![Page 1: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/1.jpg)
Metagenômica
![Page 2: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/2.jpg)
Metagenômica
• DNA é amostrado de um nicho ecológico – solo – composteira – pele, estômago, gengiva – O mar
• O DNA amostrado provêm de vários
organismos, tudo misturado
![Page 3: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/3.jpg)
Por que metagenômica?
• Procariotos: “a maioria invisível” Tanto carbono quanto plantas [Whitman et al,
1998]
Estão por todo lugar Da atmosfera superior ao subsolo
• Enorme diversidade genética organismos proteínas
![Page 4: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/4.jpg)
Como podemos estudar os genomas dessa maioria invisível?
• Organismo isolado: cultura em laboratório • Menos do que 1% dos procariotos são
cultiváveis • Metagenômica: não há necessidade de cultura
![Page 5: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/5.jpg)
JC Setubal 5
comunidade
populações
Um nicho ecológico
![Page 6: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/6.jpg)
JC Setubal 6
DNA A comunidade
![Page 7: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/7.jpg)
JC Setubal 7
DNA
A comunidade
SEQ BIOINFO
![Page 8: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/8.jpg)
Questões básicas
• Quem está na amostra? • Que funções estão presentes? • Avaliação quantitativa (abundância) • Metagenômica comparativa • Metadados são essenciais
![Page 9: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/9.jpg)
Bioinformática é complexa
• Volume de dados: milhões de reads • Baixa cobertura de genomas individuais • erros de sequenciamento • → baixa qualidade de dados • → algoritmos precisam ser mais robustos • Montagem • Binning; classificação filogenética • Metodologia padronizada para comparações
![Page 10: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/10.jpg)
Classificação com base na frequência
de palavras de k bases k = 4: AAAA, AAAC, AAAG, AAAT, CAAA, etc…
Dada uma janela de x kb, podemos contar as ocorrencias de cada uma dessas palavras dentro da janela
Exemplo: AGATTAGCGACTATTATAGCCTAGATCGATCATTACC AGAT ocorre 2 vezes ATTA ocorre 3 vezes etc
![Page 11: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/11.jpg)
Matriz de frequências
janela AAAA AAAC AAAG AAAT ACAA ACAC ACAG ACAT
1 15 2
2 16 3
3 14 0
4 13 2
5 15 4
6 12 0
7 18 1
8 17 3
9 16 1
![Page 12: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/12.jpg)
Zhou, Olman, Xu, BMC Bioinformatics, 2009
Genome “barcodes”
![Page 13: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/13.jpg)
Não funciona bem com fragmentos curtos
Fragment size, bp
Accuracy, %
Zhou et al, 2009 simulated data
![Page 14: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/14.jpg)
Red Sea Project
• American University in Cairo
14
![Page 15: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/15.jpg)
2,200 m
Africa Saudi Arabia
Brine pool Atlantis IIC
Discovery
Kebrit
15
![Page 16: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/16.jpg)
The brine pools are extreme environments
• High salinity (10X more than surface water)
• Enriched with heavy metals: iron, manganese, copper, zinc (1000X more concentrated than normal water)
• High temperatures (70 °C) • High pressure • No light
16
![Page 17: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/17.jpg)
2,200 m
Africa Saudi Arabia
Water column
1,500m
700m
200m
50m
ATIIC brine pool 17
![Page 18: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/18.jpg)
18
![Page 19: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/19.jpg)
Bioinformatics
• BLASTX of reads against a COG database • Cluster of Orthologous Groups
19
Example of a COG: monoamine oxidase
http://www.ncbi.nlm.nih.gov/books/NBK21090/
![Page 20: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/20.jpg)
COGs diferencialmente representados
• Quais genes (representados pelos COGs ao qual foram associados) são mais ou menos abundantes em diferentes amostras
![Page 21: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/21.jpg)
41 COGs with higher abundance in photic zones
34 COGs with higher abundance in aphotic zones
21
![Page 22: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/22.jpg)
Photic COGs
• Photosyntesis • biosynthesis of light-harvesting pigments • assimilation of CO2 by photosynthetic bacteria • Light-induced DNA repair • oxidative stress response • N2 fixation • phosphate metabolism
![Page 23: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/23.jpg)
Aphotic COGs
• Catabolism of proteins and aminoacids • Methane oxidation • sulfate assimilation and metabolism • selenocysteine metabolism • terpenoid biosynthesis
![Page 24: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/24.jpg)
41 COGs with higher abundance in photic zones
34 COGs with higher abundance in aphotic zones
24
![Page 25: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/25.jpg)
PAR values (Photosynthetically active radiation )
25
![Page 26: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/26.jpg)
http://what-when-how.com/marine-mammals/south-american-aquatic-mammals
http://mynasadata.larc.nasa.gov/glossary.php?&word=upwelling
upwelling
iquique
26
![Page 27: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/27.jpg)
Compostagem no Zoo-SP
• Escala “industrial” • Entram todos os resíduos orgânicos
disponíveis – Galhos e folhas da mata atlântica – Resíduos dos animais – Carcassas de animais mortos
• Resultado: adubo para a fazenda do zoo
![Page 28: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/28.jpg)
http://www.zoologico.com.br/admin/wp-content/files_mf/ciencianozoo_112011.pdf
![Page 29: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/29.jpg)
Objetivo do projeto
• Estudar a diversidade microbiana da compostagem
• Estudar a diversidade proteica da compostagem (biotecnologia)
• Resultados preliminares: duas amostras de duas diferentes compostagens
![Page 30: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/30.jpg)
0 2 4 6 8
10 12 14 16 18
Abu
ndan
ce %
0 10 20 30 40 50 60 70 80
Abu
ndan
ce %
Figure 3
ZC2
ZC1
![Page 31: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/31.jpg)
![Page 32: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:](https://reader033.vdocuments.pub/reader033/viewer/2022043010/5fa22f645e5b2446f214a785/html5/thumbnails/32.jpg)