sulfat sind
(Spormann & Widdel, 2000).
Tatsächlich wurde auch unter anaeroben Bedingungen der Abbau von Kohlenwasser-
stoffen beobachtet. Zu Beginn der 1990er Jahre wurde das erste anaerob Alkan-
verwertende Bakterium isoliert (Aeckersberg et al., 1991). Mittlerweile sind einige Isolate
beschrieben, die n-Alkane mit Nitrat oder Sulfat als terminalem Elektronenakzeptor
vollständig zu CO2 abbauen (Tab. 2). Kürzlich wurde berichtet, dass Pseudomonas
chloritidismutans n-Decan mit Chlorat als Elektronenakzeptor abbaut (Mehboob et al.,
2009). Die Isolate entstammen unterschiedlichen Habitaten. Sulfatreduzierer wurden aus
marinen Sedimenten, in denen die n-Alkane durch geologische Bildung natürlicherweise
vorkommen, wie z.B. im Golf von Mexiko oder im Guaymas Basin im Golf von
Kalifornien (Rueter et al., 1994; Kniemeyer et al., 2007), oder aus marinen Sedimenten
und Schlämmen, die anthropogen mit n-Alkanen kontaminiert sind, isoliert (Aeckersberg
et al., 1998; So & Young, 1999; Cravo-Laureau et al., 2004). Neben diesen
Salzwasserisolaten wurden Bakterien auch aus Brackwasser (Grossi et al., 2007) und
aus Süßwassergrabenschlämmen (Ehrenreich et al., 2000) isoliert. Desweiteren wurden
Isolate aus Abwässern, die bei der Erdölförderung anfallen (Davidova & Suflita, 2005),
oder aus Erdölförderanlagen gewonnen (Aeckersberg et al., 1991). Stamm HdN1 wurde
aus Schlamm einer Kläranlage isoliert (Ehrenreich et al., 2000). Mit Ausnahme des
thermophilen Stammes TD3, der aus dem Guaymas Basin stammt (Rueter et al., 1994),
sind alle anderen Isolate mesophil. Das Substratspektrum der Isolate ist auf einen
bestimmten Kettenlängenbereich beschränkt (Tab. 2). Alle bislang auf n-Alkanen
isolierten Reinkulturen sind Proteobakterien (Widdel et al., 2010).
Neben den Isolaten wurden auch Anreicherungskulturen beschrieben, die n-Alkane mit
Nitrat (Bregnard et al., 1997; Callaghan et al., 2009) oder Sulfat (Caldwell et al., 1998;
Kniemeyer et al., 2007; Savage et al., 2010) oxidieren oder durch Methanogenese
abbauen (Zengler et al., 1999b; Anderson & Lovley, 2000; Jones et al., 2008). Syntrophe
Konsortien aus Archaeen und sulfatreduzierenden Bakterien oxidieren anaerob Methan
(Boetius et al., 2000; Nauhaus et al., 2002). Vor kurzem wurde eine Anreicherungskultur
beschrieben, in der das dominierende Bakterium Methylomirabilis oxyfera Methan durch
Denitrifikation oxidiert (Ettwig et al., 2008; Ettwig et al., 2010).
![Page 16: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/16.jpg)
Einleitung
10
Tab. 2 Bislang isolierte Bakterien, die anaerob n-Alkane bestimmter Kettenlängen abbauen.
Isolat n-Alkane Referenz
Denitrifizierer
Stamm HdN1 C14-C20 Ehrenreich et al. (2000)
Stamm HxN1 C6-C8 Ehrenreich et al. (2000)
Stamm OcN1 C8-C12 Ehrenreich et al. (2000)
Marinobacter sp. (BC36, BC38, BP42) C18 Bonin et al. (2004)
Pseudomonas balearica Stamm BerOc6 C15-C18 Grossi et al. (2008)
Sulfatreduzierer
Desulfococcus oleovorans Stamm Hxd3 C12-C20 Aeckersberg et al. (1991)
Stamm TD3 C6-C16 Rueter et al. (1994)
Stamm Pnd3 C14-C17 Aeckersberg et al. (1998)
Desulfatibacillum alkenivorans Stamm AK-01 C13-C18 So & Young (1999)
Desulatibacillum aliphaticivorans CV2803 C13-C18 Cravo-Laureau et al. (2004)
Desulfoglaeba alkanexedens (ALDC) C6-C12 Davidova & Suflita (2005)
Desulfoglaeba alkanexedens (Lake) C6-C10 Davidova & Suflita (2005)
Stamm Bus5 C3, C4 Kniemeyer et al. (2007)
Stamm PL12 C6, C10 Higashioka et al. (2009)
Chloratreduzierer
Pseudomonas chloritidismutans C10 Mehboob et al. (2009)
3. Reaktionen, Proteine und Gene des anaeroben n-Alkanabbaus
Die Fähigkeit von Bakterien, n-Alkane unter anaeroben Bedingungen abzubauen, setzt
einen Aktivierungsmechanismus voraus, der sich von der Aktivierung mittels Sauerstoff
unterscheiden muss. Die Identifizierung der bislang bedeutendsten Aktivierungsreaktion
sowie der dafür verantwortlichen Proteine baut auf den Erkenntnissen zur anaeroben
Aktivierung des aromatischen Kohlenwasserstoffes Toluol auf.
3.1 n-Alkan-Aktivierung durch Addition an Fumarat
In dem denitrifizierenden Betaproteobakterium Thauera aromatica wurde gezeigt, dass
die Bildung von Benzylsuccinat der erste Schritt im anaeroben Abbau von Toluol ist
(Biegert et al., 1996). Benzylsuccinat entsteht bei der Addition von Fumarat an die
Methylgruppe des Toluols (Abb. 5). Diese Reaktion wurde in den folgenden Jahren für
![Page 17: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/17.jpg)
Einleitung
11
weitere Nitrat- (Beller & Spormann, 1997b), Sulfat- (Beller & Spormann, 1997a; Morasch
et al., 2004) und Fe(III)-Reduzierer (Kane et al., 2002), phototrophe Bakterien (Zengler
et al., 1999a) und eine methanogene Anreicherungskultur (Beller & Edwards, 2000)
beschrieben. Ein alternativer Aktivierungsmechanismus für Toluol unter anaeroben
Bedingungen ist bisher nicht bekannt.
Auch für andere monoaromatische Kohlenwasserstoffe, die vollständig von Bakterien
mineralisiert werden, wurden Metabolite identifiziert, die auf eine Aktivierung mittels
Addition an Fumarat hindeuten. Der sulfatreduzierende Stamm OX39 baut neben Toluol
auch m- und o-Xylol vollständig ab (Morasch et al., 2004). Der Denitrifizierer
Azoarcus sp. Stamm T dagegen metabolisiert neben Toluol nur m-, aber nicht o-Xylol
(Krieger et al., 1999). Desulfobacterium cetonicum aktiviert m- und p-Cresol durch
Addition an Fumarat und oxidiert beide Substrate vollständig zu CO2 (Müller et al., 1999,
2001). Für Ethylbenzol hingegen sind zwei verschiedene Aktivierungsmechanismen
beschrieben worden. In dem sulfatreduzierenden Stamm EbS7 wird Ethylbenzol durch
Addition der aromatenständigen Methylengruppe an Fumarat aktiviert (Kniemeyer et al.,
2003), in dem Nitratreduzierer Aromatoleum aromaticum Stamm EbN1 hingegen durch
eine Dehydrogenierung (Kniemeyer & Heider, 2001).
Metabolitanalysen an n-Alkanabbauern, dem denitrifizierenden Stamm HxN1, den
Sulfatreduzierern D. alkenivorans Stamm AK-01 und D. aliphaticivorans Stamm CV2803,
und an sulfatreduzierenden Anreicherungskulturen, identifizierten die Additionsprodukte
von Fumarat an das subterminale C-Atom eines n-Alkans, (Kropp et al., 2000; Rabus et
al., 2001; Cravo-Laureau et al., 2005; Davidova et al., 2005; Callaghan et al., 2006). So
wird in Stamm HxN1 bei der Aktivierung von n-Hexan durch Addition an Fumarat
(1-Methylpentyl)succinat gebildet (Abb. 5) (Rabus et al., 2001).
Energetisch betrachtet ist die Aktivierung eines n-Alkans am sekundären C-Atom
(395,7 kJ mol–1) günstiger als am terminalen C-Atom (410 kJ mol–1) (Tab.1). Es wird
jedoch mehr Energie benötigt als für die Aktivierung von Toluol an dessen Methylgruppe
(368 kJ mol–1), da ein Benzylradikal durch sein π-Elektronensystem stabilisiert wird
(Rabus et al., 2001).
![Page 18: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/18.jpg)
Einleitung
12
Abb. 5 Aktivierung von Aromaten und n-Alkanen durch Addition an Fumarat. a) Bei der Addition
von Toluol an Fumarat entsteht Benzylsuccinat. b) Durch Addition von n-Hexan an Fumarat wird
(1-Methylpentyl)succinat gebildet.
Nach der Aktivierung des n-Alkans zu einem (1-Methylalkyl)succinat wird dieses
möglicherweise durch Coenzym A zu (1-Methylalkyl)succinyl-CoA aktiviert (Abb. 6)
(Wilkes et al., 2002). Die Oxidation zu CO2 über die β-Oxidation erfordert zunächst eine
intramolekulare Umlagerung des (1-Methylalkyl)succinyl-CoA zu (2-Methylalkyl)malonyl-
CoA, das dann decarboxyliert wird (Wilkes et al., 2002; Wilkes et al., 2003). Das bei der
Decarboxylation gebildete 4-Methylalkanoyl-CoA wurde in Form seines Methylesters in
Zellen von Stamm HxN1, die auf n-Hexan gewachsen waren, detektiert (Wilkes et al.,
2002). Propionyl-CoA, das bei der β-Oxidation von methylverzweigten Fettsäuren
gebildet wird, kann für die Regeneration von Fumarat, beispielsweise über den
Methylmalonyl-CoA-Weg und den anschließenden Eintritt des Produktes dieser
Reaktion, Succinyl-CoA, in den Citratzyklus genutzt werden (Abb. 6) (Wilkes et al.,
2002).
Die Addition an Fumarat wurde, basierend auf Metabolitstudien, auch für die Aktivierung
zyklischer Alkane propagiert (Rios-Hernandez et al., 2003; Musat et al., 2010). Die
Aktivierung findet bei Ethylcyclopentan, genau wie bei Cyclohexan, am Ring und nicht
an der Alkylseitenkette statt (Rios-Hernandez et al., 2003; Musat et al., 2010). Für den
polyzyklischen aromatischen Kohlenwasserstoff 2-Methylnaphthalin wurden ebenfalls
Metabolite, die für eine Aktivierung mittels Addition an Fumarat an den Methylrest
sprechen, analog zur Toluolaktivierung, identifiziert (Annweiler et al., 2000; Musat et al.,
2009). Die Addition an Fumarat ist damit die bis heute am häufigsten dokumentierte
Aktivierungsreaktion von Kohlenwasserstoffen unter anaeroben Bedingungen.
![Page 19: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/19.jpg)
Einleitung
13
Abb. 6 Möglicher Abbauweg für n-Hexan unter anaeroben Bedingungen in Stamm HxN1. Nach
Addition von n-Hexan an Fumarat wird das hierbei entstandene (1-Methylpentyl)succinat (1)
durch Coenzym A aktiviert zu (1-Methylpentyl)succinyl-CoA (2). Durch eine intramolekulare
Umlagerung wird (2-Methylhexyl)malonyl-CoA gebildet (3), welches decarboxyliert wird zu
4-Methyloctanoyl-CoA (4). Bei der anschließenden β-Oxidation werden Acetyl-CoA und
Propionyl-CoA gebildet (5). Letzteres wird carboxyliert zu Methylmalonyl-CoA (6), während das
Acetyl-CoA zu CO2 oxidiert wird. Eine Umlagerung des Methylmalonyl-CoA bildet Succinyl-CoA
(7), welches im Citratzyklus über Succinat (8) Fumarat als Co-Substrat der Aktivierung von
n-Hexan regeneriert (9). Verändert nach: Wilkes et al. (2002).
![Page 20: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/20.jpg)
Einleitung
14
3.2. Glycyl- und SAM-Radikalenzyme
Das Enzym, das die Additionsreaktion von Fumarat und Toluol katalysiert, wurde aus
T. aromatica Stamm K172 isoliert (Leuthner et al., 1998). Sequenzähnlichkeiten der
α-Untereinheit dieser Benzylsuccinat-Synthase zu den bis dato einzigen Glycylradikal-
enzymen Pyruvat-Formiat-Lyase (Knappe et al., 1984) und anaerobe Ribonukleotid-
Reduktase (Sun et al., 1993) deuteten auf eine radikalische Aktivierung des Toluols hin
(Leuthner et al., 1998). Mittlerweile wurden als weitere Glycylradikalenzyme die
4-Hydroxyphenylacetat-Decarboxylase (Selmer & Andrei, 2001) und die Coenzym B12-
unabhängige Glycerin-Dehydratase beschrieben (Raynaud et al., 2003; O´Brien et al.,
2004).
Für Glycylradikalenzyme ist ein konservierter Glycinrest mit dem Sequenzmotiv RVXG
am C-Terminus der katalytischen Untereinheit charakteristisch (Sun et al., 1993). Im
aktiven Zustand des Enzyms ist ein Radikal an diesem Glycinrest lokalisiert (Abb. 7)
(Wagner et al., 1992; King & Reichard, 1995; Sun et al., 1996). Bei einer Reaktion des
Radikals mit Sauerstoff wird die Polypeptidkette an dieser Position irreversibel gespalten
(Wagner et al., 1992; King & Reichard, 1995). Das Glycylradikal liefert ein
charakteristisches Elektronen-Paramagnetisches-Resonanz (EPR)-Signal (Unkrig et al.,
1989), welches in der aktiven, partiell aufgereinigten Benzylsuccinat-Synthase aus
Azoarcus sp. Stamm T, in Zellextrakten von T. aromatica Stamm K172, angezogen auf
Toluol und m-Xylol, und in Zellextrakten von Stamm HxN1, angezogen auf n-Hexan,
nachgewiesen wurde (Krieger et al., 2001; Rabus et al., 2001; Verfürth et al., 2004). Bei
Wachstum von Stamm HxN1 auf der C6-Fettsäure Capronat war dieses Radikal
hingegen nicht nachweisbar (Rabus et al., 2001).
Glycylradikalenzyme müssen durch andere Enzyme, die das Radikal auf den Glycinrest
übertragen, aktiviert werden. Bei diesen Aktivierungsenzymen handelt es sich um
S-Adenosylmethionin (SAM)-Radikalenzyme (Sofia et al., 2001). SAM-Radikalenzyme
zeichnet ein unkonventionelles Eisen-Schwefel-Zentrum aus, das nur durch drei anstatt
vier Cysteinreste koordiniert wird (Layer et al., 2004). Die Cysteine bilden ein
konserviertes CxxxCxxC-Motiv in SAM-Radikalenzymen (Sofia et al., 2001). Das Eisen-
Schwefel-Zentrum transferiert ein Elektron von einem Elektronendonor mit niedrigem
Potenzial, Flavodoxin oder Ferredoxin, auf S-Adenosylmethionin (Buckel & Golding,
2006), das dadurch homolytisch gespalten wird in Methionin und ein
5´-Desoxyadenosylradikal (Abb. 7) (Layer et al., 2004). Das 5´-Desoxyadenosylradikal
seinerseits abstrahiert ein Wasserstoffatom vom Glycinrest des Glycylradikalenzyms
(Buckel & Golding, 2006).
![Page 21: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/21.jpg)
Einleitung
15
Das aktivierte Glycylradikalenzym aktiviert sein Substrat nicht mit dem Glycylradikal,
sondern mit einem Thiylradikal. Hierfür wird das Radikal innerhalb des Enzyms auf einen
ebenfalls konservierten Cysteinrest übertragen (Knappe et al., 1993). Das entstandene
Thiylradikal vollzieht dann den Angriff auf das Substrat (Abb. 7). Das Radikal wird
innerhalb des Enzyms regeneriert und steht dann für weitere Aktivierungen zur
Verfügung.
-Gly--Cys-
HH – S
-Gly--Cys-
H – S
-Gly--Cys-
HH – S
-Gly--Cys-
S H3
4
12
5
6
-Gly--Cys-
HH – S
-Gly--Cys-
H – S
-Gly--Cys-
HH – S
-Gly--Cys-
S H
-Gly--Cys-
HH – S
-Gly--Cys-
H – S
-Gly--Cys-
HH – S
-Gly--Cys-
S H3
4
12
5
6
Abb. 7 Radikalischer Aktivierungsmechanismus von n-Hexan durch Addition an Fumarat. Die
Aktivase überträgt ein Elektron auf S-Adenosylmethionin und spaltet dieses dadurch in Methionin
und ein 5´-Desoxyadenosylradikal (1). Das Radikal abstrahiert ein Wasserstoffatom vom
konservierten Glycinrest des Glycylradikalenzyms (2). Das Glycylradikal wiederum abstrahiert ein
Wasserstoffatom vom konservierten Cysteinrest (3) und das hierbei entstehende Thiylradikal
greift das n-Hexan am C-2 an, wobei ein n-Hexylradikal (4) gebildet wird. Hieran addiert das
Fumarat unter Bildung eines (1-Methylpentyl)succinylradikals (5). Das Radikal wird dann im
Glycylradikalenzym regeneriert (6,3), es entsteht das Additionsprodukt (1-Methylpentyl)succinat
(6). Rot: inaktives Glycylradikalenzym; blau: aktives Glycylradikalenzym; roter Punkt: Radikal.
Verändert nach: Widdel et al. (2006).
![Page 22: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/22.jpg)
Einleitung
16
SAM-Radikalenzyme, die selber kein Substrat aktivieren sondern ein anderes Enzym,
werden als Aktivasen bezeichnet (Layer et al., 2004). Die Aktivasen der oben
beschriebenen Glycylradikalenzyme nutzen SAM als Substrat, das irreversibel gespalten
wird (Wang & Frey, 2007). Andere SAM-Radikalenzyme katalysieren direkt die
Umwandlung eines Substrates. Ein Beispiel ist die Lysin-2,3-Aminomutase, die
Wasserstoff vom 5´-Desoxyadenosylradikal auf Lysin und β-Lysin überträgt (Baraniak et
al., 1989). Hierbei wird SAM als Coenzym genutzt, das regeneriert wird (Buckel &
Golding, 2006; Wang & Frey, 2007).
3.3 Benzylsuccinat- und (1-Methylalkyl)succinat-Synthase
Bei der Reinigung der Benzylsuccinat-Synthase aus T. aromatica Stamm K172,
angezogen auf Toluol, wurden drei Untereinheiten des Enzyms identifiziert, eine große
α-Untereinheit und zwei kleine β- und γ-Untereinheiten (Leuthner et al., 1998). Für das
Holoenzym wurde eine α2β2γ2-Zusammensetzung postuliert. Das kodierende bss
Operon enthält vier offene Leserahmen, von denen drei den Untereinheiten des Enzyms
zugeordnet wurden (Abb. 8) (Leuthner et al., 1998). Die Sequenz der großen
α-Untereinheit (BssA) ist ähnlich dem Glycylradikalenzym Pyruvat-Formiat-Lyase und
auch die für Glycylradikalenzyme charakteristischen Glycin- und Cysteinreste wurden in
dieser Untereinheit identifiziert (Leuthner et al., 1998). Die Funktion der beiden kleinen
Untereinheiten (β-Untereinheit: BssB; γ-Untereinheit: BssC) ist ungeklärt. In der
Proteinsequenz dieser Untereinheiten wurden konservierte Cystein-Sequenzmotive
identifiziert, die womöglich die in der Benzylsuccinat-Synthase detektierten Eisen-
Schwefel-Zentren koordinieren (Li et al., 2009; Hilberg et al., 2012). Mögliche daraus
abgeleitete Funktionen beinhalten die Vermittlung von struktureller Stabilität des Enzyms
(Li et al., 2009) oder ein Elektronentransfer bei der Bildung des Glycylradikals (Hilberg et
al., 2012). Das vierte Gen des Operons (bssD) kodiert die Aktivase der Benzylsuccinat-
Synthase (Leuthner et al., 1998).
Gene für die Benzylsuccinat-Synthase wurden auch in anderen Denitrifizierern
(Coschigano et al., 1998; Achong et al., 2001; Kube et al., 2004; Shinoda et al., 2004;
Shinoda et al., 2005), sowie einem Fe(III)-Reduzierer (Kane et al., 2002) und einer
methanogenen Anreicherungskultur (Washer & Edwards, 2007), die Toluol abbauen,
detektiert. Für Sulfatreduzierer stehen bislang nur partielle bssA Sequenzen zur
Verfügung (Winderl et al., 2007). Georgfuchsia toluolica metabolisiert Toluol mit Nitrat,
Fe(III) oder Mn(IV) als Elektronenakzeptor (Weelink et al., 2009). In T. aromatica
Stamm T1 sind die bss Gene alternativ als tut Gene (für toluene utilization) benannt
(Coschigano et al., 1998). Zusätzlich zu den vier genannten Genen (bssA bis bssD)
![Page 23: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/23.jpg)
Einleitung
17
kann das bss Operon in verschiedenen Organismen noch weitere Gene mit teilweise
ungeklärter Funktion umfassen (Coschigano, 2000; Hermuth et al., 2002; Kube et al.,
2004).
In dem anaerob n-Alkane abbauenden Stamm HxN1 wurden bei Wachstum auf n-Hexan
Proteine identifiziert, die den Untereinheiten der Benzylsuccinat-Synthase ähnlich sind
und womöglich die Untereinheiten einer (1-Methylalkyl)succinat-Synthase repräsentieren
(Grundmann et al., 2008). Die kodierenden Gene liegen in einem Operon mit insgesamt
sieben offenen Leserahmen (Abb. 8) (Grundmann et al., 2008). Sie wurden nach der
postulierten Funktion des n-alkanaktivierenden Enzyms (1-Methylalkyl)succinat-
Synthase als Gene masA bis masG benannt.
masEmasC masD masF masGmasBmasA
1000 bp
bssAbssCbssD bssB
a)
b)
masEmasC masD masF masGmasBmasA
1000 bp
bssAbssCbssD bssB
a)
b)
Abb. 8 Genetische Organisation der Gene für den anaeroben Kohlenwasserstoffabbau mittels
Addition an Fumarat. a) bss Gene in Toluolabbauern. b) mas Gene in Stamm HxN1. Dunkelblau:
Gene, die die katalytische Untereinheit des kohlenwasserstoffaktivierenden Enzyms (Bss, Mas)
kodieren; hellblau: Gene, die die kleinen Untereinheiten des Enzyms kodieren; orange: Gen, das
die zusätzliche vierte Untereinheit der Mas kodiert; blau-gestreift: Aktivase-kodierende Gene;
weiß: zusätzliche Gene im mas Operon von Stamm HxN1 kodieren eine AcylCoA-
Dehydrogenase (masA) und eine Transposase (masF).
Auf Proteinebene hat MasD eine Identität von 33,7% zur großen α-Untereinheit der
Benzylsuccinat-Synthase (BssA) (Grundmann et al., 2008). Die Sequenz weist auch die
charakteristischen, konservierten Glycin- und Cysteinreste eines Glycylradikalenzyms
auf. Die Genprodukte MasC und MasE wurden als die kleinen β- und γ-Untereinheiten
des Enzyms charakterisiert, obwohl sie nur geringe (MasC) oder keine (MasE)
Sequenzähnlichkeit zu den kleinen Untereinheiten der Benzylsuccinat-Synthase
aufweisen (Grundmann et al., 2008). MasC und MasE sind jedoch genauso wie BssB
und BssC reich an Cysteinen und die kodierenden Gene sind im Operon vor und hinter
![Page 24: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/24.jpg)
Einleitung
18
dem Gen für die große Untereinheit angeordnet, genauso wie im bss Operon
(Grundmann et al., 2008). Die Reinigung der (1-Methylalkyl)succinat-Synthase aus
Stamm HxN1 identifizierte eine weitere Untereinheit, kodiert von masB (Werner, 2009).
Die wenigen verfügbaren Homologe von MasB wurden alle in anaeroben
n-Alkanabbauern gefunden (Werner, 2009). Auch MasB kennzeichnet das Vorkommen
mehrerer Cysteine, seine Funktion ist jedoch, ebenso wie die der anderen kleinen
Untereinheiten, ungeklärt. Die Aktivase, die für die Aktivierung der
(1-Methylalkyl)succinat-Synthase notwendig ist, wird von masG kodiert (Grundmann et
al., 2008). MasG ist durch das für SAM-Radikalenzyme spezifische CxxxCxxC-Motiv
charakterisiert. Anders als im bss Operon liegt masG nicht vor den Genen für das
Glycylradikalenzym, sondern dahinter, separiert durch ein weiteres Gen (masF), welches
eine Transposase kodiert (Abb. 8) (Grundmann et al., 2008). Das erste Gen des
Operons (masA) kodiert ein Protein, das Acyl-CoA-Dehydrogenasen ähnlich ist
(Grundmann et al., 2008). Eine Acyl-CoA-Dehydrogenase kann in den weiteren Abbau
des aktivierten n-Alkans involviert sein (Wilkes et al., 2002; Grundmann et al., 2008). In
dem Denitrifizierer Stamm OcN1 und den Sulfatreduzierern Stamm Pnd3 und Stamm
TD3 wurden ebenfalls mas Gene identifiziert (Werner, 2009). In D. alkenivorans Stamm
AK-01 wurden entsprechende ass Gene (für Alkylsuccinat-Synthase) annotiert
(Callaghan et al., 2008).
3.4 Alternative anaerobe Aktivierungsmechanismen für n-Alkane
Die Addition an Fumarat ist nicht die einzige Möglichkeit der anaeroben Aktivierung von
n-Alkanen. Für Desulfococcus oleovorans Stamm Hxd3 und eine Anreicherungskultur
wurde als Aktivierung eine Carboxylierung am C-3 Atom vorgeschlagen (So et al., 2003;
Callaghan et al., 2006; Callaghan et al., 2009). Nach Abspaltung einer C2-Einheit wird
die um ein C-Atom gegenüber dem n-Alkan verkürzte Fettsäure zu CO2 oxidiert. In
Stamm Hxd3 beeinflusst das verwertete n-Alkan die Zusammensetzung der zellulären
Fettsäuren: n-Alkane mit einer geraden Anzahl an C-Atomen werden zu Fettsäuren mit
einer ungeraden Anzahl an C-Atomen und umgekehrt abgebaut (Aeckersberg et al.,
1998). Dies spricht für die postulierte Carboxylierung, der Mechanismus bleibt jedoch
hypothetisch, da verantwortliche Enzyme bisher nicht identifiziert wurden. Aber auch
bss/mas/ass ähnlichen Sequenzen wurden im Genom von Stamm Hxd3 nicht annotiert
(GenBank Acc.-Nr. NC 013939).
In Stamm HdN1 wurden ebenfalls weder im Genom mas- oder bss-ähnliche Sequenzen
gefunden, noch wurden alkylsubstituierte Metabolite, die auf eine Addition an Fumarat
hindeuten, detektiert (Zedelius et al., 2011). Postuliert wird eine Dismutation von Nitrit
![Page 25: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/25.jpg)
Einleitung
19
oder Stickstoffmonooxid zu molekularem Stickstoff und Sauerstoff. Der intramolekular
gebildete Sauerstoff wird dann zur Aktivierung eines n-Alkans durch Alkanhydroxylasen,
wie für den aeroben Abbau beschrieben, genutzt. Die Dismutation von
Stickstoffmonooxid wurde auch für eine methanoxidierende Anreicherungskultur
vorgeschlagen (Ettwig et al., 2010). Die hierin dominierende Spezies Methylomirabilis
oxyfera aktiviert Methan unter anaeroben Bedingungen durch eine Methan-
Monooxygenase mit dem intramolekular produziertem Sauerstoff. Ähnliches wurde für
den anaeroben Abbau von n-Decan mit Chlorat als Elektronenakzeptor in
Pseudomonas chloritidismutans berichtet (Mehboob et al., 2009). In diesem Fall wird
das Chlorat zunächst zu Chlorit reduziert. Nach der Dismutation in Chlorid-Ionen und
Sauerstoff wird der Sauerstoff zur Aktivierung des n-Alkans durch eine Oxygenase
genutzt.
Die anaerobe Oxidation von Methan (AOM), katalysiert von Konsortien aus Archaeen
und sulfatreduzierenden Bakterien, läuft vermutlich über reverse Methanogenese ab
(Thauer, 2011). Das Schlüsselenzym der Methanogenese, die Methyl-CoM-Reduktase,
katalysiert die exergone Umwandlung von Methyl-Coenzym M und Coenzym B zu
Methan und dem Heterodisulfid CoM–S–S–CoB (Thauer, 1998). Ein homologes Enzym
wurde aus methanotrophen Archaeen isoliert (Krüger et al., 2003). Daher wurde
vermutet, dass dieses Enzym in methanotrophen Archaeen die reverse Reaktion der
Methanbildung, die Oxidation von Methan, katalysiert (Krüger et al., 2003). In dem
methanogenen Archaeon Methanothermobacter marburgensis wurde die Reversibilität
diser Reaktion mittels eines Isotopen-Markierungs-Experimentes bestätigt (Scheller et
al., 2010). Dadurch wurde erstmalig gezeigt, dass die Aktivierung der starken C–H
Bindung im Methan (439 kJ mol–1) im Gegensatz zum aeroben Abbau von Methan
mittels Methan-Monooxygenasen (Hanson & Hanson, 1996) auch ohne reaktive
Sauerstoffspezies stattfinden kann. In AOM-Anreicherungskulturen wurde ebenfalls
durch ein Markierungsexperiment die Reversibilität der AOM und somit vermutlich auch
des methanogenen Stoffwechselweges bestätigt (Holler et al., 2011). Die Kristallstruktur
der Methyl-CoM-Reduktase aus methanotrophen Archaeen zeigte das Enzym in einem
Komplex mit Coenzym M und Coenzym B, den gleichen Substraten, die die Methyl-
CoM-Reduktase in methanogenen Archaeen zur Synthese von Methan nutzt (Shima et
al., 2011). Anders als bei der anaeroben Aktivierung von Alkanen und Aromaten durch
Addition an Fumarat wird für die Aktivierung von Methan kein Glycylradikal benötigt.
Möglicherweise ist jedoch ein Ni-Radikal darin involviert die Bindungsdissoziations-
energie der C–H Bindung im Methan, die höher ist als die der Methyl- oder
Methylengruppen in n-Alkanen, zu überwinden (Ragsdale, 2007).
![Page 26: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/26.jpg)
Einleitung
20
4. Stamm HxN1 als Modellorgansimus für den anaeroben n-Alkanabbau
Eine Anreicherungskultur, die mit einem Gemisch von Grabenschlämmen des
Kuhgrabens aus Bremen inokuliert worden war, verwertete unter denitrifizierenden
Bedingungen in Süßwassermedium n-Alkane von C5 bis C12 des als Kohlenstoffquelle
eingesetzten Erdöls (Rabus et al., 1999). Zur Isolierung der Denitrifizierer, die das
n-Hexan in der Anreicherung abgebaut haben, wurde Süßwassermedium mit n-Hexan
als Substrat und Nitrat als Elektronenakzeptor mit der Anreicherungskultur inokuliert. Die
hieraus isolierte Reinkultur, Stamm HxN1, verwertet neben n-Hexan auch n-Heptan und
n-Octan (Ehrenreich et al., 2000). Zyklische Alkane, aromatische Kohlenwasserstoffe
und Alkene werden von HxN1 nicht abgebaut (Behrends, 1999). Jedoch werden einige
Alkohole, Aldehyde, Carbonsäuren und Fructose anaerob metabolisiert. Erwähnenswert
ist die Verwertung der aromatischen Fettsäure Benzoat als einzige metabolisierbare
aromatische Verbindung (Behrends, 1999). Aerobes Wachstum auf n-Alkanen,
Carbonsäuren und Fructose ist ebenfalls möglich.
Phylogenetisch wurde Stamm HxN1
aufgrund einer 16S rRNA-Analyse dem
Azoarcus/Thauera-Cluster innerhalb
der Betaproteobakterien zugeordnet
(Behrends, 1999). Zur Gattung
Thauera zählen u.a. Denitrifizierer, die
fähig sind Toluol und andere Alkyl-
benzole abzubauen (Macy et al., 1993;
Anders et al., 1995). Die Gattung
Azoarcus umfasst zwei distinkte
Untergruppen, zum einen die Azoarcus
indigens Untergruppe, der pflanzen-
assoziierte, diazotrophe, aerobe Bakterien angehören und zum anderen die Untergruppe
Azoarcus evansii, deren Mitglieder anaerob u.a. aromatische Kohlenwasserstoffe
abbauen (Reinhold-Hurek & Hurek, 2006). Es wurde daher vorgeschlagen, die A. evansii
Untergruppe als neue Gattung Aromatoleum zu klassifizieren, der aufgrund seines
hohen Verwandtschaftsgrades zu den Mitgliedern dieser Gattung, Stamm EbN1 und
Stamm PbN1, auch Stamm HxN1 zugeordnet werden soll (Wöhlbrand, 2008). Zellen des
Stammes HxN1 sind unbeweglich und oval mit einer Größe von 1,0 - 1,5 µm x
1,8 - 2 µm (Abb. 9) (Ehrenreich et al., 2000). Die Zellen wachsen homogen in der
Flüssigkeit und adherieren im Gegensatz zu anderen Kohlenwasserstoffabbauern nicht
an die kohlenwasserstoffhaltige Oberphase (Ehrenreich et al., 2000). Diese Eigenschaft
Abb. 9 Phasenkontrastmikroskopie-Aufnahme von
Stamm HxN1, gewachsen auf n-Hexan.
Balken = 10 µm. Aus: Ehrenreich et al. (2000).
![Page 27: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/27.jpg)
Einleitung
21
und eine, verglichen mit Sulfatreduzierern, kurze Verdopplungszeit von ca. 11 Stunden
auf n-Hexan machen Stamm HxN1 zu einem geeigneten Modellorganismus um den
anaeroben n-Alkanabbau durch Addition an Fumarat weiter im Detail zu untersuchen.
5. Zielsetzung der vorliegenden Arbeit
Ziel dieser Arbeit war es, ein genetisches System für Stamm HxN1 zu entwickeln, das
die Generierung von Mutanten dieses Stammes ermöglicht. Mithilfe dieses Systems
sollte der in vivo Nachweis der bis dato nur postulierten Reaktion der
(1-Methylalkyl)succinat-Synthase durch Deletion der kodierenden Gene erbracht
werden. Anschließende physiologische Wachstumsversuche der generierten Mutanten
würden dann die Effekte der Mutation auf die Fähigkeit n-Alkane abzubauen, aufzeigen.
Die Regulation des anaeroben n-Alkanabbaus ist noch unbekannt. Erste Hinweise auf
die Regulation des mas Operons in Stamm HxN1 geben Studien zur Induktion und
Inhibierung der Expression. Hierzu sollte die Anwesenheit der (1-Methylalkyl)succinat-
Synthase nach Inkubation von Stamm HxN1 mit verschiedenen Kohlenwasserstoffen
sowie weiteren Kohlenstoffquellen untersucht werden.
In vorangegangenen Arbeiten wurde für die (1-Methylalkyl)succinat-Synthase aus
Stamm HxN1 ein Protokoll zur Reinigung entwickelt (Werner, 2009). In dieser Arbeit
sollte die nach diesem Protokoll gereinigte (1-Methylalkyl)succinat-Synthase für
Kristallisationsversuche eingesetzt werden. Ein Proteinkristall ermöglicht die Erstellung
einer Röntgenstruktur der (1-Methylalkyl)succinat-Synthase und damit die Aufklärung
der Funktion der verschiedenen Untereinheiten des Enzyms.
![Page 28: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/28.jpg)
22
B Ergebnisse Die Ergebnisse sind in Form von Manuskripten oder Berichten dargestellt.
Mein Anteil an den Manuskripten ist erläutert.
![Page 29: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/29.jpg)
23
1. Manuskript Purification of the (1-methylalkyl)succinate synthase from the Betaproteo-bacterium strain HxN1 revealed an unexpected fourth subunit that is conserved in all investigated fumarate dependent n-alkane activation enzymes Insa Schmitt, Kirsten Webner, Friedrich Widdel and Olav Grundmann Max-Planck-Institut für Marine Mikrobiologie, Celsiusstraße 1, D-28359 Bremen,
Germany.
Erstellung des Manuskriptes in Zusammenarbeit mit Olav Grundmann. Durchführung der
Wachstumsversuche auf n-Pentan und Cyclopentan. Amplifikation der masG Sequenz
von Stamm Pnd3 und der partiellen masB Sequenz von Stamm TD3 sowie Auswertung
der generierten Sequenzen. Die weiteren Ergebnisse stammen aus der Promotion von
Insa Schmitt, geb. Werner.
Abstract
The common mechanism for anaerobic n-alkane degradation is the activation by addition
to fumarate yielding (1-methylalkyl)succinate in a first step. In the Betaproteobacterium
strain HxN1 the tentative (1-methylalkyl)succinate synthase catalyzes this initial step in
anaerobic n-alkane degradation. Here, we report for the first time the purification of an
anaerobic n-alkane activating enzyme. Purification revealed the existence of four
subunits of (1-methylalkyl)succinate synthase. In contrast, the functional homologous
enzyme for the anaerobic degradation of toluene, benzylsuccinate synthase, consists of
only three subunits. According to sequence analysis of bacteria degrading n-alkanes,
toluene or 2-methylnaphthalene by addition to fumarate, homologues of the newly
identified MasB subunit were found to be exclusively present in n-alkane degrading
bacteria. In enzyme activity measurements the postulated catalyzed reaction of
(1-methylalkyl)succinate synthase was displayed in vitro. The enzyme did not only
activate the known growth substrates of strain HxN1, n-hexane, -heptane and -octane,
but also n-pentane and cyclopentane. Whereas n-pentane was identified as growth
substrate for strain HxN1, cyclopentane was oxidized incompletely.
![Page 30: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/30.jpg)
Purification of (1-methylalkyl)succinate synthase
24
Introduction
Saturated hydrocarbons (alkanes) are widespread in nature. They are major compounds
of crude oil (Tissot & Welte, 1984), as well as produced by many plants and some
microbes (Widdel & Rabus, 2001). The absence of functional groups or multiple
C-bounds results in a chemical stability, which prevents alkanes from most common
degradation mechanisms. Therefore, the degradation of alkanes requires a special
activation mechanism to overcome their chemical inertness. Under aerobic conditions,
oxygenases use free oxygen to introduce a hydroxyl group into the alkane (Rojo, 2009).
The degradation of n-alkanes was also reported under anaerobic conditions, where no
free oxygen is available: First isolates were obtained in the beginning of the 1990´s
(overview in Widdel et al., 2010). Recent publications also demonstrated an anaerobic
activation of alkanes via oxygenases by using NO to build “intracellular” oxygen under
anaerobic conditions (Ettwig et al., 2010; Zedelius et al., 2011).
A more common anaerobic activation mechanism is the radical involved addition of
fumarate to the n-alkane, which results in a substituted succinate. Metabolites supporting
this mechanism were identified in several denitrifying and sulfate-reducing bacteria
(Kropp et al., 2000; Rabus et al., 2001; Cravo-Laureau et al., 2005; Davidova et al.,
2005; Callaghan et al., 2006). The postulated enzyme catalyzing this reaction is the
(1-methylalkyl)succinate synthase (Mas) or alkylsuccinate synthase (Ass) (Callaghan et
al., 2008; Grundmann et al., 2008). In the betaproteobacterial denitrifying strain HxN1
the proteins MasC, MasD and MasE are regarded as subunits of
(1-methylalkyl)succinate synthase (Grundmann et al., 2008) due to sequence similarities
or characteristic features to the subunits of the well investigated benzylsuccinate
synthase (Bss), the enzyme that activates toluene anaerobically by addition to fumarate
(Leuthner et al., 1998). Benzylsuccinate synthase, (1-methylalkyl)succinate synthase
and alkylsuccinate synthase are supposed to be glycyl radical enzymes, because of
conserved amino acid motifs in their large α-subunits (Leuthner et al., 1998; Callaghan
et al., 2008; Grundmann et al., 2008). Nevertheless, until now an experimental proof for
the postulated catalyzed reaction of an anaerobic n-alkane activation enzyme is missing.
To demonstrate the predicted function of (1-methylalkyl)succinate synthase in vitro we
purified the enzyme from strain HxN1 and measured enzyme activity for the addition of
n-hexane to fumarate. Furthermore, purification allowed first insights into the structural
composition of this enzyme, for which a configuration similar to benzylsuccinate
synthase was proposed.
![Page 31: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/31.jpg)
Purification of (1-methylalkyl)succinate synthase
25
Material and Methods
Bacterial strains and growth conditions
Strain HxN1, OcN1, Pnd3 and TD3 are kept in the laboratory since their isolation from
n-alkane-utilizing enrichment cultures (Rueter et al., 1994; Aeckersberg et al., 1998;
Ehrenreich et al., 2000). Growth conditions are described in detail elsewhere
(Ehrenreich, 1996; Aeckersberg et al., 1998; Ehrenreich et al., 2000). Large scale
cultivations of strain HxN1 were performed in an anaerobic 50 l fermenter. Culture
mixing was achieved with a magnetic stirrer in a 28 °C water bath. In contrast to smaller
cultures, nitrate was added continuously via a pump with a flow rate up to
1 mM nitrate h–1. Nitrate and nitrite were measured with an ion chromatograph
connected to an UV detector (Sykam, Fürstenfeldbruck, Germany) as described (Rabus
& Widdel, 1995). Data analysis was performed with the Clarity HPLC software
(DataApex, Praque, Czech Republic). Escherichia coli strain BL21 Star (DE3)
(Invitrogen, Darmstadt, Germany) was cultivated in Luria Bertani medium at 37 °C.
Kanamycin was added to a final concentration of 45 µg ml–1.
Preparation of crude extract
Before harvesting, nitrate addition was stopped for at least 3 h to allow the culture to
reduce remaining nitrate and nitrite. Cells were harvested anaerobically using a Heraeus
Contifuge Stratos (Heraeus, Newport Pagnell, UK) with a flow through of 200 ml min–1 at
4 °C and 17000 rpm. During harvesting a pressure of 0.1 bar N2 was applied to the
culture to avoid oxygen input. Following centrifugation, the rotor was immediately
transferred into an anoxic chamber. Cells were suspended in an equal volume of
100 mM Tris-HCl, pH 8.0, supplemented with 5 mM fumarate, 8 mM DTT, 4 mM sodium
dithionite, 4 mM titanium (III) citrate and 20% (v/v) glycerol. The suspension was then
transferred into a French press cell (SLM Aminco Spectronic Instruments, Rochester,
USA), where cells were disrupted with a pressure of 1000 psig (70 bar) outside the
anoxic chamber. Cell extract was transferred directly via a needle into an anoxic butyl
stoppered bottle. 0.25 mg ml–1 DNaseA and small glass bullets (0.5 mm) were added for
DNA disruption. The extract was agitated for 30 min at 28 °C and centrifuged
anaerobically (20000 x g, 25 min) afterwards. The supernatant, in the following termed
as crude extract, was then used for further investigations.
Purification of (1-methylalkyl)succinate synthase
Purification was performed in an anoxic chamber at 7 °C using an ÄKTA explorer FPLC
system (GE Healthcare, Munich, Germany). Buffers were sterile filtered and degassed
![Page 32: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/32.jpg)
Purification of (1-methylalkyl)succinate synthase
26
before use and supplemented with 5 mM fumarate for protein stabilization and
0.5 mM sodium dithionite as reductant. Crude extract (12 ml) was loaded on five 5 ml
HiTrap ANX FF columns (GE Healthcare) connected in series and equilibrated with
100 mM Tris-HCl, pH 8.0. The column was washed with 150 mM NaCl and a flow rate of
3 ml min–1. Elution of (1-methylalkyl)succinate synthase was performed with 250 mM
NaCl. To minimize the volume for the next column, the eluted fraction was concentrated
by ultrafiltration with a cellulose membrane (Amicon Ultra-15 100K, Millipore, Billerica,
USA). The concentrated ANX chromatography fraction was loaded on a sephadex G 25
column (GE Healthcare) equilibrated with 50 mM NaH2PO4/Na2HPO4, pH 8.0 at a flow
rate of 3 ml min–1 for buffer exchange. The eluted protein fraction was loaded onto a 2 ml
hydroxyapatite column (CHT2-1, Biorad, Munich, Germany). After washing with 50 mM
NaH2PO4/Na2HPO4, pH 8.0 and a flow rate of 3.5 ml min–1, the concentration was
increased to 102 mM to elute (1-methylalkyl)succinate synthase. The presence of
(1-methylalkyl)succinate synthase after each chromatography step was detected by
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), Western blot
and enzymatic assay.
Molecular weight determination
A HiLoad 16/60 Superdex 200 prepgrade column (GE Healthcare) was calibrated with
standard proteins from the High and Low Molecular Weight Gel Filtration Calibration Kit
(GE Healthcare). The column was equilibrated with 100 mM Tris-HCl, pH 8.0 with 5 mM
fumarate and a flow rate of 0.5 ml min–1. The elution volumes of the standard proteins
were used to calculate the partition coefficient (KAV) of each protein and to generate a
calibration line. To determine the molecular weight of (1-methylalkyl)succinate synthase
0.5 ml of the concentrated fraction after hydroxyapatite chromatography were loaded
onto the HiLoad 16/60 Superdex 200 prepgrade column. Buffer and flow rate were
identical to those of the calibration. With the resulting KAV value the molecular weight of
(1-methylalkyl)succinate synthase was determined from the calibration line.
SDS-PAGE and Western blotting
SDS-PAGE was performed on 12% (w/v) polyacrylamide gels as described (Laemmli,
1970). As molecular size marker the PageRuler Prestained Protein Ladder from
Fermentas (St. Leon-Rot, Germany) was used. Proteins of interest were cut from the gel
and analyzed by peptide mass fingerprinting (Toplab, Martinsried, Germany). Proteins
were stained with Coomassie R250 and fixed with glacial acetic acid (0.25%
(v/v) Coomassie R250, 40% (v/v) ethanol, 10% (v/v) glacial acetic acid).
![Page 33: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/33.jpg)
Purification of (1-methylalkyl)succinate synthase
27
For immunoblotting experiments, the proteins separated by SDS-PAGE were transferred
onto a nitrocellulose membrane (Optitran BA-S 83 reinforced NC 0,2 µm, Whatman/GE
Healthcare) by electroblotting. To generate antibodies against the α-, β- and γ-subunit of
the (1-methylalkyl)succinate synthase, the genes masC, masD and masE of strain HxN1
were each cloned without start codon in frame into the expression vector pET-42a(+)
(Novagen, Darmstadt, Germany) fused with the N-terminus to the GST-tag. Cloning was
performed according to standard techniques using DNA modifying enzymes from
Fermentas. Oligonucleotide primers and plasmids are depicted in table 1 and 2. The
fusion proteins were expressed heterologously in E. coli BL21 Star (DE3) induced with
1 mM IPTG and purified via the GST-tag on a GSTrap HP column according to the
instructions (GE Healthcare). The purified proteins were used to immunize rabbits for the
production of antibodies (Pineda Antikörperservice, Berlin, Germany), which were
applied in a non-purified form as immune serum in Western blot analysis. As secondary
antibody goat anti-rabbit IgG-AP was used (Santa Cruz Biotechnology, Santa Cruz,
USA). Hybridization signals were detected with NBT/BCIP ready-to-use-tablets (Roche,
Darmstadt, Germany).
Table 1 Oligonucleotide primers for cloning of mas genes into the expression vector pET-42a(+).
Restriction sites are underlined.
Primer
Target gene
Sequence (5´→ 3´)
Product length [bp]
masC_BamHI_f masC CGGATCCTCTACATGCAAAGAGTGTC 183
masC_HindIII_r GCCAAGCTTCTAATGCGCTTTTGCTGTTC
masD_BamHI_f masD GCGGATCCACTGCAACTTCAACACTATCCA 2520
masD_XhoI_r CCGCTCGAGTTAGCCTAGCCCCTGGACGGT
masE_HindIII_f masE CAGAAGCTTCCAAATGCACAGAATGTGGCCA 213
masE_XhoI_r AGCTCGAGCTAACCTTCGGCCAAGTTTT
Table 2 Plasmids for expression of Mas-GST fusion proteins.
Plasmid Genotype and characteristics Reference or source
pET-42a(+) KmR, GST-tag, His-tag, S-tag Novagen
pET-42_masC KmR, GST-tag, His-tag, S-tag, masC this study
pET-42_masD KmR, GST-tag, His-tag, S-tag, masD this study
pET-42_masE KmR, GST-tag, His-tag, S-tag, masE this study
![Page 34: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/34.jpg)
Purification of (1-methylalkyl)succinate synthase
28
(1-Methylalkyl)succinate synthase activity assay
The assay is based on the identification of (1-methylpentyl)succinate by gas
chromatography coupled to mass spectrometry (GC-MS). Assay preparation and
incubation was performed under anoxic conditions. The sample volume was 0.5 ml of
protein fraction after each chromatography step respectively crude extract of strain
HxN1. For stabilization of (1-methylalkyl)succinate synthase, the assay contained
50 mg ml–1 bovine serum albumin (BSA). As substrates, 6% (v/v) n-hexane and
40 mM fumarate were added. Alternative substrates (n-alkanes from C5 to C12,
cyclopentane, cyclohexane and toluene) to determine the substrate range of
(1-methylalkyl)succinate synthase in crude extract were added to a final concentration of
2% (v/v). In case of n-butane, the assay was flushed with the gas. The activity assays
were incubated with agitation at 28 °C for 16 h and then stopped by adding
20 µl 50% sulfuric acid. Sebacic acid buffered in 200 mM Tris-HCl, pH 8.0 in a final
concentration of 100 µM served as internal standard. Methylation of free carboxylic acid
groups was performed by adding 100 µl 0.25 M trimethylsulfoniumhydroxide (TMSH) and
incubation for 20 min at 99 °C in a water bath. After cooling, the ester of the
(1-methylpentyl)succinate was extracted with n-hexane, concentrated to 100 µl and then
analyzed by GC-MS on a type 5890 gas chromatograph (Hewlett Packard, Waldbronn,
Germany) connected to a type 95SQ mass spectrometer (Finnigan MAT/Thermoquest,
Egelsbach, Germany). For separation, 1 µl of sample was loaded splitless by means of
an autosampler onto an OPTIMA 5MS capillary column (30 m long, 0.25 µm film
thickness, Macherey-Nagel Düren, Germany). The temperature of the injector was set to
250 °C. Helium served as carrier gas. The GC program was as follows: The initial
column temperature was 130 °C with a hold time of 3 min. At the first chute, the column
temperature was set to 175° C with a heating rate of 4 °C min–1 and a hold time of 6 sec.
At the second chute, the column temperature was set to 280 °C with a heating rate of
30 °C min–1 and a hold time of 1 min. The mass spectrometer was operated in electron
impact mode. Identification of (1-methylpentyl)succinate was achieved by comparing
spectra and retention time with those previously published (Rabus et al., 2001).
Amplification of mas genes in the bacterial strains OcN1, Pnd3 and TD3
Chromosomal DNA was isolated with the Qiagen chromosomal DNA Kit according to the
instructions (Qiagen, Hilden, Germany). For strain OcN1, a fosmid library was
constructed with the CopyControl Fosmid Library Production Kit (Epicentre, Madison,
USA). Obtained fosmid clones were transferred from solid medium onto nylon
membranes (Hybond-N+, GE Healthcare). For the following steps the membranes were
![Page 35: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/35.jpg)
Purification of (1-methylalkyl)succinate synthase
29
in each case incubated for 5 min on soaked Whatman paper. Cells were lysed with 10%
SDS. Denaturation of the DNA was performed with 1.5 M NaCl, 0.5 M NaOH, following
neutralization with 1.5 M NaCl, 0.5 M Tris-HCl, pH 7.4. Afterwards, the membranes were
incubated with 2x SSPE (20 mM NaH2PO4, 0.3 M NaCl, 2 mM EDTA). The DNA was
immobilized on the membrane by UV irradiation at 254 nm for 2 min at 1.5 J cm–2
(Biolink DNA Crosslinker, Biometra, Göttingen, Germany). A specific probe was obtained
by polymerase chain reaction (PCR) with degenerated primers (table 3) on chromosomal
DNA of strain OcN1. The probe was labeled with [α-33P]-dATP using the HexaLabel DNA
Labeling Kit (Fermentas). Hybridization was performed over night at 65 °C in Church
buffer (1% (w/v) BSA, 7% (w/v) SDS, 1 mM EDTA, 250 mM NaHPO4, pH 7.2).
Radioactive signals were detected with a Storage Phosphor Screen (GE, Healthcare)
and analyzed on a phosphoimager (Typhoon, GE Healthcare). One out of 56 positive
clones was sequenced by GATC (Konstanz, Germany). For the strains Pnd3 and TD3,
mas sequences were amplified with degenerated primers based on the assA1 and
assA2 sequences of strain AK-01 (table 3). The obtained PCR products were sequenced
with the Big Dye terminator cycle sequencing kit (Applied Biosystems, Darmstadt,
Germany) on a 3130XL Genetic Analyzer (Applied Biosystems). Sequence assembly
was performed with the Lasergene software (DNASTAR, Konstanz, Germany).
Table 3 Oligonucleotide primers for amplification of (partial) mas genes in the strains OcN1,
Pnd3, and TD3.
Primer
Target strain
Target gene
Sequence (5´→ 3´)
Product length [bp]
masD_OcN1_f OcN1 masD TWYGASGAKAAGAAGTACAC ~ 500
masD_OcN1_r MMGTTGAACTGNAYRTGRTC
masD_Pnd3_f Pnd3 masD AATGGTGGTGGRTSGCKGAA 2384
masD_Pnd3_r AAAGTGKGCGCTGTADCCVG
masGD_Pnd3_f Pnd3 masG to masD ATGGCCAATGCCTGCTTGAT 3246
masGD_Pnd3_r AGGGCGTATTCCACCATCTT
masDE_Pnd3_f Pnd3 masD to masE CTCGGCCGTTTTGAAATCCT 1127
masDE_Pnd3_r GATTTCCAATCCGTGTTCCG
masB_TD3_f TD3 masB GTBCCMGAGMAGGCRTGYGG 224
masB_TD3_r TCGTKRCCRTCSGTATCRAT
masD_TD3_f TD3 masD AATGGTGGTGGRTSGCKGAA 2379
masD_TD3_r AAAGTGKGCGCTGTADCCVG
![Page 36: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/36.jpg)
Purification of (1-methylalkyl)succinate synthase
30
Results and Discussion
Development of an in vitro activity assay for (1-methylalkyl)succinate synthase
The activation mechanism of (1-methylalkyl)succinate synthase was postulated based
on metabolites identified in cells anaerobically grown with n-alkanes (Kropp et al., 2000;
Rabus et al., 2001; Cravo-Laureau et al., 2005; Davidova et al., 2005; Callaghan et al.,
2006). An in vitro assay was developed to confirm the proposed n-alkane activation and
the involvement of the genetically identified (1-methylalkyl)succinate synthase
(Callaghan et al., 2008; Grundmann et al., 2008). The assay detects the activation
product (1-methylalkyl)succinate by GC-MS analysis (Fig. 1). To verify the efficiency of
the methylation, the C10 dicarboxylic acid sebacic acid served as internal standard. In
addition, chemically synthesized (1-methylpentyl)succinate, kindly provided by Dr.
Dauelsberg (University of Applied Science, Emden), was used to calibrate the GC-MS
detection. Obviously, most of the (1-methylpentyl)succinate was incompletely methylated
and eluted after 10.3 min (Fig. 1). Minor amounts were fully methylated, which eluted
after 7.9 min.
Retention time [min]
Rel
ativ
e ab
unda
nce
[%]
100
0
50
8 10 1412
Sebacic acid methylated
Methylpentylsuccinic acidfully methylated
Methylpentylsuccinic acid,incompletely methylated
100
0
50
8 10 1412
Sebacic acid methylated
Methylpentylsuccinic acidfully methylated
Methylpentylsuccinic acid,incompletely methylated
1412108
100
50
0
(1-methylpentyl)succinic acid,
incompletely methylatedsebacic acid,
methylated
(1-methylpentyl)succinic
acid, fully methylated
Retention time [min]
Rel
ativ
e ab
unda
nce
[%]
100
0
50
8 10 1412
Sebacic acid methylated
Methylpentylsuccinic acidfully methylated
Methylpentylsuccinic acid,incompletely methylated
100
0
50
8 10 1412
Sebacic acid methylated
Methylpentylsuccinic acidfully methylated
Methylpentylsuccinic acid,incompletely methylated
1412108
100
50
0
(1-methylpentyl)succinic acid,
incompletely methylatedsebacic acid,
methylated
(1-methylpentyl)succinic
acid, fully methylated
Fig. 1 Separation of methylated products of (1-methylalkyl)succinate synthase activity assay by
gas chromatography. Grey: fully and incompletely methylated (1-methylpentyl)succinic acid after
incubation with n-hexane; black: control without n-hexane. Sebacic acid was added as internal
standard.
Typical m/z ions of single and double methylated (1-methylpentyl)succinate are depicted
in Fig. 2. Most characteristic for (1-methylpentyl)succinic acid is the m/z 114 ion. Further
abundant ions of the fully methylated form are the m/z 146, 157 and 199 ions, whereas
in the incompletely methylated form the m/z 100, 143 and 185 ions are present. Attempts
![Page 37: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/37.jpg)
Purification of (1-methylalkyl)succinate synthase
31
to optimize the methylation efficiency of TMSH remained unsuccessful, although sebacic
acid, as control in each sample, was always fully methylated. Anyhow, TMSH was taken
as methylation reagent because of its advantages in handling and the possibility to
specifically detect the partially methylated form.
m/z60 80 100 120 140 160 180 200 220 240 260
m/z
010
2030
405060
708090100
114
157146
1998569
231171
Rel
ativ
e A
bund
ance
[%]
96125
a)
185
60 80 100 120 140 160 180 200 220 240 2600
10
2030405060708090
100
Rel
ativ
e A
bund
ance
[%]
114
14385
12569151 199 245
100
b)
c) d)
m/z60 80 100 120 140 160 180 200 220 240 260
m/z
010
2030
405060
708090100
114
157146
1998569
231171
Rel
ativ
e A
bund
ance
[%]
96125
a)
60 80 100 120 140 160 180 200 220 240 260
m/z
010
2030
405060
708090100
010
2030
405060
708090100
114
157146
1998569
231171
Rel
ativ
e A
bund
ance
[%]
96125
a)
185
60 80 100 120 140 160 180 200 220 240 2600
10
2030405060708090
100
Rel
ativ
e A
bund
ance
[%]
114
14385
12569151 199 245
100
b)
185
60 80 100 120 140 160 180 200 220 240 2600
10
2030405060708090
100
010
2030405060708090
100
Rel
ativ
e A
bund
ance
[%]
114
14385
12569151 199 245
100
b)
c) d)c) d)
Fig. 2 Mass spectra of (1-methylpentyl)succinic acid. a) Characteristic peaks of the fully
methylated (1-methylpentyl)succinic acid. b) Characteristic peaks of the incompletely methylated
(1-methylpentyl)succinic acid. c) Fragment pattern of the fully methylated form. d) Fragment
pattern of the incompletely methylated form.
The activity assay was optimized regarding temperature and time. In crude extracts of
strain HxN1, the highest activity of (1-methylalkyl)succinate synthase was measured
between 12 and 42 °C with a maximum at around 32 °C (Fig. 3a). This temperature was
expected for an enzyme of a mesophilic organism with an optimal growth rate at about
28°C. As determined by an Arrhenius plot, the activation energy is 100 kJ mol –1 (data
not shown). Measurement of enzyme activity over time resulted in a stable production
rate of (1-methylpentyl)succinate within the first five hours (Fig. 3b), independent of the
starting activity (data not shown). After eight hours, about 95% of the product amount,
which is produced within 24 hours of incubation, has already formed.
![Page 38: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/38.jpg)
Purification of (1-methylalkyl)succinate synthase
32
a) b)
Time [h]0 5 10 15 20 25(1
-met
hylp
enty
l)suc
cina
te [µ
M]
0
100
200
300
400
Temperature [°C]0 10 20 30 40 50
Act
ivity
[nka
t]
0
5
10
15
20
25a) b)
Time [h]0 5 10 15 20 25(1
-met
hylp
enty
l)suc
cina
te [µ
M]
0
100
200
300
400
Temperature [°C]0 10 20 30 40 50
Act
ivity
[nka
t]
0
5
10
15
20
25
Fig. 3 Dependence of (1-methylalkyl)succinate synthase activity from temperature and time. a) Activity of (1-methylalkyl)succinate synthase plotted against temperature. b) Activity of
(1-methylalkyl)succinate synthase expressed in the amount of formed product as a function of
time.
Effect of nitrate and nitrite on in vitro enzyme activity
Usually, cells are most active in the logarithmic phase and thus, proteins are purified
from log phase cells. However, (1-methylalkyl)succinate synthase was inactive in crude
extracts of strain HxN1, when harvested in its log phase. In the beginning, the cells were
harvested when the cultures had a doubling time of around 9 hours, which is on the level
of optimal growth for strain HxN1 in batch culture (11 hours) as described by Ehrenreich
et al. (2000). Additionally, nitrate and nitrite measurements were performed in the
supernatant of the culture by high performance liquid chromatography. Within the log
phase (OD600 0.6-1.5), nitrate was added continuously up to a rate of 1 mM h–1, but
neither nitrate nor nitrite were detectable (detection limit is lower than 5 µM), supporting
the hypothesis of a high metabolic activity of strain HxN1 at this state. However, no
enzymatic activity was measured. The lack of enzymatic activity suggests inhibition or
inactivation of (1-methylalkyl)succinate synthase during cell harvesting or disruption.
Thus, harvesting conditions were modified to receive active (1-methylalkyl)succinate
synthase. Enzyme activity was identified in crude extracts from cultures, which were
starved for nitrate at least three hours before harvesting, but the obtained activity was
with up to 0.45 fkat mg–1 protein more than 30 000 fold lower than expected from the
nitrate consumption of the culture (14 nkat mg–1 protein). The very low measured in vitro
activity is comparable to the low in vitro activities reported for benzylsuccinate synthases
in crude extract of T. aromatica (0.3 - 3 fkat mg–1 protein) (Leuthner et al., 1998) and in
crude extract of Azoarcus sp. Strain T (98 fkat mg–1 protein) (Beller & Spormann, 1999),
which are, compared to their growth rates, 200 - 1000 fold lower.
![Page 39: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/39.jpg)
Purification of (1-methylalkyl)succinate synthase
33
The observation that nitrate starvation
before cell harvesting results in
measurable enzyme activity suggests an
influence of nitrate reduction products to
enzyme inhibition. For example, S-
nitrosylation of proteins by nitric oxide is
described as a known regulatory effect
on protein activity (Broillet, 1999). Native
benzylsuccinate synthase in cell extract
of T. aromatica was shown to be
completely inhibited by a 280 µM nitric
oxide solution (Feil, 2006). Inhibition
studies with nitric oxide on crude extract
of strain HxN1 are shown in Fig. 4. The nitric oxide source was a fresh prepared water
solution and as control only water was used. Nitric oxide concentrations of 500 to
1000 µM showed a clear inhibition of the (1-methylalkyl)succinate synthase activity. At
higher concentrations (1500 µM) the effect interferes with the inhibition of the enzyme by
dilution. One explanation for the higher nitric oxide resistance in comparison to the
purified benzylsuccinate synthase is the high protein concentration (up to 50 mg ml–1) in
the crude extract, which traps the nitric oxide before reacting with
(1-methylalkyl)succinate synthase. As consequence, log phase grown cultures were
generally harvested after nitrate starvation for three to four hours to allow metabolization
of possible inhibitory substances of the nitrate reduction pathway.
In vitro substrate range of (1-methylalkyl)succinate synthase
In growth experiments, strain HxN1 was able to grow with n-hexane, -heptane and
-octane as sole carbon and energy source under denitrifying conditions (Ehrenreich et
al., 2000). Activity tests of crude extract from cells anaerobically grown with n-hexane
identified additional to these three alkanes the succinated products of n-pentane and
cyclopentane (Fig. 5), whereas n-butane, -nonane, -decane, -undecane, -dodecane,
cyclohexane and toluene showed no corresponding activation products. However, the
amount of the succinated products from n-pentane and cyclopentane are strongly
reduced to 5% respectively 2.5% in comparison to n-hexane (Fig. 5).
Fig. 4 Inhibition of (1-methylalkyl)succinate
synthase by nitric oxide. Black: enzyme assays
supplemented with NO; white: controls without
NO, diluted with the equal amount of water.
NO concentration [µM] 100 500 1000 1500
Act
ivity
[nka
t]
0.0
0.5
1.0
1.5
2.0
![Page 40: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/40.jpg)
Purification of (1-methylalkyl)succinate synthase
34
Fig. 5 Substrate range of
(1-methylalkyl)succinate synthase of
strain HxN1 in the activity assay.
n-Pentane, -hexane, -heptane, -octane
and cyclo-pentane were activated by
addition to fumarate to a succinated
product. The amount of formed
methylpentylsuccinate (55 µM) was set
as reference to 100%.
To investigate, whether activation of n-pentane and cyclopentane results in complete
oxidation, growth of strain HxN1 on n-pentane respectively cyclopentane was tested.
Strain HxN1 was able to grow with n-pentane but not with cyclopentane (Fig. 6). Growth
with n-pentane is characterized by a longer lag phase and a doubling time, which is 3.5
to 4 fold lower than growth with n-hexane. Obviously, n-pentane is oxidized completely,
but growth is retarded, compared to n-hexane, because (1-methylalkyl)succinate
synthase has a lower affinity towards n-pentane.
Time [h]
0 100 200 300 400 500 600 700
Opt
ical
den
sity
600
nm
0.0
0.2
0.4
0.6
0.8
1.0n-hexanen-hexane, cyclopentanen-pentanecyclopentanenegative control
cyclopentane added
Time [h]
0 100 200 300 400 500 600 700
Opt
ical
den
sity
600
nm
0.0
0.2
0.4
0.6
0.8
1.0n-hexanen-hexane, cyclopentanen-pentanecyclopentanenegative control
cyclopentane added
Fig. 6 Time course of growth of strain HxN1 with n-hexane, n-pentane and cyclopentane.
n-Hexane is consumed after a lag phase of around 72 hours, but is inhibited by addition of
cyclopentane (indicated with an arrow). Strain HxN1 is unable to grow with cyclopentane. Growth
with n-pentane is characterized by a considerably longer lag phase of around ten days and a
lower doubling time compared to grow with n-hexane.
Hydrocarbon substrate
C5 C6 C7 C8 cyclo-C5
Succ
inat
ed p
rodu
ct
[% to
(1-m
ethy
lpen
tyl)s
ucci
nate
]
0
20
40
60
80
100
120
140
C5 C6 C7 C8 cyclo-C5
Hydrocarbon substrate
C5 C6 C7 C8 cyclo-C5
Succ
inat
ed p
rodu
ct
[% to
(1-m
ethy
lpen
tyl)s
ucci
nate
]
0
20
40
60
80
100
120
140
C5 C6 C7 C8 cyclo-C5
![Page 41: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/41.jpg)
Purification of (1-methylalkyl)succinate synthase
35
Probably, activation of cyclopentane results in a death end product, which is not further
oxidized to CO2, due to a missing enzyme for cleavage of the cyclic structure.
Interestingly, growth with n-hexane was inhibited by addition of cyclopentane after seven
days (white dots in Fig. 6), whereas in a control experiment cyclopentane did not inhibit
growth of strain HxN1 on caproate (data not shown). This control experiment excluded
toxicity of cyclopentane onto growth in general. It rather seems that degradation of
n-hexane is prohibited by a metabolite of cyclopentane, which blocks the active centre of
an enzyme needed for n-hexane degradation. This might even be the
(1-methylalkyl)succinate synthase itself. Thus, the substrate range of the
(1-methylalkyl)succinate synthase is not the only limiting factor for growth of strain HxN1
with n-alkanes.
Purification of (1-methylalkyl)succinate synthase from strain HxN1
In contrast to the benzylsuccinate synthases for anaerobic toluene activation, anaerobic
alkane activating proteins have not been purified so far. Here, a purification protocol for
the (1-methylalkyl)succinate synthase from strain HxN1 is described. Exemplarily, a cell
extract with a specific activity of 0.087 fkat mg–1 protein was applied to an ANX column.
The eluted protein fraction showed no (1-methylalkyl)succinate synthase activity. After
buffer exchange from 250 mM NaCl, 100 mM Tris-HCl, pH 8.0 to 50 mM
NaH2PO4/Na2HPO4, pH 8.0 on a desalting column, the enzyme activity was recovered to
0.065 fkat mg–1 protein (Table 4). For further purification, the protein fraction was loaded
onto a hydroxyapatite column, resulting in a specific activity of 0.03 fkat mg–1 protein in
the eluted protein fraction. After purification 99.5% of the initial activity was lost. The
obtained data for purification of the (1-methylalkyl)succinate synthase are comparable to
the benzylsuccinate synthase from T. aromatica (Leuthner et al., 1998) and from
Azoarcus sp. Strain T (Beller & Spormann, 1999), where a loss of 98–99% respectively
99.3% was reported.
Table 4 Purification of (1-methylalkyl)succinate synthase from strain HxN1.
Purification step
Volume [ml]
Protein [mg]
Activity [fkat]
Specific activity [fkat mg–1 protein]
Yield [%]
Crude extract 12 533 46 0.086 100
ANX (+G25) 24 80 5.2 0.065 11.2
Hydroxyapatite 5 7.5 0.23 0.03 0.5
SDS-PAGE analysis of cell extract and ANX as well as hydroxyapatite chromatography
fraction represents purification of a prominent band with a size of ~ 94 kDa (Fig. 7a). The
![Page 42: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/42.jpg)
Purification of (1-methylalkyl)succinate synthase
36
size corresponds well to the proposed MasD protein as α-subunit of
(1-methylalkyl)succinate synthase (Grundmann et al., 2008). This assumption was
confirmed by Western blotting with immune serum against the α-subunit and peptide
mass fingerprint analysis, which clearly identified the protein band as MasD (data not
shown). During purification of the benzylsuccinate synthase from T. aromatica half the
amount of the α-subunit was cleaved oxygenolytically, resulting in a truncated α´-subunit
with a size of ~ 90 kDa (Leuthner et al., 1998). Obviously, only one of the two catalytic
subunits of the holoenzyme is present in its active state (Knappe & Sawers, 1990;
Leuthner et al., 1998). A truncated α´-subunit of the (1-methylalkyl)succinate synthase
was, however, not observed.
The small β- and γ-subunits, which are proposed to be encoded by the genes masE (β)
and masC (γ) (Grundmann et al., 2008) were not clearly separated by SDS-PAGE
(Fig. 7a) neither by tricine-SDS-PAGE (data not shown) due to their small size and low
difference in mass (β-subunit: 8 kDa; γ-subunit: 7 kDa). Their presence in the purified
fractions was hence displayed by Western blot using immune serum against the β- and
γ-subunit (Fig. 7b, c). Signals were visible in cell extract of HxN1 cells grown with
n-hexane as well as in ANX and hydroxyapatite fractions. The occurrence of a second
band in the reaction of the immune serum against the γ-subunit with crude extract
probably represents a cross-reaction with another protein (Fig. 7c).
Fig. 7 Purification of (1-methylalkyl)succinate
synthase from strain HxN1. a) SDS-PAGE of
cell extract of HxN1 grown on n-hexane and
fractions obtained during purification of
(1-methylalkyl)succinate synthase. Lane 1:
pre-stained protein ladder; lane 2: cell extract;
lane 3: ANX fraction; lane 4: hydroxyapatite
fraction. The subunits are labeled with MasD
and MasB. The subunits MasC and MasE are
not clearly separated since they run with the
front. b, c) Western Blot for identification of
MasE (b) and MasC (c) in extract of HxN1
cells grown with n-hexane and purification
fractions containing (1-methylalkyl)succinate
synthase. Lane 1: pre-stained protein ladder;
lane 2: cell extract; lane 3: ANX fraction;
lane 4: hydroxyapatite fraction.
1 2 3 4
b)
1 2 3 4
10 kDa MasE (β-subunit)
c)
10 kDa MasC (γ-subunit)
1 2 3 4
MasB
MasC & MasE?
a)
MasD (α-subunit)
100 kDa
10 kDa
70 kDa
15 kDa
1 2 3 4
b)
1 2 3 4
10 kDa MasE (β-subunit)
c)
10 kDa MasC (γ-subunit)
1 2 3 4
MasB
MasC & MasE?
a)
MasD (α-subunit)
100 kDa
10 kDa
70 kDa
15 kDa
![Page 43: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/43.jpg)
Purification of (1-methylalkyl)succinate synthase
37
(1-methylalkyl)succinate synthases contain an additional subunit compared to anaerobic aromatic hydrocarbon activating enzymes
In addition to MasD, a fourth protein with a size of ~ 13 kDa was displayed in SDS-PAGE
analysis of purification steps (Fig. 7a). The close association of another protein to
(1-methylalkyl)succinate synthase from strain HxN1 after its purification is a strong
evidence that this protein represents an additional subunit of (1-methylalkyl)succinate
synthase. Determination of the molecular weight by gel filtration chromatography
revealed a mass of 240 kDa ± 10% for (1-methylalkyl)succinate synthase (data not
shown). This is in between the masses so far determined for benzylsuccinate synthases.
For T. aromatica a mass of 220 ± 20 kDa (Leuthner et al., 1998) and for Azoarcus sp.
Strain T a mass of 260 kDa is reported (Beller & Spormann, 1999). Based on the native
molecular mass and the sizes of the three subunits an α2β2γ2 composition was proposed
for benzylsuccinate synthase (Leuthner et al., 1998). The mass of
(1-methylalkyl)succinate synthase also fits in this holoenzyme composition. However, an
α2β2γ2δ2 composition, assuming the existence of four different subunits, is in accordance
with the molecular mass of 240 kDa ± 10% determined for (1-methylalkyl)succinate
synthase of strain HxN1 as well.
The 13 kDa protein was identified as MasB by peptide mass fingerprint analysis. A
function of MasB had not been proposed before. The encoding gene is localized within
the mas operon upstream of the genes encoding the subunits of (1-methylalkyl)succinate
synthase (Grundmann et al., 2008). Despite two similar genes in the two ass operons of
Desulfatibacillum alkenivorans strain AK-01 related sequences are unknown (Callaghan
et al., 2008). The MasB homologues AssB1 and AssB2 of strain AK-01 were annotated
as β-subunits of the enzyme (Callaghan et al., 2012). In comparison with the β-subunits
of benzylsuccinate synthase (BssB), AssB1 and AssB2 show a similar distribution of
cysteines, which are supposed to arrange a Fe-S cluster in benzylsuccinate synthases
(Callaghan et al., 2012; Hilberg et al., 2012). Nevertheless, we stick to MasE as
β-subunit because its size and the orientation of the encoding gene are consistent with
the β-subunit of benzylsuccinate synthase (Grundmann et al., 2008). The size of MasE
(8 kDa) fits much better with the sizes of the β-subunits from the toluene and
2-methlynaphthalene activating enzymes (9 kDa) than MasB and AssB with a size of
13 kDa. In bss operons, the β-subunit encoding gene is located downstream of the
α-subunit encoding gene. The same pattern is also present in the mas operon of strain
HxN1 and the nms operon of 2-methylnaphthalene degrading strains (Fig. 8) (Selesi et
al., 2010). Thus, the gene downstream of masD was determined to code for the
β-subunit in strain HxN1 (Grundmann et al., 2008). Additionally, MasE contains four
![Page 44: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/44.jpg)
Purification of (1-methylalkyl)succinate synthase
38
cysteines as well. An alignment with protein sequences of BssB, MasB, MasE, AssB and
potential AssE subunits did not elucidate a phylogenetic relationship of BssB to
MasB/AssB or to MasE/AssE, because identities were only between 7% and 14.6%
(data not shown). Thus, it remains unclear if MasB or MasE should be regarded as
homologue of BssB.
So far, full sequence data for potential n-alkane activating enzymes were only available
for the strains HxN1 and AK-01. To expand the number of sequence data, we
constructed a fosmid library of strain OcN1, a nitrate reducer, which degrades n-alkanes
with a chain length from C8 to C12 (Ehrenreich et al., 2000). By usage of a degenerated
masD probe, a mas operon was identified in fosmid clones of strain OcN1. The
assembly of the genes was similar to the mas operon of strain HxN1 (Fig. 8) and the
gene product of one ORF showed 74% sequence identity to MasB of strain HxN1.
Azoarcus sp. HxN1
Aromatoleum (ex Azoarcus) sp. OcN1
Desulfatibacillum alkenivorans AK-01
Desulfatibacillum sp. Pnd3
1000 bp
masEmasC masD masF masGmasB
masGmasEmasDmasCmasB
masDmasB masC masE
assA
assAassD
assD assD´ assC
assC
masG
Aromatoleum aromaticum EbN1bssAbssCbssD bssB
nmsAnmsCnmsD nmsBenrichment culture N47
masA
Desulfothermus naphthae TD3masB masD
Azoarcus sp. HxN1
Aromatoleum (ex Azoarcus) sp. OcN1
Desulfatibacillum alkenivorans AK-01
Desulfatibacillum sp. Pnd3
1000 bp1000 bp
masEmasC masD masF masGmasB
masGmasEmasDmasCmasB
masDmasB masC masE
assA
assAassD
assD assD´ assC
assC
masG
Aromatoleum aromaticum EbN1bssAbssCbssD bssB
nmsAnmsCnmsD nmsBenrichment culture N47
masA
Desulfothermus naphthae TD3masB masD
Fig. 8 Genes potentially involved in the anaerobic n-alkane activation in denitrifying (HxN1,
OcN1) and sulfate-reducing bacteria (AK-01, Pnd3, TD3) compared to the genes of strain EbN1
as example for anaerobic toluene activation and the enrichment culture N47 as example for
2-methylnaphthalene activation. Orange: genes possibly encoding a fourth subunit of the
n-alkane activating enzyme (masB); dark blue: genes encoding the catalytic subunit (masD, assA,
bssA, nmsA); light blue: small subunits (masC, assC, bssC, nmsC and masE, bssB, nmsB); blue-
striped: genes encoding the protein-activating SAM-enzyme (masG, assD, bssD, nmsD).
By PCR with degenerated primers, a full sequence masB homologue was also identified
in the sulfate-reducing strain Pnd3 and a partial sequence was obtained for the
![Page 45: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/45.jpg)
Purification of (1-methylalkyl)succinate synthase
39
thermophilic sulfate-reducing strain TD3 (Fig. 8) (Rueter et al., 1994; Aeckersberg et al.,
1998). The gene product of strain Pnd3 was 73% and of the partial MasB sequence of
strain TD3 was 50% identical to the MasB protein of strain HxN1. In strain Pnd3 genes
encoding the α-, β- and γ-subunit of the alkane activating enzyme and a gene for its
activating enzyme were identified by PCR, revealing a similar organization of the genes
as in the ass1 operon of strain AK-01 (Fig. 8). An incomplete sequence of masD was
amplified in strain TD3 with degenerated primers as well, while amplification of masC
and masE sequences remained unsuccessful. Therefore, the position of the masB and
masD genes to each other could not be resolved for strain TD3. A gene similar to masB
is absent in all known bss/tut operons of anaerobic toluene degrading bacteria (Fig. 8).
Conclusion
Purification of (1-methylalkyl)succinate synthase from strain HxN1 revealed a new fourth
subunit of this enzyme. Homologues of this subunit were identified in all other
investigated alkane degrading bacteria, which activate n-alkanes by addition to fumarate,
suggesting that (1-methylalkyl)succinate synthases are the first known glycyl radical
enzymes with an α2β2γ2δ2 composition. The existence of a fourth subunit distinguishes
(1-methylalkyl)succinate synthases from benzylsuccinate synthases. We conclude that
MasB is needed specifically for the activation of n-alkanes by addition to fumarate,
independently from the electron acceptor and the length of n-alkanes which are
degraded.
Acknowledgement
This work was supported by the Max-Planck-Gesellschaft.
References
Aeckersberg, F., Rainey, F.A. & Widdel, F. (1998) Growth, natural relationships, cellular
fatty acids and metabolic adaptation of sulfate-reducing bacteria that utilize long-
chain alkanes under anoxic conditions. Arch. Microbiol. 170: 361−369.
Beller, H.R. & Spormann, A.M. (1999) Substrate range of benzylsuccinate synthase from
Azoarcus sp. strain T. FEMS Microbiol. Lett. 178: 147−153.
Broillet, M.C. (1999) S-nitrosylation of proteins. Cell. Mol. Life Sci. 55: 1036−1042.
![Page 46: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/46.jpg)
Purification of (1-methylalkyl)succinate synthase
40
Callaghan, A.V., Gieg, L.M., Kropp, K.G., Suflita, J.M. & Young, L.Y. (2006) Comparison
of mechanisms of alkane metabolism under sulfate-reducing conditions among two
bacterial isolates and a bacterial consortium. Appl. Environ. Microbiol. 72: 4274−
4282.
Callaghan, A.V., Wawrik, B., Ni Chadhain, S.M., Young, L.Y. & Zylstra, G.J. (2008)
Anaerobic alkane-degrading strain AK-01 contains two alkylsuccinate synthase
genes. Biochem. Biophys. Res. Commun. 366: 142−148.
Callaghan, A.V., Morris, B.E., Pereira, I.A., McInerney, M.J., Austin, R.N., Groves, J.T. et
al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: a
blueprint for anaerobic alkane oxidation. Environ. Microbiol. 14: 101−113.
Cravo-Laureau, C., Grossi, V., Raphel, D., Matheron, R. & Hirschler-Réa, A. (2005)
Anaerobic n-alkane metabolism by a sulfate-reducing bacterium, Desulfatibacillum
aliphaticivorans strain CV2803T. Appl. Environ. Microbiol. 71: 3458−3467.
Davidova, I.A., Gieg, L.M., Nanny, M., Kropp, K.G. & Suflita, J.M. (2005) Stable isotopic
studies of n-alkane metabolism by a sulfate-reducing bacterial enrichment culture.
Appl. Environ. Microbiol. 71: 8174−8182.
Ehrenreich, P. (1996) Anaerobes Wachstum neuartiger sulfatreduzierender und
nitratreduzierender Bakterien auf n-Alkanen und Erdöl. Dissertation, Universität
Bremen.
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Ettwig, K.F., Butler, M.K., Le Paslier, D., Pelletier, E., Mangenot, S., Kuypers, M.M. et al.
(2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature
464: 543−548.
Feil, C. (2006) Biochemie des anaeroben Toluol-Stoffwechsels von Thauera aromatica.
Dissertation, Universität Darmstadt.
Grundmann, O., Behrends, A., Rabus, R., Amann, J., Halder, T., Heider, J. & Widdel, F.
(2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes
in the denitrifying bacterium, strain HxN1. Environ. Microbiol. 10: 376−385.
Hilberg, M., Pierik, A.J., Bill, E., Friedrich, T., Lippert, M.L. & Heider, J. (2012)
Identification of FeS clusters in the glycyl-radical enzyme benzylsuccinate synthase
via EPR and Mossbauer spectroscopy. J. Biol. Inorg. Chem. 17: 49−56.
Knappe, J. & Sawers, G. (1990) A radical-chemical route to acetyl-CoA: the
anaerobically induced pyruvate formate-lyase system of Escherichia coli. FEMS
Microbiol. Rev. 6: 383−398.
![Page 47: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/47.jpg)
Purification of (1-methylalkyl)succinate synthase
41
Kropp, K.G., Davidova, I.A. & Suflita, J.M. (2000) Anaerobic oxidation of n-dodecane by
an addition reaction in a sulfate-reducing bacterial enrichment culture. Appl.
Environ. Microbiol. 66: 5393−5398.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680−685.
Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E. et al. (1998)
Biochemical and genetic characterization of benzylsuccinate synthase from
Thauera aromatica: a new glycyl radical enzyme catalysing the first step in
anaerobic toluene metabolism. Mol. Microbiol. 28: 615−628.
Rabus, R. & Widdel, F. (1995) Anaerobic degradation of ethylbenzene and other
aromatic hydrocarbons by new denitrifying bacteria. Arch. Microbiol. 163: 96−103.
Rabus, R., Wilkes, H., Behrends, A., Armstroff, A., Fischer, T., Pierik, A.J. & Widdel, F.
(2001) Anaerobic initial reaction of n-alkanes in a denitrifying bacterium: Evidence
for (1-methylpentyl)succinate as initial product and for involvement of an organic
radical in n-hexane metabolism. J. Bacteriol. 183: 1707−1715.
Rojo, F. (2009) Degradation of alkanes by bacteria. Environ. Microbiol. 11: 2477−2490.
Rueter, P., Rabus, R., Wilkes, H., Aeckersberg, F., Rainey, F.A., Jannasch, H.W. &
Widdel, F. (1994) Anaerobic oxidation of hydrocarbons in crude oil by new types of
sulphate-reducing bacteria. Nature 372: 455−458.
Selesi, D., Jehmlich, N., von Bergen, M., Schmidt, F., Rattei, T., Tischler, P. et al. (2010)
Combined genomic and proteomic approaches identify gene clusters involved in
anaerobic 2-methylnaphthalene degradation in the sulfate-reducing enrichment
culture N47. J. Bacteriol. 192: 295−306.
Tissot, B.P. & Welte, D.H. (1984) Petroleum formation and occurence. Berlin, Germany:
Springer Verlag.
Widdel, F. & Rabus, R. (2001) Anaerobic biodegradation of saturated and aromatic
hydrocarbons. Curr. Opin. Biotechnol. 12: 259−276.
Widdel, F., Knittel, K. & Galushko, A. (2010) Anaerobic hydrocarbon-degrading
microorganisms: an overview. In Handbook of hydrocarbon and lipid microbiology.
Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 1998−2021.
Zedelius, J., Rabus, R., Grundmann, O., Werner, I., Brodkorb, D., Schreiber, F. et al.
(2011) Alkane degradation under anoxic conditions by a nitrate-reducing bacterium
with possible involvement of the electron acceptor in substrate activation. Environ.
Microbiol. Rep. 3: 125−135.
![Page 48: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/48.jpg)
42
![Page 49: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/49.jpg)
43
2. Bericht Attempts to crystallize (1-methylalkyl)succinate synthase of strain HxN1 and alternative strategies for protein purification Dieser Bericht enthält zusätzliche Ergebnisse für die (1-Methylalkyl)succinat-Synthase,
die nicht Bestandteil eines Manuskriptes sind.
Summary
The (1-methylalkyl)succinate synthase of strain HxN1, which was purified according to
the protocol established by Schmitt et al. (unpublished results), crystallized to many thin
needles. Modifications of the crystallization conditions did not lead to the formation of
larger crystals for the generation of an X-ray structure of (1-methylalkyl)succinate
synthase. Alternative purification strategies comprised immunoaffinity purification of the
native enzyme as well as the purification of tagged (1-methylalkyl)succinate synthase
from Escherichia coli and from strain HxN1. By immunoaffinity, so far only one subunit of
the enzyme was purified. The expression of tagged (1-methylalkyl)succinate synthase in
E. coli resulted in aggregation of most of the enzyme in inclusion bodies. The amount of
(1-methylalkyl)succinate synthase in the soluble fraction was insufficient for its
purification. In strain HxN1 the tagged (1-methylalkyl)succinate synthase was not
expressed.
![Page 50: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/50.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
44
Introduction
The (1-methylalkyl)succinate synthase catalyzes the activation of n-alkanes by addition
to fumarate (Rabus et al., 2001; Grundmann et al., 2008). The inert n-alkane molecules
are activated by insertion of a radical, which is transferred from the catalytic α-subunit
(MasD) of the (1-methylalkyl)succinate synthase to the n-alkane. Oxidative cleavage at
the radical harboring residue inactivates the enzyme irreversibly (Wagner et al., 1992). In
addition to the catalytic subunit MasD, the enzyme consists of three small subunits
(MasB, MasC and MasE), whose function is still unclear (Grundmann et al., 2008;
Schmitt et al., unpublished results). The presence of four subunits is a unique feature of
(1-methylalkyl)succinate synthase, since all other known glycyl radical enzymes do not
exceed three subunits (Schmitt et al., unpublished results). The benzylsuccinate
synthase, catalyzing the addition of toluene to fumarate, consists of only three subunits,
one large catalytic subunit (BssA) and two small subunits (BssB, BssC) (Leuthner et al.,
1998). Due to the presence of Fe-S cluster in the small subunits of benzylsuccinate
synthase, it has been speculated that the small subunits are required for electron
transfer or for structural stabilization of the holoenzyme (Li et al., 2009; Hilberg et al.,
2012).
This study describes attempts to crystallize (1-methylalkyl)succinate synthase that has
been purified from cell extracts of strain HxN1 grown with n-hexane. A crystal structure
of (1-methylalkyl)succinate synthase will illustrate the association of the subunits to each
other and thus, may explain the function of the small subunits. Of special interest is the
fourth subunit MasB, which is not necessary for anaerobic toluene activation. Besides,
alternative purification strategies were developed in order to obtain a more stable protein
for crystallization.
Material and Methods
Bacterial strains and growth conditions
Strain HxN1 was cultivated under denitrifying conditions in defined mineral medium with
n-hexane or caproate as described previously (Rabus & Widdel, 1995; Ehrenreich et al.,
2000). Cultivation in a 50 l fermenter was performed as described by Schmitt et al.
(unpublished results), cultivation on solid medium as described in Webner et al.
(unpublished results). The bacterial Escherichia coli strains used in this study are
described in table 1. They were cultivated at 37 °C in Luria Bertani medium. Antibiotics
![Page 51: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/51.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
45
were added at the following concentrations: ampicillin (50 µg ml–1), chloramphenicol
(20 µg ml–1), kanamycin (45 µg ml–1).
Table 1 Strains used in this study.
Strain Genotype Reference or source
HxN1 wild type Ehrenreich et al. (2000)
E. coli BL21 Star (DE3)
F- ompT hsdSB (rB-mB
-) gal dcm rne131
(DE3)
Invitrogen
(Darmstadt, Germany)
E. coli Lemo21 (DE3)
fhuA2 [lon] ompT gal (λ DE3) [dcm]
∆hsdS/ pLemo(CamR)
λ DE3 = λ sBamHIo ∆EcoRI-B
int::(lacI::PlacUV5::T7 gene1) i21 ∆nin5
pLemo = pACYC184-PrhaBAD-lysY
New England Biolabs
(Ipswich, USA)
E. coli S17-1
thi recA pro hsdR
RP 4-2-Tc::MU-Km::Tn7
Simon et al. (1983)
Cloning of mas genes
Genomic DNA of strain HxN1 was isolated with the DNeasy Blood & Tissue Kit (Qiagen,
Hilden, Germany). The genes masB, masC, masD and masE were amplified by
polymerase chain reaction (PCR) with Phusion High-Fidelity DNA Polymerase
(Finnzymes, Vantaa, Finland). For cloning, the oligonucleotide primers (table 2)
contained recognition sites for restriction enzymes, which were applied according to the
instructions (Fermentas, St. Leon-Rot, Germany). Restricted DNA was purified with the
QIAquick Gel Extraction Kit (Qiagen) from agarose gels or with the QIAquick PCR
Purification Kit (Qiagen). PCR products and plasmids (table 3) were mixed in a 2:1 molar
ratio and ligated with T4 DNA Ligase (Fermentas).
For purification of the (1-methylalkyl)succinate synthase with the glutathione
S-transferase (GST)-tag, the genes were cloned into pET-42a(+) and for purification with
the Strep-tag, they were cloned into pET-51b(+). The genes masBC including the
ribosomal binding site of masB were cloned upstream of the tag-coding sequence, masD
was amplified without its start codon together with masE and cloned in frame behind the
tag to enable purification as a fusion protein (Fig. 1a). To generate
pBBR1MCS-2_masBCDE-Strep for purification of tagged (1-methylalkyl)succinate
synthase from strain HxN1, masBCDE were amplified together with the sequence coding
![Page 52: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/52.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
46
for the Strep-tag from pET-51b_masBCDE and ligated into pBBR1MCS-2 under the
control of the T7 promoter (Fig. 1b).
The plasmids pET-42a_masBCDE and pET-51b_masBCDE were transformed into
chemically competent E. coli BL21 Star (DE3) or Lemo21 (DE3) cells according to Inoue
et al. (1990) and cultivated as described above. pBBR1MCS-2_masBCDE-Strep was
transferred by conjugation from E. coli S17-1 into strain HxN1 as described by Webner
et al. (unpublished results). To confirm the correct insert, the plasmids were sequenced
with the BigDye v3.0 terminator cycle sequencing kit on an ABI Prism 3130 XL Genetic
Analyzer (Applied Biosystems, Darmstadt, Germany). Sequencing data were analyzed
with the Lasergene software (DNASTAR, Konstanz, Germany).
Table 2 Sequences of oligonucleotide primers used in this study; restriction sites are underlined.
Primer
Target gene
Sequence (5´→ 3´)
Product length [bp]
masB_HindIII_f masB TGACAAGCTTATAGTCGACGCGATGAGTG 360
masB_XhoI_r CGCTCGAGTCAGGATTTCTTGATGCTTGA
masBC_XbaI_f masBC GATCTAGACAGTGAAGAAGAAGCCAC 647
masBC_XbaI_r CGTCTAGATCAATGCGCTTTTGCTGT
masDE_HindIII_f masDE GTCAAGCTTGCACTGCAACTTCAACACTA 2758
masDE_XhoI_r ATGACTCGAGCTAACCTTCGGCCAAGTTT
masDE_BamHI_f masDE CAGGATCCTACTGCAACTTCAACACTATCC 2758
masDE_HindIII_r CTGAAGCTTCTAACCTTCGGCCAAGTTTTC
masB_SacII_f masBCDE ATCCGCGGCAGTGAAGAAGAAGCCAC 3453
masE_HindIII_r CTGAAGCTTCTAACCTTCGGCCAAGTTTTC
![Page 53: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/53.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
47
Table 3 Plasmids used in this study.
Plasmid Characteristics Reference or source
pET-42a(+)
KmR, GST-tag, His-tag, S-tag
Novagen (Darmstadt,
Germany)
pET-42a_masB KmR, GST-tag, His-tag, S-tag, masB this study
pET-42a_masBC KmR, GST-tag, His-tag, S-tag, masBC this study
pET-42a_masBCDE KmR, GST-tag, His-tag, S-tag, masBCDE this study
pET-51b(+) ApR, Strep-tag II, His-tag Novagen
pET-51b_masBC ApR, Strep-tag II, His-tag, masBC this study
pET-51b_masBCDE ApR, Strep-tag II, His-tag, masBCDE this study
pBBR1MCS-2 KmR, mob Kovach et al. (1995)
pBBR1MCS-2_
masBCDE-Strep
KmR, mob, Strep-Tag II, masBCDE
this study
pBBR1MCS-2_masBCDE-Strep
masC
masB
masD
masE
T7
kan
rep
mob
Strep-tag
8605 bp
masCmasB
masD
masE
T7
kan
f1 ori
GST-tag
pET42_masBCDE9333 bp
a) b)
pBBR1MCS-2_masBCDE-Strep
masC
masB
masD
masE
T7
kan
rep
mob
Strep-tag
8605 bp
masCmasB
masD
masE
T7
kan
f1 ori
GST-tag
pET42_masBCDE9333 bp
a) b)
Fig. 1 Plasmids for purification of tagged (1-methylalkyl)succinate synthase. a) Genes masB,
masC, masD and masE cloned into pET-42a(+) for purification of the holoenzyme by the GST-
tagged MasD subunit from E. coli. For purification via the Strep-tag the mas genes were cloned
into pET-51b(+) in an analogous manner. b) pBBR1MCS-2_masBCDE-Strep for expression of
tagged (1-methylalkyl)succinate synthase in strain HxN1. Blue: mas genes; red: antibiotic
resistance genes; yellow: origin of replication; green: origin of transfer; purple: GST- and
Strep-Tag.
![Page 54: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/54.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
48
Purification of (1-methylalkyl)succinate synthase
Purification of (1-methylalkyl)succinate synthase from cell extracts of strain HxN1 and
determination of molecular weight and of enzymatic activity was performed as described
in Schmitt et al. (unpublished results). Purification of (1-methylalkyl)succinate synthase
from strain HxN1 by immunoaffinity chromatography was performed in an anaerobic
chamber. Columns with crosslinked antibodies against MasB or MasD were prepared
with the Pierce Crosslink Immunoprecipitation Kit (Pierce Protein, Rockford, USA). The
production of immune serum against MasD is described in Schmitt et al. (unpublished
results). Immune serum against MasB was performed analogously. Oligonucleotide
primers for cloning of masB into pET-42a(+) are listed in table 2. Each 100 µl of immune
serum was used to crosslink the antibodies to the column. Cell lysates of strain HxN1,
which were applied to the columns, were adjusted to a concentration of 500 to 1000 µg
protein. The protein concentration was determined with the Bio-Rad Protein Assay
based on the method of Bradford (1976). The protein was eluted from the column
according to the instructions of the Crosslink Immunoprecipitation Kit.
The recombinant (1-methylalkyl)succinate synthase fused to GST- or Strep-tag was
purified from E. coli harboring the appropriate plasmid. Protein expression was induced
by addition of 1 mM IPTG in the exponential growth phase (optical density at
600 nm = 0.6). For expression of the (1-methylalkyl)succinate synthase in E. coli
Lemo21 (DE3), 2 mM rhamnose were added at inoculation. The cells were harvested by
centrifugation after 3 h of induction (4410 x g, 15 min, 4 °C). 2 g of wet weight cell pellet
were re-suspended in PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM
KH2PO4, pH 7.3) or binding buffer (100 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, pH 8),
both supplemented with 1 mg ml–1 DNase. Cells were disrupted with 10 mg ml–1
lysozyme, incubated for 10 min at room temperature, followed by ultrasonification on ice.
Afterwards, the cell lysate was centrifuged to remove cell debris (16100 x g, 15 min,
4 °C) and the obtained supernatant was filtered (0.2 µm, Whatman/GE Healthcare,
Munich, Germany) before purification with an ÄKTA purifier FPLC system (GE
Healthcare). Buffers were sterile filtered (0.45 µm, Sarstedt, Nümbrecht, Germany) and
degassed. The flow rate for all steps was set to 1 ml min–1. The GST-tag fusion protein
was purified on a 1 ml GSTrap HP column (GE Healthcare) equilibrated with PBS.
Following washing with 5 ml PBS, the GST-tagged protein was eluted with 5 ml of
10 mM reduced glutathione in 50 mM Tris-HCl, pH 8. The Strep-tag fusion protein was
purified on a 1 ml StrepTrap HP column (GE Healthcare), equilibrated with binding
buffer. After washing with 10 ml binding buffer the Strep-tagged protein was eluted with
![Page 55: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/55.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
49
6 ml 2.5 mM desthiobiotin in binding buffer. Eluted protein from both columns was
sampled in five fractions of 1 ml.
SDS-PAGE and Western Blot
Protein purification was displayed by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE), as described by Laemmli (1970). The PageRuler
Prestained Protein Ladder (Fermentas) was used for size determination. Immunoblotting
experiments were performed as described in Schmitt et al. (unpublished results), with
immune sera against MasB, MasC, MasD and MasE and goat anti-rabbit IgG-AP as
secondary antibody (Santa Cruz Biotechnology, Santa Cruz, USA).
Protein crystallization
The (1-methylalkyl)succinate synthase purified from strain HxN1 was concentrated
through a cellulose membrane (Amicon Ultra-15 100K, Millipore, Billerica, USA) to a
concentration of 4 to 20 mg ml–1. The protein was dissolved in 102 mM
NaH2PO4/Na2HPO4, pH 8.0 or 100 mM Tris-HCl, 5 mM fumarate, pH 8.0. Crystallization
experiments were performed with the sitting drop method using comboplates and crystal
bridges (Greiner Bio-One, Kremsmünster, Austria) in an anaerobic chamber at 20 °C.
Each drop consisted of 5 µl protein solution and 5 µl reservoir solution. The volume of
solution in the reservoir was 1 ml. Reservoir solutions were obtained from the JBScreen
Classic 1 to 10 Crystal Screening Kits (Jena Bioscience, Jena, Germany). Newly
developed solutions based on those from the Screening Kit were designed with
chemicals of analytical grade and sterilized by filtration. All solutions were adapted to
anaerobic conditions before protein crystallization was started. As control, crystals of
lysozyme were grown with the JBS Starter Kit (Jena Bioscience). Crystal structures were
recorded inside the anaerobic chamber with the Moticam 2300 (Motic, Wetzlar,
Germany) connected to a binocular and a monitor.
Results and Discussion
Attempts to crystallize (1-methylalkyl)succinate synthase
For a first screening, protein purified from crude extract of strain HxN1 at a concentration
of 4 mg ml–1, stored in 102 mM NaH2PO4/Na2HPO4, pH 8.0 was used. The crude extract
had an enzyme activity of 140 µM of (1-methylpentyl)succinate, indicating that the
(1-methylalkyl)succinate synthase was active before purification. However, the enzyme
activity might be affected during purification. The enzyme activity was not determined
![Page 56: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/56.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
50
again after purification, because the remaining protein solution would not have been
enough for a complete screening. Crystallization experiments were performed under 240
different conditions with the JBScreen Classic 1 to 10 Crystal Screening Kits. Each kit is
based on another primary precipitant and consists of 24 solutions (A1 to D6), which differ
in precipitant concentration, added secondary precipitants, buffer and pH. One hour
later, the protein had been precipitated in 122 of the tested conditions, while in the
remaining 118 conditions precipitation did not occur (table 4).
Table 4 Screening for ideal conditions to crystallize (1-methylalkyl)succinate synthase of strain
HxN1 with the JBScreen Kits. Conditions, which did not lead to protein precipitation after one
hour, are marked with a +.
Kit Number 1 2 3 4 5 6 7 8 9 10
A 1 + + + + + +
2 + + + + + +
3 + + + +
4 + + + + + + + +
5 + + + + +
6 + + + + + +
B 1 + + + +
2 + + + + +
3 + + + + +
4 + + + + +
5 + + + +
6 + + + + + +
C 1 + + + + +
2 + +
3 + + + + + +
4 + + + + +
5 + + + + +
6 + + + + + + +
D 1 + + + + +
2 + + + + +
3 + +
4 + +
5 + + + +
6 + + + + + +
![Page 57: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/57.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
51
Dark, fast evolving precipitates usually indicate denaturation of the protein. Clear
approaches were checked daily for the formation of crystals. Crystals develop by
reducing the solubility of the protein molecule. In case this happens too fast, precipitation
occurs. Reduction of protein solubility is achieved by addition of salts, organic solvents
or polymers. The solubility is also influenced by the pH. Crystal formation lasts up to
several weeks. Two conditions, 100 mM Tris-HCl, pH 8.5, 10% isopropanol, 10 mM
MgCl2 (solution 9A4) and 100 mM Tris-HCl, pH 8.5, 2% isopropanol, 10 mM MgSO4
(solution 8D6) led to the formation of crystal needles after one day (Fig. 2a). Slipknot-like
structures represent a large number of thin needles growing from a single nucleation
centre (http: xray.bmc.uu/se/terese/tutorial). Nucleation is the first step in crystallization,
followed by crystal growth (Garcia-Ruiz, 2003). Under optimal conditions, a single crystal
develops from one nucleation centre. However, the formation of larger, single crystals
failed. The slipknots appeared to be dark coloured, while other needles were colourless
(Fig. 2a). The purified (1-methylalkyl)succinate synthase is also dark brown coloured,
possibly due to Fe-S cluster. The small subunits of (1-methylalkyl)succinate synthase
are expected to coordinate Fe-S cluster, because they have, like the small subunits of
benzylsuccinate synthase (Hilberg et al., 2012), conserved cysteine residues, which
might coordinate Fe-S cluster.
a) b)a) b)
Fig. 2 Crystals of (1-methylalkyl)succinate synthase. a) Slipknot-like structures after one day of
incubation in 100 mM Tris-HCl, pH 8.5, 10% isopropanol, 10 mM MgCl2. b) Small crystals after
15 days of incubation in 100 mM Tris-HCl, pH 8.5, 1% isopropanol, 10 mM MgCl2. Pictures were
taken with 40x magnification.
The complete screening was performed a second time in a slightly different way: The
protein concentration was raised to 10 mg ml–1 and the protein was purified from inactive
crude extract. In its inactive state the (1-methylalkyl)succinate synthase does not carry a
radical at its catalytic subunit. It was assumed that the inactive protein is more stable
![Page 58: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/58.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
52
during crystallization, because it cannot be cleaved at the radical harboring site by
accidentally exposure to oxygen. The truncated catalytic subunit may destabilize the
composition of the holoenzyme by loosing association of the different subunits to each
other. Losses in activity during purification have been reported for
(1-methylalkyl)succinate synthase and benzylsuccinate synthase (Leuthner et al., 1998;
Schmitt et al., unpublished results). The correct composition of the inactive holoenzyme
was confirmed by gel filtration, which determined the molecular weight (data not shown).
The new screening confirmed the previously obtained results. The same conditions
mentioned above showed crystal-like structures, while formation of larger crystals failed.
To obtain larger crystals, new solutions were prepared, based on those, which yielded
initial crystal formation. The buffer (100 mM Tris-HCl, pH 8.5) remained the same, while
for the two precipitants different concentrations were prepared, in total two times 24 new
conditions (table 5 and 6).
Table 5 Composition of new solutions for crystallization of (1-methylalkyl)succinate synthase,
based on solution 9A4 (100 mM Tris-HCl, pH 8.5, 10% isopropanol, 10 mM MgCl2) of the
JBScreen Kit. Conditions, which led to the formation of crystal structures, are marked with a +.
1 2 3 4 5 6 Isopropanol
MgCl2 2% 5% 10% 15% 20% 25%
A 10 mM + + + +
B 50 mM +
C 100 mM +
D 200 mM
Table 6 Composition of new solutions for crystallization of (1-methylalkyl)succinate synthase,
based on solution 8D6 (100 mM Tris-HCl, pH 8.5, 2% isopropanol, 10 mM MgSO4) of the
JBScreen Kit. Conditions, which led to the formation of crystal structures, are marked with a +.
1 2 3 4 5 6 Isopropanol
MgSO4 2% 5% 10% 15% 20% 25%
A 10 mM + + +
B 50 mM + +
C 100 mM +
D 200 mM +
![Page 59: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/59.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
53
The new experiments were performed with inactive protein, concentrated to 20 mg ml–1.
In parallel, the 102 mM NaH2PO4/Na2HPO4 buffer was used alone as control, to exclude
formation of salt crystals. Conditions marked with a + in table 5 and 6 led to the
formation of crystalline structures (needles and slipknots) within one to five days, while
crystals were not observed in the control experiment with NaH2PO4/Na2HPO4 buffer. As
evident, combinations of high salt and high isopropanol concentrations caused protein
precipitation (table 5 and 6). For a further improvement of the obtained results, solutions
with lower concentrations of salt and isopropanol were prepared (table 7 and 8). The
same protein with a concentration of 20 mg ml–1 was used. This time, more approaches
led to the formation of crystals (marked with a + in table 7 and 8).
Table 7 Composition of new solutions for crystallization of (1-methylalkyl)succinate synthase,
based on the solutions of table 5. Conditions, which led to the formation of crystal structures, are
marked with a +.
1 2 3 4 5 6 Isopropanol
MgCl2 1% (A,C)
6% (B,D)
2% (A,C)
7% (B,D)
3% (A,C)
8% (B,D)
4% (A,C)
6% (B,D)
5% (A,C)
6% (B,D)
1% (A,C)
6% (B,D)
A 10 mM + + + + + + B 10 mM + + + + + +
C 20 mM + + + + + +
D 20 mM + + + +
Table 8 Composition of new solutions for crystallization of (1-methylalkyl)succinate synthase,
based on the solutions of table 6. Conditions, which led to the formation of crystal structures, are
marked with a +.
1 2 3 4 5 6 Isopropanol
MgSO4 1%
2%
3%
5% (A-C)
1% (D)xx
7.5% (A-C)
2% (D)
10% (A-C)
3% (D)
A 10 mM + + + + + + B 50 mM + + + + + + C 100 mM + + + + + + D 150 mM (1-3)
200 mM (4-6) + + + + + +
![Page 60: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/60.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
54
After incubation of two weeks, needles had disappeared and small crystals appeared
(Fig. 2b). Small size crystals develop, if growth happens too fast, because of suboptimal
conditions and they are unsuitable for X-ray analysis. Furthermore, the obtained crystals
were not brownish anymore. They turned out to be salt crystals, which probably
developed from the buffer in the crystallization solution (Tris-HCl) and the
NaH2PO4/Na2HPO4 buffer, in which the protein was dissolved, yielding NaCl. In the
control experiments with buffer instead of protein solution, no salt crystals developed
within the first five days, as mentioned above. Unfortunately, these approaches were not
further analyzed for a later crystal development. It is assumed that the initially observed
crystal structures were of protein origin, which did not develop to a larger crystal and
instead were destroyed due to suboptimal conditions. By contrast, the salt crystals
developed later, after evaporation of the solution.
The transfer of a crystal into fresh solutions with a thin hairloop needle, which is called
seeding, might allow further growth of this crystal, because the conditions for nucleation
are not the ideal ones for subsequent growth (Bergfors, 2003). So far, application of this
method remained unsuccessful for (1-methylalkyl)succinate synthase. To circumvent
formation of salt crystals, the (1-methylalkyl)succinate synthase was buffered in 20 mM
Tris-HCl, pH 8 and a new screening was performed with the Screen Kits 1 to 10. Nearly
the same conditions depicted in table 4 stayed clear, but further improvements were not
undertaken. Simply to get an idea about the shape of protein crystals, lysozyme was
crystallized according to standard protocols. After one day, large and structurally diverse
crystals had formed (Fig. 3).
a) b)a) b)
Fig. 3 Crystals of lysozyme one day after preparation. a) Conditions: 7% NaCl, 250 mM sodium
acetate, pH 4.8. b) Conditions: 8% NaCl, 250 mM sodium acetate, pH 4.8. Pictures were taken
with 40x magnification.
![Page 61: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/61.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
55
Immunoaffinity purification of (1-methylalkyl)succinate synthase
To minimize purification steps and coupled loss in activity, an alternative purification
strategy was investigated for (1-methylalkyl)succinate synthase of strain HxN1.
Purification was attempted with columns, to which antibodies against MasD or MasB
were bound covalently. The native holoenzyme is purified, if the quaternary structure is
maintained and if the antibody binding site of the protein is accessible. In first attempts,
MasB was purified with the MasB immune serum (Fig. 4), while the other subunits were
not. A reason for unsuccessful purification of the other three subunits along with MasB
might be inconvenient conditions (e.g.
buffer, pH) during purification, which
caused dissoziation of the subunits from
each other. Purification with the MasD
immune serum even failed for the MasD
subunit. However, this purification
strategy might be valuable after effective
optimization of adequate conditions for
(1-methylalkyl)succinate synthase to
purify related enzymes. The immune sera
against MasB and MasD have been successfully applied in Western blot analysis to
detect MasB and MasD of strain OcN1 (Fig. 5). In strain OcN1, which degrades
n-alkanes with a chain length of C8–C12 anaerobically (Ehrenreich et al., 2000), a mas
operon has been identified, assuming activation of the n-alkanes by addition to fumarate
as well (Werner, 2009). Sequence identity of MasB from strains HxN1 and OcN1 is 71%
and of MasD it is 86%. This indicates that the antibodies of the immune sera possess
relaxed specificity towards target polypeptides. Thus, it might be possible to purify the
(1-methylalkyl)succinate synthase of strain OcN1 and as well as of other strains with the
antisera against the subunits of strain HxN1. Hereby, the presence of a MasB subunit,
which has been proposed to be an exclusive feature of anaerobic n-alkane activating
enzymes, can be analyzed (Schmitt et al., unpublished results).
eluate HxN1 HxN1
capr n-hex
eluate HxN1 HxN1
capr n-hex
Fig. 4 Purification of (1-methylalkyl)succinate
synthase with immune serum against MasB.
Strain HxN1 grown with caproate or n-hexane
served as negative respectively positive control.
![Page 62: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/62.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
56
15 kDa
100 kDa
70 kDa
MasB
MasD
L HxN1 HxN1 OcN1
n-hex capr n-oct
15 kDa
100 kDa
70 kDa
MasB
MasDMasD
L HxN1 HxN1 OcN1
n-hex capr n-oct
Fig. 5 Detection of MasB and MasD in cell extracts of strain OcN1 grown with n-octane by
Western blot with immune serum against MasB and MasD of strain HxN1. Strain HxN1 grown
with n-hexane or caproate served as positive or negative control, respectively. L: pre-stained
ladder.
Purification of recombinant (1-methylalkyl)succinate synthase from E. coli
(1-Methylalkyl)succinate synthase is purified from E. coli in its inactive form, due to the
missing activating enzyme, which transfers a radical generated by cleavage of
S-adenosylmethionine from the resulting 5´-deoxyadenosylradical to the catalytic subunit
of (1-methylalkyl)succinate synthase (Layer et al., 2004). Thus, cleavage of a radical-
bearing polypeptide chain by reaction with oxygen (Wagner et al., 1992) is precluded
and the enzyme is supposed to be more stable. The (1-methylalkyl)succinate synthase
expressed in E. coli BL21 Star (DE3) was purified under aerobic conditions. Purification
from E. coli was also applied for the benzylsuccinate synthase of Thauera aromatica
strain T1 (Li et al., 2009). Additionally to the generation of a stable protein, E. coli
enables the production of higher amounts of protein in a shorter time. Fusion of the
desired protein to a tag further simplifies purification. The N- and C-termini of proteins
are rarely located inside the three-dimensional structure and therefore, fused tags should
be accessible for affinity purification. Affinity purification gives high yields of pure protein,
but is anyway often combined with a second purification step. The Strep-tag consists of
only eight amino acids and, due to his small size, does not hamper crystallization (Terpe,
2003). The larger GST-tag (26 kDa) needs to be removed before crystallization, which is
achieved by cleavage of the protein during purification, while it is bound to the column, or
afterwards with the proteases thrombin or Factor Xa (Terpe, 2003). Recognition sites for
these proteases are encoded in the plasmid backbone of pET-42a(+) between the GST-
coding sequence and the multiple cloning site. For purification of tagged
(1-methylalkyl)succinate synthase only the large subunit MasD was fused with its
N-terminus either to the GST- or Strep-tag. If the correct quaternary structure of
(1-methylalkyl)succinate synthase is formed in E. coli, the small subunits should be co-
purified together with the tagged MasD subunit. Co-purification of the two small subunits
![Page 63: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/63.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
57
of benzylsuccinate synthase together with the his6-tagged large subunit was shown by Li
et al. (2009). In this case, all three subunits were expressed as soluble proteins in E. coli
BL21 Star (DE3), while expression of the tagged large subunit alone caused inclusion
bodies.
For the tagged (1-methylalkyl)succinate synthase of strain HxN1 expression in E. coli
was successful (Fig. 6a). In denaturing gel electrophoresis the tagged MasD subunit with
a size of 94 kDa or 120 kDa (94 kDa MasD + 26 kDa GST-Tag), respectively, is clearly
visible after induction with IPTG. Expression of the small subunits was verified by
Western blot, as exemplarily shown for pET51_masBCDE in Fig. 6b.
pET-51_ HxN1 HxN1
masBCDE capr n-hex
MasD-GST
MasD-Strep
100 kDa
130 kDa
L pET-42_masBCDE pET-51_masBCDE
1 2 1 2
a) b) pET-51_ HxN1 HxN1
masBCDE capr n-hex
MasD-GST
MasD-Strep
100 kDa
130 kDa
L pET-42_masBCDE pET-51_masBCDE
1 2 1 2
a) b)
Fig. 6 Expression of recombinant (1-methylalkyl)succinate synthase in E. coli. a) SDS-PAGE of
cell extracts before (1) and three hours after induction (2). GST-tagged MasD expressed from
pET-42_masBCDE is apparent with a size of 120 kDa, Strep-tagged MasD expressed from
pET-51_masBCDE has a size of 94 kDa. L: ladder. b) Western blot for detection of MasB (top),
MasC (center) and MasE (bottom) in cell extract of E. coli + pET-51_masBCDE, which was
obtained three hours after induction with IPTG. Cell extract of strain HxN1 either grown with
caproate or with n-hexane served as negative or positive control, respectively.
Most of the Mas-GST-tag and Mas-Strep-tag fusion proteins aggregated as inclusion
bodies (Fig. 7), which are present after cell lysis in the cell debris rather than in the
soluble fraction because of their high density. Inclusion bodies consist of incorrectly
folded protein, which are stabilized by hydrophobic interactions (Mukhopadhyay, 1997).
Especially hydrophobic proteins tend to fold incorrectly. Proteins, which require formation
of disulfide bonds to obtain their correct structure, need to be transported into the
periplasm, because under the reducing conditions in the cytoplasm disulfide bonds are
not formed. The lack of a proper secretory systems leads to accumulation of incorrect
folded proteins in the cytoplasm as inclusion bodies (Mukhopadhyay, 1997). Sometimes,
cofactors required by the protein are missing in E. coli. Another reason for formation of
inclusion bodies is protein expression at high rates (Mukhopadhyay, 1997). Expression
![Page 64: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/64.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
58
vectors like the pET-series are optimized for high expression levels by using the T7
promoter to obtain a large amount of the desired protein. With this system the induced
protein accounts for up to 50% of the entire cell protein. A disadvantage of high
expression rates is insufficient time for protein folding (Mukhopadhyay, 1997). To
circumvent high expression rates, it might be advantageous to perform growth below the
optimal temperature of 37 °C. For expression of (1-methylalykl)succinate synthase in
E. coli BL21 Star (DE3) incubation at room temperature did not lead to the formation of
less inclusion bodies (data not shown). Protein expression was also tried in E. coli strain
Lemo21 (DE3). The Lemo strain allows tuning of expression by varying the level of
lysozyme, the natural inhibitor of T7 RNA polymerase, which is achieved by adding
rhamnose during growth. Rhamnose regulates expression of lysozyme. However, a
concentration of 2 mM rhamnose resulted in insufficient amounts of expressed
(1-methylalykl)succinate synthase (data not shown). Further optimization regarding the
concentration of rhamnose was not performed. Overall, the amount of protein purified
from the soluble fraction of E. coli BL21 Star (DE3) was insufficient to initiate
crystallization (Fig. 7). The GST-tagged MasD subunit is barely visible in the eluted
fractions 3 and 4 after purification with glutathione. The same result was obtained for the
Strep-tagged enzyme (data not shown). The small subunits were not visible in SDS-
PAGE. Their presence in the elution fraction was, however, not confirmed by Western
blot. Thus, it is presently unclear, if the low amount of soluble holoenzyme, which was
purified, has been folded correctly in E. coli and if all four subunits were purified.
L S C W 1 2 3 4 5
100 kDa130 kDa
MasD-GST
L S C W 1 2 3 4 5
100 kDa130 kDa
MasD-GST
Fig. 7 Purification of GST-tagged (1-methylalkyl)succinate synthase from E. coli. L: ladder; S:
supernatant after cell lysis, which was used for purification; C: cell debris after cell lysis; W: non-
bound protein eluted after column wash; 1–5: elution fractions from the column. GST-tagged
MasD with a size of 120 kDa is dominant in the cell debris, small amounts of purified MasD-GST
are in fraction 3 and 4.
For purification of the benzylsuccinate synthase holoenzyme from E. coli, it was shown
to be advantageous to supplement the growth medium with Fe(NH4)2(SO4)2, to enable
![Page 65: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/65.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
59
formation of Fe-S cluster within the small subunits (Li et al., 2009). Fe-S clusters are
supposed to be important for assembly of the holoenzyme. Correct folding avoids
precipitation in form of inclusion bodies, as mentioned above. Therefore, the effect of
Fe(NH4)2(SO4)2 onto the formation of soluble (1-methylalykl)succinate synthase in E. coli
should be tested in the future.
In principle, protein purification from inclusion bodies is possible. Inclusion bodies are
separated by ultracentrifugation from cell debris due to their dense clustering. However,
solubilization of inclusion bodies requires denaturing agents. Thus, the protein has to
refold under convenient conditions afterwards. Purification from inclusion bodies was
successfully shown for the large subunit of benzylsuccinate synthase fused to a His6 tag
(Li et al., 2009), but was not taken into account for the (1-methylalykl)succinate synthase
holoenzyme, because the success to refold four subunits and to retain the correct
quaternary structure was estimated to be marginal.
A plasmid for purification of tagged (1-methylalkyl)succinate synthase from strain HxN1
To combine the advantages of purification of the inactive, radical-free, tagged
(1-methylalkyl)succinate synthase with the expression in the natural environment to
simplify correct folding, it was thought to express the tagged protein encoded on a
plasmid in strain HxN1 grown with caproate. In pBBR1MCS-2_masBCDE-Strep (Fig. 1b)
the mas genes are under the control of the T7 promoter and thus, are expressed
constitutively, whereas the wild type mas operon is not induced during growth with
caproate. Expression of the wild type mas operon requires the presence of a
hydrocarbon such as n-hexane (Grundmann et al., 2008). Consequently, the activating
enzyme of (1-methylalkyl)succinate synthase encoded by masG will not be expressed
during growth with caproate. MasG is needed to deliver a radical to the catalytic subunit.
Thus, the (1-methylalkyl)succinate synthase will be produced in its inactive form in strain
HxN1 in the absence of MasG.
The recently established genetic system allows introduction of foreign DNA by
conjugation into strain HxN1 (Webner et al., unpublished results). The broad-host-range
plasmid pBBR1MCS-2 was shown to be stably maintained in the strain. Therefore,
pBBR1MCS-2_masBCDE-Strep was transferred into strain HxN1 and kanamycin-
resistant clones were obtained. Regrettably, expression of the plasmid encoded mas
genes was not confirmed in Western Blot analysis (data not shown). For future analysis,
masBCDE-Strep should be cloned the other way round into the multiple cloning site of
pBBR1MCS-2. Then, expression would be under the control of the T3 and lac promoter.
![Page 66: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/66.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
60
Expression of masD cloned into pBBR1MCS in this direction was successful in a mutant
of strain HxN1 grown with caproate (Webner et al., unpublished results).
Conclusion
Purification of native (1-methylalkyl)succinate synthase by immunoaffinity or purification
of Strep-tagged protein from strain HxN1 should be further tracked as alternative
purification strategies. The results obtained so far for these strategies do not exclude
them as appropriate method, yet. Still, there are possibilities for modifications to improve
the outcoming results. In case of successful purification by application of these
alternative strategies, another attempt to crystallize the enzyme should be started as well
as with the “traditionally” purified enzyme.
References
Bergfors, T. (2003) Seeds to crystals. J. Struct. Biol. 142: 66−76.
Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:
248−254.
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Garcia-Ruiz, M.J. (2003) Nucleation of protein crystals. J. Struct. Biol. 142: 22−31.
Grundmann, O., Behrends, A., Rabus, R., Amann, J., Halder, T., Heider, J. & Widdel, F.
(2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes
in the denitrifying bacterium, strain HxN1. Environ. Microbiol. 10: 376−385.
Hilberg, M., Pierik, A.J., Bill, E., Friedrich, T., Lippert, M.L. & Heider, J. (2012)
Identification of FeS clusters in the glycyl-radical enzyme benzylsuccinate synthase
via EPR and Mossbauer spectroscopy. J. Biol. Inorg. Chem. 17: 49−56.
Inoue, H., Nojima, H. & Okayama, H. (1990) High efficiency transformation of
Escherichia coli with plasmids. Gene 96: 23−28.
Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., 2nd &
Peterson, K.M. (1995) Four new derivatives of the broad-host-range cloning vector
pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175−176.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680−685.
![Page 67: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/67.jpg)
Attempts to crystallize (1-methylalkyl)succinate synthase
61
Layer, G., Heinz, D.W., Jahn, D. & Schubert, W.D. (2004) Structure and function of
radical SAM enzymes. Curr. Opin. Chem. Biol. 8: 468−476.
Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E. et al. (1998)
Biochemical and genetic characterization of benzylsuccinate synthase from
Thauera aromatica: a new glycyl radical enzyme catalysing the first step in
anaerobic toluene metabolism. Mol. Microbiol. 28: 615−628.
Li, L., Patterson, D.P., Fox, C.C., Lin, B., Coschigano, P.W. & Marsh, E.N. (2009)
Subunit structure of benzylsuccinate synthase. Biochemistry 48: 1284−1292.
Mukhopadhyay, A. (1997) Inclusion bodies and purification of proteins in biologically
active forms. Adv. Biochem. Eng. Biotechnol. 56: 61−109.
Rabus, R. & Widdel, F. (1995) Anaerobic degradation of ethylbenzene and other
aromatic hydrocarbons by new denitrifying bacteria. Arch. Microbiol. 163: 96−103.
Rabus, R., Wilkes, H., Behrends, A., Armstroff, A., Fischer, T., Pierik, A.J. & Widdel, F.
(2001) Anaerobic initial reaction of n-alkanes in a denitrifying bacterium: Evidence
for (1-methylpentyl)succinate as initial product and for involvement of an organic
radical in n-hexane metabolism. J. Bacteriol. 183: 1707−1715.
Simon, R., Priefer, U. & Pühler, A. (1983) A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Nat.
Biotechnol.1: 784−791.
Terpe, K. (2003) Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60: 523−533.
Wagner, A.F., Frey, M., Neugebauer, F.A., Schäfer, W. & Knappe, J. (1992) The free
radical in pyruvate formate-lyase is located on glycine-734. Proc. Natl. Acad. Sci.
U S A 89: 996−1000.
Werner, I. (2009) Untersuchungen zum Stoffwechsel des anaeroben Alkanabbaus.
Dissertation, Universität Bremen
![Page 68: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/68.jpg)
62
![Page 69: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/69.jpg)
63
3. Manuskript Identification of a second functional mas operon in the anaerobic n-alkane degrader strain HxN1 by a newly developed genetic system Kirsten Webner, Friedrich Widdel and Olav Grundmann Max-Planck-Institut für Marine Mikrobiologie, Celsiusstraße 1, D-28359 Bremen,
Germany.
Erstellung des Manuskriptes, Planung und Durchführung der Versuche. Die Plasmide
pCM184_∆masD_aacC1 und pBBR1MCS_mas operon wurden von Olav Grundmann
hergestellt.
Abstract
Strain HxN1 is able to degrade n-alkanes anaerobically with nitrate as terminal electron
acceptor. The n-alkanes are activated by addition to fumarate, presumably catalyzed by
the (1-methylalkyl)succinate synthase (Mas). The enzyme and its encoding mas genes
were recently identified in strain HxN1. To study the anaerobic n-alkane activation in
more detail, strain HxN1 was chosen as a model organism. Here, we report on the
introduction of foreign DNA into strain HxN1 by conjugation and gene deletion by
homologous recombination. The applicability of this genetic system was demonstrated
by deletion of masD, encoding the tentative catalytic subunit of (1-methylalkyl)succinate
synthase. Physiological characterization of the masD deletion mutant confirmed its
proposed function of being necessary for the anaerobic n-alkane degradation. By
complementation the phenotype was restored. The present study proofs for the first time
the function of an anaerobic n-alkane activating enzyme in vivo. In addition, deletion of
masD revealed a second, identical copy of the mas operon in strain HxN1.
![Page 70: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/70.jpg)
Identification of a second mas operon
64
Introduction
The isolation of bacterial strains with the capability to degrade n-alkanes with nitrate (e.g.
Ehrenreich et al., 2000) or sulfate (e.g. Rueter et al., 1994) as terminal electron acceptor
with the beginning of the 1990s (reviewed in Widdel et al., 2010) opened a new research
field focused on the identification of underlying activation mechanisms and responsible
enzymes and genes. Previously, n-alkanes were regarded as to be unable to be
degraded under anaerobic conditions, because they have no functional groups and
contain exclusively apolar σ-bonds, which make them chemically unreactive. Under
aerobic conditions n-alkanes are activated by monooxygenases, which introduce a
functional hydroxyl group into the molecule (van Beilen & Funhoff, 2005).
Metabolite analyses in the denitrifying strain HxN1 (Rabus et al., 2001) and sulfate-
reducing strains and enrichments (Kropp et al., 2000; Cravo-Laureau et al., 2005;
Davidova et al., 2005; Callaghan et al., 2006) demonstrated activation of the n-alkanes
at the secondary carbon atom by addition to fumarate yielding (1-methylalkyl)succinates.
Further studies with strain HxN1 and D. alkenivorans strain AK-01 identified the potential
enzymes catalyzing this activation reaction as well as their encoding genes (Callaghan
et al., 2008; Grundmann et al., 2008). In strain HxN1 proteins especially formed during
growth on n-hexane were supposed to be involved in the anaerobic activation of
n-alkanes (Grundmann et al., 2008). Four proteins, MasC, MasD, MasE and MasG, were
assigned as homologues to the subunits of the glycyl radical enzyme benzylsuccinate
synthase (BssABC) and its activating enzyme (BssD), which were first identified in
Thauera aromatica strain K172 (Leuthner et al., 1998). The benzylsuccinate synthase
catalyzes the addition of fumarate to the aromatic hydrocarbon toluene (Leuthner et al.,
1998). The large α-subunit BssA harbors a conserved glycine and cysteine residue.
These residues transiently carry the radical necessary for toluene activation and are
characteristic for glycyl radical enzymes (Selmer et al., 2005). The two small β- (BssB)
and γ-subunits (BssC) contain Fe-S cluster, but their function is still unknown (Li et al.,
2009; Hilberg et al., 2012). The necessitiy of the benzylsuccinate synthase for the
anaerobic degradation of toluene was confirmed in Azoarcus sp. strain T by deletion of
bssA and in Thauera aromatica strain T1 by deletion of tutF, tutD and tutG (Achong et
al., 2001; Coschigano, 2002).
MasC and MasD are regarded as structural homologues of BssC and BssA, respectively
and thus, are supposed to be the α- and γ-subunit of a potential (1-methylalkyl)succinate
synthase (Grundmann et al., 2008). Corresponding genes are encoded in a mas operon,
containing seven open reading frames (masA to masG). The gene product of another
ORF, MasE, was designated as homologue of BssB, representing the β-subunit
![Page 71: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/71.jpg)
Identification of a second mas operon
65
(Grundmann et al., 2008). Other publications postulated MasB as homologue of BssB
(Callaghan et al., 2012; Hilberg et al., 2012). Recently, purification of the
(1-methylalkyl)succinate synthase from strain HxN1 revealed the existence of four
subunits, namely MasB, MasC, MasD and MasE (Schmitt et al., unpublished results).
MasG represents the activating enzyme of (1-methylalkyl)succinate synthase,
homologous to BssD (Grundmann et al., 2008). The two remaining ORFs (masA, masF)
in the mas operon of strain HxN1 are not directly linked to the anaerobic n-alkane
activation. MasA is similar to acyl-CoA dehydrogenases and might be involved in the
further downstream β-oxidation of n-alkanes, whereas MasF was designated as
transposase (Grundmann et al., 2008). In D. alkenivorans strain AK-01 two operons
(ass1 and ass2) coding for proteins of the anaerobic n-alkane activation were identified
(Callaghan et al., 2008). The Ass proteins showed homologies to the Bss proteins as
well.
A definite proof of the predicted function of (1-methylalkyl)succinate synthase requires
the analysis of mas deletion mutants. For an anaerobic n-alkane degrading strain a
genetic approach was not available so far. Herein, we describe the development of a
genetic system for strain HxN1 and the exemplary deletion of gene masD, presumably
encoding the catalytic subunit of the n-alkane activating enzyme.
Material and Methods
Bacterial strains and plasmids
The bacterial Escherichia coli and HxN1 strains and the plasmids used in this study are
described in table 1. Strain HxN1 has been maintained in the laboratory since its
isolation from a nitrate-reducing, n-hexane degrading enrichment culture (Ehrenreich et
al., 2000). Chemically competent E. coli cells were prepared according to the calcium
chloride method as described by Cohen et al. (1972).
![Page 72: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/72.jpg)
Identification of a second mas operon
66
Table 1 Bacterial strains and plasmids used in this study.
Strain or plasmid
Marker
Genotype and characteristics
Reference or source
Strains
E. coli S17-1 thi recA pro hsdR RP 4-2-Tc::MU-Km::Tn7
Simon et al.
(1983)
E. coli TOP10 StrR F- mcrA ∆(mrr-hsdRMS-
mcrBC) Ф80lacZ∆M15
∆lacX74 recA1
araD139 ∆(araleu)7697 galU
galK rpsL endA1 nupG
Invitrogen
(Darmstadt,
Germany)
HxN1 wild type Ehrenreich et al.
(2000)
HxN1 ∆masD KmR ∆masD this study
HxN1 ∆masD, ∆masD´ KmR, GmR ∆masD, ∆masD´ this study
Plasmids
pCM184 ApR, KmR, TcR Marx & Lidstrom
(2002)
pCM184_masABC ApR, KmR, TcR masA, masB, masC this study
pCM184_∆masD ApR, KmR, TcR masA, masB, masC, masE,
masF
this study
pCM184_∆masD_
aacC1
ApR, GmR, TcR masA, masB, masC, masE,
masF
this study
pBBR1MCS CmR Kovach et al.
(1994)
pBBR1MCS_masD CmR masD + ribosomal binding
site
this study
pBBR1MCS_
mas operon
CmR mas operon + 1kb upstream
sequence
this study
pBBR1MCS-2 KmR Kovach et al.
(1995)
pBBR1MCS-5 GmR Kovach et al.
(1995)
![Page 73: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/73.jpg)
Identification of a second mas operon
67
Cultivation and growth media
E. coli strains were cultivated at 37 °C in Luria Bertani (LB) medium. Strain HxN1 was
cultivated in defined anoxic mineral medium at 28 °C under a head space of an N2/CO2
mixture as described (Rabus & Widdel, 1995; Ehrenreich et al., 2000). As carbon
sources n-hexane, provided as a 5% (v/v) solution in heptamethylnonane, or caproate at
a final concentration of 5 mM were supplied. Nitrate was added regularly in portions
≤ 5 mM.
Anaerobic growth experiments with n-hexane or caproate were performed in tubes with
10 ml of anoxic medium. HxN1 cultures grown with caproate served as inoculum. Prior
inoculation, the cultures were washed once with anoxic medium to remove remaining
caproate. An approach without added carbon source served as negative control. The
optical density (OD) was monitored at 600 nm directly in the tubes (UV-1202, Shimadzu,
Duisburg, Germany). The amount of nitrate and nitrite in the cultures was determined
with Merckoquant test stripes (Merck, Darmstadt, Germany). Nitrate was re-added in
portions of 5 mM after it has been consumed.
The solid mineral medium contained per liter 0.1 g CaCl2 and 0.3 g NH4Cl. Following
autoclaving in a smaller volume, the following components were added from sterile stock
solutions: 8 ml HCl (1 M), 6.67 ml MgSO4 (15 g 100 ml–1), 8 ml KH2PO4 (1 M), 32 ml
K2HPO4 (1 M), each 1 ml of vitamins, an EDTA-chelated mixture of trace elements and
selenate/tungsten solution (Widdel & Bak, 1992), 5 ml fructose (1 M) as carbon source
and 5 ml NaNO3 (1 M) as electron acceptor for anoxic incubation. The pH was adjusted
to 7.0–7.2. Finally, separately autoclaved agar was added to a concentration of
1.5% (v/v). The same medium without agar served as oxic liquid mineral medium.
Antibiotics in liquid and solid medium were added at the following concentrations:
ampicillin (50 µg ml–1), chloramphenicol (20 µg ml–1), gentamycin (10 µg ml–1),
kanamycin (45 µg ml–1), neomycin (30 µg ml–1), rifampicin (200 µg ml–1), streptomycin
(50 µg ml–1), tetracycline (20 µg ml–1).
DNA techniques
Genomic DNA was isolated with the DNeasy Blood & Tissue Kit (Qiagen, Hilden,
Germany). Plasmid DNA was isolated by alkaline lysis with SDS as described
(Sambrook & Russell, 2001). Amplification by polymerase chain reaction (PCR) was
performed with Taq DNA Polymerase (Fermentas, St. Leon-Rot, Germany) or Phusion
High-Fidelity DNA Polymerase (Finnzymes, Vantaa, Finland) according to the
instructions. Oligonucleotide sequences are listed in table 2. DNA restriction enzymes
were applied according to the instructions (Fermentas). For analysis or further
![Page 74: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/74.jpg)
Identification of a second mas operon
68
purification, PCR-products and restricted plasmid DNA were run on 1 to 1.5% agarose
gels. DNA size marker (GeneRuler 100 bp Plus DNA Ladder and GeneRuler 1 kb DNA
Ladder) were obtained from Fermentas. Restricted DNA was purified with the QIAquick
Gel Extraction Kit (Qiagen) from agarose gels or with the QIAquick PCR Purification Kit
(Qiagen). PCR products and plasmids were ligated in a 2:1 ratio with T4 DNA Ligase
(Fermentas). Sequencing was performed with the BigDye v3.0 terminator cycle
sequencing kit (Applied Biosystems, Darmstadt, Germany) on an ABI Prism 3130 XL
Genetic Analyzer (Applied Biosystems). Sequencing data were analyzed with the
Lasergene software (DNASTAR, Konstanz, Germany).
Construction of a masD deletion cassette in pCM184
The upstream and downstream regions of masD were cloned consecutively into the
vector pCM184 (Marx & Lidstrom, 2002). First, the upstream region beginning with the
start codon of masA and ending directly before the start codon of masD was amplified
from genomic DNA of strain HxN1 with primers containing recognition sites. The PCR-
product was cloned into the first MCS of pCM184 upstream of the kan gene. The
obtained plasmid was named pCM184_masABC. Second, the downstream region
beginning directly behind the stop codon of masD and ending with the stop codon of
masF was amplified from genomic DNA of strain HxN1 with one primer containing a
recognition site and a second primer generating a blunt end. The PCR-product was
cloned into the second MCS of pCM184_masABC downstream of the kan gene. The
HpaI recognition site of the plasmid was used to generate a blunt end. The obtained
plasmid was named pCM184_∆masD. A second deletion cassette with an alternative
antibiotic resistant marker was obtained by exchanging the kan gene in pCM184_∆masD
with the aacC1 gene. The kan gene and its ribosomal binding site were cut from
pCM184_∆masD with SbfI. The aacC1 gene including its ribosomal binding site was
amplified from pBBR1MCS-5 (Kovach et al., 1995) with primers containing PstI
recognition sites and cloned into the SbfI-cut pCM184_∆masD. SbfI and PstI generate
the same overhangs. This plasmid was named pCM184_∆masD_aacC1.
![Page 75: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/75.jpg)
Identification of a second mas operon
69
Table 2 Oligonucleotide primers used in this study; restriction sites are underlined.
Primer
Target gene or region
Sequence (5´→ 3´)
Product length [bp]
masD deletion construct in pCM184
masABC_EcoRI_f CTGAATTCATGAATCGCGCGCACTTT
masABC_NcoI_r
upstream masD
ATCCATGGGATTCAATCCTCCTAAGG
1842
masEF_ApaI_f CAGGGCCCAAAATTCATTTAATTAGG
masEF_r
downstream masD
ATGGATCCCTAATTGGACTGTGTCATTAA
1991
aacC1_PstI_f ATGCTGCAGCCGATCTCGGCTTGAACGA
aacC1_PstI_r
aacC1
ATGCTGCAGCAGTGGCGGTTTTCATGGC
674
Confirmation of double crossover
masD_f CTGCAACTTCAACACTATCC
masD_r
masD
ACCAGCCACACGAACGATA
2438
bla_f ACATTTCCGTGTCGCCCTTA
bla_r
bla
ATCAGTGAGGCACCTATCTC
837
kan_f ATGAGCCATATTCAACGGGA
kan_r
kan
GAGGCAGTTCCATAGGATG
708
aacC1_f ATGTTACGCAGCAGCAAC
aacC1_r
aacC1
GGTACTTGGGTCGATATCA
525
masA_f CGGCTACACGTCGATTGAAG 6534a/
masG_r
masA to masG
ATGACACCAAGCACATCGCA 5417b
masD complementation
masD_XhoI_f GACTCGAGAGCATTCACCATCTA
masD_HindIII_r
masD
CTGAAGCTTCCACATTCTGTGCAT
2520
mas operon_f GGTACAGCGCCAACCACTCGTAGAT
mas operon_SpeI_r
mas operon
ATTACTAGTGTTAATAGAAGACGCCGCTAT
8356
Probe for southern blot
southern probe_f masA TTCAGAGCTATTGACCCGTG
southern probe_r masB GACAGTACTTGGCGTCACTA
505
a referring to HxN1 wild type; b referring to HxN1 ∆masD
![Page 76: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/76.jpg)
Identification of a second mas operon
70
Construction of complementation plasmids
The masD gene including its ribosomal bindung site and the complete mas operon
including around 1 kb of upstream sequence were amplified from genomic DNA of strain
HxN1 and cloned into the broad-host-range vector pBBR1MCS under the control of the
lac and the T3 promoter (Kovach et al., 1994). The plasmids were designated as
pBBR1MCS_masD and pBBR1MCS_mas operon.
pBBR1MCS_masD
masDrep
mobtet
lacT3
7242 bp
masA
loxP
10 563 bp masC
masEmasF
masB
kan
bla
tet
oriT
ColE1 ori
loxP
pCM184_ ∆masD
a) b)
pBBR1MCS_masD
masDrep
mobtet
lacT3
7242 bp
masA
loxP
10 563 bp masC
masEmasF
masB
kan
bla
tet
oriT
ColE1 ori
loxP
pCM184_ ∆masD
a) b)
Fig. 1 Schematic depiction of the constructed plasmids used in this study. a) pCM184_∆masD for
generation of a ∆masD deletion mutant of strain HxN1. b) pBBR1MCS_masD for
complementation of the ∆masD deletion in strain HxN1. Blue: mas genes; red: antibiotic
resistance marker; yellow: origin of replication; green: origin of transfer; black: loxP sites in
pCM184 and promoters T3 and lac in pBBR1MCS.
Plasmid transfer
Ligation reactions were transformed into chemically competent E. coli TOP10 as
described by Inoue et al. (1990). For conjugation, the appropriate plasmids were
transformed into the donor E. coli S17-1. For conjugational plasmid transfer, overnight
cultures of strain E. coli S17-1 containing the appropriate plasmid served as donor. The
recipient, strain HxN1, was used in its exponential growth phase on caproate. Cultures of
E. coli S17-1 and strain HxN1 were adjusted to an optical density at 600 nm of 1,
washed once with oxic mineral medium and then mixed in a 2:1 (recipient : donor) ratio
in a final volume of 1 ml. This mixture was concentrated by centrifugation (16 000 x g,
5 min) to 50 µl and spotted as single drop onto solid mineral medium without antibiotics.
![Page 77: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/77.jpg)
Identification of a second mas operon
71
Incubation was performed aerobically at 28 °C for 9 h. The drop was washed from the
solid medium with 1 ml of oxic mineral medium and serial dilutions were plated onto solid
mineral medium containing the convenient antibiotics. Incubation was carried out at
28 °C for 5 days in anaerobic jars under an N2-atmosphere.
Identification of HxN1 ∆masD clones
Colonies obtained on solid medium with kanamycin after conjugation of HxN1 with
pCM184_∆masD were streaked onto new solid mineral medium containing kanamycin to
enable a double crossover. Transconjugants of HxN1 ∆mas::kan (= HxN1 ∆masD) with
pCM184_∆masD_aacC1 were streaked onto new solid mineral medium containing
kanamycin and gentamycin to select for a double crossover. Afterwards, single colonies
were transferred into 150 µl oxic mineral medium with antibiotics. Cultures were allowed
to grow for three days before being transferred into 5 ml of anoxic mineral medium with
antibiotics and caproate as carbon source. All incubations were performed at 28 °C. For
PCR analysis, 0.5 ml of the cultures was centrifuged (10 000 x g, 5 min, 4 °C). The pellet
was suspended in 50 µl PCR-H2O and 1 µl of this suspension served as template in the
PCR-reaction. PCR was performed to verify a double crossover by applying primer pairs
which target i) masD, ii) bla, iii) kan, iv) aacC1 and v) the mas operon. Colonies obtained
from conjugations of HxN1 ∆mas::kan, ∆masD´::aacC1 (= HxN1 ∆masD, ∆masD´) with
the complementation plasmids were directly transferred into liquid mineral medium with
convenient antibiotics.
Southern blot
1 µg of chromosomal DNA of HxN1 wild type, ∆masD and ∆masD, ∆masD´ mutants was
digested with PstI and separated on 0.75% agarose gels. Prior transfer, the DNA was
partially hydrolyzed (0.25 M HCl) to simplify transfer, denatured (0.5 M NaOH, 1 M NaCl)
and neutralized (1 M NH4ClAc, 0.02 M NaOH). Afterwards, the DNA was transferred
onto a positively charged nylon membrane (Amersham Hybond-N+ 0.45 µm, GE
Healthcare, Munich, Germany) by dry capillary blotting. Following transfer, the DNA was
immobilized on the membrane by UV irradiation at 254 nm for 2 min at 1.5 J cm–2
(Biolink DNA Crosslinker, Biometra, Göttingen, Germany). A specific probe derived from
PCR was labelled with biotin-dUTP using the Biotin DecaLabel DNA Labeling Kit
(Fermentas). The biotinylated hybridized probe was detected with a streptavidin-HRP
conjugate and the chemiluminescent substrate luminol. Hybridization and detection was
performed with the North2South Chemiluminescent Hybridization and Detection Kit
according to the instructions (Pierce Protein, Rockford, USA). Hybridization signals were
![Page 78: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/78.jpg)
Identification of a second mas operon
72
visualized with an ECL camera system (BIS 303 PC Bioimaging, Amersham Pharmacia
Biotech/GE Healthcare). For molecular weight determination the Biotinylated DNA
Molecular Weight Marker (Vector Laboratories, Burlingame, USA) was used.
SDS-PAGE and Western blot
Cell extracts of HxN1 wild type and mutants adjusted to an optical density at 600 nm of 4
were run on 12% polyacrylamide gels as described by Laemmli (1970). The PageRuler
Prestained Protein Ladder from Fermentas served as molecular weight marker.
Immunoblotting experiments for the detection of MasC, MasD and MasE are described
in Schmitt et al. (unpublished results).
Results and Discussion
Establishment of conjugational DNA transfer into strain HxN1
Characterization of deletion mutants requires the possibility to isolate genetically
modified clones. Hence, a solid growth medium was developed, because strain HxN1
was unable to grow on standard solid LB medium. The originally described defined
anoxic mineral medium (Rabus & Widdel, 1995; Ehrenreich et al., 2000) was modified as
follows: the medium was buffered with phosphate instead of bicarbonate and fructose
was added as carbon source instead of caproate. On this newly developed solid mineral
medium, white colonies with a size of 0.5 to 1 mm in diameter grew after four to five days
of incubation at 28 °C both under oxic and anoxic conditions.
Since electroporation of strain HxN1 remained unsuccessful, conjugation was chosen for
the introduction of DNA into strain HxN1. Conjugation has been effectively applied in
Aromatoleum aromaticum strain EbN1, an anaerobic aromatic hydrocarbon degrading
strain, which is related to strain HxN1 (Wöhlbrand & Rabus, 2009). A common method to
select between donor and recipient strain in conjugation-mediated DNA transfer is to
generate an antibiotic resistant mutant of the recipient strain (Schultheiss & Schuler,
2003; Wöhlbrand & Rabus, 2009). However, all attempts to generate an antibiotic
resistant mutant of strain HxN1 failed. Growth of strain HxN1 was completely inhibited in
anoxic liquid and solid mineral medium by ampicillin (50 µg ml–1), chloramphenicol
(20 µg ml–1), gentamycin (10 µg ml–1), kanamycin (45 µg ml–1), neomycin (30 µg ml–1),
rifampicin (200 µg ml–1), streptomycin (50 µg ml–1) and tetracycline (20 µg ml–1). Thus,
the disability of E. coli S17-1 to grow on the solid mineral medium served as selection
marker.
![Page 79: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/79.jpg)
Identification of a second mas operon
73
Uptake of foreign DNA was established by conjugational transfer of the broad-host-range
cloning vector pBBR1MCS-2 (Kovach et al., 1995) from the donor E. coli S17-1 to strain
HxN1. The pBBR1MCS- series of vectors are relatively small (~ 5 kb), have an extensive
multiple cloning site and are available in variants with different antibiotic marker
resistance genes (Kovach et al., 1994; Kovach et al., 1995). These features make them
an appropriate tool for the establishment of conjugational transfer and for later
complementation of the deleted gene. The pBBR1MCS vectors are not self-
transmissible. Instead they are transferred by the tra functions of plasmid RP4 that are
integrated into the chromosome of E. coli S17-1 (Simon et al., 1983). The vector
pBBR1MCS-2 carries a kanamycin resistance gene (kan) for screening purposes.
Transfer of this vector from E. coli S17-1 to strain HxN1 yielded kanamycin resistant
colonies after 5 days of anoxic incubation. Conjugation frequencies varied between
1.1 x 10–3 and 1.8 x 10–4. For the transfer of pBBR1MCS-4 from E. coli S17-1 to strain
EbN1 a conjugation frequency of 1.3 x 10–5 was reported (Wöhlbrand & Rabus, 2009).
Within the same range conjugation frequencies were also reported for the proteobateria
Bartonella henselae (2 x 10–5), Chromatium vinosum (3.6 x 10–4 to 7.5 x 10–2) and
Eikenella corrodens (2.5 x 10–7) with E. coli S17-1 as donor (Rao et al., 1993;
Pattaragulwanit & Dahl, 1995; Dehio & Meyer, 1997). The presence of pBBR1MCS-2 in
the HxN1 transconjugants was verified by PCR targeting the kan gene, indicating
replication of the plasmid in strain HxN1 (data not shown).
Generation of a ∆masD deletion mutant of strain HxN1
Deletion of masD was performed by homologous recombination and gene replacement
using the cre-lox system of Marx & Lidstrom (2002). This system is based on a positive
screening for antibiotic resistant mutants and further allows the generation of multiple
mutants by antibiotic marker recycling in a second step. For homologous recombination
with the bacterial DNA of strain HxN1, the narrow host range vector pCM184 was used
(Marx & Lidstrom, 2002). The pCM184 vector carries three antibiotic resistance marker
genes (bla, kan, tet). The kan gene is flanked by two loxP sites and two multiple cloning
sites and replaces the deleted gene after homologous recombination. The loxP sites are
recognition sites for the Cre recombinase, encoded on vector pCM157, which enable the
generation of an unmarked deletion mutant (Marx & Lidstrom, 2002). The two additional
antibiotic genes encoded in pCM184, bla and tet, are markers to screen for a double
crossover event.
Due to its narrow host range, limited to E. coli and closely relatives, the plasmid pCM184
is only maintained in HxN1 cells if the DNA integrates into the genome. Consequentially,
![Page 80: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/80.jpg)
Identification of a second mas operon
74
the transfer of pCM184 without homologous insertions from E. coli S17-1 to strain HxN1
did not yield any transconjugants. Additionally, this served as control for the efficiency of
the selection criteria: E. coli S17-1 harboring pCM184 should be able to grow in the
presence of kanamycin. Since E. coli S17-1 is unable to grow on the solid mineral
medium no colonies were obtained.
For deletion of masD, the vector pCM184_∆masD (Fig. 1a) was transferred by
conjugation from E. coli S17-1 into strain HxN1. Following crossover of the homologous
regions of pCM184_∆masD with their counterparts in strain HxN1, masD should be
replaced by kan, resulting in a marked deletion mutant. The integration frequency of
pCM184_∆masD into the genome of strain HxN1 was 7.06 x 10–6, as displayed by
kanamycin resistant colonies. Similar integration frequencies (2.2 x 10–6) with the cre-lox
system were reported for Magnetospirillum gryphiswaldense (Gärdes, 2005). Obtained
kanamycin resistant colonies were streaked onto fresh solid medium containing
kanamycin to promote a double crossover in the absence of ampicillin and tetracycline.
The generation of a marked deletion mutant and the following screening in the presence
of an antibiotic has the advantage over the generation of an unmarked mutant that a
reversion to the wild type genotype is omitted. Accordingly, the number of ∆masD
mutants should be higher with the cre-lox system than with a system, which generates
unmarked deletion mutants as for instance the sacB system (Schäfer et al., 1994). 20%
of the screened clones of strain HxN1 showed a deletion of masD, whereas the
remaining clones still contained the plasmid backbone, indicating a single crossover. It is
assumed that a double crossover will also happen in these clones after longer incubation
without selective pressure towards ampicillin and tetracycline, yielding a KmR, ApS, TcS
phenotype. In comparison, the generation of an unmarked deletion mutant of
A. aromaticum strain EbN1 with the sacB system yielded less than 4% of double
crossover mutants (Wöhlbrand & Rabus, 2009).
Identification of a second mas operon in strain HxN1
The potential deletion mutants were analyzed by PCR. Unexpectedly, the masD and the
kan gene were both present, although removal of the plasmid DNA backbone was
confirmed in a PCR targeting the bla gene (product size 837 bp), which was negative for
the mutant (Fig. 2). To elucidate these contradictory results, another PCR reaction was
performed. The used primers were localized outside the regions, which are part of the
deletion cassette in pCM184_∆masD to exclude binding of the primers to the cassette, in
case it has integrated elsewhere in the genome. The forward primer hybridizes 73 bases
upstream of masA, the reverse primer within masG. The expected length of the PCR
![Page 81: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/81.jpg)
Identification of a second mas operon
75
product for the deletion mutant was 5417 bp, whereas for the wild type a length of
6534 bp was calculated.
wild typemasEmasC masD masF masGmasBmasA
masA_f masD_f masD_rmasG_r
1000 bp
∆masD::aacC1EC F GBA aacC1
loxPloxP
aacC1_f aacC1_r
6534 bp
5417 bp
2438 bp
wild type
∆masD::kan
masD
PCR-product masA_f + masG_r:
aacC1
kan
525 bp
708 bp
a)
b)
∆masD::kanEC F GBA kan
loxPloxP
kan_f kan_rmasA_f masG_r
wild typemasEmasC masD masF masGmasBmasA
masA_f masD_f masD_rmasG_r
1000 bp
∆masD::aacC1EC F GBA aacC1
loxPloxP
aacC1_f aacC1_r
6534 bp
5417 bp
2438 bp
wild type
∆masD::kan
masD
PCR-product masA_f + masG_r:
aacC1
kan
525 bp
708 bp
a)
b)
∆masD::kanEC F GBA kan
loxPloxP
kan_f kan_rmasA_f masG_r
masD bla kan aacC1
L wt ∆ ∆,∆ ´ nc L pc ∆ ∆,∆ ´ nc L pc ∆ ∆,∆ ´ nc LL pc ∆ ∆,∆ ´ nc
700
size
[bp]
800900
2000
3000
600500
c)masD bla kan aacC1
L wt ∆ ∆,∆ ´ nc L pc ∆ ∆,∆ ´ nc L pc ∆ ∆,∆ ´ nc LL pc ∆ ∆,∆ ´ nc
700
size
[bp]
800900
2000
3000
600500
c)
Fig. 2 Genetic characterization of strain HxN1
masD deletion mutants by PCR. a) Schematic
depiction of the chromosomal region of the wild
type, the ∆masD::kan and the ∆masD::aacC1´
mas operon. Primer binding sites are indicated
with arrows. b) Sizes of PCR-products obtained
wt ∆ ∆,∆ ´ nc L
10
5
86
size
[kb]
d) masA - masG
wt ∆ ∆,∆ ´ nc L
10
5
86
size
[kb]
d) masA - masG
![Page 82: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/82.jpg)
Identification of a second mas operon
76
with the applied primers. c) Electropherogram of PCR-products obtained for the HxN1 wild type
(abbreviated as wt), the ∆masD (∆) and the ∆masD, ∆masD´ mutant (∆,∆´). A negative control
(nc) was performed without template. As positive controls (pc) plasmid-DNA of pCM184 for bla
and kan and of pBBR1MCS-5 for aacC1 was used. L: molecular weight ladder.
d) Electropherogram of the PCR-product obtained with the primer pair targeting the mas operon
in the HxN1 wild type (wt), the ∆masD (∆) and the ∆masD, masD´ (∆,∆´) mutant. A negative
control (nc) was performed without template.
Unexpectedly, the mutant strain showed both signals (Fig. 2). This pointed to the
presence of at least two mas operons in strain HxN1. Following conjugational transfer of
pCM184_∆masD, homologous recombination occurred with one mas operon, while the
other mas operon(s) were not affected due to transfer of only one plasmid molecule
during conjugation.
For further investigation of the obtained ∆masD mutant, Southern blot analysis was
performed. The applied probe hybridizes with parts of the genes masA and masB
(Fig. 3). Following restriction digest of genomic DNA with PstI, the probe bound in the
wild type to a DNA fragment with a size of 7300 bp (Fig. 3). In a mutant, where masD is
replaced by kan, the probe should hybridize with a 6150 bp fragment, due to the smaller
size of the kan gene as compared to masD. The present mutant strain yielded two
hybridization signals (Fig. 3), both for the wild type and for the ∆masD::kan mas operon,
which further supports the hypothesis of two or more mas operons in the genome of
strain HxN1. Assuming another mas operon to be present in strain HxN1, a second
deletion cassette with another marker gene (aacC1) for resistance against gentamycin
was constructed for homologous recombination with the remaining wild type mas
operon. The vector pCM184_∆masD_aacC1 was introduced into HxN1 ∆masD by
conjugation, which resulted in kanamycin and gentamycin resistant colonies. The
presence of kanamycin prevents from a double crossover with the already mutated mas
operon, where masD is replaced by kan. Only those colonies, which harbor two modified
mas operons were able to grow on mineral medium containing kanamycin and
gentamycin. PCR analysis targeting the masD, bla and aacC1 genes was performed to
verify a double crossover in potential mutants (Fig. 2). Concurrent with the absence of
bla, masD was not detected anymore, which confirmed a double crossover and excluded
the presence of more than two mas operons in strain HxN1 (Fig. 2). In the ∆masD,
∆masD´ mutant, both antibiotic marker genes, kan and aacC1, which have been
integrated into the genome, were detected. The primer pair, which amplifies the mas
operon did not yield the 6534 bp PCR-product for the wild type mas operon anymore, but
only the 5417 bp PCR-product for the ∆masD::kan mas operon. A second PCR-product
![Page 83: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/83.jpg)
Identification of a second mas operon
77
for the ∆masD::aacC1 mas operon with a calculated size of 4858 bp was not obtained,
probably due to suboptimal conditions of the PCR conditions (Fig. 2d).
Integration of aacC1 into the mas operon also results in a different restriction pattern with
PstI in comparison to the wild type and the ∆masD::kan mas operon. Accordingly, in
Southern blot analysis the probe should hybridize in the mas operon where masD is
replaced by aacC1 with a 5600 bp fragment. Consequentially, the HxN1 mutant strain
with two modified mas operons showed two signals: the 6510 bp signal for the
∆masD::kan mas operon and the 5600 bp signal for the ∆masD::aacC1 mas operon,
whereas the 7300 bp signal of the wild type mas operon was absent (Fig. 3).
1000 bp
wild typemasEmasC masD masF masGmasBmasA
∆masD::kanEC F GBA kan
loxPloxP
∆masD::aacC1EC F GBA aacC1
loxPloxP
a)probe
probe
probe
PsiI
PsiI
PsiI PsiI
PsiI
PsiI
b)
wild type
∆masD::kan
∆masD::aacC1
7300 bp
6150 bp
5600 bp
L wt ∆ ∆, ∆ ´
8765
size [kb] c)
1000 bp
wild typemasEmasC masD masF masGmasBmasA
∆masD::kanEC F GBA kan
loxPloxP
∆masD::aacC1EC F GBA aacC1
loxPloxP
a)probeprobe
probeprobe
probeprobe
PsiIPsiI
PsiIPsiI
PsiIPsiI PsiIPsiI
PsiIPsiI
PsiIPsiI
b)
wild type
∆masD::kan
∆masD::aacC1
7300 bp
6150 bp
5600 bp
L wt ∆ ∆, ∆ ´
8765
size [kb] c)
Fig. 3 Genetic characterization of strain HxN1 masD deletion mutants by Southern blot.
a) Schematic depiction of the chromosomal region of the wild type mas operon, the ∆masD::kan
mas operon and the ∆masD::aacC1 mas operon. Restriction sites of PstI and the hybridization
site of the probe are indicated. b) Sizes of fragments obtained by restriction with PstI in the wild
type mas operon, the ∆masD::kan and the ∆masD::aacC1 mas operon of strain HxN1.
c) Detection of the PstI restriction fragments in the HxN1 wild type (abbreviated as wt), the
∆masD (∆) and the ∆masD, ∆masD´ (∆,∆´) mutant by Southern blot. L: biotinylated molecular
weight ladder.
![Page 84: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/84.jpg)
Identification of a second mas operon
78
Sequencing of the remaining masD gene of the ∆masD mutant revealed a sequence
completely identical to the one, which has been deposited in GenBank under Accession
No. AM748709 (Grundmann et al., 2008). We assume that both mas operons are
identical in their sequence because sequencing always resulted in only one sequence
and not in ambiguous chromatograms. In addition, the mas operons need to be identical
in the 73 bases upstream of masA, otherwise the forward primer for the amplification of
the mas operon could not have bound to the mutated and to the wild type mas operon
(Fig. 2). Apart from the sequence of the mas operon, around 3 kb of upstream sequence
were retrieved in a clone library. However, the upstream sequence is covered by only
one clone completely and partially by two more clones. Downstream of the mas operon,
the sequence is unknown at all. As long as more sequence information is not available, it
remains unclear, where the sequences upstream and downstream of the mas operons
start to differ from each other. Accordingly, the location of the two mas operons in the
genome of strain HxN1 is presently unknown. Therefore, the antibiotic marker genes in
the mutants were not recycled by Cre recombinase, because Cre-mediated
recombination might result in the removal of the sequence between the two mas
operons, which both harbor loxP recognition sites.
The presence of two mas operons is not unique to strain HxN1. The anaerobic n-alkane
degrading sulfate reducer D. alkenivorans strain AK-01 contains two ass operons as
well, but in contrast to strain HxN1 the ass operons are not identical to each other
(Callaghan et al., 2008). Two or more non-identical copies of the genes encoding an
n-alkane activating enzyme have not only been identified in anaerobic but also in aerobic
n-alkane degrading bacteria (van Beilen et al., 2001; van Beilen et al., 2004). As the
given examples indicate, multiple copies of n-alkane activating enzyme encoding genes
are widespread. However, strain HxN1 differs from other known strains with more than
one gene for an n-alkane activating enzyme by having two completely identical copies of
an entire operon.
Physiological characterization of the HxN1 ∆masD and ∆masD, ∆masD´ mutants
The obtained ∆masD and ∆masD, ∆masD ´mutants were analyzed regarding their ability
to grow anaerobically with n-hexane. The ∆masD mutant was, after a prolonged lag-
phase as compared to the wild type, still able to grow with n-hexane (Fig. 4). Growth was
only slightly impaired in the presence of the two antibiotics, kanamycin and gentamycin.
The ability of the ∆masD mutant to grow with n-hexane as well as the difference in the
lag phase between wild type and mutant confirms the functionality of both mas operons.
In the ∆masD mutant the lag phase is prolonged, because with less amount of
![Page 85: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/85.jpg)
Identification of a second mas operon
79
(1-methylalkyl)succinate synthase it takes longer to reach substrate saturation and the
maximal reaction rate of the enzyme. Thus, a duplication of the mas operon optimizes
growth with n-alkanes in the beginning, while later on the metabolic rate is limited by
substrate saturation. Therefore, the doubling time (23 hours) and the growth rate
(µ = 0.029) of the wild type and the ∆masD mutant were identical. Under optimal
conditions the doubling time of strain HxN1 is 9 to 11 hours (Ehrenreich et al., 2000;
Schmitt et al., unpublished results). The higher doubling times observed in this study are
the result of stepwise addition of small amounts of nitrate (≤ 5 mM) instead of supply with
8.5 to 9 mM (Ehrenreich et al., 2000) or continuous supply in a fermenter (Schmitt et al.,
unpublished results). The proposed function of the mas encoded (1-methylalkyl)
succinate synthase was confirmed by the inability of the ∆masD, ∆masD´ mutant to grow
with n-hexane (Fig. 4). Control experiments with caproate as carbon source showed no
effect of the masD, masD´ deletion on the capability of strain HxN1 to degrade fatty
acids (data not shown).
Time [h]
0 100 200 300 400
Opt
ical
den
sity
600
nm
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Fig. 4 Time course of anaerobic growth of strain HxN1 wild type, ∆masD and ∆masD, ∆masD´
with n-hexane. Growth of the wild type (black squares) starts after three days, whereas the lag
phase in the ∆masD mutant (black and white circles) is prolonged. With antibiotics (black circles)
growth is slightly inhibited. The ∆masD, ∆masD´ mutant (black and white triangles) is unable to
grow with n-hexane.
![Page 86: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/86.jpg)
Identification of a second mas operon
80
In trans expression of masD by complementation
To restore the capability of the ∆masD, ∆masD´ mutant to grow with n-alkanes
anaerobically, masD was introduced into strain HxN1 on the vector pBBR1MCS (Fig. 1b)
(Kovach et al., 1994). Despite in trans expression of masD was confirmed in Western
blot (Fig. 5), the complemented mutant failed to grow with n-hexane, independent of the
presence or absence of antibiotics. As revealed by Western blot, the signal obtained for
MasD of the complemented mutant is weaker, compared to the wild type of strain HxN1
grown with n-hexane (Fig. 5). Probably, expression of masD under the control of the lac
and the T3 promoter of the vector is suboptimal, but constitutively. However, reduced
growth should also be possible with low amounts of (1-methylalkyl)succinate synthase.
Hwild type N1 wt ∆masD, ∆masD´ + ∆masD, ∆masD´ +
pBBR1MCS pBBR1MCS_masD
n-hex n-hex n-hex
100 kDa
70 kDa
L capr capr capr capr capr capr
Hwild type N1 wt ∆masD, ∆masD´ + ∆masD, ∆masD´ +
pBBR1MCS pBBR1MCS_masD
n-hex n-hex n-hex
100 kDa
70 kDa
L capr capr capr capr capr capr
Fig. 5 Western blot for verification of masD expression in the complemented ∆masD, ∆masD´
mutant. The HxN1 wild type and the ∆masD, ∆masD´ mutants were grown with caproate either
alone or in addition with n-hexane. Obtained signals in the ∆masD, ∆masD´ mutant
complemented with pBBR1MCS_masD during growth with caproate and n-hexane indicate
constitutive expression of masD under the control of the plasmid promoters. The ∆masD, ∆masD´
mutant with the empty pBBR1MCS plasmid served as negative control. The HxN1 wild type
served as positive control. For the wild type, a signal for MasD was only obtained during growth
with n-hexane, because the mas operon needs to be induced. L: pre-stained ladder.
As the deletion and insertion of genes can cause polar effects on the adjacent genes,
expression of masC and masE was analyzed on the protein level in Western blot. MasC
and MasE probably represent the small subunits of (1-methylalkyl)succinate synthase
and thus, are needed for enzyme activity. For this purpose, the mutants were grown in
the presence of n-hexane and caproate to promote expression of the mas operon, which
is only induced in the presence of n-alkanes (Grundmann et al., 2008), while caproate
served as carbon source to enable growth of the mutants. Expression of the mas operon
was shown to be not inhibited in the presence of a second carbon source (Webner et al.,
unpublished results). Western blot confirmed polar effects, because MasC and MasE
were not detectable in the mutant strain (data not shown). Polar effects were also
![Page 87: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/87.jpg)
Identification of a second mas operon
81
observed in T. aromatica strain T1 after partial deletion of tutD, which encodes the
catalytic subunit of the benzylsuccinate synthase (Coschigano, 2002). By introducing a
plasmid harboring the entire tut gene cluster with an in-frame deletion in the upstream
gene of tutD, the phenotype was restored (Coschigano, 2002). This proved that only the
genes downstream of tutD are affected by its deletion. However, in strain HxN1 the
downstream as well as the upstream genes are affected by the deletion of masD. A
possible recombination between the chromosomal and the plasmid encoded tut operon
of strain T1 was excluded and thus, the ability of the complemented mutant to grow with
toluene, was due to complementation rather than recombination (Coschigano, 2002). In
Azoarcus sp. strain T complementation of the deletion of 96% of the bssA gene was
achieved by introducing a plasmid harboring the genes bssA, bssB and bssC without
any modifications (Achong et al., 2001). The complemented mutant grew again with a
reduced growth rate on toluene. However, possible recombination events and polar
effects were not analyzed in this case.
Based on the results obtained for the complementation of the benzylsuccinate synthase
catalytic subunit, a plasmid harboring the entire mas operon plus 1 kb of upstream
sequence to include its elements for transcription was constructed for complementation
of masD in the HxN1 mutant strain. One week later, the complemented mutant started to
grow with n-hexane in the absence of antibiotics, whereas growth in the presence of all
three antibiotics together (kanamycin, gentamycin, chloramphenicol) was not observed
(data not shown). In further approaches, the culture, which was grown in the absence of
antibiotics, was transferred into new tubes with n-hexane, each containing only one of
the three antibiotics. In the presence of kanamycin or chloramphenciol the mutant grew,
but with gentamycin growth started not until a considerably longer lag phase of at least
two weeks (data not shown). Obviously, gentamycin inhibits growth with n-hexane by an
unknown mechanism, whereas it has no effect onto growth with caproate. Growth might
be possible after around two weeks, because gentamycin has become ineffective over
time. However, the successful reconstitution of the phenotype proofs the necessity of
masD for the anaerobic degradation of n-alkanes. A possible recombination of the wild
type mas operon of the plasmid with the mutated mas operons in the genome was not
investigated, but even in this case, the necessity of masD for the degradation of
n-hexane was confirmed. Re-introduction of masD into the genome would demonstrate
the effort of the cells to restore optimal conditions for the degradation of n-alkanes.
![Page 88: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/88.jpg)
Identification of a second mas operon
82
Conclusion
The development of a genetic system for strain HxN1 will allow the investigation of
proteins with so far unknown function. Of special interest is MasB, the fourth subunit of
(1-methylalkyl)succinate synthase, which is unique to anaerobic n-alkane degrading
bacteria (Schmitt et al., unpublished results). The established genetic system will further
be a useful tool to study the proteins of other anaerobic n-alkane degrading strains,
which differ in their substrate range. Strain HxN1 might represent a convenient model
organism due to its relatively fast growth with n-alkanes (doubling time of around
11 hours (Ehrenreich et al., 2000)) compared to sulfate-reducing bacteria. Another
interesting aspect of strain HxN1 revealed in this study is the identification of two
completely identical mas operons. As soon as the genome sequence of strain HxN1 will
be available, the genetic system will be useful to identify the regulating system of these
two mas operons.
Acknowledgement
We thank Insa Schmitt for the development of the solid growth medium for strain HxN1.
This work was supported by the Max-Planck-Gesellschaft.
References
Achong, G.R., Rodriguez, A.M. & Spormann, A.M. (2001) Benzylsuccinate synthase of
Azoarcus sp. strain T: cloning, sequencing, transcriptional organization, and its role
in anaerobic toluene and m-xylene mineralization. J. Bacteriol. 183: 6763−6770.
Callaghan, A.V., Gieg, L.M., Kropp, K.G., Suflita, J.M. & Young, L.Y. (2006) Comparison
of mechanisms of alkane metabolism under sulfate-reducing conditions among two
bacterial isolates and a bacterial consortium. Appl. Environ. Microbiol. 72: 4274−
4282.
Callaghan, A.V., Wawrik, B., Ni Chadhain, S.M., Young, L.Y. & Zylstra, G.J. (2008)
Anaerobic alkane-degrading strain AK-01 contains two alkylsuccinate synthase
genes. Biochem. Biophys. Res. Commun. 366: 142−148.
Callaghan, A.V., Morris, B.E., Pereira, I.A., McInerney, M.J., Austin, R.N., Groves, J.T. et
al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: a
blueprint for anaerobic alkane oxidation. Environ. Microbiol. 14: 101−113.
![Page 89: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/89.jpg)
Identification of a second mas operon
83
Cohen, S.N., Chang, A.C. & Hsu, L. (1972) Nonchromosomal antibiotic resistance in
bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl.
Acad. Sci. U S A 69: 2110−2114.
Coschigano, P.W. (2002) Construction and characterization of insertion/deletion
mutations of the tutF, tutD, and tutG genes of Thauera aromatica strain T1. FEMS
Microbiol. Lett. 217: 37−42.
Cravo-Laureau, C., Grossi, V., Raphel, D., Matheron, R. & Hirschler-Réa, A. (2005)
Anaerobic n-alkane metabolism by a sulfate-reducing bacterium, Desulfatibacillum
aliphaticivorans strain CV2803T. Appl. Environ. Microbiol. 71: 3458−3467.
Davidova, I.A., Gieg, L.M., Nanny, M., Kropp, K.G. & Suflita, J.M. (2005) Stable isotopic
studies of n-alkane metabolism by a sulfate-reducing bacterial enrichment culture.
Appl. Environ. Microbiol. 71: 8174−8182.
Dehio, C. & Meyer, M. (1997) Maintenance of broad-host-range incompatibility group P
and group Q plasmids and transposition of Tn5 in Bartonella henselae following
conjugal plasmid transfer from Escherichia coli. J. Bacteriol. 179: 538−540.
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Gärdes, A. (2005) Deletionsmutagenese eines Magnetosomenproteins in
Magnetospirillum gryphiswaldense unter Etablierung des Cre-loxP-Systems.
Diplomarbeit, Fachhochschule Emden.
Grundmann, O., Behrends, A., Rabus, R., Amann, J., Halder, T., Heider, J. & Widdel, F.
(2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes
in the denitrifying bacterium, strain HxN1. Environ. Microbiol. 10: 376−385.
Hilberg, M., Pierik, A.J., Bill, E., Friedrich, T., Lippert, M.L. & Heider, J. (2012)
Identification of FeS clusters in the glycyl-radical enzyme benzylsuccinate synthase
via EPR and Mossbauer spectroscopy. J. Biol. Inorg. Chem. 17: 49−56.
Inoue, H., Nojima, H. & Okayama, H. (1990) High efficiency transformation of
Escherichia coli with plasmids. Gene 96: 23−28.
Kovach, M.E., Phillips, R.W., Elzer, P.H., Roop, R.M., 2nd & Peterson, K.M. (1994)
pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16: 800−802.
Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., 2nd &
Peterson, K.M. (1995) Four new derivatives of the broad-host-range cloning vector
pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175−176.
Kropp, K.G., Davidova, I.A. & Suflita, J.M. (2000) Anaerobic oxidation of n-dodecane by
an addition reaction in a sulfate-reducing bacterial enrichment culture. Appl.
Environ. Microbiol. 66: 5393−5398.
![Page 90: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/90.jpg)
Identification of a second mas operon
84
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680−685.
Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E. et al. (1998)
Biochemical and genetic characterization of benzylsuccinate synthase from
Thauera aromatica: a new glycyl radical enzyme catalysing the first step in
anaerobic toluene metabolism. Mol. Microbiol. 28: 615−628.
Li, L., Patterson, D.P., Fox, C.C., Lin, B., Coschigano, P.W. & Marsh, E.N. (2009)
Subunit structure of benzylsuccinate synthase. Biochemistry 48: 1284−1292.
Marx, C.J. & Lidstrom, M.E. (2002) Broad-host-range cre-lox system for antibiotic marker
recycling in gram-negative bacteria. Biotechniques 33: 1062−1067.
Pattaragulwanit, K. & Dahl, C. (1995) Development of a genetic system for a purple
sulfur bacterium: conjugative plasmid transfer in Chromatium vinosum. Arch.
Microbiol. 164: 217−222.
Rabus, R. & Widdel, F. (1995) Anaerobic degradation of ethylbenzene and other
aromatic hydrocarbons by new denitrifying bacteria. Arch. Microbiol. 163: 96−103.
Rabus, R., Wilkes, H., Behrends, A., Armstroff, A., Fischer, T., Pierik, A.J. & Widdel, F.
(2001) Anaerobic initial reaction of n-alkanes in a denitrifying bacterium: Evidence
for (1-methylpentyl)succinate as initial product and for involvement of an organic
radical in n-hexane metabolism. J. Bacteriol. 183: 1707−1715.
Rao, V.K., Whitlock, J.A. & Progulske-Fox, A. (1993) Development of a genetic system
for Eikenella corrodens: transfer of plasmids pFM739 and pLES2. Plasmid 30:
289−295.
Rueter, P., Rabus, R., Wilkes, H., Aeckersberg, F., Rainey, F.A., Jannasch, H.W. &
Widdel, F. (1994) Anaerobic oxidation of hydrocarbons in crude oil by new types of
sulphate-reducing bacteria. Nature 372: 455−458.
Sambrook, J. & Russell, D.W. (2001) Molecular Cloning: A Laboratory Manual. New
York: Cold Spring Harbor Laboratory Press.
Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G. & Pühler, A. (1994)
Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli
plasmids pK18 and pK19: selection of defined deletions in the chromosome of
Corynebacterium glutamicum. Gene 145: 69−73.
Schultheiss, D. & Schuler, D. (2003) Development of a genetic system for
Magnetospirillum gryphiswaldense. Arch. Microbiol. 179: 89−94.
Selmer, T., Pierik, A.J. & Heider, J. (2005) New glycyl radical enzymes catalysing key
metabolic steps in anaerobic bacteria. Biol. Chem. 386: 981−988.
![Page 91: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/91.jpg)
Identification of a second mas operon
85
Simon, R., Priefer, U. & Pühler, A. (1983) A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Nat.
Biotechnol.1: 784−791.
van Beilen, J.B. & Funhoff, E.G. (2005) Expanding the alkane oxygenase toolbox: New
enzymes and applications. Curr. Opin. Biotechnol. 16: 308−314.
van Beilen, J.B., Panke, S., Lucchini, S., Franchini, A.G., Rothlisberger, M. & Witholt, B.
(2001) Analysis of Pseudomonas putida alkane-degradation gene clusters and
flanking insertion sequences: evolution and regulation of the alk genes. Microbiol.
147: 1621−1630.
van Beilen, J.B., Marin, M.M., Smits, T.H., Rothlisberger, M., Franchini, A.G., Witholt, B.
& Rojo, F. (2004) Characterization of two alkane hydroxylase genes from the
marine hydrocarbonoclastic bacterium Alcanivorax borkumensis. Environ.
Microbiol. 6: 264−273.
Widdel, F. & Bak, F. (1992) Gram-negative mesophilic sulfate-reducing bacteria. In The
Prokaryotes. Balows, A., Trüper, H. G., Dworkin, M., Harder, W., Schleifer, K.-H.
(ed). Berlin: Springer Verlag, pp. 3352−3389.
Widdel, F., Knittel, K. & Galushko, A. (2010) Anaerobic hydrocarbon-degrading
microorganisms: an overview. In Handbook of hydrocarbon and lipid microbiology.
Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 1998−2021.
Wöhlbrand, L. & Rabus, R. (2009) Development of a genetic system for the denitrifying
bacterium 'Aromatoleum aromaticum' strain EbN1. J. Mol. Microbiol. Biotechnol.
17: 41−52.
![Page 92: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/92.jpg)
86
![Page 93: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/93.jpg)
87
4. Bericht Construction and characterization of ∆masBCDE deletion mutants of strain HxN1
In diesem Bericht ist die Herstellung weiterer Mutanten von Stamm HxN1 beschrieben,
die nicht Bestandteil des Manuskriptes “Identification of a second functional mas operon
in the anaerobic n-alkane degrader strain HxN1 by a newly developed genetic system”
sind.
Herstellung und Charakterisierung der Mutanten. Die verwendeten Plasmide wurden von
Olav Grundmann hergestellt.
Summary
The generation of a ∆masBCDE, ∆masBCDE´ mutant of strain HxN1 confirmed the
results obtained for the ∆masD, ∆masD´ mutant, namely the presence of two mas
operons and the necessity of the deleted genes for the anaerobic degradation of
n-alkanes.
Introduction
The successful establishment of a genetic system for strain HxN1 and the in vivo
verification of the necessity of masD, encoding the catalytic subunit of
(1-methylalkyl)succinate synthase (Webner et al., unpublished results), enables the
investigation of the necessity of the small subunits MasB, MasC and MasE for the
anaerobic activation of n-alkanes. For this purpose a ∆masBCDE mutant of strain HxN1
was generated, instead of deletion of each gene alone. The aim was to re-introduce all
subunit encoding genes except of one on a plasmid into the mutant and to analyze the
effect of the one missing subunit onto growth of strain HxN1 with n-hexane.
![Page 94: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/94.jpg)
Construction of masBCDE deletion mutants
88
Material and methods
For a detailed description of the applied methods the reader is referred to the manuscript
“Identification of a second functional mas operon in the anaerobic n-alkane degrader
strain HxN1 by a newly developed genetic system”. Bacterial strains and plasmids used
in this study are depicted in table 1, sequences of oligonucleotide primers are listed in
table 2. The masBCDE deletion cassette in pCM184 was constructed analogously by
subsequent cloning of the upstream region of masB (2940 bp) and of the downstream
region of masE (2753 bp) into pCM184. The resulting plasmid pCM184_∆masBCDE has
a size of 12 453 bp.
Table 1 Bacterial strains and plasmids used in this study.
Strain or plasmid xx
Marker xx
Genotype and characteristics
Reference or source
Strains
E. coli S17-1 thi recA pro hsdR
RP4-2-Tc::Mu-Km::Tn7
Simon et al.
(1983)
E. coli TOP10 StrR F- mcrA ∆(mrr-hsdRMS-
mcrBC) Ф80lacZ∆M15
∆lacX74 recA1 araD139
∆(araleu)7697 galU galK
rpsL endA1 nupG
Invitrogen
(Darmstadt,
Germany)
HxN1
Ehrenreich et
al. (2000)
HxN1 ∆masBCDE KmR ∆masBCDE this study
HxN1 ∆masBCDE,
∆masBCDE´
KmR, GmR ∆masBCDE, ∆masBCDE´ this study
Plasmids
pCM184
ApR, KmR, TcR
Marx &
Lidstrom (2002)
pCM184_upstream-masB ApR, KmR, TcR masA, this study
pCM184_∆masBCDE ApR, KmR, TcR masA, masF, masG this study
pCM184_∆masBCDE_aacC1 ApR, GmR, TcR masA, masF, masG this study
pBBR1MCS_mas operon CmR mas operon + 1kb
upstream sequence
Webner et al.,
unpublished
![Page 95: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/95.jpg)
Construction of masBCDE deletion mutants
89
Table 2 Oligonucleotide primers used in this study; restriction sites are underlined.
Primer
Target gene or region
Sequence (5´→ 3´)
Product length [bp]
masBCDE deletion construct in pCM184
upstream_BglII_f ATCAGATCTTAGCCAGAATTGCATGGTCAT
upstream_KpnI_r
upstream masBCDE
ATCGGTACCCATAACATATTAGGATTTTTAC
2940
downstream_ApaI_f TCGGGCCCTAGGCAGCAAGTAGCCTCCCTT
downstream_MluI_r
downstream masBCDE
ATCACGCGTGAAGACGCCGCTATCAGTCAG
2753
aacC1_PstI_f ATGCTGCAGCCGATCTCGGCTTGAACGAA
aacC1_PstI_r
aacC1
ATGCTGCAGCAGTGGCGGTTTTCATGGC
674
Confirmation of double crossover
masD_f CTGCAACTTCAACACTATCC
masD_r
masD
ACCAGCCACACGAACGATA
2438
bla_f ACATTTCCGTGTCGCCCTTA
bla_r
bla
ATCAGTGAGGCACCTATCTC
837
kan_f ATGAGCCATATTCAACGGGA
kan_r
kan
GAGGCAGTTCCATAGGATG
708
aacC1_f ATGTTACGCAGCAGCAAC
aacC1_r
aacC1
GGTACTTGGGTCGATATCA
525
masBCDE complementation
mas operon_f GGTACAGCGCCAACCACTCGTAGAT
mas operon_SpeI_r
mas operon
ATTACTAGTGTTAATAGAAGACGCCGCTAT
8356
Probe for southern blot
southern probe_f masA TTCAGAGCTATTGACCCGTG
southern probe_r masB GACAGTACTTGGCGTCACTA
505
Results and Discussion
Generation of a ∆masBCDE, ∆masBCDE´ deletion mutant of strain HxN1
Following conjugational transfer of pCM184_∆masBCDE into strain HxN1, the obtained
kanamycin resistant colonies were analyzed by PCR for the presence of masD and the
antibiotic resistance genes. Analogously to the ∆masD mutant, a double crossover was
confirmed by the absence of bla, concurrent with the presence of masD and kan (data
![Page 96: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/96.jpg)
Construction of masBCDE deletion mutants
90
not shown). A second homologous recombination event of the genomic DNA with the
plasmid pCM184_∆masBCDE_aacC1 resulted in a ∆masBCDE, ∆masBCDE´ mutant.
The homologous recombination of the genome with this plasmid indicates that both mas
operons need to be identical not only in the 73 bases upstream of masA, as shown for
the ∆masD, ∆masD´ mutant (Webner et al., unpublished results), but also in the region
1 kb upstream of masA. Otherwise, homologous recombination of the plasmid and the
genome would have remained unsuccessful.
1000 bp
wild typemasEmasC masD masF masGmasBmasA
∆masBCDE::kanF GA kan
loxPloxP
∆masBCDE::aacC1F GA aacC1
loxPloxP
a)probe
probe
probe
PsiI
PsiI
PsiI PsiI
PsiI
PsiI
b)
wild type
∆masBCDE::kan
∆masBCDE::aacC1
7300 bp
5280 bp
4700 bp
L wt ∆ ∆, ∆ ´8765
size [kb] c)
4
1000 bp
wild typemasEmasC masD masF masGmasBmasA
∆masBCDE::kanF GA kan
loxPloxP
∆masBCDE::aacC1F GA aacC1
loxPloxP
a)probeprobe
probeprobe
probeprobe
PsiIPsiI
PsiIPsiI
PsiIPsiI PsiIPsiI
PsiIPsiI
PsiIPsiI
b)
wild type
∆masBCDE::kan
∆masBCDE::aacC1
7300 bp
5280 bp
4700 bp
L wt ∆ ∆, ∆ ´8765
size [kb] c)
4
Fig. 1 Genetic characterization of strain HxN1 masBCDE deletion mutants by Southern blot.
a) Schematic depiction of the chromosomal region of the wild type mas operon, the
∆masBCDE::kan mas operon and the ∆masBCDE::aacC1 mas operon. Restriction sites of PstI
and the hybridization site of the probe are indicated. b) Sizes of fragments obtained by restriction
with PstI in the wild type mas operon, the ∆masBCDE::kan and the ∆masBCDE::aacC1 mas
operon of strain HxN1. c) Detection of the PstI restriction fragments in the HxN1 wild type
(abbreviated as wt), the ∆masBCDE (∆) and the ∆masBCDE, ∆masBCDE´ (∆,∆´) mutant by
Southern blot. L: biotinylated molecular weight ladder.
![Page 97: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/97.jpg)
Construction of masBCDE deletion mutants
91
The deletion of masBCDE was confirmed by Southern blot analysis of restriction
fragments of the HxN1 wild type, the ∆masBCDE and the ∆masBCDE ∆masBCDE´
mutant (Fig. 1). In the HxN1 wild type only one signal for the unmodified mas operon
with a size of 7300 bp was detected. The ∆masBCDE mutant yielded two signals, one
for the unmodified wild type mas operon and a second signal for the ∆masBCDE::kan
mas operon with a size of 5280 bp. Finally, in the ∆masBCDE ∆masBCDE´ mutant, a
signal for the wild type mas operon was absent, but instead a 4780 bp fragment for the
∆masBCDE::aacC1 mas operon was detected additionally to the 5280 bp fragment for
the ∆masBCDE::kan mas operon.
In trans expression of masD by complementation
Likewise the ∆masD mutants, the ∆masBCDE mutant grew with n-hexane after a
prolonged lag phase, whereas the ∆masBCDE, ∆masBCDE´ mutant was unable to grow
with n-hexane anymore (data not shown). Initially, it was planned to complement the
mutant with a pBBR1MCS plasmid harboring the genes masB to masE (data for
generation of this plasmid are not shown). Before and behind each gene, recognition
sites for restriction enzymes were inserted, which allows removal of one gene from the
plasmid backbone. By introducing the plasmid lacking one of the masBCDE genes into
the ∆masBCDE, ∆masBCDE´ mutant, the effect of the missing gene on the ability of
strain HxN1 to grow with n-hexane could have been analyzed.
However, the results of the ∆masD complementation pointed to polar effects (Webner et
al., unpublished results), which probably also affect transcription of masG, the gene
encoding the activating enzyme of (1-methylalkyl)succinate synthase. Accordingly,
complementation with masB to masE was regarded to be insufficient to restore the
phenotype. Therefore, the plasmid pBBR1MCS_mas operon, which has been used for
successful complementation of ∆masD, was introduced into the ∆masBCDE,
∆masBCDE´ mutant first. In the presence of chloramphenicol or kanamycin the
complemented mutant grew with n-hexane again, indicating an effective reconstitution of
the phenotype (data not shown). Retarded growth was also observed in the presence of
gentamycin, as it has been described for the complemented ∆masD, ∆masD´ mutant.
Complementation with the pBBR1MCS_masBCDE plasmid has not been conducted so
far, but is expected to remain unsuccessful.
![Page 98: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/98.jpg)
Construction of masBCDE deletion mutants
92
Outlook
To analyze the function of the small subunits by deletion of their encoding genes, it is
probably necessary to use the plasmid pBBR1MCS_mas operon, in which restriction
sites need to be introduced, to allow the removal of single mas genes. In case of
success, this plasmid can be further used for the generation of a chimeric
(1-methylalkyl)succinate synthase. This could be achieved by exchange one of the
masBCDE genes with its homologue of the related strain OcN1. Strain HxN1 and OcN1
differ by the chain length of the n-alkanes, which are oxidized completely. Strain HxN1
completely degrades n-alkanes with a chain length from C5 to C8, while strain OcN1 uses
C8 to C12 n-alkanes (Ehrenreich et al., 2000; Schmitt et al., unpublished results). The
analysis of active chimeric proteins might elucidate, which one of the subunits
determines the substrate range of the enzyme.
References
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Marx, C.J. & Lidstrom, M.E. (2002) Broad-host-range cre-lox system for antibiotic marker
recycling in gram-negative bacteria. Biotechniques 33: 1062−1067.
Simon, R., Priefer, U. & Pühler, A. (1983) A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Nat.
Biotechnol.1: 784−791.
![Page 99: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/99.jpg)
93
5. Manuskript The (1-methylalkyl)succinate synthase of the n-alkane degrading strain HxN1 is expressed under a wide range of carbon sources Kirsten Webner, Friedrich Widdel and Olav Grundmann Max-Planck-Institut für Marine Mikrobiologie, Celsiusstraße 1, D-28359 Bremen,
Germany.
Erstellung des Manuskriptes, Planung und Durchführung aller Versuche.
Abstract
The (1-methylalkyl)succinate synthase catalyzes the addition of n-alkanes to fumarate in
strain HxN1 under anaerobic conditions. The encoding mas genes are induced in the
presence of the growth substrate n-hexane. In the present study, we show that induction
additionally occurs during cultivation with substrate mixtures of n-hexane and another
carbon source such as a carboxylic acid. The induction of the mas genes under these
conditions disagrees with the concept of carbon catabolite repression. Expression is
even induced by n-alkanes, cyclic alkanes, aromatic hydrocarbons and alcohols, which
are not oxidized completely or which are not a substrate for (1-methylalkyl)succinate
synthase at all, probably due to a relaxed substrate specificity of the sensor mediating
expression of the mas genes. We propose that mas expression induced by a wide range
of carbon sources, even in the presence of other carbon sources, enables strain HxN1 to
respond to utilizable n-alkanes immediately, once they become available and to detoxify
those hydrocarbons, which are a substrate of the (1-methylalkyl)succinate synthase.
![Page 100: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/100.jpg)
Expression of (1-methylalkyl)succinate synthase
94
Introduction
Within the last years an increasing number of microorganisms capable to degrade
petroleum derived hydrocarbons has been isolated. These isolates degrade alkanes or
aromatic hydrocarbons completely to CO2 by anaerobic respiration with nitrate, sulfate or
ferric iron as electron acceptor or by phototrophy (overview in Widdel et al., 2010). The
most widespread mechanism to activate an inert hydrocarbon molecule under anaerobic
conditions is the addition to fumarate yielding substituted succinates, a reaction which is
catalyzed by a glycyl radical enzyme (Heider, 2007). In the case of toluene activation,
the responsible enzyme benzylsuccinate synthase, consisting of three subunits, and its
encoding bss genes have been identified and characterized (Leuthner et al., 1998).
Later, related enzymes catalyzing the addition of an n-alkane to fumarate were
described in the denitrifying strain HxN1 (Grundmann et al., 2008) and the sulfate-
reducer Desulfatibacillum alkenivorans strain AK-01 (Callaghan et al., 2008). The
enzymes were named (1-methylalkyl)succinate synthase (Grundmann et al., 2008),
respectively alkylsuccinate synthase (Callaghan et al., 2008) and the encoding genes
were titled mas, respectively ass.
So far no bacterium has been isolated, which is able to grow with both alkanes and
aromatic hydrocarbons. All obtained isolates use only one of these substrates for growth.
Moreover, the substrate range of the isolated strains is restricted. For many strains
toluene is the only growth substrate among the hydrocarbons and for the n-alkane
degrading bacteria the utilizable n-alkanes lie within a certain range of chain length
(Widdel et al., 2010). Strain HxN1 for example grows with n-alkanes from C5 to C8,
whereas the related strain OcN1 uses n-alkanes with a chain length from C8 to C12
(Ehrenreich et al., 2000, Schmitt et al., unpublished results). However, strain HxN1 co-
metabolizes the alkanes n-butane, cyclopentane and methylcyclopentane if incubated
together with n-hexane (Wilkes et al., 2003). Not only the succinated products of the
activation reaction, but also metabolites of the further downstream degradation pathway,
were identified. Additionally, strain HxN1 and two other alkane degrading strains, OcN1
and TD3, were shown to activate both an alkane and toluene if they were supplied
together (Rabus et al., 2011). For strain HxN1 metabolites of the further degradation
pathway of toluene were analyzed. These metabolites proposed a pathway different to
the regular toluene degradation. It still remains open, whether co-metabolism of certain
hydrocarbons is incompletely to a dead-end product or whether hydrocarbons are
oxidized completely but slower than the preferred ones and might contribute to a minor
amount to energy gain and growth (Wilkes et al., 2003). In contrast, toluene degrading
bacteria were unable to co-metabolize n-alkanes, which was explained by the higher
![Page 101: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/101.jpg)
Expression of (1-methylalkyl)succinate synthase
95
bond dissociation energy of a C–H bond to overcome for an n-alkane at its secondary
carbon atom (– 398 kJ mol–1) than for the methyl group of toluene (– 368 kJ mol–1)
(Rabus et al., 2011). Toluene-activating enzymes possibly are not able to cope with this
higher bond dissociation energy, but an n-alkane activating enzyme should be able to
overcome the weaker bond dissociation energy for toluene activation.
Another aspect that should be considered in terms of the limited substrate range is the
regulation of the hydrocarbon degradation pathway. It was shown that anaerobic
hydrocarbon degradation is inducible. In Thauera aromatica, the benzylsuccinate
synthase as well as the transcript containing the bss genes were only detectable in cells
grown on toluene and not in benzoate-grown cells (Leuthner et al., 1998). The same was
reported for the (1-methylalkyl)succinate synthase and its mas genes, which were only
evident when strain HxN1 was grown with n-hexane and not upon growth with caproate
(Grundmann et al., 2008). The bss operon in toluene-degrading bacteria is likely
regulated by a two-component regulatory system, whose encoding genes were found
adjacent to the bss operon (Coschigano & Young, 1997; Leuthner & Heider, 1998;
Achong et al., 2001; Kube et al., 2004).
The present study was undertaken to gain first insights into the regulation of the
anaerobic n-alkane degradation in strain HxN1. We investigated, whether expression of
the mas genes is inhibited in the presence of n-hexane and a second carbon source.
Furthermore, induction of mas expression by organic compounds and hydrocarbons,
which do not serve as growth substrates, was analyzed.
Material and Methods
Cultivation
The bacterial strain HxN1 was cultivated under denitrifying conditions in defined mineral
medium as described previously (Rabus & Widdel, 1995; Ehrenreich et al., 2000).
Substrates with toxic potential and/or low solubility in water were supplied as 1 or 5%
(v/v) dilution in 2,2,4,4,6,8,8-heptamethylnonane (HMN). Gaseous alkanes were
provided as 1 bar overpressure to the headspace. Carboxylic acids, sugars and alcohols
were added to a final concentration of 5 or 10 mM. Nitrate was supplied regularly in
portions ≤ 5 mM.
Analysis of inhibition and induction of the mas expression
Strain HxN1 was grown with caproate over several passages, then harvested by
centrifugation (10 000 x g, 10 min, 4 °C), washed and re-suspended in anoxic mineral
![Page 102: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/102.jpg)
Expression of (1-methylalkyl)succinate synthase
96
medium. The cell suspension served as inoculum for cultivation under different substrate
conditions. Cultivation was carried out in hungate tubes containing 10 ml of anoxic
mineral medium. The optical density (OD) was measured directly in the tubes at 600 nm
(UV-1202, Shimadzu, Duisburg, Germany). To analyze the inhibition of mas expression,
strain HxN1 was cultivated with caproate, acetate, succinate, fumarate, benzoate or
fructose each together with n-hexane. Parallel control experiments were performed
without n-hexane. For analysis of mas expression as response to different hydrocarbons,
strain HxN1 was cultivated with caproate and one of the hydrocarbons or alcohols
depicted in table 1.
Table 1 n-Alkanes, cyclic alkanes, aromatic hydrocarbons and alcohols used in this study.
n-alkanes cyclic alkanes, aromatics alcohols
methane cyclopentane methanol
ethane methylcyclopentane ethanol
propane cyclohexane 1-propanol
n-butane methylcyclohexane 1-butanol
n-pentane ethylcyclohexane 1-pentanol
n-hexane propylcyclohexane 1-hexanol
n-heptane benzene 1,6-hexanediol
n-octane toluene 2,5-hexanediol
n-nonane ethylbenzene 1-heptanol
n-decane propylbenzene 1-octanol
n-undecane 1-decanol
n-dodecane 1-dodecanol
n-tetradecane 1-tetradecanol
cyclohexanol
A control experiment was conducted with caproate as sole carbon source. Growth was
monitored at least once per day by OD measurement and by determination of nitrate and
nitrite in the cultures with Merckoquant test stripes (Merck, Darmstadt, Germany). Nitrate
was added in portions of 5 mM after depletion. After two or three days of incubation,
samples were withdrawn, centrifuged (10 000 x g, 5 min, 4 °C) and re-suspended in
phosphate buffered saline (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM
KH2PO4, pH 7.3) to an OD of 4 at 600 nm. These cell suspensions were run on 12 %
polyacrylamide gels as described by Laemmli (1970). The PageRuler Prestained Protein
![Page 103: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/103.jpg)
Expression of (1-methylalkyl)succinate synthase
97
Ladder (Fermentas, St. Leon-Rot, Germany) served as molecular size marker. Proteins
were stained with Coomassie R-250 (0.25% (v/v) Coomassie R250, 40% (v/v) ethanol,
10% (v/v) glacial acetic acid). Immunoblotting for detection of MasD was performed as
described by Schmitt et al. (unpublished results). As alternative secondary antibody,
horse radish peroxidase conjugated goat-anti rabbit IgG (Pierce Protein, Rockford,
USA), visualized with an ECL camera system (BIS 303 PC Bioimaging, Amersham
Pharmacia Biotech/GE Healthcare, Munich, Germany), was used.
Analysis of (1-methylalkyl)succinate synthase activity
Strain HxN1 was grown with n-hexane as described above and then transferred with an
inoculation size of 10% into hungate tubes containing 10 ml of fresh anoxic mineral
medium and one of the alkanes or aromatic hydrocarbons depicted above (table 1). An
approach without any carbon source served as negative control. After one week of
incubation samples were withdrawn to determine nitrate consumption and nitrite
production with an ion chromatograph connected to an UV detector (Sykam,
Fürstenfeldbruck, Germany) as described by Rabus and Widdel (1995). Data analysis
was performed with the Clarity HPLC software (DataApex, Praque, Czech Republic).
Results and Discussion
MasD as a marker for mas expression
As reported previously, strain HxN1 consumes n-hexane only after a lag phase if grown
on caproate before (Grundmann et al., 2008), suggesting that the enzyme responsible
for the activation of n-hexane, the (1-methylalkyl)succinate synthase, needs to be
induced. In contrast, caproate was consumed immediately in n-hexane-grown cells,
indicating a constitutive ability to degrade caproate. Correspondingly, in differential two-
dimensional gel electrophoresis of n-hexane- versus caproate-grown cells, subunits of
(1-methylalkyl)succinate synthase were only identified in the n-alkane-grown cells
(Grundmann et al., 2008). The large, catalytic α-subunit (MasD) of the enzyme is
detectable in caproate-adapted cells of strain HxN1 after incubation with n-hexane for at
least two days in sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE) as a prominent protein band with a size of ~ 94 kDa, as well as in Western
blot with immune serum against MasD (Fig. 1a, 2). The amount of MasD increases over
time, which indicates continuous expression of the mas genes to produce high amounts
of (1-methylalkyl)succinate synthase (Fig. 1b). Thus, the presence of MasD was used as
marker for the expression of the mas genes under all tested conditions described below.
![Page 104: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/104.jpg)
Expression of (1-methylalkyl)succinate synthase
98
70 kDa
100 kDaMasD
L 0 7 22 31 46 55 71 79 100 124 143 166 h La)
b)
Time [h]0 20 40 60 80 100 120 140 160 180
Rel
ativ
e In
tens
ity [%
]
0
20
40
60
80
100
70 kDa
100 kDaMasD
L 0 7 22 31 46 55 71 79 100 124 143 166 h La)
b)
Time [h]0 20 40 60 80 100 120 140 160 180
Rel
ativ
e In
tens
ity [%
]
0
20
40
60
80
100
Fig. 1 Production of MasD over time in cell extracts of strain HxN1 shifted from caproate to
n-hexane. a) Western blot for the detection of MasD in cell extracts of strain HxN1 sampled at
different time points (0 to 166 hours). L = pre-stained ladder. b) Relative intensity of the MasD
signal in Western blot at different time points (0 to 166 hours). The highest intensity at time point
166 h was set to 100%.
Expression of the mas genes during cultivation on substrate mixtures
The cultivation of strain HxN1 with two growth substrates, n-hexane and a carboxylic
acid or sugar, showed that the induction of the mas expression was not inhibited in the
presence of a second growth substrate (Fig 2). Apparently, strain HxN1 used the
supplied caboxylic acid or fructose for growth, because growth started immediately,
without showing a lag phase, in contrast to the control with n-hexane as sole carbon
source (Fig 3). Growth with caproate and n-hexane was somewhat slower compared to
growth with caproate alone. Similar results were obtained for carbon sources other than
caproate (data not shown). Anyhow, the mas genes were expressed in all incubations
containing n-hexane. The carboxylic acids and fructose were supplied in a suitable
amount for complete oxidation with the provided nitrate. Both were added regularly to
prevent expression of mas simply due to a lack of the carboxylic acids or fructose.
Without n-hexane MasD was not detectable, which also demonstrates that the induction
of the mas genes is dependent on the presence of n-alkanes (Fig 2).
![Page 105: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/105.jpg)
Expression of (1-methylalkyl)succinate synthase
99
70 kDa
100 kDa
L hexane caproate acetate L benzoate fructose
+ – + – + – + –
MasD
70 kDa
100 kDa
L hexane caproate acetate L benzoate fructose
+ – + – + – + –
MasD
Fig. 2 Denaturing gel electrophoresis (SDS-PAGE) of cell extracts from strain HxN1. Cells were
grown with caproate, acetate, benzoate or fructose either together with n-hexane (+) or alone (–)
and in a positive control with n-hexane as sole carbon source for two days. MasD is apparent in
all cultivations containing n-hexane. L: protein ladder.
For Azoarcus sp. strain T transcription of the bss operon in the presence of benzoate
and toluene was reported (Achong et al., 2001). These two examples (strain HxN1 and
strain T) indicate that expression of the genes for hydrocarbon degradation, even in the
presence of another carbon and energy source, which is more easily to degrade, might
be a common feature in anaerobic hydrocarbon degrading bacteria. This is of interest,
because it disagrees with the commonly established model of carbon catabolite
repression, where induction of one catabolic pathway is inhibited as long as a preferred
carbon source is available (Görke & Stülke, 2008). Carbon catabolite repression was for
example shown in aerobic n-alkane degrading Pseudomonas strains, which
preferentially used other carbon sources than n-alkanes (summarized in Rojo, 2010a).
For anaerobic hydrocarbon degrading bacteria cultivation with a hydrocarbon and
another carbon source has not been conducted so far.
It cannot be excluded that degradation of n-hexane takes place in parallel to the
degradation of another carbon source and contributes to energy gain. However, this
should be only possible after more than two days, because the same time is required for
synthesis of the (1-methylalkyl)succinate synthase (Fig. 1). In addition, consumption of
both substrates should result in faster growth than with one substrate, which was not
observed for strain HxN1 (Fig. 3). It is also possible that the (1-methylalkyl)succinate
synthase is only present after two days in its inactive, radical-free form, which requires
activation by an activating enzyme of the S-adenosylmethionine radical enzyme family
encoded by masG (Sofia et al., 2001; Grundmann et al., 2008). Activation might not take
place until the preferred carbon source is consumed completely. From an energetic point
of view, the expression of (1-methylalkyl)succinate synthase in the presence of a second
carbon source is not that expensive, because the complete oxidation of carboxylic acids
![Page 106: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/106.jpg)
Expression of (1-methylalkyl)succinate synthase
100
or sugars provides energy. Consumption of energy for expression of the mas genes
might be an explanation for the observed slower growth with caproate and n-hexane
together compared to caproate alone (Fig. 3). The question is, why strain HxN1
expresses the mas genes in the presence of another carbon source, which is degraded
immediately. With regard to the natural environment, expression might be advantageous
to be prepared for changes in the availability of carbon sources. When the preferred
growth substrate has been consumed completely, the cell is able to use n-hexane
immediately by the (1-methylalkyl)succinate synthase expressed in advance. Thus, co-
expression of several catabolic pathways might, in the environment, be more common
than carbon catabolite repression observed in laboratory studies.
Time [h]
0 20 40 60 80 100 120
Opt
ical
den
sity
600
nm
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4caproatecaproate + n-hexanen-hexane
Fig. 3 Time course of growth of strain HxN1 with either caproate or n-hexane or both, caproate
and n-hexane.
Another reason for the expression of (1-methylalkyl)succinate synthase, although it is not
required for energy gain, might be the protection against toxic concentrations of
n-hexane. Alkanes are supposed to diffuse freely through the cytoplasmic membrane
due to their hydrophobicity and thus, the diffusion of n-hexane into the cell is not
regulated (Sikkema et al., 1995). High concentrations of hydrocarbons in the membrane
change membrane structure and function by increasing fluidity. As a result, interactions
between lipids and proteins are destroyed and energy conduction is affected (for an
overview see Sikkema et al., 1995). Expression of (1-methylalkyl)succinate synthase
enables the cells to metabolize n-hexane immediately and consequently prevents
![Page 107: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/107.jpg)
Expression of (1-methylalkyl)succinate synthase
101
accumulation to toxic levels. The applied concentration of 5% n-hexane in HMN in this
study is not toxic for strain HxN1. Anyhow, concentrations ≥ 10% inhibit growth partially
and at a concentration of 75% n-hexane in HMN growth of strain HxN1 is inhibited
completely (Behrends, 1999). In the environment, n-alkanes are not diluted in HMN to
prevent toxicity as it is performed in the laboratory. Efflux pumps for hydrocarbons are
not known for strain HxN1, but were for example identified in Pseudomonas putida to
remove aromatic hydrocarbons (Ramos et al., 2002). Conversion of a toxic substrate into
a non-toxic metabolite is another protection strategy.
Induction of mas expression
Expression of the mas genes in strain HxN1 grown with n-hexane and caproate enabled
the investigation of mas expression in the presence of hydrocarbons, which do not
support growth. In these experiments caproate promoted growth whereas the
hydrocarbon served as possible inductor of the mas expression. Signals for MasD in
Western blot analysis were obtained upon incubation with those alkanes, which serve as
growth substrate for strain HxN1: n-pentane, n-hexane, n-heptane and n-octane (Fig. 4).
In addition, the hydrocarbons n-butane, cyclopentane, methylcyclopentane and toluene,
which were shown to be activated co-metabolically (Wilkes et al., 2003; Rabus et al.,
2011), promoted mas expression (Fig. 4, 5).
L C1 C2 C3 C4 C5 C6
70 kDa
100 kDa
L C7 C8 C9 C10 C11 C12
70 kDa
100 kDa
L C1 C2 C3 C4 C5 C6
70 kDa
100 kDa
L C7 C8 C9 C10 C11 C12
70 kDa
100 kDa
Fig. 4 Western blot for the identification of MasD in cell extracts of strain HxN1 after incubation of
caproate-adapted cells for three days with n-alkanes of a chain length from C1 to C12. L: pre-
stained ladder.
Hence, the enzyme not only converts other alkanes than those used for growth
accidentally co-metabolically together with n-hexane, but these alkanes are also able to
induce expression of the enzyme needed for their activation. According to detection of
MasD in Western blot, mas expression is also induced by the alkanes n-propane,
n-nonane, n-decane, n-undecane, cyclohexane and alkylsubstituted derivatives of it
![Page 108: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/108.jpg)
Expression of (1-methylalkyl)succinate synthase
102
(Fig. 4, 5), as well as alkylsubstituted derivatives of the aromatic hydrocarbon benzene
(Fig. 5). None of these alkanes was shown to be activated co-metabolically before
(Wilkes et al., 2003), while co-metabolic activation of benzene derivatives other than
toluene has not been investigated so far.
L
70 kDa
100 kDa
L
70 kDa
100 kDa
L
70 kDa
100 kDa
L
70 kDa
100 kDa
Fig. 5 Western blot for the identification of MasD in cell extracts of strain HxN1 after incubation of
caproate-adapted cells for three days with cyclic alkanes (cyclopentane, methylcyclopentane,
cyclohexane, methyl-, ethyl- and propylcyclohexane) and aromatic hydrocarbons (benzene,
toluene, ethyl- and propylbenzene). L: pre-stained ladder.
Similar to this, in Thauera aromatica strain T1 the TutD protein, characterized as the
catalytic subunit of the benzylsuccinate synthase, was detected after induction with
o-xylene, which is not a growth substrate for this strain (Coschigano & Bishop, 2004).
During growth of Aromatoleum aromatica strain EbN1 with toluene not only the bss
operon, but also the ebd operon for the degradation of ethylbenzene was induced to a
minor level, which was thought to be due to a relaxed specificity of the sensor for the ebd
operon towards toluene (Kühner et al., 2005).
The signal intensity for MasD was highest for the growth substrates n-pentane,
n-hexane, n-heptane and n-octane and decreased with shorter and longer chain length
(Fig. 4). Signals were not detectable in n-alkanes shorter than n-propane and larger than
n-undecane. For the cyclic alkanes and the aromatic hydrocarbons the signal increased
with increasing length of the alkyl moiety of the substance, only for benzene a signal was
not detectable (Fig. 5). Interestingly, mas expression was also induced by the presence
of alcohols from 1-butanol to 1-decanol, although they are not activated by the
(1-methylalkyl)succinate synthase for their degradation (Fig. 6). Alcohols are channelled
via aldehyde and fatty acid into the β-oxidation. Some of the tested alcohols (1-propanol,
![Page 109: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/109.jpg)
Expression of (1-methylalkyl)succinate synthase
103
1-butanol, 1-hexanol) were shown to allow growth of strain HxN1 (Behrends, 1999). Very
light signals were obtained for the diols 1,6- and 2,5-hexanediol.
Obviously, the mas operon is induced by a lot of the tested substances, even though
several of them are not used for growth neither are activated by (1-methylalkyl)succinate
synthase. The induction by a wide range of hydrocarbons is explained by a relaxed
specificity of the sensor, which regulates the mas operon. As concluded from the
obtained results, the sensor recognizes linear and cyclic alkanes, aromatic hydrocarbons
as well as alcohols. A hydrophobic character of the molecule is probably necessary for
being recognized by the sensor. Alcohols with one hydroxyl group are assumed to be
recognized by their hydrophobic alkyl moiety, whereas the more polar diols
1,6-hexanediol and 2,5-hexanediol induce expression only lightly.
L C4 -ol C6 -ol C8 -ol C10 -ol C6
L C6 -ol 1,6 C6 -diol 2,5 C6 -diol C6 capr
70 kDa
100 kDa
70 kDa
100 kDa
L C4 -ol C6 -ol C8 -ol C10 -ol C6
L C6 -ol 1,6 C6 -diol 2,5 C6 -diol C6 capr
70 kDa
100 kDa
70 kDa
100 kDa
Fig. 6 Western blot for the identification of MasD in cell extracts of strain HxN1 after incubation of
caproate-adapted cells for three days with the alcohols 1-butanol (C4 -ol), 1-hexanol (C6 -ol),
1,6-hexanediol (1,6 C6-diol), 2,5-hexanediol (2,5 C6-diol), 1-octanol (C8 -ol) or 1-decanol (C10 -ol).
Cells grown with n-hexane (C6) or caproate served as positive or negative control, respectively.
L: pre-stained ladder.
Although several n-alkanes and alcohols are recognized by the sensor, a certain length
of the molecule is required. The smallest ones, methane, ethane, methanol, ethanol and
propanol are probably too small to be bound by the sensor and therefore do not
stimulate mas expression. Alcohols larger than 1-decanol and n-alkanes larger than
n-undecane are likely too large for recognition by the sensor and thus, are also unable to
induce mas expression. The largest substances, which are recognized by the sensor,
1-decanol and n-undecane, in fact have the same size, whereas the smallest inducers
for the sensor, 1-butanol and propane do not have the same size. Simply from size,
ethanol should be the smallest alcohol, which is recognized by the sensor. However, the
polar hydroxyl group might prevent recognition by the sensor. Probably, a longer
hydrophobic residue, as it is the case for 1-butanol, is required for an alcohol to allow
![Page 110: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/110.jpg)
Expression of (1-methylalkyl)succinate synthase
104
binding of the sensor. This is in accordance with the poor inducing effect of the polar 1,6-
and 2,5-hexanediols. In case of the cyclic alkanes and aromatic hydrocarbons the
presence of an alkyl moiety increases recognition by the sensor. Probably an aromatic
ring requires an alkyl moiety to be recognized by the sensor, because no signal was
obtained for benzene.
In the environment, an unspecific sensor is possibly of advantage for a strain degrading
components of crude oil. Crude oils are always composed of n-alkanes and aromatic
hydrocarbons as main components (Tissot & Welte, 1984). The amount of n-alkanes
reaches up to 60% and the content of aromatic hydrocarbons varies from 20 to 45%.
Therefore, even if cells exposed to crude oil get first into contact with aromatics due to
their higher solubility, n-alkanes are almost certainly also present (Hildebrand solubility
parameter δ for toluene: 8.9 versus 7.3 for n-hexane (Weast, 1990)). Expression of the
n-alkane activating enzyme induced by aromatic hydrocarbons allows immediate use of
n-alkanes for energy gain once they have entered the cell. In addition, a promiscuous
sensor is of advantage for strain HxN1 for detoxification of aromatic hydrocarbons. The
induction by alcohols can be explained by accidentally recognition of their hydrocarbon
residues. Relaxed substrate specificity was reported for several regulators/sensors
involved in aromatic hydrocarbon degradation (Shingler, 2003). One example is the
regulating protein AlkS of the alk genes for aerobic degradation of n-alkanes in
Pseudomonas putida. The promoter under the control of AlkS was shown to respond to
branched alkanes, alkenes, haloalkanes, ethers and ketones in addition to n-alkanes (de
Lorenzo & Perez-Martin, 1996).
Activity of (1-methylalkyl)succinate synthase from n-hexane adapted cells towards other alkanes and aromatic hydrocarbons
To analyze, whether the limited range of n-alkanes used for growth by strain HxN1 is
caused by insufficient induction of the mas genes, we incubated strain HxN1, having the
(1-methylalkyl)succinate synthase already expressed, with alkanes and aromatic
hydrocarbons, which were shown to induce mas expression in the previous experiment.
Expression of (1-methylalkyl)succinate synthase was ensured by culturing strain HxN1
on n-hexane before. Cultures incubated with n-hexane, n-heptane and n-octane had
consumed the supplied 2.5 mM of nitrate after three to five days and growth became
visible by OD measurement (data not shown). Besides, partial nitrate consumption had
been only observed for n-pentane (1.4 mM), which is a growth substrate, too (Schmitt et
al., unpublished results), and n-nonane (0.1 mM). All the rest of the tested hydrocarbons
did not promote consumption of any nitrate. Hence, the limited range of n-alkanes, which
![Page 111: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/111.jpg)
Expression of (1-methylalkyl)succinate synthase
105
allow growth of strain HxN1, is not explained by the ineffectiveness of hydrocarbons
other than the known growth substrates to act as efficient effector for the regulating
system of mas expression. Otherwise the hydrocarbons should have been converted by
the already active (1-methylalkyl)succinate synthase. The results obtained for strain
HxN1 differ from those of Pseudomonas putida GPo1. In this strain, it was proposed that
growth is optimal for C5 to C10 n-alkanes, because they bind efficiently as effectors to the
AlkS regulator (Sticher et al., 1997). AlkS initiates expression of the alkane hydroxylase
encoding genes for aerobic degradation of n-alkanes (van Beilen et al., 1994). However,
slow growth with a considerable lag time was also observed for C3 to C4 n-alkanes
(Johnson & Hyman, 2006). This was assumed to be due to their inability to act as
efficient effector for AlkS (Rojo, 2010b).
The purified (1-methylalkyl)succinate synthase of strain HxN1 has been shown to
activate cyclopentane besides n-pentane, -hexane, -heptane and -octane (Schmitt et al.,
unpublished results). However, conversion of n-hexane was 40 times more effective than
conversion of cyclopentane, which is already an indication for a restricted substrate
range of (1-methylalkyl)succinate synthase. Some more hydrocarbons were activated by
strain HxN1 in cultivation with substrate mixtures and it remained open, if the activated
hydrocarbons are oxidized completely to CO2 or if they are only converted to a dead end
product due to a missing enzyme (Wilkes et al., 2003; Rabus et al., 2011). Since
n-alkanes only differ in size, it is assumed that they are all degraded by the available
enzymes, but degradation might be below the detection limit due to poor binding of these
n-alkanes by (1-methylalkyl)succinate synthase. Cyclic alkanes and aromatic
hydrocarbons possibly accumulate in a dead end product due to an enzyme needed for
conversion of a ring structure, which is missing in strain HxN1. Benzoate is excluded as
possible dead end product in degradation of aromatics, as proposed by Rabus et al.
(2011), because strain HxN1 grew with benzoate as sole carbon source in the present
study. Growth of strain HxN1 on benzoate had also been reported before (Behrends,
1999; Trautwein et al., 2012). Conversion of substrates, which are not used for growth,
into succinated products was observed in the toluene-degrading strains Azoarcus sp.
strain T and T. aromatica strain K172, too (Beller & Spormann, 1997; Verfürth et al.,
2004). The activation product of for example toluene and fumarate, benzylsuccinate, is
more hydrophilic and thus less toxic, because it does not diffuse into the membrane
anymore. Therefore, even incomplete degradation of aromatic hydrocarbons might be
useful in terms of detoxification for strain HxN1.
![Page 112: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/112.jpg)
Expression of (1-methylalkyl)succinate synthase
106
Conclusion
Our results indicate that the mas operon of strain HxN1 is regulated by a so far unknown
protein with a relaxed substrate specificity towards various hydrocarbons and alcohols. A
promiscuous sensor/regulator improves the competitiveness in the environment with
regard to detoxification and energy gain by fast conversion of substrates into non-toxic
intermediates, which in the case of growth substrates are oxidized completely. Further
support of this theory is gained by the observation that mas expression is not regulated
by carbon catabolite repression. The obtained results reflect effective adaptation of strain
HxN1 towards fast growth with n-alkanes.
Acknowledgement
We thank Miriam Sadowski for conducting the experiments of the MasD production over
time. This work was supported by the Max-Planck-Gesellschaft.
References
Achong, G.R., Rodriguez, A.M. & Spormann, A.M. (2001) Benzylsuccinate synthase of
Azoarcus sp. strain T: cloning, sequencing, transcriptional organization, and its role
in anaerobic toluene and m-xylene mineralization. J. Bacteriol. 183: 6763−6770.
Behrends, A. (1999) Physiologie und substratspezifische Proteinbildung
denitrifizierender Bakterien mit der Fähigkeit zur anaeroben Oxidation kurzkettiger
Alkane. Dissertation, Universität Bremen.
Beller, H.R. & Spormann, A.M. (1997) Anaerobic activation of toluene and o-xylene by
addition to fumarate in denitrifying strain T. J. Bacteriol. 179: 670−676.
Callaghan, A.V., Wawrik, B., Ni Chadhain, S.M., Young, L.Y. & Zylstra, G.J. (2008)
Anaerobic alkane-degrading strain AK-01 contains two alkylsuccinate synthase
genes. Biochem. Biophys. Res. Commun. 366: 142−148.
Coschigano, P.W. & Young, L.Y. (1997) Identification and sequence analysis of two
regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl.
Environ. Microbiol. 63: 652−660.
Coschigano, P.W. & Bishop, B.J. (2004) Role of benzylsuccinate in the induction of the
tutE tutFDGH gene complex of T. aromatica strain T1. FEMS Microbiol. Lett. 231:
261−266.
![Page 113: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/113.jpg)
Expression of (1-methylalkyl)succinate synthase
107
de Lorenzo, V. & Perez-Martin, J. (1996) Regulatory noise in prokaryotic promoters: how
bacteria learn to respond to novel environmental signals. Mol. Microbiol. 19: 1177−
1184.
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Görke, B. & Stülke, J. (2008) Carbon catabolite repression in bacteria: many ways to
make the most out of nutrients. Nat. Rev. Microbiol. 6: 613−624.
Grundmann, O., Behrends, A., Rabus, R., Amann, J., Halder, T., Heider, J. & Widdel, F.
(2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes
in the denitrifying bacterium, strain HxN1. Environ. Microbiol. 10: 376−385.
Heider, J. (2007) Adding handles to unhandy substrates: Anaerobic hydrocarbon
activation mechanisms. Curr. Opin. Chem. Biol. 11: 188−194.
Johnson, E.L. & Hyman, M.R. (2006) Propane and n-butane oxidation by Pseudomonas
putida GPo1. Appl. Environ. Microbiol. 72: 950−952.
Kube, M., Heider, J., Amann, J., Hufnagel, P., Kuhner, S., Beck, A. et al. (2004) Genes
involved in the anaerobic degradation of toluene in a denitrifying bacterium, strain
EbN1. Arch. Microbiol. 181: 182−194.
Kühner, S., Wöhlbrand, L., Fritz, I., Wruck, W., Hultschig, C., Hufnagel, P. et al. (2005)
Substrate-dependent regulation of anaerobic degradation pathways for toluene and
ethylbenzene in a denitrifying bacterium, strain EbN1. J. Bacteriol. 187: 1493−
1503.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680−685.
Leuthner, B. & Heider, J. (1998) A two-component system involved in regulation of
anaerobic toluene metabolism in Thauera aromatica. FEMS Microbiol. Lett. 166:
35−41.
Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E. et al. (1998)
Biochemical and genetic characterization of benzylsuccinate synthase from
Thauera aromatica: a new glycyl radical enzyme catalysing the first step in
anaerobic toluene metabolism. Mol. Microbiol. 28: 615−628.
Rabus, R. & Widdel, F. (1995) Anaerobic degradation of ethylbenzene and other
aromatic hydrocarbons by new denitrifying bacteria. Arch. Microbiol. 163: 96−103.
Rabus, R., Jarling, R., Lahme, S., Kühner, S., Heider, J., Widdel, F. & Wilkes, H. (2011)
Co-metabolic conversion of toluene in anaerobic n-alkane-degrading bacteria.
Environ. Microbiol. 13: 2576−2586.
![Page 114: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/114.jpg)
Expression of (1-methylalkyl)succinate synthase
108
Ramos, J.L., Duque, E., Gallegos, M.T., Godoy, P., Ramos-Gonzalez, M.I., Rojas, A. et
al. (2002) Mechanisms of solvent tolerance in gram-negative bacteria. Annu. Rev.
Microbiol. 56: 743−768.
Rojo, F. (2010a) Carbon catabolite repression in Pseudomonas : optimizing metabolic
versatility and interactions with the environment. FEMS Microbiol. Rev. 34: 658−
684.
Rojo, F. (2010b) Genetic features and regulation of n-alkane metabolism. In Handbook
of hydrocarbon and lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg:
Springer Verlag, pp. 1141−1154.
Shingler, V. (2003) Integrated regulation in response to aromatic compounds: from
signal sensing to attractive behaviour. Environ. Microbiol. 5: 1226−1241.
Sikkema, J., de Bont, J.A. & Poolman, B. (1995) Mechanisms of membrane toxicity of
hydrocarbons. Microbiol. Rev. 59: 201−222.
Sofia, H.J., Chen, G., Hetzler, B.G., Reyes-Spindola, J.F. & Miller, N.E. (2001) Radical
SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic
pathways with radical mechanisms: functional characterization using new analysis
and information visualization methods. Nucleic Acids Res. 29: 1097−1106.
Sticher, P., Jaspers, M.C., Stemmler, K., Harms, H., Zehnder, A.J. & van der Meer, J.R.
(1997) Development and characterization of a whole-cell bioluminescent sensor for
bioavailable middle-chain alkanes in contaminated groundwater samples. Appl.
Environ. Microbiol. 63: 4053−4060.
Tissot, B.P. & Welte, D.H. (1984) Petroleum formation and occurence. Berlin, Germany:
Springer Verlag.
Trautwein, K., Grundmann, O., Wöhlbrand, L., Eberlein, C., Boll, M. & Rabus, R. (2012)
Benzoate mediates repression of C4-dicarboxylate utilization in "Aromatoleum
aromaticum" EbN1. J. Bacteriol. 194: 518−528.
van Beilen, J.B., Wubbolts, M.G. & Witholt, B. (1994) Genetics of alkane oxidation by
Pseudomonas oleovorans. Biodegradation 5: 161−174.
Verfürth, K., Pierik, A.J., Leutwein, C., Zorn, S. & Heider, J. (2004) Substrate specificities
and electron paramagnetic resonance properties of benzylsuccinate synthases in
anaerobic toluene and m-xylene metabolism. Arch. Microbiol. 181: 155−162.
Weast, R.C. (1990) CRC Handbook of Chemistry and Physics, 70th ed., 1989-1990.
Boca Raton, Florida: CRC Press.
Widdel, F., Knittel, K. & Galushko, A. (2010) Anaerobic hydrocarbon-degrading
microorganisms: an overview. In Handbook of hydrocarbon and lipid microbiology.
Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 1998−2021.
![Page 115: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/115.jpg)
Expression of (1-methylalkyl)succinate synthase
109
Wilkes, H., Kühner, S., Bolm, C., Fischer, T., Classen, A., Widdel, F. & Rabus, R. (2003)
Formation of n-alkane and cycloalkane-derived organic acids during anaerobic
growth of a denitrifying bacterium with crude oil. Org. Geochem. 34: 1313−1323.
![Page 116: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/116.jpg)
110
![Page 117: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/117.jpg)
1 111
C Gesamtübergreifende Diskussion und Ausblick
1. Die Bedeutung der (1-Methylalkyl)succinat-Synthase für den anaeroben n-Alkanabbau
Die Aktivierung von n-Alkanen unter anaeroben Bedingungen durch die
(1-Methylalkyl)succinat-Synthase mittels Addition an Fumarat wurde ausgehend von
Metabolitstudien, der Präsenz der Mas-Proteine bei Wachstum auf n-Hexan, sowie
Sequenzähnlichkeiten der Mas-Proteine zur Benzylsuccinat-Synthase, die die Addition
von Toluol an Fumarat katalysiert, für Stamm HxN1 postuliert (Rabus et al., 2001;
Grundmann et al., 2008).
Die im Rahmen dieser Arbeit erzeugten Deletionsmutanten erbrachten erstmalig den in
vivo Nachweis der Notwendigkeit der (1-Methylalkyl)succinat-Synthase für den
anaeroben n-Alkanabbau in Stamm HxN1. Bei der Herstellung der Deletionsmutanten
von Stamm HxN1 wurde ein zweites, identisches mas Operon identifiziert. Die einfach
deletierte masD Mutante (∆masD) zeigte, nach einer gegenüber dem Wildtyp
verlängerten Lag-Phase, ebenfalls Wachstum auf n-Hexan, wodurch die Funktionalität
beider Operone bestätigt wird. Nach Deletion beider masD Gene (∆masD, ∆masD´)
konnte Stamm HxN1 nicht mehr mit n-Hexan als einziger C-Quelle wachsen. Dies
beweist, dass das Genprodukt MasD für den anaeroben n-Alkanabbau benötigt wird. Die
längere Lag-Phase im Wachstum der einfachen Mutante macht auch deutlich, dass zwei
funktionale mas Operone eine Optimierung hinsichtlich der Verwertung von n-Hexan
darstellen, da größere Mengen an Protein gebildet werden als mit nur einem mas
Operon. Für eine rasche Umsetzung des Substrates ist eine große Menge an Enzym
vorteilhaft, da die maximale Geschwindigkeit der Enzymreaktion schneller erreicht wird.
Nach Erreichen der Maximalgeschwindigkeit ist das Wachstum limitiert durch die
Substratsättigung des Enzyms. Dies zeigt sich in der identischen Verdopplungszeit von
Wildtyp und ∆masD Mutante.
Bei Wachstum des Wildtyps von Stamm HxN1 auf n-Hexan ist die große Untereinheit
MasD nach gelelektrophoretischer Auftrennung als dominante Bande sichtbar und daher
verglichen mit anderen Zellproteinen in großer Menge vorhanden. Schätzungen zufolge
macht die (1-Methylalkyl)succinat-Synthase in Stamm HxN1 bis zu 6% des löslichen
Proteingehaltes aus (Rabus et al., 2001). Für die Benzylsuccinat-Synthase aus Thauera
aromatica Stamm K172 wurde ein Anteil von mindestens 2–3% an der Gesamtmenge
löslichen Proteins berechnet (Leuthner et al., 1998). In der ∆masD Mutante sollte der
![Page 118: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/118.jpg)
Diskussion und Ausblick
112
Proteingehalt von MasD nach der Lag-Phase nur die Hälfte des Proteingehaltes des
Wildtyps ausmachen. Dieses muss noch experimentell bestätigt werden.
Die Fähigkeit zur Aktivierung von n-Hexan setzt zunächst die Expression der mas Gene
voraus. In dieser Arbeit wurde gezeigt, dass die mas Gene nicht durch
Katabolitrepression reguliert werden und dass neben n-Hexan auch viele Kohlenwasser-
stoffe, die nicht vollständig oder gar nicht oxidiert werden, induzierend wirken. Ein
Sensor mit breitem Substratspektrum und die Induktion der Expression der mas Gene,
sobald die Zelle mit Kohlenwasserstoffen in Kontakt kommt, können in der Umwelt
vorteilhaft sein für ein kohlenwasserstoffabbauendes Bakterium. Diese Art der
Regulation erlaubt nicht nur den Umsatz potenziell toxischer Substanzen durch die
(1-Methylalkyl)succinat-Synthase, sondern auch eine schnelle Reaktion auf Substrate,
die zur Energiegewinnung genutzt werden.
2. (1-Methylalkyl)succinat-Synthasen sind heterotetramere Glycylradikal-enzyme
Die ersten bekannten Glycylradikalenzyme, Pyruvat-Formiat-Lyase und anaerobe
Ribonukleotid-Reduktase sind Homodimere (Conradt et al., 1984; Eliasson et al., 1992).
Ein weiteres Glycylradikalenzym ist die 4-Hydroxyphenylacetat-Decarboxylase, die die
Bildung von p-Cresol in Clostridium difficile katalysiert (Selmer & Andrei, 2001). Sie
besteht neben der großen, katalytischen Untereinheit aus einer weiteren kleinen
Untereinheit, die zusammen ein α4β4-Heterooktamer bilden (Andrei et al., 2004; Yu et
al., 2006). Die kleine Untereinheit der 4-Hydroxyphenylacetat-Decarboxylase bildet
Eisen-Schwefel-Zentren aus und ist notwendig für die katalytische Aktivität der großen
Untereinheit (Yu et al., 2006). Die Benzylsuccinat-Synthase war das erste
Glycylradikalenzym mit drei Untereinheiten (Leuthner et al., 1998). Aufgrund von
Ähnlichkeiten in Bezug auf die Sequenz und die katalytische Funktion wurde auch für die
(1-Methylalkyl)succinat-Synthase eine Zusammensetzung aus drei Untereinheiten
postuliert (Grundmann et al., 2008). Bei der Reinigung der (1-Methylalkyl)succinat-
Synthase aus Stamm HxN1 wurde jedoch noch eine weitere Untereinheit identifiziert
(Werner, 2009). Damit ist die (1-Methylalkyl)succinat-Synthase das erste beschriebene
Glycylradikalenzym, das aus vier Untereinheiten besteht. Die Existenz des die vierte
Untereinheit kodierenden masB Gens in allen bisher bekannten Stämmen, die n-Alkane
anaerob mittels Addition an Fumarat aktivieren, legt nahe, dass diese zusätzliche
Untereinheit eine Funktion ausübt, die für die anaerobe Aktivierung von Toluol nicht
benötigt wird.
![Page 119: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/119.jpg)
Diskussion und Ausblick
113
Möglicherweise ist der Unterschied in der Bindungsdissoziationsenergie, die
aufgewendet werden muss, um die C–H-Bindung im Toluol bzw. am sekundären C-Atom
des n-Alkans homolytisch zu spalten, hierfür von Bedeutung. Für die Aktivierung des
n-Alkans werden 398 kJ mol–1 benötigt, für die Aktivierung von Toluol nur 368 kJ mol–1.
Dieser Unterschied von 30 kJ mol–1 ist womöglich auch verantwortlich dafür, dass Toluol
von Stamm HxN1 aktiviert wird, n-Hexan jedoch nicht von dem toluolabbauenden
Aromatoleum aromaticum Stamm EbN1 (Rabus et al., 2011). Für die
(1-Methylalkyl)succinat-Synthase sollte es energetisch kein Problem darstellen eine
Reaktion zu katalysieren, für die weniger Energie benötigt wird als für die üblicherweise
katalysierte Reaktion, während Benzylsuccinat-Synthasen vielleicht nicht in der Lage
sind die stärkere C–H-Bindung in n-Alkanen zu spalten (Rabus et al., 2011).
Ein weiterer Unterschied zwischen der Aktivierung von n-Hexan und von Toluol liegt in
der Stereospezifität. Bei der Aktivierung von Toluol wird zu mehr als 95% das (R)-(+)-
Benzylsuccinat Enantiomer gebildet (Beller & Spormann, 1998; Leutwein & Heider,
1999). Von dem bei der Aktivierung von n-Hexan mit Fumarat entstehenden
(1-Methylpentyl)succinat existieren aufgrund von zwei chiralen Zentren vier
Stereoisomere (Abb. 1). Zwei dieser Stereoisomere werden von Stamm HxN1 bei der
Aktivierung von n-Hexan in gleichen Mengen gebildet, das 2R,1´R- und das 2S,1´R-
Isomer (Rabus et al., 2001; Jarling et al., 2012). Am C-2 des Succinatrestes treten also
beide Konfigurationen auf, während am C-1´ des Produktes (= C-2 des n-Hexans) nur
die R-Konfiguration gebildet wird (Abb. 1). Die Bildung zweier Diastereoisomere ist
erwähnenswert, da die meisten Enzymreaktionen stereoselektiv sind (Rabus et al.,
2001).
Abb. 1 Die vier Stereoisomere des (1-Methylpentyl)succinats. C-2 des Succinatrestes ist mit 2
gekennzeichnet, das ehemalige C-2 des n-Hexans (= C-1´) mit 1´.
![Page 120: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/120.jpg)
Diskussion und Ausblick
114
Es wird spekuliert, dass in Stamm HxN1 eines der gebildeten Diastereoisomere des
(1-Methylpentyl)succinats nach seiner möglichen Aktivierung zum CoA-Thioester in das
andere epimerisiert wird, da nur eines der Diastereoisomere das Substrat einer
möglichen Mutase ist, die die nachfolgende Reaktion zum (2-Methylhexyl)malonyl-CoA
katalysiert (Wilkes et al., 2002; Jarling et al., 2012). Die Epimerisierung des einen
CoA-Thioesters wird möglicherweise ebenfalls von der (1-Methylalkyl)succinat-Synthase
katalysiert (Jarling et al., 2012), wofür eine zusätzliche Untereinheit benötigt werden
könnte.
Nach der Identifizierung des mas Operons in Stamm HxN1 wurde davon ausgegangen,
dass die Genprodukte MasC und MasE homolog zu den kleinen Untereinheiten BssB
und BssC der Benzylsuccinat-Synthase sind und damit die kleinen Untereinheiten der
(1-Methylalkyl)succinat-Synthase repräsentieren (Grundmann et al., 2008). Später
wurde vermutet, dass nicht MasE sondern MasB (AssB in Desulfatibacillum alkenivorans
Stamm AK-01) homolog zu BssB ist (Callaghan et al., 2012; Hilberg et al., 2012).
Ursprung dieser Vermutung war ein Sequenzvergleich mehrerer BssB-Untereinheiten
mit MasB und AssB, nach dem die Lage der Cysteine in MasB und AssB den BssB-
Proteinen der Toluolabbauer ähnelt, auch wenn ansonsten keine Sequenzähnlichkeit
besteht (Hilberg et al., 2012). MasE jedoch passt von seiner Größe her besser zu den
BssB-Proteinen als MasB, aber auch in diesem Fall gibt es keine Sequenzähnlichkeiten,
obwohl in diesem Protein ebenfalls mehrere Cysteinreste vorkommen (Grundmann et
al., 2008). Die Reinigung der (1-Methylalkyl)succinat-Synthase aus Stamm HxN1 hat
gezeigt, dass sowohl MasB als auch MasE Bestandteil des Enzyms sind. Daher gibt es
womöglich in n-Alkanabbauern gar kein Homolog zu BssB der Benzylsuccinat-Synthase,
weil die Aufgabe, die der BssB-Untereinheit bei der Toluolaktivierung zuteil wird, bei der
Aktivierung von n-Alkanen von zwei Untereinheiten, MasB und MasE, durchgeführt wird.
Erst eine Röntgenkristallstruktur für die (1-Methylalkyl)succinat-Synthase und die
Benzylsuccinat-Synthase wird die Funktion der kleinen Untereinheiten aufklären.
3. Verbreitung kataboler Gene in Kohlenwasserstoffabbauern
Zwei funktionale mas Operone stellen aufgrund der größeren Menge an
(1-Methylalkyl)succinat-Synthase eine Optimierung der Aktivierung von n-Hexan dar und
sind damit für Stamm HxN1 ökonomisch sinnvoll. Die Präsenz eines für eine
Transposase kodierenden Gens im mas Operon legt nahe, dass das mas Operon
irgendwann im Genom verdoppelt und/oder neu ins Genom aufgenommen wurde.
Transposasen inserieren DNA in andere DNA-Bereiche. Transposons bestehen aus der
Sequenz, die für die Transposase kodiert, Sequenzwiederholungen, die von der
![Page 121: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/121.jpg)
Diskussion und Ausblick
115
Transposase erkannt werden und aus weiteren Strukturgenen (Knippers, 2001). Das
Transposon wird entweder aus der ursprünglichen Sequenz ausgeschnitten und in den
Zielort wieder eingefügt oder replikativ vermehrt (Choi & Kim, 2009). Bei der replikativen
Transposition erfolgt also eine Verdopplung des Transposons.
In dem n-Alkanabbauer D. alkenivorans Stamm AK-01 wurden ebenfalls zwei ass
Operone identifiziert, die eine Alkylsuccinat-Synthase kodieren (Callaghan et al., 2008).
Die beiden Operone liegen auf dem 6,5 Mb großen Genom etwa 91 kb voneinander
entfernt (Callaghan et al., 2012). Im Gegensatz zu den mas Operonen in Stamm HxN1
sind die ass Operone jedoch nicht identisch. So beträgt die Identität der beiden
katalytischen Untereinheiten AssA1 und AssA2 auf Proteinebene nur 81,6% (Callaghan
et al., 2008). Ob beide Operone eine aktive Alkylsuccinat-Synthase exprimieren, ist
ungeklärt, da nur AssA1 in proteomischen Analysen eindeutig bei Wachstum auf n-Alkan
nachgewiesen wurde (Callaghan et al., 2008). Es wurde vermutet, dass die beiden
Enzyme Ass1 und Ass2 verschiedene Substrate aktivieren oder zu unterschiedlichen
Zeitpunkten des Wachstums aktiv sind (Callaghan et al., 2008). Ein unterschiedliches
Substratspektrum oder die differenzielle Induktion in Abhängigkeit von der
Wachstumsphase der Zelle wurde für multiple, nicht identische Alkanhydroxylase Gene
in mehreren aeroben n-Alkanabbauern nachgewiesen (Tani et al., 2001; Whyte et al.,
2002; Marin et al., 2003; van Beilen et al., 2004; Liu et al., 2011; Wang & Shao, 2011).
Teilweise wurden Gene, die eine Transposase kodieren, in unmittelbarer Nähe der alk
Gene identifiziert (van Beilen et al., 2004). Innerhalb oder in der Nähe der ass Operone
von Stamm AK-01 sind jedoch keine Transposasen kodiert (Callaghan et al., 2012), Dies
macht eine Verdopplung des Operons, so wie in Stamm HxN1 vermutet,
unwahrscheinlich.
In der bekannten Sequenz vor dem mas Operon von Stamm HxN1 befinden sich Gene
für zwei weitere Transposasen (Abb. 2a, dort annotiert als tnpH1, tnpH2). Sie beginnen
in entgegengesetzter Richtung ca. 2 und 2,5 kb vor dem mas Operon. Auch in dem
verwandten Stamm OcN1, in dessen Genom ebenfalls mindestens ein mas Operon
kodiert ist, wurde in der bekannten Sequenz 5,3 kb hinter dem mas Operon ein
Transposase-Gen (tnpO1) identifiziert (Abb. 2b). Im mas Operon von Stamm OcN1
selbst kodiert jedoch kein Gen eine Transposase (Werner, 2009).
![Page 122: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/122.jpg)
Diskussion und Ausblick
116
masEmasC masD masF masGmasB
masA
1000 bp
masEmasC masD masGmasB
masA
a)
b)
tnpH1
tnpO1
tnpH2 masEmasC masD masF masGmasB
masA
1000 bp
masEmasC masD masGmasB
masA
a)
b)
tnpH1
tnpO1
tnpH2
Abb. 2 Transposase-Gene in bekannten Sequenzbereichen der Stämme HxN1 (a) und OcN1 (b).
Transposase-Gene sind blau markiert und wurden hier annotiert als tnpH1 und tnpH2 für
„Transposase HxN1“ bzw. tnpO1 für „Transposase OcN1“. Eine weitere Tranposase im mas
Operon von Stamm HxN1 ist als masF annotiert. Weitere Gene der mas Operone sind weiß
dargestellt. Erstes BLASTP Ergebnis für MasF mit 58% Sequenzidentität ist eine Transposase
aus Ralstonia solanacearum, für TnpH1 mit 45% eine IS4 Transposase aus Thauera sp. MZ1T
und für TnpH2 mit 81% Sequenzidentität bei vollständiger Abdeckung eine ISMca7 Transposase
aus Nitrococcus mobilis. Die Transposase TnpO1 von Stamm OcN1 hat 78% Sequenzidentität zu
einer Transposase aus Acidovorax sp. NO-1.
Von dem mit Stamm HxN1 und OcN1 verwandten Stamm EbN1 ist die Genomsequenz
annotiert. Es wurden 180 Gene für Transposasen im bakteriellen Chromosom gefunden,
sowie 57 weitere verteilt auf zwei Plasmide (Rabus et al., 2005). Bei einer Größe des
Genoms von 4,7 Mb (Chromosom: 4,3 Mb; Plasmid 1: 0,21 Mb; Plasmid 2: 0,22 Mb)
kommt statistisch alle 20 000 kb ein Transposase-Gen vor. Das Genom des
Sulfatreduzierers Stamm AK-01 ist ebenfalls sequenziert (Callaghan et al., 2012). In
diesem Genom wurden nur acht Gene für Transposasen annotiert. Dies entspricht bei
einer Genomgröße von 6,5 Mb nur einem Transposase-Gen pro 812 000 kb. Die
Identifizierung von drei Transposasen in einem 10,5 kb großen bekannten Bereich der
DNA von Stamm HxN1 lässt vermuten, dass sich in dem größtenteils unbekannten
Genom noch viele weitere Transposase-Gene, ähnlich wie in Stamm EbN1, befinden.
Die hohe Anzahl an Transposase-Genen in Stamm EbN1, teilweise in der Nähe von
katabolen Genclustern, spricht für eine große Flexibilität des Genoms durch vielfachen
horizontalen Gentransfer (Rabus et al., 2005). Unterstützt wird diese These durch eine
zum Teil hohe Sequenzidentität von katabolen Genclustern mit weiter entfernt
verwandten Stämmen, wie z.B. Thauera sp. und das Vorkommen von paralogen
Genclustern (Rabus et al., 2005). Katabole Gencluster wurden womöglich durch
horizontalen Gentransfer auf Stamm EbN1 übertragen, um die Adaptation des Stammes
an veränderte Umweltbedingungen zu gewährleisten. Die genetische Flexibilität von
Stamm AK-01 ist aufgrund der geringen Anzahl an Transposasen verglichen mit Stamm
EbN1 wesentlich schwächer. Möglicherweise sind kohlenwasserstoffabbauende
![Page 123: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/123.jpg)
Diskussion und Ausblick
117
Sulfatreduzierer wie Stamm AK-01 schon immer zum anaeroben Abbau von
Kohlenwasserstoffen befähigt, da Kohlenwasserstoffe seit ihrer geologischen Bildung
beständig aus natürlichen Erdöllagerstätten am Meeresgrund freigesetzt werden. Stamm
AK-01, isoliert aus Kohlenwassterstoff-kontaminiertem Sediment, verwertet neben
n-Alkanen auch 1-Alkene, Alkohole und Fettsäuren (So & Young, 1999), Stamm Bus5,
isoliert aus dem Guaymas Basin, hingegen ausschließlich Propan und n-Butan
(Kniemeyer et al., 2007). Der Guaymas Basin im Golf von Kalifornien ist eine
Hydrothermalquelle, die aufgrund tektonischer Aktivitäten beständig Alkane und
aromatische Kohlenwasserstoffe freisetzt (Bazylinski et al., 1989). Dort lebende
Bakterien scheinen auf die Nutzung dieser Kohlenstoffquelle spezialisiert zu sein, wie
das Beispiel Stamm Bus5 zeigt.
Süßwasserbakterien wie Stamm EbN1, HxN1 und OcN1 nutzen unter aeroben wie auch
unter anaeroben Bedingungen eine Vielzahl an Substraten, wie z.B. Fettsäuren,
Alkohole oder im Fall von Stamm HxN1 sogar Zucker als Kohlenstoffquelle (Rabus &
Widdel, 1995; Ehrenreich, 1996; Behrends, 1999) und haben die Fähigkeit zum Abbau
von Kohlenwasserstoffen vermutlich erst erworben, nachdem ihr Lebensraum
anthropogen mit Kohlenwasserstoffen verschmutzt worden war. Stamm HxN1 und OcN1
wurden aus Grabensedimenten isoliert (Ehrenreich et al., 2000), Stamm EbN1 aus
einem Schlammgemisch von Gräben und der Weser (Rabus & Widdel, 1995). Die
Aufnahme neuer kataboler Gene befähigte diese Stämme zum Abbau einer weiteren
Kohlenstoffquelle. Dies ist unter substratlimitierenden Bedingungen von Vorteil
gegenüber anderen Bakterien, die keine Kohlenwasserstoffe verwerten können. Die
Enzyme für den weiteren Abbau über die β-Oxidation nach der Aktivierung des n-Alkans
waren vermutlich schon vor der Aufnahme der neuen katabolen Gene in Stamm HxN1
vorhanden, da diese auch für den Abbau von Fettsäuren benötigt werden. Durch die
Aktivierung der Kohlenwasserstoffe schützten sich die Zellen außerdem vor diesen
toxischen Substanzen.
Katabole Gencluster, die eine zum Teil hohe Sequenzidentität untereinander aufweisen,
wurden in vielen Bakterienstämme identifiziert, die phylogenetisch nicht miteinander
verwandt sind und von geographisch unterschiedlichen Standorten isoliert wurden
(Tsuda et al., 1999). Das Vorkommen sehr ähnlicher Gene in verschiedenen Spezies
spricht für einen gemeinsamen evolutionären Ursprung dieser Gene, die durch
horizontalen Gentransfer mittels Transformation oder Konjugation zur Adaptation des
Empfängers an veränderte Umweltbedingungen verbreitet wurden (Tsuda et al., 1999).
Daher ist es nicht überraschend, dass viele dieser Gencluster in Transposons lokalisiert
sind. In dem 56 kb großen Transposon Tn4651 befinden sich die nötigen Gene für den
![Page 124: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/124.jpg)
Diskussion und Ausblick
118
aeroben Abbau von Toluol (Tsuda & Iino, 1987). Dieses Transposon ist oft Bestandteil
des 117 kb großen TOL Plasmids pWWO, das in toluolabbauenden Pseudomonaden
vorkommt (Burlage et al., 1989; Greated et al., 2002). Das Transposon Tn4651 wird
entweder über das konjugativ übertragbare Plasmid pWWO verbreitet oder es
transponiert vom Plasmid ins Genom. Für die Transposition ins Genom spricht eine fast
identische DNA-Sequenz des Transposons Tn4651, die im Genom zweier
Pseudomonas Stämme identifiziert wurde (Sinclair et al., 1986; Sinclair & Holloway,
1991). Die alk Gene für den aeroben Abbau von n-Alkanen in Pseudomonas
putida GPo1 sind auf dem OCT-Plasmid kodiert (Chakrabarty et al., 1973). Da die Gene
von Insertionssequenzen flankiert sind, wird angenommen, dass die Insertions-
sequenzen zusammen mit den alk Genen ein Transposon bilden, welches in das
OCT-Plasmid integriert wurde (van Beilen et al., 2001). Eine ähnliche Genanordnung mit
flankierenden Insertionssequenzen in P. putida P1 weist auf einen horizontalen
Gentransfer der alk Gene hin (Smits et al., 1999; van Beilen et al., 2001). In
P. aeruginosa PAO1 und Alcanivorax borkumensis AP1 befinden sich sogar je zwei nicht
identische alkB Gene im Genom (van Beilen et al., 2004). Nur eines der beiden alkB
Gene von A. borkumensis ist Bestandteil eines alk Operons, ähnlich wie auf dem OCT-
Plasmid. Das Fehlen mobiler genetischer Elemente deutet darauf hin, dass die alk Gene
in diesem Fall vermutlich nicht über horizontalen Gentransfer von diesem Stamm
erworben wurden, sondern vielmehr schon lange präsent sind. Dies ist übereinstimmend
mit der Fähigkeit von A. borkumensis neben n-Alkanen nur wenige andere
Kohlenstoffquellen nutzen zu können (van Beilen et al., 2004). Auch für den Abbau
zahlreicher anderer Kohlenwasserstoffe wurden katabole Transposons identifiziert, die
auf Plasmiden oder im Genom lokalisiert sind (Nojiri et al., 2004).
Katabole Gencluster werden nicht nur durch Transformation oder Konjugation, sondern
auch über integrative und konjugative Elemente (ICElands) übertragen. Der Begriff
ICEland umfasst mobile DNA-Elemente wie konjugative Transposons, integrative
Plasmide und genomische Inseln (Burrus et al., 2002). ICElands werden als zirkuläre
DNA-Moleküle wie Plasmide von Zelle zu Zelle übertragen, ohne jedoch die Hilfe eines
coexistierenden Plasmides zu benötigen (Tsuda et al., 1999; van der Meer & Sentchilo,
2003). Als erstes wird das mobile Element aus der DNA herausgeschnitten und ligiert.
Über den Mechanismus der rolling-circle Replikation wird es dann in die Empfängerzelle
transferiert. Im Anschluss erfolgt die Integration ins Genom der Empfängerzelle und die
Re-Integration in das Genom der Donorzelle (Tsuda et al., 1999).
Die zahlreichen Beispiele horizontalen Gentransfers kataboler Gene für den Abbau von
Kohlenwasserstoffen unterstützen die Hypothese, dass das mas Operon ebenfalls auf
![Page 125: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/125.jpg)
Diskussion und Ausblick
119
einem der beschriebenen Wege in Stamm HxN1 transferiert und ins Genom integriert
worden ist. Die Duplikation des mas Operons kann sowohl vor der Integration ins
Genom als auch zu einem späteren Zeitpunkt, nachdem das Operon bereits ins Genom
integriert worden war, stattgefunden haben.
4. Regulation der mas Operone in Stamm HxN1
Sowohl Stamm HxN1 als auch Stamm AK-01 haben in ihrem Genom zwei mas bzw. ass
Operone kodiert. Die Regulation zweier Operone mit gleicher Funktion ist vermutlich
komplexer als die Regulation eines einzelnen Operons. Alle bisher bekannten anaerob
toluolabbauenden Bakterien haben nur ein bss Operon. In unmittelbarer Nähe
stromaufwärts der bss Operone wurden Gene identifiziert, die ein Zweikomponenten-
Regulationssystem kodieren (Coschigano & Young, 1997; Leuthner & Heider, 1998;
Achong et al., 2001; Kube et al., 2004). Zweikomponentensysteme werden von
Bakterien vielfach genutzt, um ihren Stoffwechsel als Antwort auf Umweltreize zu
regulieren. Diese Systeme bestehen aus einer Sensorkinase und einem
Transkriptionsregulator. Die membranständige Sensorkinase phosphoryliert sich als
Reaktion auf die Wahrnehmung eines für sie empfänglichen Signals selbst an einem
spezifischen intrazellulären Histidinrest. Durch anschließende Übertragung des
Phosphorylrestes auf den Responseregulator wird dieser aktiviert. Der
Responseregulator bindet an den Promotor, wodurch die Transkription der Gene
aktiviert wird, die für die Verarbeitung des Umweltreizes benötigt werden.
Das bss Operon wird wahrscheinlich in Anwesenheit von Toluol durch das
Zweikomponentensystem TdiSR (für toluene degradation induction) bzw. TutBC1 (für
toluene utilization) aktiviert (Leuthner & Heider, 1998; Achong et al., 2001; Kube et al.,
2004). In T. aromatica Stamm K172 wurde gezeigt, dass der Transkriptionsregulator
TdiR an die 5´-DNA-Sequenz des bss Operons bindet (Leuthner & Heider, 1998). Auch
für die Regulation des aeroben Abbaus von Toluol in P. putida F1 wurde ein
Zweikomponentensystem (TodST; für toluene degradation) identifiziert (Lau et al., 1997).
Das fakultativ anaerobe Bakterium T. aromatica Stamm T1 oxidiert Toluol sowohl unter
aeroben als auch unter anaeroben Bedigungen (Evans et al., 1991). Zusätzlich zu dem
TutBC1-System für die Regulation des anaeroben Abbaus ist in Stamm T1 ein weiteres
Zweikomponentensystem, TutBC, vorhanden, das vermutlich für die Regulation des
aeroben Abbaus zuständig ist, da es ähnlich dem TodST-System ist (Coschigano &
Young, 1997; Leuthner & Heider, 1998).
![Page 126: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/126.jpg)
Diskussion und Ausblick
120
Für die Regulation des Abbaus von n-Alkanen sind hingegen bisher keine
Zweikomponentensysteme bekannt. In P. putida Gpo1 wird die Expression der
plasmidkodierten Alkanhydroxylase-Gene von AlkS reguliert (van Beilen et al., 1994).
Die n-Alkane wirken bei dieser Regulation als Effektor, der an AlkS bindet. In
Abwesenheit von n-Alkanen wird alkS in geringer Konzentration exprimiert, aber nur in
Anwesenheit von n-Alkanen bindet AlkS an den Promotor der Alkanhydroxylase-Gene
und induziert dadurch deren Expression (Rojo, 2009). Anders verhält es sich in
A. borkumensis AP1 mit zwei für eine Alkanmonooxygenase kodierenden alkB Genen
(van Beilen et al., 2004). Die beiden alkB Gene sind nicht identisch, werden aber
dennoch beide durch n-Alkane induziert. Nur vor einem der beiden alkB Gene ist alkS
kodiert, dessen Expression jedoch nicht durch n-Alkane induziert wird. Die Induktion
beider alkB Gene durch n-Alkane spricht für die Regulation durch denselben Regulator,
der aber nicht AlkS ist (van Beilen et al., 2004).
Die Regulation der beiden mas Operone in Stamm HxN1 erfolgt wahrscheinlich auch
über einen gemeinsamen Regulator, der jedoch noch identifiziert werden muss. Offen ist
auch, ob die Regulation über ein Zweikomponentensystem oder über einen Regulator,
der direkt mit n-Alkanen interagiert, erfolgt. Das im Verlauf dieser Arbeit entwickelte
genetische System für Stamm HxN1 kann zur Identifizierung des Regulators des
anaeroben n-Alkanabbaus genutzt werden, sobald die Genomsequenz von Stamm
HxN1 verfügbar ist. Auch der Regulator der ass Operone in Stamm AK-01 ist noch nicht
identifiziert. Für diesen Stamm sind zwar die Genomdaten bekannt (Callaghan et al.,
2012), jedoch steht kein genetisches System zur Verfügung. Vorausgesetzt, dass beide
ass Operone unter den gleichen Bedingungen aktiv sind, erfolgt vermutlich auch in
diesem Fall die Regulation über denselben Regulator. In unmittelbarer Nähe der ass
Operone wurden im Genom von AK-01 keine Gene für Regulator- oder Sensorproteine
identifiziert (Callaghan et al., 2012). Das nächstgelegene Gen, das einen Regulator
kodiert, ist Dalk_1723, welches ca. 5 kb vor dem ass1 Operon lokalisiert ist. Dalk_1723
ist annotiert als ein PAS-modulierter, σ54-spezifischer Transkriptionsregulator
(Callaghan et al., 2012). PAS-Domänen kommen in Sensoren für Sauerstoff, Licht und
Redoxpotentiale vor, wurden aber auch in TodS, TutC und TdiS identifiziert (Leuthner &
Heider, 1998; Taylor & Zhulin, 1999). Die Regulation des n-Alkanabbaus in Stamm
AK-01 durch Dalk_1723 bleibt spekulativ, da im Genom noch weitere
Transkriptionsregulatoren annotiert sind, denen keine Regulation zugeordnet ist
(Callaghan et al., 2012). Die Regulation von zwei weit voneinander entfernten Operonen
setzt auch nicht voraus, dass das Gen für den Regulator in räumlicher Nähe zu einem
der beiden Operone lokalisiert sein muss.
![Page 127: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/127.jpg)
Diskussion und Ausblick
121
Globale Kontrollsysteme sind der spezifischen Regulation von Operonen durch einen
einzelnen Regulator übergeordnet und dienen der Regulation mehrerer
Stoffwechselwege. Die Katabolitrepression ist eine Kombination globaler und
operonspezifischer Regulationsmechanismen, die in Anwesenheit mehrerer
Wachstumssubstrate die Expression der Enzyme für deren Verstoffwechselung reguliert
(Görke & Stülke, 2008). Erst nach Verbrauch des bevorzugten Substrates, welches
normalerweise eine höhere Wachstumsrate ermöglicht, werden die Gene für den Abbau
des anderen Substrates induziert (Harder & Dijkhuizen, 1982). Die Folge dieser
sequenziellen Induktion ist diauxisches Wachstum, das durch eine kurze Lag-Phase
zwischen zwei Wachstumsphasen gekennzeichnet ist (Harder & Dijkhuizen, 1982).
Während der Lag-Phase werden die Proteine für den Abbau des zweiten Substrates
synthetisiert. Die Katabolitrepression ist in Enterobacteriaceae (Escherichia coli) und
Firmicutes (Bacillus subtilis) gut untersucht (Deutscher, 2008).
Das lac Operon in E. coli wird über einen Repressor negativ reguliert. Erst in
Anwesenheit von Lactose wird das Operon induziert, indem der Induktor Allolactose an
den Repressor bindet und diesen inhibiert (Görke & Stülke, 2008). Bei gleichzeitiger
Anwesenheit von Glucose und Lactose im Medium wird das lac Operon nicht induziert,
da der Transport von Lactose in die Zelle durch Inaktivierung der Lactose-Permease
LacY verhindert wird (Görke & Stülke, 2008). Dieser Regulationsmechanismus wird als
Induktorausschluss bezeichnet (Görke & Stülke, 2008). An der globalen Kontrolle des
lac Operons sind der Transkriptionsaktivator CRP (für cyclic AMP receptor protein),
cAMP, die Adenylatzyklase und die IIA Komponente des Glucose-spezifischen
Phosphotransferasesystems (EIIAGlc) beteiligt (Deutscher, 2008). Die effiziente
Expression des lac Operons erfolgt nicht nur durch Inaktivierung des Repressors,
sondern zusätzlich über den Aktivator CRP (Görke & Stülke, 2008). Dieser ist nur als
Komplex mit cAMP aktiv, das von der Adenylatzyklase gebildet wird. Die
Adenylatzyklase wiederum wird durch phosphoryliertes EIIAGlc aktiviert und EIIAGlc ist nur
in Abwesenheit von Glucose phosphoryliert (Görke & Stülke, 2008). Die nicht
phosphorylierte Form von EIIAGlc in Anwesenheit von Glucose inaktiviert die Permease
LacY (Görke & Stülke, 2008). In B. subtilis wird die Expression alternativer kataboler
Gene durch einen Repressor verhindert, der in Anwesenheit von Glucose aktiv ist
(Görke & Stülke, 2008).
Die Katabolitrepression spielt auch bei der Regulation des aeroben n-Alkanabbaus in
P. putida eine Rolle (Rojo, 2010b). In Anwesenheit von Succinat verhindert das globale
Regulationsprotein Crc (für catabolite repression control) die Translation des Regulators
AlkS durch Bindung an das 5´-Ende der kodierenden mRNA (Moreno et al., 2007).
![Page 128: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/128.jpg)
Diskussion und Ausblick
122
Anders als in E. coli und B. subtilis erfolgt die Regulation in P. putida also nicht auf
Transkriptions- sondern auf Translationsebene. Der anaerobe n-Alkanabbau in Stamm
HxN1 hingegen wird nicht durch Katabolitrepression reguliert, wie die in dieser Arbeit
erhaltenen Ergebnisse zeigen. Die Expression der mas Gene wird bei Kultivierung von
Stamm HxN1 mit n-Alkan und einer weiteren Kohlenstoffquelle nicht inhibiert. Eine
mögliche Erklärung ist, dass nur die getesteten Kohlenstoffquellen keine Inhibierung der
Expression bewirken, es aber noch andere Kohlenstoffquellen gibt, die die Expression
inhibieren. Beispielsweise wird in P. putida die Expression der alk Gene zwar u.a. durch
Succinat inhibiert, jedoch nicht durch Citrat (Yuste et al., 1998). Auch unter
substratlimitierenden Bedingungen erfolgt normalerweise keine Katabolitrepression,
sondern ein simultaner Verbrauch der Substrate (Harder & Dijkhuizen, 1982). Das
Vorliegen einer Substratlimitation und eines simultanen Verbrauchs bei den in dieser
Arbeit durchgeführten Versuchen mit Stamm HxN1 auf n-Hexan und einer weiteren
Kohlenstoffquelle wie z.B. Capronat ist jedoch ausgeschlossen. Solange regulatorische
Proteine nicht identifiziert sind, kann über die Regulation des mas Operons nur
spekuliert werden. Einerseits kann das mas Operon positiv über einen Aktivator reguliert
werden, der durch Induktoren wie z.B. n-Hexan aktiviert wird und die Expression
induziert (Abb. 3). Andererseits ist es auch möglich, dass das mas Operon negativ über
einen Repressor reguliert wird, der die Expression in Abwesenheit eines Induktors
verhindert.
AdiI
masEmasC masD masF masGmasBmasAσ70
AdiA AdiA
+
–
1
2
AdiI AdiI
masEmasC masD masF masGmasBmasAσ70
AdiA AdiA
+
–
1
2
AdiIAdiI
Abb. 3 Modell zur möglichen Regulation des mas Operons in Stamm HxN1. (1) Positive
Regulation des mas Operons durch einen Aktivator AdiA (für alkane degradation induction
activator), der in Anwesenheit eines Induktors wie z.B. n-Hexan aktiviert wird und die Expression
initiiert. (2) Negative Regulation des mas Operons durch einen Repressor AdiI (für alkane
degradation induction inhibitor), der in Abwesenheit eines Induktors aktiv ist und die Expression
des mas Operons inhibiert. Blau: aktiv; rot: inaktiv; + : positive Regulation; – : negative
Regulation.
![Page 129: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/129.jpg)
Diskussion und Ausblick
123
Hinzuzufügen ist, dass nicht alle Bakterien ihren Stoffwechsel durch Katabolitrepression
regulieren. Eine Ausnahme bilden z.B. pathogene Bakterien wie Chlamydia trachomatis,
die aufgrund ihrer Adaptation an eine nährstoffreiche Umgebung keine Katabolit-
repression benötigen (Nicholson et al., 2004).
Auffällig in Stamm HxN1 ist auch die Induktion des mas Operons durch eine Vielzahl an
Kohlenwasserstoffen, die gar nicht zur Energiegewinnung genutzt werden. Die bereits
angesprochene Möglichkeit der Detoxifizierung dieser Substanzen durch ihre Aktivierung
trifft nicht für alle Induktoren zu, da nicht alle positiv getesteten Induktoren
nachgewiesenermaßen durch die (1-Methylalkyl)succinat-Synthase aktiviert werden
(Wilkes et al., 2003). Eine Erklärung liefert die „regulatory noise“-Hypothese, die besagt,
dass regulatorische Gene eine gewisse Unspezifität benötigen, um auch die Regulation
für die Verwertung neuer Substrate, die vorher nicht vorhanden waren, übernehmen zu
können (de Lorenzo & Perez-Martin, 1996) Im Verlauf der Evolution werden neue
Strukturgene, wie z.B. Gene für den Abbau von Kohlenwasserstoffen, unter die Kontrolle
schon vorhandener Promotoren und ihrer Regulatoren gestellt. Die Expression dieser
Strukturgene ist jedoch nur möglich, wenn das transkriptionelle Kontrollsystem einen
geeigneten Induktor erkennt. Dies wiederum erfordert einen unspezifischen Regulator
(de Lorenzo & Perez-Martin, 1996). Wie oben erwähnt, wurden die mas Gene vermutlich
nachträglich von Stamm HxN1 erworben, um auf die Anwesenheit von n-Alkanen zu
reagieren. Die große Substratspezifität des Regulators kann auf eine noch andauernde
evolutionäre Optimierung hin zu dem am besten geeigneten Induktor für die Expression
der mas Gene hindeuten.
5. Ausblick: Kohlenwasserstoffabbauende Bakterien für die biologische Sanierung
Öl wird seit Millionen von Jahren als natürlicher Prozess aus Austrittstellen am
Meeresgrund in die Ozeane freigesetzt. Seit der Nutzung von Erdöl als Energieträger
kommt es zusätzlich zur Freisetzung von Öl und Derivaten aus Tankern oder
Förderanlagen in Gewässer. Durch derartige Unfälle werden Ökosysteme beschädigt,
da anders als bei den natürlichen Ölreservoirs innerhalb kurzer Zeit große Mengen an Öl
freigesetzt werden, die oftmals auch an die Küste gespült werden, so wie bei der
Havarie der Exxon Valdez 1989 vor der Küste Alaskas (Galt et al., 1991). In Ölreservoirs
leben an das Öl adaptierte Mikroorganismen, die einen Beitrag zur Entfernung des Öls
leisten, wohingegen in anthropogen kontaminierten Gebieten solche Mikroorganismen
oft nur in geringen Mengen vorkommen (Atlas & Hazen, 2011). Daher ist es erforderlich
![Page 130: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/130.jpg)
Diskussion und Ausblick
124
Maßnahmen zur Dekontamination von Ölverschmutzungen zu entwickeln. Es gibt nur
zwei Möglichkeiten Öl komplett zu entfernen, entweder durch vollständige Verbrennung
oder durch biologischen Abbau.
Die Dekontamination mithilfe von Bakterien, die n-Alkane und Aromaten des Öls
abbauen, wird als biologische Sanierung (Bioremediation) bezeichnet. Das Wachstum
ubiquitär vorhandener kohlenwasserstoffabbauender Bakterien zu stimulieren ist das
Ziel der Biostimulation (Prince, 2010b). Normalerweise ist das Wachstum der Bakterien
durch die begrenzte Verfügbarkeit von Kohlenwasserstoffen und anderer Nährstoffe wie
Phosphat und Stickstoff limitiert (Prince, 2010b). Das Vorhandensein von Kohlenwasser-
stoffen allein ist aufgrund ihrer schlechten Löslichkeit in Wasser normalerweise nicht
ausreichend für ihren mikrobiellen Abbau. Chemische Dispergenzien unterstützen die
Verteilung von Öl als kleine Tröpfchen in Wasser (Prince, 2010b). Öltropfen haben ein
großes Oberflächen-Volumen-Verhältnis und stehen damit einer größeren Anzahl an
Bakterien zur Verfügung als ein großer Ölteppich. Die Verwendung kleiner
Mineralpartikel, die mit dem Öl interagieren, bewirkt ebenfalls eine Oberflächen-
vergrößerung des Öls (Owens & Lee, 2003). Bakterien sind auch selbst in der Lage
Emulgatoren oder Tenside wie Rhamnolipide zu sekretieren, die Micellen bilden, in
deren hydrophoben Inneren das Öl eingefangen wird (van Hamme et al., 2003; Perfumo
et al., 2010). Der Einsatz von Düngemitteln liefert für das Wachstum benötigten
Stickstoff und Phosphor. In mehreren Fällen wurde eine erhöhte Rate des Abbaus von
Kohlenwasserstoffen in Folge einer Düngung beobachtet (Prince, 2010b). Nach der
Havarie der Exxon Valdez vor der Küste Alaskas wurden in drei Jahren fast 50 Tonnen
biologisch verfügbarer Stickstoff eingesetzt, ohne einen sichtbaren negativen Einfluss
auf die Umwelt ausgeübt zu haben (Prince, 2010b). Dennoch sind Algenblüten eine
mögliche Folge zu großer Mengen an Stickstoff.
Ziel der Bioaugmentation ist es, kohlenwasserstoffabbauende Bakterien zu einem
kontaminierten Gebiet hinzuzufügen, damit diese Bakterien zur Dekontamination
beitragen (Prince, 2010a). Nachdem im Jahre 1981 das erste genetisch veränderte
Bakterium patentiert wurde, das Kohlenwasserstoffe abbaut (US Patent 4259444),
wurde davon ausgegangen, dass der Einsatz solcher Bakterien eine erfolgreiche
Methode zur biologischen Sanierung mariner Ölverschmutzungen wird (Prince, 2010b).
Bisher haben sich diese Erwartungen jedoch nicht erfüllt, da sich u.a. die
vorherrschenden Bedingungen in der Natur stark von den optimalen
(Labor-)Bedingungen der Bakterien unterscheiden. Nur sehr wenige Studien zur
Dekontamination wurden mit Wildtypstämmen durchgeführt und ein klarer Nachweis des
Abbaus von Kohlenwasserstoffen durch diese Bakterien konnte nicht erbracht werden
![Page 131: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/131.jpg)
Diskussion und Ausblick
125
(Prince, 2010b). Im Gegensatz dazu zeigten Bioaugmentationsversuche in anaerobem,
kontaminiertem Grundwasser, dass der Abbau aromatischer Kohlenwasserstoffe durch
Inokulation mit kohlenwasserstoffabbauenden Anreicherungskulturen induziert wird
(Weiner & Lovley, 1998; da Silva & Alvarez, 2004). Mithilfe von anaeroben
Kohlenwasserstoffabbauern können also von Natur aus anaerobe Umgebungen wie z.B.
Sumpfsedimente oder kontaminiertes Grundwasser saniert werden. Der Einsatz von
Nitratreduzierern, wie z.B. Stamm HxN1, für die biologische Sanierung erscheint nicht
nur aufgrund der größeren Energieausbeute, sondern auch wegen der hohen
Wasserlöslichkeit von Nitrat (92,1 g/100 ml bei 25 °C) interessant (Mbadinga et al.,
2011).
Die Kenntnis der metabolischen Aktivitäten kohlenwasserstoffabbauender Bakterien ist
auch für die enzymatische biologische Sanierung von Bedeutung (Sutherland et al.,
2004; Alcalde et al., 2006; Peixoto et al., 2011). Enzyme, die für die biologische
Sanierung eingesetzt werden, müssen in gegebenen Umweltbedingungen funktionsfähig
sein. Die Abhängigkeit vieler Enzyme von Cofaktoren limitiert, neben hohen
Produktionskosten und geringen Ausbeuten bei der Enzymreinigung, ihren Einsatz.
Bislang ist nur ein anwendbares, reines Enzymadditiv beschrieben. Das Produkt, Oil
Spill Eater II, verringert laut Herstellerangaben unter aeroben Bedingungen die Menge
an Alkanen und Aromaten nach sieben Tagen um 36,9 bzw. 33,6%, und nach 28 Tagen
sogar um 89,8 bzw. 89,6% (Peixoto et al., 2011). Der Einsatz von Enzymen hat jedoch
den Vorteil, dass keine (gentechnisch veränderten) Mikroorganismen in die Umwelt
eingebracht werden müssen und modifizierte Proteine in vitro produziert werden.
Mithilfe von funktionellen Markergenen wurden in kontaminierten Gebieten viele
Gensequenzen identifiziert, die katabole Enzyme kodieren. Zwei bekannte Marker sind
bssA und assA, die die katalytische Untereinheit der Benzylsuccinat- bzw. Alkylsuccinat-
Synthase kodieren (Winderl et al., 2007; Callaghan et al., 2010). Solche Marker können
dazu beitragen, Gene und damit Proteine von nicht-kultivierbaren Organismen zu
detektieren (Peixoto et al., 2011). Möglicherweise sind diese Proteine effizienter im
Abbau von Kohlenwasserstoffen oder haben einen anderen Vorteil gegenüber den
bisher bekannten Enzymen von kultivierbaren Organismen. Wenn die Gensequenz
solcher Proteine bekannt ist, können diese Proteine in vitro produziert werden und dann
zur enzymatischen Sanierung genutzt werden.
Nicht zuletzt ist die Kenntnis kohlenwasserstoffabbauender Bakterien auch für die
Ölindustrie von Interesse, da die Qualität von Rohöl in Lagerstätten durch die
mikrobiologische Aktivität vermindert wird und die Förderung hierdurch kostenintensiver
und schwieriger wird (Head et al., 2003). Die Erforschung von Bakterien wie Stamm
![Page 132: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/132.jpg)
Diskussion und Ausblick
126
HxN1 trägt dazu bei, den Abbau von Kohlenwasserstoffen in Ölreservoirs und
kontaminierten Sedimenten oder Grundwasser besser zu verstehen und bildet damit
auch eine Grundlage für den Einsatz dieser Bakterien oder ihrer katabolen Proteine zur
biologischen Sanierung. Stamm HxN1 eignet sich aufgrund seiner guten Kultivierbarkeit
als Modellorganismus und weist darüber hinaus interessante Eigenschaften auf, die das
Ergebnis der vorliegenden Arbeit sind und die für ein umfassendes Verständnis des
anaeroben n-Alkanabbaus weiter untersucht werden sollten.
![Page 133: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/133.jpg)
127
Referenzen für A und C
Achong, G.R., Rodriguez, A.M. & Spormann, A.M. (2001) Benzylsuccinate synthase of
Azoarcus sp. strain T: cloning, sequencing, transcriptional organization, and its role
in anaerobic toluene and m-xylene mineralization. J. Bacteriol. 183: 6763−6770.
Aeckersberg, F., Bak, F. & Widdel, F. (1991) Anaerobic oxidation of saturated
hydrocarbons to CO2 by a new type of sulfate-reducing bacterium. Arch. Microbiol.
156: 5−14.
Aeckersberg, F., Rainey, F.A. & Widdel, F. (1998) Growth, natural relationships, cellular
fatty acids and metabolic adaptation of sulfate-reducing bacteria that utilize long-
chain alkanes under anoxic conditions. Arch. Microbiol. 170: 361−369.
Alcalde, M., Ferrer, M., Plou, F.J. & Ballesteros, A. (2006) Environmental biocatalysis:
from remediation with enzymes to novel green processes. Trends Biotechnol. 24:
281−287.
Anders, H.J., Kaetzke, A., Kämpfer, P., Ludwig, W. & Fuchs, G. (1995) Taxonomic
position of aromatic-degrading denitrifying pseudomonad strains K 172 and KB 740
and their description as new members of the genera Thauera, as Thauera
aromatica sp. nov., and Azoarcus, as Azoarcus evansii sp. nov., respectively,
members of the beta subclass of the Proteobacteria. Int. J. Syst. Bacteriol. 45:
327−333.
Anderson, R.T. & Lovley, D.R. (2000) Hexadecane decay by methanogenesis. Nature
404: 722−723.
Andrei, P.I., Pierik, A.J., Zauner, S., Andrei-Selmer, L.C. & Selmer, T. (2004) Subunit
composition of the glycyl radical enzyme p-hydroxyphenylacetate decarboxylase. A
small subunit, HpdC, is essential for catalytic activity. Europ. J. Biochem. 271:
2225−2230.
Annweiler, E., Materna, A., Safinowski, M., Kappler, A., Richnow, H.H., Michaelis, W. &
Meckenstock, R.U. (2000) Anaerobic degradation of 2-methylnaphthalene by a
sulfate-reducing enrichment culture. Appl. Environ. Microbiol. 66: 5329−5333.
Atlas, R.M. & Hazen, T.C. (2011) Oil biodegradation and bioremediation: a tale of the
two worst spills in U.S. history. Environ. Sci. Technol. 45: 6709−6715.
Baraniak, J., Moss, M.L. & Frey, P.A. (1989) Lysine 2,3-aminomutase. Support for a
mechanism of hydrogen transfer involving S-adenosylmethionine. J. Biol. Chem.
264: 1357−1360.
Bazylinski, D.A., Wirsen, C.O. & Jannasch, H.W. (1989) Microbial utilization of naturally
occurring hydrocarbons at the guaymas basin hydrothermal vent site. Appl.
Environ. Microbiol. 55: 2832−2836.
![Page 134: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/134.jpg)
Referenzen
128
Behrends, A. (1999) Physiologie und substratspezifische Proteinbildung
denitrifizierender Bakterien mit der Fähigkeit zur anaeroben Oxidation kurzkettiger
Alkane. Dissertation, Universität Bremen.
Bell, G.H. (1973) Solubilities of normal aliphatic acids, alcohols and alkanes in water.
Chem. Phys. Lipids 10: 1−10.
Beller, H.R. & Spormann, A.M. (1997a) Benzylsuccinate formation as a means of
anaerobic toluene activation by sulfate-reducing strain PRTOL1. Appl. Environ.
Microbiol. 63: 3729−3731.
Beller, H.R. & Spormann, A.M. (1997b) Anaerobic activation of toluene and o-xylene by
addition to fumarate in denitrifying strain T. J. Bacteriol. 179: 670−676.
Beller, H.R. & Spormann, A.M. (1998) Analysis of the novel benzylsuccinate synthase
reaction for anaerobic toluene activation based on structural studies of the product.
J. Bacteriol. 180: 5454−5457.
Beller, H.R. & Edwards, E.A. (2000) Anaerobic toluene activation by benzylsuccinate
synthase in a highly enriched methanogenic culture. Appl. Environ. Microbiol. 66:
5503−5505.
Biegert, T., Fuchs, G. & Heider, J. (1996) Evidence that anaerobic oxidation of toluene in
the denitrifying bacterium Thauera aromatica is initiated by formation of
benzylsuccinate from toluene and fumarate. Europ. J. Biochem. 238: 661−668.
Boetius, A., Ravenschlag, K., Schubert, C.J., Rickert, D., Widdel, F., Gieseke, A. et al.
(2000) A marine microbial consortium apparently mediating anaerobic oxidation of
methane. Nature 407: 623−626.
Bonin, P., Cravo-Laureau, C., Michotey, V. & Hirschler-Rea, A. (2004) The anaerobic
hydrocarbon biodegrading bacteria: An overview. Ophelia 58: 243−254.
Bregnard, T.P., Haner, A., Hohener, P. & Zeyer, J. (1997) Anaerobic degradation of
pristane in nitrate-reducing microcosms and enrichment cultures. Appl. Environ.
Microbiol. 63: 2077−2081.
Buckel, W. & Golding, B.T. (2006) Radical enzymes in anaerobes. Annu. Rev. Microbiol.
60: 27−49.
Burlage, R.S., Hooper, S.W. & Sayler, G.S. (1989) The TOL (pWW0) catabolic plasmid.
Appl. Environ. Microbiol. 55: 1323−1328.
Burrus, V., Pavlovic, G., Decaris, B. & Guédon, G. (2002) Conjugative transposons: the
tip of the iceberg. Mol. Microbiol. 46: 601−610.
Caldwell, M.E., Garrett, R.M., Prince, R.C. & Suflita, J.M. (1998) Anaerobic
biodegradation of long-chain n-alkanes under sulfate-reducing conditions. Environ.
Sci. Technol. 32: 2191−2195.
![Page 135: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/135.jpg)
Referenzen
129
Callaghan, A.V., Tierney, M., Phelps, C.D. & Young, L.Y. (2009) Anaerobic
biodegradation of n-hexadecane by a nitrate-reducing consortium. Appl. Environ.
Microbiol. 75: 1339−1344.
Callaghan, A.V., Gieg, L.M., Kropp, K.G., Suflita, J.M. & Young, L.Y. (2006) Comparison
of mechanisms of alkane metabolism under sulfate-reducing conditions among two
bacterial isolates and a bacterial consortium. Appl. Environ. Microbiol. 72: 4274−
4282.
Callaghan, A.V., Wawrik, B., Ni Chadhain, S.M., Young, L.Y. & Zylstra, G.J. (2008)
Anaerobic alkane-degrading strain AK-01 contains two alkylsuccinate synthase
genes. Biochem. Biophys. Res. Commun. 366: 142−148.
Callaghan, A.V., Davidova, I.A., Savage-Ashlock, K., Parisi, V.A., Gieg, L.M., Suflita,
J.M. et al. (2010) Diversity of benzyl- and alkylsuccinate synthase genes in
hydrocarbon-impacted environments and enrichment cultures. Environ. Sci.
Technol. 44: 7287−7294.
Callaghan, A.V., Morris, B.E., Pereira, I.A., McInerney, M.J., Austin, R.N., Groves, J.T. et
al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: a
blueprint for anaerobic alkane oxidation. Environ. Microbiol. 14: 101−113.
Chakrabarty, A.M., Chou, G. & Gunsalus, I.C. (1973) Genetic regulation of octane
dissimilation plasmid in Pseudomonas. Proc. Natl. Acad. Sci. U S A 70: 1137−
1140.
Choi, K.H. & Kim, K.J. (2009) Applications of transposon-based gene delivery system in
bacteria. J. Microbiol. Biotechnol. 19: 217−228.
Conradt, H., Hohmann-Berger, M., Hohmann, H.P., Blaschkowski, H.P. & Knappe, J.
(1984) Pyruvate formate-lyase (inactive form) and pyruvate formate-lyase
activating enzyme of Escherichia coli: isolation and structural properties. Arch.
Biochem. Biophys. 228: 133−142.
Coschigano, P.W. (2000) Transcriptional analysis of the tutE tutFDGH gene cluster from
Thauera aromatica strain T1. Appl. Environ. Microbiol. 66: 1147−1151.
Coschigano, P.W. & Young, L.Y. (1997) Identification and sequence analysis of two
regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl.
Environ. Microbiol. 63: 652−660.
Coschigano, P.W., Wehrman, T.S. & Young, L.Y. (1998) Identification and analysis of
genes involved in anaerobic toluene metabolism by strain T1: putative role of a
glycine free radical. Appl. Environ. Microbiol. 64: 1650−1656.
![Page 136: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/136.jpg)
Referenzen
130
Cravo-Laureau, C., Matheron, R., Cayol, J.L., Joulian, C. & Hirschler-Réa, A. (2004)
Desulfatibacillum aliphaticivorans gen. nov., sp. nov., an n-alkane- and n-alkene-
degrading, sulfate-reducing bacterium. Int. J. Syst. Evol. Microbiol. 54: 77−83.
Cravo-Laureau, C., Grossi, V., Raphel, D., Matheron, R. & Hirschler-Réa, A. (2005)
Anaerobic n-alkane metabolism by a sulfate-reducing bacterium, Desulfatibacillum
aliphaticivorans strain CV2803T. Appl. Environ. Microbiol. 71: 3458−3467.
da Silva, M.L.B. & Alvarez, P.J.J. (2004) Enhanced anaerobic biodegradation of
benzene-toluene-ethylbenzene-xylene-ethanol mixtures in bioaugmented aquifer
columns. Appl. Environ. Microbiol. 70: 4720−4726.
Davidova, I.A. & Suflita, J.M. (2005) Enrichment and isolation of anaerobic hydrocarbon-
degrading bacteria. Methods Enzymol. 397: 17−34.
Davidova, I.A., Gieg, L.M., Nanny, M., Kropp, K.G. & Suflita, J.M. (2005) Stable isotopic
studies of n-alkane metabolism by a sulfate-reducing bacterial enrichment culture.
Appl. Environ. Microbiol. 71: 8174−8182.
de Lorenzo, V. & Perez-Martin, J. (1996) Regulatory noise in prokaryotic promoters: how
bacteria learn to respond to novel environmental signals. Mol. Microbiol. 19: 1177−
1184.
Deutscher, J. (2008) The mechanisms of carbon catabolite repression in bacteria. Curr.
Opin. Microbiol. 11: 87−93.
Ehrenreich, P. (1996) Anaerobes Wachstum neuartiger sulfatreduzierender und
nitratreduzierender Bakterien auf n-Alkanen und Erdöl. Dissertation, Universität
Bremen.
Ehrenreich, P., Behrends, A., Harder, J. & Widdel, F. (2000) Anaerobic oxidation of
alkanes by newly isolated denitrifying bacteria. Arch. Microbiol. 173: 58−64.
Eliasson, R., Pontis, E., Fontecave, M., Gerez, C., Harder, J., Jornvall, H. et al. (1992)
Characterization of components of the anaerobic ribonucleotide reductase system
from Escherichia coli. J. Biol. Chem. 267: 25541−25547.
Ettwig, K.F., Shima, S., van de Pas-Schoonen, K.T., Kahnt, J., Medema, M.H., Op den
Camp, H.J. et al. (2008) Denitrifying bacteria anaerobically oxidize methane in the
absence of Archaea. Environ. Microbiol. 10: 3164−3173.
Ettwig, K.F., Butler, M.K., Le Paslier, D., Pelletier, E., Mangenot, S., Kuypers, M.M. et al.
(2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature
464: 543−548.
Evans, P.J., Mang, D.T., Kim, K.S. & Young, L.Y. (1991) Anaerobic degradation of
toluene by a denitrifying bacterium. Appl. Environ. Microbiol. 57: 1139−1145.
![Page 137: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/137.jpg)
Referenzen
131
Galt, J.A., Lehr, W.J. & Payton, D.L. (1991) Fate and transport of the Exxon Valdez oil
spill, part 4. Environ. Sci. Technol. 25: 202-209.
Görke, B. & Stülke, J. (2008) Carbon catabolite repression in bacteria: many ways to
make the most out of nutrients. Nat. Rev. Microbiol. 6: 613−624.
Greated, A., Lambertsen, L., Williams, P.A. & Thomas, C.M. (2002) Complete sequence
of the IncP-9 TOL plasmid pWW0 from Pseudomonas putida. Environ. Microbiol. 4:
856−871.
Grossi, V., Cravo-Laureau, C., Guyoneaud, R., Ranchou-Peyruse, A. & Hirschler-Réa,
A. (2008) Metabolism of n-alkanes and n-alkenes by bacteria: a summary. Org.
Geochem. 39: 1197−1203.
Grossi, V., Cravo-Laureau, C., Méou, A., Raphel, D., Garzino, F. & Hirschler-Réa, A.
(2007) Anaerobic 1-alkene metabolism by the alkane- and alkene-degrading
sulfate reducer Desulfatibacillum aliphaticivorans strain CV2803T. Appl. Environ.
Microbiol. 73: 7882−7890.
Grundmann, O., Behrends, A., Rabus, R., Amann, J., Halder, T., Heider, J. & Widdel, F.
(2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes
in the denitrifying bacterium, strain HxN1. Environ. Microbiol. 10: 376−385.
Hanson, R.S. & Hanson, T.E. (1996) Methanotrophic bacteria. Microbiol. Rev. 60: 439−
471.
Harder, W. & Dijkhuizen, L. (1982) Strategies of mixed substrate utilization in
microorganisms. Philos. Trans. R. Soc. London 297: 459−480.
Hazen, T.C., Dubinsky, E.A., DeSantis, T.Z., Andersen, G.L., Piceno, Y.M., Singh, N. et
al. (2010) Deep-sea oil plume enriches indigenous oil-degrading bacteria. Science
330: 204−208.
Head, I.M., Jones, D.M. & Larter, S.R. (2003) Biological activity in the deep subsurface
and the origin of heavy oil. Nature 426: 344−352.
Hermuth, K., Leuthner, B. & Heider, J. (2002) Operon structure and expression of the
genes for benzylsuccinate synthase in Thauera aromatica strain K172. Arch.
Microbiol. 177: 132−138.
Higashioka, Y., Kojima, H., Nakagawa, T., Sato, S. & Fukui, M. (2009) A novel n-alkane-
degrading bacterium as a minor member of p-xylene-degrading sulfate-reducing
consortium. Biodegradation 20: 383−390.
Hilberg, M., Pierik, A.J., Bill, E., Friedrich, T., Lippert, M.L. & Heider, J. (2012)
Identification of FeS clusters in the glycyl-radical enzyme benzylsuccinate synthase
via EPR and Mossbauer spectroscopy. J. Biol. Inorg. Chem. 17: 49−56.
![Page 138: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/138.jpg)
Referenzen
132
Hinrichs, K.U., Hayes, J.M., Bach, W., Spivack, A.J., Hmelo, L.R., Holm, N.G. et al.
(2006) Biological formation of ethane and propane in the deep marine subsurface.
Proc. Natl. Acad. Sci. U S A 103: 14684−14689.
Holler, T., Wegener, G., Niemann, H., Deusner, C., Ferdelman, T.G., Boetius, A. et al.
(2011) Carbon and sulfur back flux during anaerobic microbial oxidation of
methane and coupled sulfate reduction. Proc. Natl. Acad. Sci. U S A 108: 1484−
1490.
Jarling, R., Sadeghi, M., Drozdowska, M., Lahme, S., Buckel, W., Rabus, R. et al. (2012)
Stereochemical investigations reveal the mechanism of the bacterial activation of
n-alkanes without oxygen. Angew. Chem. Int. Ed. 51: 1334−1338.
Jones, D.M., Head, I.M., Gray, N.D., Adams, J.J., Rowan, A.K., Aitken, C.M. et al. (2008)
Crude-oil biodegradation via methanogenesis in subsurface petroleum reservoirs.
Nature 451: 176−180.
Kane, S.R., Beller, H.R., Legler, T.C. & Anderson, R.T. (2002) Biochemical and genetic
evidence of benzylsuccinate synthase in toluene-degrading, ferric iron-reducing
Geobacter metallireducens. Biodegradation 13: 149−154.
Keppler, F., Hamilton, J.T., Brass, M. & Rockmann, T. (2006) Methane emissions from
terrestrial plants under aerobic conditions. Nature 439: 187−191.
King, D.S. & Reichard, P. (1995) Mass spectrometric determination of the radical
scission site in the anaerobic ribonucleotide reductase of Escherichia coli.
Biochem. Biophys. Res. Commun. 206: 731−735.
Knappe, J., Neugebauer, F.A., Blaschkowski, H.P. & Ganzler, M. (1984) Post-
translational activation introduces a free radical into pyruvate formate-lyase. Proc.
Natl. Acad. Sci. U S A 81: 1332−1335.
Knappe, J., Elbert, S., Frey, M. & Wagner, A.F. (1993) Pyruvate formate-lyase
mechanism involving the protein-based glycyl radical. Biochem. Soc. Trans. 21:
731−734.
Kniemeyer, O. & Heider, J. (2001) (S)-1-phenylethanol dehydrogenase of Azoarcus sp.
strain EbN1, an enzyme of anaerobic ethylbenzene catabolism. Arch. Microbiol.
176: 129−135.
Kniemeyer, O., Fischer, T., Wilkes, H., Glöckner, F.O. & Widdel, F. (2003) Anaerobic
degradation of ethylbenzene by a new type of marine sulfate-reducing bacterium.
Appl. Environ. Microbiol. 69: 760−768.
Kniemeyer, O., Musat, F., Sievert, S.M., Knittel, K., Wilkes, H., Blumenberg, M. et al.
(2007) Anaerobic oxidation of short-chain hydrocarbons by marine sulphate-
reducing bacteria. Nature 449: 898−901.
![Page 139: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/139.jpg)
Referenzen
133
Knippers, R. (2001) Molekulare Genetik. Stuttgart, New York: Georg Thieme Verlag.
Krieger, C.J., Beller, H.R., Reinhard, M. & Spormann, A.M. (1999) Initial reactions in
anaerobic oxidation of m-xylene by the denitrifying bacterium Azoarcus sp. strain T.
J. Bacteriol. 181: 6403−6410.
Krieger, C.J., Roseboom, W., Albracht, S.P. & Spormann, A.M. (2001) A stable organic
free radical in anaerobic benzylsuccinate synthase of Azoarcus sp. strain T. J. Biol.
Chem. 276: 12924−12927.
Kropp, K.G., Davidova, I.A. & Suflita, J.M. (2000) Anaerobic oxidation of n-dodecane by
an addition reaction in a sulfate-reducing bacterial enrichment culture. Appl.
Environ. Microbiol. 66: 5393−5398.
Krüger, M., Meyerdierks, A., Glöckner, F.O., Amann, R., Widdel, F., Kube, M. et al.
(2003) A conspicuous nickel protein in microbial mats that oxidize methane
anaerobically. Nature 426: 878−881.
Kube, M., Heider, J., Amann, J., Hufnagel, P., Kuhner, S., Beck, A. et al. (2004) Genes
involved in the anaerobic degradation of toluene in a denitrifying bacterium, strain
EbN1. Arch. Microbiol. 181: 182−194.
Ladygina, N., Dedyukhina, E. & Vainshtein, M. (2006) A review on microbial synthesis of
hydrocarbons. Process Biochem. 41: 1001−1014.
Lau, P.C., Wang, Y., Patel, A., Labbé, D., Bergeron, H., Brousseau, R. et al. (1997) A
bacterial basic region leucine zipper histidine kinase regulating toluene
degradation. Proc. Natl. Acad. Sci. U S A 94: 1453−1458.
Layer, G., Heinz, D.W., Jahn, D. & Schubert, W.D. (2004) Structure and function of
radical SAM enzymes. Curr. Opin. Chem. Biol. 8: 468−476.
Leuthner, B. & Heider, J. (1998) A two-component system involved in regulation of
anaerobic toluene metabolism in Thauera aromatica. FEMS Microbiol. Lett. 166:
35−41.
Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E. et al. (1998)
Biochemical and genetic characterization of benzylsuccinate synthase from
Thauera aromatica: a new glycyl radical enzyme catalysing the first step in
anaerobic toluene metabolism. Mol. Microbiol. 28: 615−628.
Leutwein, C. & Heider, J. (1999) Anaerobic toluene-catabolic pathway in denitrifying
Thauera aromatica: activation and beta-oxidation of the first intermediate, (R)-(+)-
benzylsuccinate. Microbiol. 145 3265−3271.
Li, L., Patterson, D.P., Fox, C.C., Lin, B., Coschigano, P.W. & Marsh, E.N. (2009)
Subunit structure of benzylsuccinate synthase. Biochemistry 48: 1284−1292.
![Page 140: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/140.jpg)
Referenzen
134
Liu, C., Wang, W., Wu, Y., Zhou, Z., Lai, Q. & Shao, Z. (2011) Multiple alkane
hydroxylase systems in a marine alkane degrader, Alcanivorax dieselolei B-5.
Environ. Microbiol. 13: 1168−1178.
Macy, J.M., Rech, S., Auling, G., Dorsch, M., Stackebrandt, E. & Sly, L.I. (1993) Thauera
selenatis gen. nov., sp. nov., a member of the beta subclass of Proteobacteria with
a novel type of anaerobic respiration. Int. J. Syst. Evol. Microbiol. 43: 135−142.
Marin, M.M., Yuste, L. & Rojo, F. (2003) Differential expression of the components of the
two alkane hydroxylases from Pseudomonas aeruginosa. J. Bacteriol. 185: 3232−
3237.
Mbadinga, S.M., Wang, L.-Y., Zhou, L., Liu, J.-F., Gu, J.-D. & Mu, B.-Z. (2011) Microbial
communities involved in anaerobic degradation of alkanes. Int. Biodeter. Biodegr.
65: 1−13.
McInerney, M.J., Hoehler, T., Gunsalus, R.P. & Schink, B. (2010) Introduction to
microbial hydrocarbon production: bioenergetics. In Handbook of lipid and
hydrocarbon microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag,
pp. 321−336.
Mehboob, F., Junca, H., Schraa, G. & Stams, A.J. (2009) Growth of Pseudomonas
chloritidismutans AW-1(T) on n-alkanes with chlorate as electron acceptor. Appl.
Microbiol. Biotechnol. 83: 739−747.
Morasch, B., Schink, B., Tebbe, C.C. & Meckenstock, R.U. (2004) Degradation of
o-xylene and m-xylene by a novel sulfate-reducer belonging to the genus
Desulfotomaculum. Arch. Microbiol. 181: 407−417.
Moreno, R., Ruiz-Manzano, A., Yuste, L. & Rojo, F. (2007) The Pseudomonas putida
Crc global regulator is an RNA binding protein that inhibits translation of the AlkS
transcriptional regulator. Mol. Microbiol. 64: 665−675.
Müller, J.A., Galushko, A.S., Kappler, A. & Schink, B. (1999) Anaerobic degradation of
m-cresol by Desulfobacterium cetonicum is initiated by formation of
3-hydroxybenzylsuccinate. Arch. Microbiol. 172: 287−294.
Müller, J.A., Galushko, A.S., Kappler, A. & Schink, B. (2001) Initiation of anaerobic
degradation of p-cresol by formation of 4-hydroxybenzylsuccinate in
Desulfobacterium cetonicum. J. Bacteriol. 183: 752−757.
Musat, F., Wilkes, H., Behrends, A., Woebken, D. & Widdel, F. (2010) Microbial nitrate-
dependent cyclohexane degradation coupled with anaerobic ammonium oxidation.
ISME J. 4: 1290−1301.
![Page 141: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/141.jpg)
Referenzen
135
Musat, F., Galushko, A., Jacob, J., Widdel, F., Kube, M., Reinhardt, R. et al. (2009)
Anaerobic degradation of naphthalene and 2-methylnaphthalene by strains of
marine sulfate-reducing bacteria. Environ. Microbiol. 11: 209−219.
Nauhaus, K., Boetius, A., Krüger, M. & Widdel, F. (2002) In vitro demonstration of
anaerobic oxidation of methane coupled to sulphate reduction in sediment from a
marine gas hydrate area. Environ. Microbiol. 5: 296−305.
Nicholson, T.L., Chiu, K. & Stephens, R.S. (2004) Chlamydia trachomatis lacks an
adaptive response to changes in carbon source availability. Infect. Immun. 72:
4286−4289.
Nojiri, H., Shintani, M. & Omori, T. (2004) Divergence of mobile genetic elements
involved in the distribution of xenobiotic-catabolic capacity. Appl. Microbiol.
Biotechnol. 64: 154−174.
O´Brien, J.R., Raynaud, C., Croux, C., Girbal, L., Soucaille, P. & Lanzilotta, W.N. (2004)
Insight into the mechanism of the B12-independent glycerol dehydratase from
Clostridium butyricum: preliminary biochemical and structural characterization.
Biochemistry 44: 10541−10551.
Owens, E.H. & Lee, K. (2003) Interaction of oil and mineral fines on shorelines: review
and assessment. Mar. Pollut. Bull. 47: 397−405.
Parales, R.E. & Ditty, J.L. (2010) Chemotaxis. In Handbook of hydrocarbon and lipid
microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 1531−
1544.
Peixoto, R.S., Vermelho, A.B. & Rosado, A.S. (2011) Petroleum-degrading enzymes:
bioremediation and new prospects. Enzyme Res.: doi:10.4061/2011/475193.
Perfumo, A., Smyth, T.J.P., Marchant, R. & Banat, I.M. (2010) Production and roles of
biosurfactants and bioemulsifiers in accessing hydrophobic substrates. In
Handbook of hydrocarbon and lipid microbiology. Timmis, K.N. (ed). Berlin,
Heidelberg: Springer Verlag, pp. 1501−1512.
Prince, R.C. (1993) Petroleum spill bioremediation in marine environments. Crit. Rev.
Microbiol. 19: 217−242.
Prince, R.C. (2010a) Can we improve bioremediation? In Handbook of hydrocarbon and
lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp.
3352−3355.
Prince, R.C. (2010b) Bioremediation of marine oil spills. In Handbook of hydrocarbon
and lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp.
2816−2830.
![Page 142: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/142.jpg)
Referenzen
136
Rabus, R. & Widdel, F. (1995) Anaerobic degradation of ethylbenzene and other
aromatic hydrocarbons by new denitrifying bacteria. Arch. Microbiol. 163: 96−103.
Rabus, R., Wilkes, H., Schramm, A., Harms, G., Behrends, A., Amann, R. & Widdel, F.
(1999) Anaerobic utilization of alkylbenzenes and n-alkanes from crude oil in an
enrichment culture of denitrifying bacteria affiliating with the beta-subclass of
Proteobacteria. Environ. Microbiol. 1: 145−157.
Rabus, R., Wilkes, H., Behrends, A., Armstroff, A., Fischer, T., Pierik, A.J. & Widdel, F.
(2001) Anaerobic initial reaction of n-alkanes in a denitrifying bacterium: Evidence
for (1-methylpentyl)succinate as initial product and for involvement of an organic
radical in n-hexane metabolism. J. Bacteriol. 183: 1707−1715.
Rabus, R., Kube, M., Heider, J., Beck, A., Heitmann, K., Widdel, F. & Reinhardt, R.
(2005) The genome sequence of an anaerobic aromatic-degrading denitrifying
bacterium, strain EbN1. Arch. Microbiol. 183: 27−36.
Rabus, R., Jarling, R., Lahme, S., Kühner, S., Heider, J., Widdel, F. & Wilkes, H. (2011)
Co-metabolic conversion of toluene in anaerobic n-alkane-degrading bacteria.
Environ. Microbiol. 13: 2576−2586.
Ragsdale, S.W. (2007) Nickel and the carbon cycle. J. Inorg. Biochem. 101: 1657−1666.
Raynaud, C., Sarcabal, P., Meynial-Salles, I., Croux, C. & Soucaille, P. (2003) Molecular
characterization of the 1,3-propanediol (1,3-PD) operon of Clostridium butyricum.
Proc. Natl. Acad. Sci. U S A 100: 5010−5015.
Reinhold-Hurek, R. & Hurek, T. (2006) The genera Azoarcus, Azovibrio, Azospira and
Azonexus. In The Prokaryotes; 3rd Edition. Dworkin, M., Falkow, S., Rosenberg,
E., Schleifer, K.-H. & Stackebrandt, E. (eds). Berlin, Heidelberg: Springer Verlag,
pp. 873−891.
Rios-Hernandez, L.A., Gieg, L.M. & Suflita, J.M. (2003) Biodegradation of an alicyclic
hydrocarbon by a sulfate-reducing enrichment from a gas condensate-
contaminated aquifer. Appl. Environ. Microbiol. 69: 434−443.
Rojo, F. (2009) Degradation of alkanes by bacteria. Environ. Microbiol. 11: 2477−2490.
Rojo, F. (2010a) Enzymes for aerobic degradation of alkanes. In Handbook of
hydrocarbon and lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer
Verlag, pp. 781−798.
Rojo, F. (2010b) Genetic features and regulation of n-alkane metabolism. In Handbook
of hydrocarbon and lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg:
Springer Verlag, pp. 1141−1154.
![Page 143: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/143.jpg)
Referenzen
137
Rueter, P., Rabus, R., Wilkes, H., Aeckersberg, F., Rainey, F.A., Jannasch, H.W. &
Widdel, F. (1994) Anaerobic oxidation of hydrocarbons in crude oil by new types of
sulphate-reducing bacteria. Nature 372: 455−458.
Satpute, S.K., Banat, I.M., Dhakephalkar, P.K., Banpurkar, A.G. & Chopade, B.A. (2010)
Biosurfactants, bioemulsifiers and exopolysaccharides from marine
microorganisms. Biotechnol. Adv. 28: 436−450.
Savage, K.N., Krumholz, L.R., Gieg, L.M., Parisi, V.A., Suflita, J.M., Allen, J. et al. (2010)
Biodegradation of low-molecular-weight alkanes under mesophilic, sulfate-reducing
conditions: metabolic intermediates and community patterns. FEMS Microbiol.
Ecol. 72: 485−495.
Scheller, S., Goenrich, M., Boecher, R., Thauer, R.K. & Jaun, B. (2010) The key nickel
enzyme of methanogenesis catalyses the anaerobic oxidation of methane. Nature
465: 606−608.
Schindler, D. (2010) Tar sands need solid science. Nature 468: 499−501.
Selmer, T. & Andrei, P.I. (2001) p-Hydroxyphenylacetate decarboxylase from Clostridium
difficile. A novel glycyl radical enzyme catalysing the formation of p-cresol. Europ.
J. Biochem. 268: 1363−1372.
Shima, S., Krüger, M., Weinert, T., Demmer, U., Kahnt, J., Thauer, R.K. & Ermler, U.
(2011) Structure of a methyl-coenzyme M reductase from Black Sea mats that
oxidize methane anaerobically. Nature 481: 98−101.
Shinoda, Y., Sakai, Y., Uenishi, H., Uchihashi, Y., Hiraishi, A., Yukawa, H. et al. (2004)
Aerobic and anaerobic toluene degradation by a newly isolated denitrifying
bacterium, Thauera sp. strain DNT-1. Appl. Environ. Microbiol. 70: 1385−1392.
Shinoda, Y., Akagi, J., Uchihashi, Y., Hiraishi, A., Yukawa, H., Yurimoto, H. et al. (2005)
Anaerobic degradation of aromatic compounds by Magnetospirillum strains:
isolation and degradation genes. Biosci., Biotechnol., Biochem. 69: 1483−1491.
Sinclair, M.I. & Holloway, B.W. (1991) Chromosomal insertion of TOL transposons in
Pseudomonas aeruginosa PAO. J. Gen. Microbiol. 137: 1111−1120.
Sinclair, M.I., Maxwell, P.C., Lyon, B.R. & Holloway, B.W. (1986) Chromosomal location
of TOL plasmid DNA in Pseudomonas putida. J. Bacteriol. 168: 1302−1308.
Smits, T.H., Rothlisberger, M., Witholt, B. & van Beilen, J.B. (1999) Molecular screening
for alkane hydroxylase genes in Gram-negative and Gram-positive strains. Environ.
Microbiol. 1: 307−317.
So, C.M. & Young, L.Y. (1999) Isolation and characterization of a sulfate-reducing
bacterium that anaerobically degrades alkanes. Appl. Environ. Microbiol. 65: 2969−
2976.
![Page 144: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/144.jpg)
Referenzen
138
So, C.M., Phelps, C.D. & Young, L.Y. (2003) Anaerobic transformation of alkanes to fatty
acids by a sulfate-reducing bacterium, strain Hxd3. Appl. Environ. Microbiol. 69:
3892−3900.
Sofia, H.J., Chen, G., Hetzler, B.G., Reyes-Spindola, J.F. & Miller, N.E. (2001) Radical
SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic
pathways with radical mechanisms: functional characterization using new analysis
and information visualization methods. Nucleic Acids Res. 29: 1097−1106.
Spormann, A.M. & Widdel, F. (2000) Metabolism of alkylbenzenes, alkanes, and other
hydrocarbons in anaerobic bacteria. Biodegradation 11: 85−105.
Sun, X., Harder, J., Krook, M., Jornvall, H., Sjoberg, B.M. & Reichard, P. (1993) A
possible glycine radical in anaerobic ribonucleotide reductase from Escherichia
coli: nucleotide sequence of the cloned nrdD gene. Proc. Natl. Acad. Sci. U S A 90:
577−581.
Sun, X., Ollagnier, S., Schmidt, P.P., Atta, M., Mulliez, E., Lepape, L. et al. (1996) The
free radical of the anaerobic ribonucleotide reductase from Escherichia coli is at
glycine 681. J. Biol. Chem. 271: 6827−6831.
Sutherland, T.D., Horne, I., Weir, K.M., Coppin, C.W., Williams, M.R., Selleck, M. et al.
(2004) Enzymatic bioremediation: from enzyme discovery to applications. Clin.
Exp. Pharmacol. Physiol. 31: 817−821.
Tani, A., Ishige, T., Sakai, Y. & Kato, N. (2001) Gene structures and regulation of the
alkane hydroxylase complex in Acinetobacter sp. strain M-1. J. Bacteriol. 183:
1819−1823.
Taylor, B.L. & Zhulin, I.B. (1999) PAS domains: internal sensors of oxygen, redox
potential, and light. Microbiol. Mol. Biol. Rev. 63: 479−506.
Thauer, R.K. (1998) Biochemistry of methanogenesis: a tribute to Marjory Stephenson.
1998 Marjory Stephenson Prize Lecture. Microbiol. 144 2377−2406.
Thauer, R.K. (2011) Anaerobic oxidation of methane with sulfate: on the reversibility of
the reactions that are catalyzed by enzymes also involved in methanogenesis from
CO2. Curr. Opin. Biotechnol. 14: 292−299.
Tissot, B.P. & Welte, D.H. (1984) Petroleum formation and occurence. Berlin, Germany:
Springer Verlag.
Tsuda, M. & Iino, T. (1987) Genetic analysis of a transposon carrying toluene degrading
genes on a TOL plasmid pWW0. Mol. Gen. Genet. 210: 270−276.
Tsuda, M., Tan, H.M., Nishi, A. & Furukawa, K. (1999) Mobile catabolic genes in
bacteria. J. Biosci. Bioeng. 87: 401−410.
![Page 145: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/145.jpg)
Referenzen
139
Unkrig, V., Neugebauer, F.A. & Knappe, J. (1989) The free radical of pyruvate formate-
lyase. Characterization by EPR spectroscopy and involvement in catalysis as
studied with the substrate-analogue hypophosphite. Europ. J. Biochem. 184: 723−
728.
van Beilen, J.B. & Funhoff, E.G. (2005) Expanding the alkane oxygenase toolbox: new
enzymes and applications. Curr. Opin. Biotechnol. 16: 308−314.
van Beilen, J.B. & Funhoff, E.G. (2007) Alkane hydroxylases involved in microbial alkane
degradation. Appl. Microbiol. Biotechnol. 74: 13−21.
van Beilen, J.B., Wubbolts, M.G. & Witholt, B. (1994) Genetics of alkane oxidation by
Pseudomonas oleovorans. Biodegradation 5: 161−174.
van Beilen, J.B., Li, Z., Duetz, W.A., Smits, T.H. & Witholt, B. (2003) Diversity of alkane
hydroxylase systems in the environment. Oil Gas Sci. Technol. 58: 427−440.
van Beilen, J.B., Panke, S., Lucchini, S., Franchini, A.G., Rothlisberger, M. & Witholt, B.
(2001) Analysis of Pseudomonas putida alkane-degradation gene clusters and
flanking insertion sequences: evolution and regulation of the alk genes. Microbiol.
147: 1621−1630.
van Beilen, J.B., Marin, M.M., Smits, T.H., Rothlisberger, M., Franchini, A.G., Witholt, B.
& Rojo, F. (2004) Characterization of two alkane hydroxylase genes from the
marine hydrocarbonoclastic bacterium Alcanivorax borkumensis. Environ.
Microbiol. 6: 264−273.
van der Meer, J.R. & Sentchilo, V. (2003) Genomic islands and the evolution of catabolic
pathways in bacteria. Curr. Opin. Biotechnol. 14: 248−254.
van Hamme, J.D., Singh, A. & Ward, O.P. (2003) Recent advances in petroleum
microbiology. Microbiol. Mol. Biol. Rev. 67: 503−549.
Verfürth, K., Pierik, A.J., Leutwein, C., Zorn, S. & Heider, J. (2004) Substrate specificities
and electron paramagnetic resonance properties of benzylsuccinate synthases in
anaerobic toluene and m-xylene metabolism. Arch. Microbiol. 181: 155−162.
Vollhardt, P.C. (1990) Organische Chemie. Weinheim: VCH Verlagsgesellschaft.
Wackett, L.P. (2010) Aliphatic hydrocarbon producers. In Handbook of hydrocarbon and
lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 609−
614.
Wagner, A.F., Frey, M., Neugebauer, F.A., Schäfer, W. & Knappe, J. (1992) The free
radical in pyruvate formate-lyase is located on glycine-734. Proc. Natl. Acad. Sci. U
S A 89: 996−1000.
Wang, S.C. & Frey, P.A. (2007) S-adenosylmethionine as an oxidant: the radical SAM
superfamily. Trends Biochem. Sci. 32: 101−110.
![Page 146: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/146.jpg)
Referenzen
140
Wang, W. & Shao, Z. (2011) Genes involved in alkane degradation in the Alcanivorax
hongdengensis strain A-11-3. Appl. Microbiol. Biotechnol.: doi: 10.1007/s00253-
00011-03818-x.
Wang, Y., Rawlings, M., Gibson, D.T., Labbe, D., Bergeron, H., Brousseau, R. & Lau,
P.C. (1995) Identification of a membrane protein and a truncated LysR-type
regulator associated with the toluene degradation pathway in Pseudomonas putida
F1. Mol. Gen. Genet. 246: 570−579.
Washer, C.E. & Edwards, E.A. (2007) Identification and expression of benzylsuccinate
synthase genes in a toluene-degrading methanogenic consortium. Appl. Environ.
Microbiol. 73: 1367−1369.
Weast, R.C. (1990) CRC Handbook of Chemistry and Physics, 70th ed., 1989-1990.
Boca Raton, Florida: CRC Press.
Weelink, S.A., van Doesburg, W., Saia, F.T., Rijpstra, W.I., Roling, W.F., Smidt, H. &
Stams, A.J. (2009) A strictly anaerobic betaproteobacterium Georgfuchsia toluolica
gen. nov., sp. nov. degrades aromatic compounds with Fe(III), Mn(IV) or nitrate as
an electron acceptor. FEMS Microbiol. Lett. 70: 575−585.
Weiner, J.M. & Lovley, D.R. (1998) Anaerobic benzene degradation in petroleum-
contaminated aquifer sediments after inoculation with a benzene-oxidizing
enrichment. Appl. Environ. Microbiol. 64: 775−778.
Werner, I. (2009) Untersuchungen zum Stoffwechsel des anaeroben Alkanabbaus.
Dissertation, Universität Bremen.
Whyte, L.G., Smits, T.H., Labbe, D., Witholt, B., Greer, C.W. & van Beilen, J.B. (2002)
Gene cloning and characterization of multiple alkane hydroxylase systems in
Rhodococcus strains Q15 and NRRL B-16531. Appl. Environ. Microbiol. 68: 5933−
5942.
Widdel, F., Boetius, A. & Rabus, R. (2006) Anaerobic biodegradation of hydrocarbons
including methane. In The prokaryotes; 3rd edition. Dworkin, M., Falkow, S.,
Rosenberg, E., Schleifer, K.-H. & Stackebrandt, E. (eds). Berlin, Heidelberg:
Springer Verlag, pp. 1028−1049.
Widdel, F., Knittel, K. & Galushko, A. (2010) Anaerobic hydrocarbon-degrading
microorganisms: an overview. In Handbook of hydrocarbon and lipid microbiology.
Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp. 1998−2021.
Wilkes, H. & Schwarzbauer, J. (2010) Hydrocarbons: an introduction to structure,
physico-chemical properties and natural occurence. In Handbook of hydrocarbon
and lipid microbiology. Timmis, K.N. (ed). Berlin, Heidelberg: Springer Verlag, pp.
3−48.
![Page 147: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/147.jpg)
Referenzen
141
Wilkes, H., Rabus, R., Fischer, T., Armstroff, A., Behrends, A. & Widdel, F. (2002)
Anaerobic degradation of n-hexane in a denitrifying bacterium: further degradation
of the initial intermediate (1-methylpentyl)succinate via C-skeleton rearrangement.
Arch. Microbiol. 177: 235−243.
Wilkes, H., Kühner, S., Bolm, C., Fischer, T., Classen, A., Widdel, F. & Rabus, R. (2003)
Formation of n-alkane and cycloalkane-derived organic acids during anaerobic
growth of a denitrifying bacterium with crude oil. Org. Geochem. 34: 1313−1323.
Winderl, C., Schaefer, S. & Lueders, T. (2007) Detection of anaerobic toluene and
hydrocarbon degraders in contaminated aquifers using benzylsuccinate synthase
(bssA) genes as a functional marker. Environ. Microbiol. 9: 1035−1046.
Wöhlbrand, L. (2008) Proteomische und genetische Untersuchungen zum Aromaten-
Abbau in "Aromatoleum aromaticum" Stam EbN1. Dissertation, Universität
Bremen.
Yu, L., Blaser, M., Andrei, P.I., Pierik, A.J. & Selmer, T. (2006) 4-Hydroxyphenylacetate
decarboxylases: properties of a novel subclass of glycyl radical enzyme systems.
Biochemistry 45: 9584−9592.
Yuste, L., Canosa, I. & Rojo, F. (1998) Carbon-source-dependent expression of the
PalkB promoter from the Pseudomonas oleovorans alkane degradation pathway. J.
Bacteriol. 180: 5218−5226.
Zedelius, J., Rabus, R., Grundmann, O., Werner, I., Brodkorb, D., Schreiber, F. et al.
(2011) Alkane degradation under anoxic conditions by a nitrate-reducing bacterium
with possible involvement of the electron acceptor in substrate activation. Environ.
Microbiol. Rep. 3: 125−135.
Zengler, K., Heider, J., Rossello-Mora, R. & Widdel, F. (1999a) Phototrophic utilization of
toluene under anoxic conditions by a new strain of Blastochloris sulfoviridis. Arch.
Microbiol. 172: 204−212.
Zengler, K., Richnow, H.H., Rossello-Mora, R., Michaelis, W. & Widdel, F. (1999b)
Methane formation from long-chain alkanes by anaerobic microorganisms. Nature
401: 266−269.
![Page 148: Die Gene der (1-Methylalkyl)succinat-Synthase im anaeroben ...elib.suub.uni-bremen.de/edocs/00102600-1.pdf · insufficient for X-ray analysis. ... Zu den ungesättigten Kohlenwasserstoffen](https://reader030.vdocuments.pub/reader030/viewer/2022040700/5d4f1e5488c993790d8bab93/html5/thumbnails/148.jpg)
142
Danksagung
Ich danke Prof. Friedrich Widdel dafür, dass ich meine Promotion in der Abteilung
Mikrobiologie anfertigen konnte. Außerdem bedanke ich mich für die Erstellung des
Erstgutachtens meiner Dissertation.
PD Dr. Jens Harder danke ich für die Übernahme des Zweitgutachtens und für die
Betreuung in den letzten Wochen meiner Promotion.
Ich danke Dr. Olav Grundmann für die Betreuung meiner Doktorarbeit, die zahlreichen
Diskussionen, die hilfreichen Tips für die Laborarbeit, die Einführung in die ÄKTA und
die freundschaftliche Zusammenarbeit.
Ein großer Dank geht an Prof. Ulrich Fischer für die Teilnahme an meinem
Prüfungskomitee sowie an meinem letzten Thesiskomitee.
Dr. Bernhard Fuchs danke ich für die Teilnahme an vorangegangenen Thesiskomitees.
Herzlich danken möchte ich auch Ingrid Kunze für die Unterstützung bei der Laborarbeit.
Vielen lieben Dank an Frauke, Christina, Christin, Anne, Anna, Ines, Julia, Sandra,
Verena und Ulli für all die schönen und lustigen Mittags-, Kaffee- und Kekspausen,
Mädelsabende und sonstigen Freizeitaktivitäten.
Ganz besonders danken möchte ich Frauke, Anne und Thomas für die Durchsicht
meiner Arbeit und die Hilfe bei der Formatierung.
Auch bei meinen langjährigen Freundinnen Sarah, Cora, Kerstin, Marie-Jo und Sonja
möchte ich mich dafür bedanken, dass sie stets ein offenes Ohr für die Leiden einer
Doktorandin hatten.
Ein ganz großes Dankeschön geht an meine Familie, die mich immer unterstützt hat und
an Mike, der meine Schlechte-Laune-Phasen immer ertragen hat bzw. musste ;-)