Transcript
Page 1: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Metagenômica

Page 2: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Metagenômica

• DNA é amostrado de um nicho ecológico – solo – composteira – pele, estômago, gengiva – O mar

• O DNA amostrado provêm de vários

organismos, tudo misturado

Page 3: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Por que metagenômica?

• Procariotos: “a maioria invisível” Tanto carbono quanto plantas [Whitman et al,

1998]

Estão por todo lugar Da atmosfera superior ao subsolo

• Enorme diversidade genética organismos proteínas

Page 4: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Como podemos estudar os genomas dessa maioria invisível?

• Organismo isolado: cultura em laboratório • Menos do que 1% dos procariotos são

cultiváveis • Metagenômica: não há necessidade de cultura

Page 5: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

JC Setubal 5

comunidade

populações

Um nicho ecológico

Page 6: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

JC Setubal 6

DNA A comunidade

Page 7: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

JC Setubal 7

DNA

A comunidade

SEQ BIOINFO

Page 8: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Questões básicas

• Quem está na amostra? • Que funções estão presentes? • Avaliação quantitativa (abundância) • Metagenômica comparativa • Metadados são essenciais

Page 9: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Bioinformática é complexa

• Volume de dados: milhões de reads • Baixa cobertura de genomas individuais • erros de sequenciamento • → baixa qualidade de dados • → algoritmos precisam ser mais robustos • Montagem • Binning; classificação filogenética • Metodologia padronizada para comparações

Page 10: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Classificação com base na frequência

de palavras de k bases k = 4: AAAA, AAAC, AAAG, AAAT, CAAA, etc…

Dada uma janela de x kb, podemos contar as ocorrencias de cada uma dessas palavras dentro da janela

Exemplo: AGATTAGCGACTATTATAGCCTAGATCGATCATTACC AGAT ocorre 2 vezes ATTA ocorre 3 vezes etc

Page 11: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Matriz de frequências

janela AAAA AAAC AAAG AAAT ACAA ACAC ACAG ACAT

1 15 2

2 16 3

3 14 0

4 13 2

5 15 4

6 12 0

7 18 1

8 17 3

9 16 1

Page 12: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Zhou, Olman, Xu, BMC Bioinformatics, 2009

Genome “barcodes”

Page 13: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Não funciona bem com fragmentos curtos

Fragment size, bp

Accuracy, %

Zhou et al, 2009 simulated data

Page 14: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Red Sea Project

• American University in Cairo

14

Page 15: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

2,200 m

Africa Saudi Arabia

Brine pool Atlantis IIC

Discovery

Kebrit

15

Page 16: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

The brine pools are extreme environments

• High salinity (10X more than surface water)

• Enriched with heavy metals: iron, manganese, copper, zinc (1000X more concentrated than normal water)

• High temperatures (70 °C) • High pressure • No light

16

Page 17: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

2,200 m

Africa Saudi Arabia

Water column

1,500m

700m

200m

50m

ATIIC brine pool 17

Page 18: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

18

Page 19: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Bioinformatics

• BLASTX of reads against a COG database • Cluster of Orthologous Groups

19

Example of a COG: monoamine oxidase

http://www.ncbi.nlm.nih.gov/books/NBK21090/

Page 20: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

COGs diferencialmente representados

• Quais genes (representados pelos COGs ao qual foram associados) são mais ou menos abundantes em diferentes amostras

Page 21: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

41 COGs with higher abundance in photic zones

34 COGs with higher abundance in aphotic zones

21

Page 22: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Photic COGs

• Photosyntesis • biosynthesis of light-harvesting pigments • assimilation of CO2 by photosynthetic bacteria • Light-induced DNA repair • oxidative stress response • N2 fixation • phosphate metabolism

Page 23: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Aphotic COGs

• Catabolism of proteins and aminoacids • Methane oxidation • sulfate assimilation and metabolism • selenocysteine metabolism • terpenoid biosynthesis

Page 24: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

41 COGs with higher abundance in photic zones

34 COGs with higher abundance in aphotic zones

24

Page 25: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

PAR values (Photosynthetically active radiation )

25

Page 26: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

http://what-when-how.com/marine-mammals/south-american-aquatic-mammals

http://mynasadata.larc.nasa.gov/glossary.php?&word=upwelling

upwelling

iquique

26

Page 27: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Compostagem no Zoo-SP

• Escala “industrial” • Entram todos os resíduos orgânicos

disponíveis – Galhos e folhas da mata atlântica – Resíduos dos animais – Carcassas de animais mortos

• Resultado: adubo para a fazenda do zoo

Page 28: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

http://www.zoologico.com.br/admin/wp-content/files_mf/ciencianozoo_112011.pdf

Page 29: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Objetivo do projeto

• Estudar a diversidade microbiana da compostagem

• Estudar a diversidade proteica da compostagem (biotecnologia)

• Resultados preliminares: duas amostras de duas diferentes compostagens

Page 30: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

0 2 4 6 8

10 12 14 16 18

Abu

ndan

ce %

0 10 20 30 40 50 60 70 80

Abu

ndan

ce %

Figure 3

ZC2

ZC1

Page 31: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:
Page 32: Metagenômica - IQ USP · Atlantis IIC Discovery Kebrit ; 15 ; The brine pools are ; extreme environments • High salinity (10X more than surface water) • Enriched with heavy metals:

Top Related