Nitric oxide induces hypoxia-inducible factor 1 activation that is
dependent on MAP kinase and phosphatidylinositol 3-kinase signaling
Kenji Kasuno 1, 3, Satoshi Takabuchi 2, 4, Kazuhiko Fukuda 4, Shinae Kizaka-
Kondoh 5, Junji Yodoi 1, 3, Takehiko Adachi 2, Gregg L. Semenza 6, and Kiichi
Hirota 2, 4, 7
From 1Human Stress Signal Research Center, National Institute of Advanced
Industrial Science and Technology (AIST), IKEDA, Osaka, Japan 563-0053,
2Department of Anesthesia, Tazuke Kofukai Medical Research Institute Kitano
Hospital, 2-4-20, Ohgimachi, Kita-ku, Osaka 530-8480, 3Institute for Virus
Research, Kyoto University, 4Department of Anesthesia, Kyoto University
Hospital, Kyoto University, 5Department of Molecular Oncology, Kyoto
University Graduate School of Medicine, Sakyo-ku, Kyoto 606-850, Japan and
6McKusick-Nathans Institute of Genetic Medicine, The Johns Hopkins University
School of Medicine, Baltimore, Maryland 21287, USA
7 To whom correspondence should be addressed: Department of Anesthesia,
Tazuke Kofukai Medical Research Institute Kitano Hospital, 2-4-20,
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-0-
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on November 4, 2003 as Manuscript M308197200 by guest on A
pril 11, 2018http://w
ww
.jbc.org/D
ownloaded from
Ohgimachi, Kita-ku, Osaka 530-8480; Tel:+81-6-6312-8831 Fax:+81-6-
6361-8867; e-mail:[email protected]
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-1-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Running title
Nitric oxide up-regulates HIF-1α synthesis
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-2-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Summary
Hypoxia inducible factor-1 (HIF-1) is a master regulator of cellular adaptive
responses to hypoxia. Levels of the HIF-1α subunit increase under hypoxic
conditions. Exposure of cells to certain nitric oxide (NO) donors also induces
HIF-1α expression under non-hypoxic conditions. We demonstrate that exposure
of cells to the NO donor NOC18 or GSNO induces HIF-1α expression and
transcriptional activity. In contrast to hypoxia, NOC18 did not inhibit HIF-1α
hydroxylation, ubiquitination, and degradation, indicating an effect on HIF-1α
protein synthesis that was confirmed by pulse labeling studies. NOC18 stimulation
of HIF-1α protein and HIF-1-dependent gene expression was blocked by treating
cells with an inhibitor of the phosphatidylinositol 3-kinase or MAP kinase-
signaling pathway. These inhibitors also blocked NOC18-induced
phosphorylation of the translational regulatory proteins 4E-BP1, p70 S6 kinase,
and eIF-4E, thus providing a mechanism for the modulation of HIF-1α protein
synthesis. In addition, expression of a dominant-negative form of Ras
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-3-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
significantly suppressed HIF-1 activation by NOC18. We conclude that the NO
donor NOC18 induces HIF-1α synthesis under conditions of NO formation during
normoxia and that hydroxylation of HIF-1α is not regulated by NOC18.
Introduction
Hypoxia induces a series of adaptive physiological responses (1). At the cellular
level, the adaptation involves a switch of energy metabolism from oxidative
phosphorylation to anaerobic glycolysis, increased glucose uptake, and the
expression of stress proteins related to cell survival or death (2). At the molecular
level, the adaptation involves changes in mRNA transcription and mRNA stability
(2,3). One of the most important transcription factors that activates the expression
of oxygen-regulated genes including vascular endothelial growth factor (VEGF)
and inducible nitric oxide synthase (iNOS) is hypoxia-inducible factor 1 (HIF-1)
(4-6). VEGF is a potent angiogenic and vascular permeability factor that plays
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-4-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
critical roles in both physiological and pathological angiogenesis (7). Recently, the
expression of VEGF in response to heregulin-induced activation of the HER2/neu
receptor tyrosine kinase in breast cancer cells (8), IGF-1 stimulation of colon
cancer cells (9), and insulin treatment of retinal pigment epithelial cells (10) was
shown to be mediated by HIF-1 via the phosphatidylinositol 3-kinase (PI3K) and
MAP kinase (MAPK) pathways. Thus, HIF-1 regulates both hypoxia- and growth
factor-induced VEGF expression.
HIF-1 is a heterodimer composed of a constitutively expressed β subunit
(HIF-1β) and an inducibly expressed α subunit (HIF-1α) (4). The regulation of
HIF-1 activity occurs at multiple levels in vivo (11). Among these, the
mechanisms regulating HIF-1α protein expression and transcriptional activity
have been most extensively analyzed. The von Hippel-Lindau tumor-suppressor
protein (VHL) has been identified as the HIF-1α-binding component of a
ubiquitin-protein ligase that targets HIF-1α for proteasomal degradation in non-
hypoxic cells (12-15). Under hypoxic conditions, the hydroxylation of specific
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-5-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
proline and asparagine residues in HIF-1α is inhibited due to substrate (O2)
limitation, resulting in HIF-1α protein stabilization and transcriptional activation
(14,16,17). The iron chelator deferrioxamine (DFX) inhibits the prolyl and
asparaginyl hydroxylases, which contain Fe2+ at their catalytic sites, causing HIF-
1α stabilization and transactivation under normoxic conditions (12,13).
Signaling via the HER2/neu and IGF-1 receptor tyrosine kinases induces
HIF-1 expression by an independent mechanism. HER2/neu activation increases
the rate of HIF-1α protein synthesis via PI3K and the downstream serine-
threonine kinases AKT (protein kinase B) and FRAP (FKBP/rapamycin-
associated protein; also known as mTOR [mammalian target of rapamycin]) (8).
IGF-1-induced HIF-1α synthesis is dependent upon both the PI3K and MAPK
pathways (10). FRAP/mTOR phosphorylates and activates the translational
regulatory proteins eIF-4E-binding protein 1 (4E-BP1) and p70 S6 kinase
(p70S6K). Phosphorylation of 4E-BP1 disrupts its inhibitory interaction with eukaryotic
initiation factor 4E (eIF-4E), whereas activated p70S6K phosphorylates the 40S
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-6-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
ribosomal protein S6. The effect of HER2/neu signaling on translation of HIF-1α
protein is dependent upon the presence of the 5’-untranslated region of HIF-1α
mRNA (8).
Nitric oxide (NO) is known to mediate many physiological and pathological
functions including vascular dilatation, cytotoxicity mediated by activated
macrophages, and cGMP formation following glutamate receptor activation in
neurons (18). NO has also been implicated in pathological conditions such as
destruction of tumor cells by macrophages, rheumatoid arthritis, and focal brain
ischemia. There are several reports demonstrating that exposure of cells to certain
NO donors or gaseous NO modulates HIF-1 activity (19-23). S-
nitrosoglutathione (GSNO) or NOC18 induces HIF-1 activity under non-hypoxic
conditions (22). In contrast, sodium nitroprusside (SNP) inhibits hypoxia-induced
HIF-1 activation (19-21). However, the molecular mechanisms that regulate
HIF-1α expression and transactivation in response to NO donors are poorly
defined. In this study, we found that NOC18 induces HIF-1 activity by increasing
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-7-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
HIF-1α protein synthesis via PI3K- and MAPK-dependent pathways.
Experimental Procedures
Cell culture and reagents
Hep3B cells, HEK293 cells, and HCT116 cells were maintained in MEM with Earle’s
salts, DMEM, and McCoy’s 5A medium, respectively supplemented with 10% FBS and 100
units/ml penicillin, and 100 µg/ml streptomycin. Human umbilical vein endothelial cells
(HUVECs) were obtained from Kurabo (Osaka, Japan) and cultured with HuMedia-EG2
(Kurabo). DFX, and the thiol-dependent NO releaser GSNO, N-acetyl cysteine were obtained
from Sigma. The spontaneous NO releaser NOR4 (half-life, 60 min), NOR5 (half-life, 20 h),
NOC12 (half-life, 100 min), and NOC18 (half-life, 21 h) were obtained from Dojindo
(Kumamoto, Japan). Cycloheximide (CHX), SNP, wortmannin, genistein, LY294002, PD98059,
and rapamycin were obtained from Calbiochem (San Diego, CA).
Plasmid constructs
Expression vectors pGAL4/HIF-1α(531-826), pGAL4/HIF-1α(531-575),
pGAL4/HIF-1α(726-826) and pGAL4/HIF-1α(786-826) were described
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-8-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
previously (24). Plasmid p2.1 contains a 68-bp hypoxia response element (HRE)
from the ENO1 gene inserted upstream of an SV40 promoter in the luciferase
reporter plasmid pGL2-Promoter (Promega) and p2.4 contains a mutation in the
HRE (24,25). Plasmid pVEGF-KpnI contains nucleotides –2274 to +379 of the
human VEGF gene inserted into the luciferase reporter pGL2-Basic (Promega)
(26). The reporter GAL4E1bLuc contains 5 copies of a GAL4 binding site
upstream of a TATA sequence and firefly luciferase coding sequences (24). A
FLAG-tagged dominant negative form of HIF-1α pCMV-3XFLAG-HIF-
1αNBAB was generated based on pCEP4-HIF-1αNBAB (27). The expression plasmid
pCH-NLS-HIF1α(548-603)-LacZ was described elsewhere (28). Plasmids
encoding p85, a dominant-negative form of the PI3K p85 regulatory subunit, and a
kinase dead form of Akt were gifts from Dr. Wataru Ogawa (Kobe University,
Kobe, Japan) (29,30). Plasmid encoding a dominant negative form of Ras (31) was
a generous gift from Dr. Kaikobad Irani (Johns Hopkins University, Baltimore,
MD).
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-9-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Hypoxic treatment
Tissue culture dishes were transferred to a modular incubator chamber
(Billups-Rothenberg, Del Mar, CA) which was flushed with 1% O2-5% CO2-
O2%-94%N2, sealed, and placed at 37 ÚC.
Immunoblot Assays
Whole cell lysates were prepared by incubating cells for 30 min in cold
radioimmune precipitation assay buffer containing 2 mM dithiothreitol, 1 mM
NaVO3, and Complete protease inhibitor (Roche Applied Science, Tokyo Japan)
(32). Samples were centrifuged at 10,000 x g to pellet cell debris. For HIF-1α
and HIF-1β, 100-µg aliquots were fractionated by 7.5% SDS-PAGE and
subjected to immunoblot assay using mouse monoclonal antibody against HIF-1α
(BD Biosciences, San Jose, CA) or HIF-1β (H1β234; Novus Biologicals,
Littleton, CO) at 1:1000 dilution. Signal was developed using ECL reagent
(Amersham Biosciences, Piscataway, NJ). For phosphorylated protein, HEK293
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-10-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
cells or HCT116 cells were serum-starved (0.1% FBS for 24 h), treated with
NOC18, and 50-µg aliquots were analyzed using specific antibodies (1:1000
dilution) (Cell Signaling Technology, Beverly, MA). Signal was developed by
using ECL reagents (Amersham Biosciences).
Inhibitor Treatments
PD98059, LY294002, genistein, or rapamycin was added 1 h before
exposure to NOC18 or 1% O2. CHX was added to the medium of HEK293 cells
that were treated with NOC18, GSNO, or DFX for 4 h, and whole cell extracts
were prepared at 15, 30, and 60 min.
RT-PCR
The protocol of RT-PCR is described elsewhere (33). Briefly, cells were
lysed, and RNA was isolated with TRIzol reagent (Invitrogen). 0.5 µg of total
RNA were subjected to first strand cDNA synthesis using SuperScript II RT kit
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-11-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
(Invitrogen) with random hexamers. cDNAs were amplified with TaqGold
polymerase in a thermal cycler with the following primer pairs: HIF1A,
GAAAGCGCAAGTCCTCAAA and CTATATGGTGATGATGTGGCACTA;
VEGF, CCATGAACTTTCTGCTGTCTT and ATCGCATCAGGGGCACACAG;
GLUT1, GGGCATGTGCTTCCAGTATGT and
ACGAGGAGCACCGTGAAGAT; 18S, ATCCTGCCAGTAGCATATGC and
ACCCGGGTTGGTTTTGATCTG. For each primer pair, PCR was optimized for
cycle number to obtain linearity between the amount of input RT product and
output PCR product. Thermocycling conditions were 30 s at 94°C, 60 s at 57°C,
and 30 s at 72°C for 25 (HIF1A), 27 (VEGF), or 14 (18S rRNA) cycles preceded
by 10 min at 94°C. PCR products were fractionated by 3% Nusieve agarose gel
electrophoresis, stained with ethidium bromide, and visualized with UV.
Metabolic labeling assay
The protocol is described elsewhere (8). Briefly, a total of HEK293 cells were plated in a
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-12-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
10-cm dish, and 24 h later the cells were serum starved for 20 h. The cells were pretreated with
500 µM NOC18 or 100 µM DFX for 30 min in methionine-free DMEM. [ 35 S]Met-Cys was
added to a final concentration of 0.3 mCi/ml, and the cells were pulse-labeled for 20 to 40 min
and then harvested. Whole-cell extracts were prepared and 1 mg of extract was precleared with
60 µl of protein A-Sepharose for 1h. Twenty microliters of anti-HIF-1 antibody H1 67 was
added to the supernatant and rotated overnight at 4°C. Forty microliters of protein A-Sepharose
was added, rotated for 2 h at 4°C, pelleted, and washed five times with 1 ml of RIPA buffer. The
samples were analysed by SDS-polyacrylamide gel electrophoresis. The gel was dried and
exposed to X-ray film.
Immunoprecipitation Assay
Cells were harvested in 200 µL of lysis buffer (Dulbecco’s PBS [pH 7.4], 0.1% Tween-
20, 1 mM sodium orthovanadate, and Complete protease inhibitor) and drawn through a 20G
needle 4 times. The lysate was incubated on ice for 1 h followed by centrifugation at 14,000 rpm
for 15 min. The cleared lysates were brought to a volume of 1 mL with lysis buffer followed by
a 2-h incubation with 20 µL of anti-HA (Roche) or anti-FLAG (Sigma) affinity matrix beads at
4 ÚC on a rotator. The beads were then washed 3 times with lysis buffer. Protein was eluted by
the addition of Laemmli sample buffer and analyzed by SDS-PAGE and immunoblot analysis
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-13-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
(16).
In Vitro HIF-1α-VHL Interaction Assay
Glutathione S-transferase (GST)-HIF-1α(429-608) fusion protein was
expressed in E. coli as described (16,33). Biotinylated methionine-labeled
proteins were generated in reticulocyte lysates using the TNT T7 coupled
transcription/translation system using Transcend Biotinylated tRNA (Promega).
25-µg aliquots of HEK293 cell lysate were preincubated with NO donor or DFX
for 30 min at 30 ÚC, 2.5 µg of GST-HIF-1α(429-608) was added and incubated
for 30 min at 30 ÚC. A 5-µl aliquot of in vitro-translated biotinylated VHL
protein was mixed with 4 µg of GST fusion protein in a final volume of 200 µL of
binding buffer (Dulbecco’s PBS [pH 7.4], 0.1% Tween-20) and incubated for 2 h
at 4 ÚC with rotation followed by addition of 10 µL of glutathione-Sepharose 4B
beads (Pharmacia) and incubation at 4 ÚC for 1 h. The beads were pelleted,
washed 3 times in binding buffer, pelleted, resuspended in Laemmli sample buffer,
and analyzed by SDS-PAGE. Proteins were transferred to PVDF membrane and
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-14-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
visualized using streptavidin-labeled horseradish peroxidase and ECL reagent
(Amersham Biosciences).
In Vitro Ubiquitination Assay
HEK293 cells were washed twice with cold hypotonic extraction buffer (20
mM Tris [pH 7.5], 5 mM KCl, 1.5 mM MgCl2, 1mM dithiothreitol), and lysed in a
Dounce homogenizer. The cell extract was centrifuged at 10,000 x g for 10 min at
4ÚC, and the supernatant was stored at 70ÚC. Ubiquitination assays were
performed as described previously (33). At 30ÚC in a volume of 40 µl containing
27 µl (50 µg) of cell extract, 4 µl of 10 x ATP-regenerating system (20 m M Tris
[pH 7.5], 10 mM ATP, 10 mM magnesium acetate, 300 mM creatine phosphate,
0.5 mg/ml creatine phosphokinase), 4 µl of 5 mg/ml ubiquitin (Sigma), 1 µl of 150
µM ubiquitin aldehyde (Sigma), and 2 µl of HA-HIF-1α that was in vitro
translated (TNT Quick Coupled Transcription/Translation System, Promega) in the
presence of [35S] methionine. HA-HIF-1α was recovered using anti-HA-
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-15-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
agarose beads, which were then mixed with SDS sample buffer and boiled for 5
min. The eluates were analyzed by SDS-PAGE and autoradiography.
Reporter Gene Assays
Reporter assays were performed in Hep3B cells and HEK293 cells (32,34). 5x104 cells
were plated per well on the day before transfection. In each transfection, indicated dose of test
plasmids, 200 ng of reporter gene plasmid, and 50 ng of the control plasmid pTK-RL (Promega),
containing a thymidine kinase promoter upstream of Renilla reniformis (sea pansy) luciferase
coding sequences, were pre-mixed with Fugene 6 transfection reagent (Roche). In each assay
the total amount of DNA was held constant by addition of empty vector. After treatment, the
cells were harvested and the luciferase activity was determined using the Dual-Luciferase
Reporter Assay System (Promega). The ratio of firefly to sea pansy luciferase activity was
determined. For each experiment, at least two independent transfections were performed in
triplicate.
X-gal staining
HEK293 cells were washed twice with PBS, fixed with 1% formaldehyde-0.2%
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-16-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
glutaraldehyde solution, washed twice with PBS, and then treated with an X-gal staining
solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mM MgCl2, and 0.04%
X-gal) at 37°C (28).
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-17-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Results
NO donors activate HIF-1 under non-hypoxic conditions
To study the effect of NO on HIF-1 activation, we tested several NO donors. NORs and
NOCs spontaneously release NO with different kinetics (see Experimental Procedures) whereas
GSNO and SNP require cellular thiol for NO release. HEK293 cells were exposed to the
compounds for 1-4 h at 20% O2, harvested, and subjected to immunoblot analysis using anti-
HIF-1α or anti-HIF-1β antibody (Fig. 1A). Neither NOR4 nor NOR5 induced
HIF-1α protein accumulation (lane 2-6). In contrast, exposure of cells to NOC18
or GSNO efficiently induced HIF-1α protein accumulation comparably to 100 µM
DFX (lane 6-8, 12,13). SNP did not induce HIF-1α accumulation (lane 10, 11).
Expression of HIF-1β was not affected by NO donors or DFX. NOCs induced
accumulation of HIF-1α with quite different kinetics as compared to GSNO.
NOC18-induced accumulation was detected as early as 30 min and lasted no less
than 8 h. The effect of GSNO peaked at 1 h (lane 8) and was lost by 4 h after
addition (lane 9).
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-18-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
NOC18 induced HIF-1α accumulation in a dose-dependent manner up to
500 µM (Fig. 1B). Induction by GSNO was saturated at a concentration of 100
µM. The accumulation of HIF-1α induced by NOC12, which releases NO by the
same mechanism as NOC18 but has a different NO-releasing time-constant, was
stronger than that induced by NOC18 at 30 min at a concentration of 250 µM (Fig.
1C, top panel). However, the induction of HIF-1α was dose-dependent such that
the effect of 40 µM NOC12 was weaker than 500 µM NOC18 (Fig.1C, bottom
panel).
We screened other cell lines for the effect of NO donors on HIF-1α protein
levels. 500 µM NOC18 induced HIF-1α accumulation in Hep3B human
hepatocellular carcinoma cells and HCT116 human colorectal carcinoma cells as
strongly as 100 µM DFX (data not shown). NOC18 also induced HIF-1α in
HUVECs (data not shown). These results indicate that the effect of NOC18 on
HIF-1α expression is observed in multiple transformed and primary cell types.
We investigated by RT-PCR whether NO donors induced gene expression
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-19-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
downstream of HIF-1. VEGF and GLUT1 mRNA expression was induced by
NOC18 treatment under non-hypoxic conditions (Fig. 2). In contrast, HIF-1α
mRNA expression was not affected by NOC18 treatment, indicating that the effect
of NOC18 occurs at the level of HIF-1α protein expression. HEK293 cells were
transfected with the reporter p2.1, containing a HIF-1-dependent HRE, or p2.4,
containing a mutated HRE. NOC18 induced HRE-dependent gene expression in a
dose-dependent manner comparably to DFX or 1% O2 (Fig. 3A, B). The mutated
reporter p2.4 was not activated by NOC18 (Fig, 3B) and expression of a dominant
negative form of HIF-1α reduced p2.1 reporter gene expression (Fig. 3C)
providing evidence that the gene activation was HRE- and HIF-1-dependent.
NOC18 also induced dose-dependent transcription of a reporter gene containing
the VEGF promoter encompassing nucleotides -2274 to +379 relative to the
transcription start site (Fig. 3D).
NOC18 does not prolong HIF-1α protein half-life
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-20-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
To determine whether NOC18 treatment affected HIF-1α protein half-life,
HEK293 cells were treated with NOC18 or DFX for 4 h to induce HIF-1α
expression, and then CHX was added to block ongoing protein synthesis. In the
presence of CHX, the half-life of HIF-1α was > 30 min in DFX-treated cells but
< 15 min in NOC18-treated cells (Fig. 4A). Similarly the half-life of GSNO-
induced HIF-1α is < 15 min in the presence of CHX (Fig. 4B). These results
indicate that HIF-1α expression in NOC18-treated cells is dependent upon
ongoing protein synthesis. Similar results were observed in Hep3B cells and
HUVECs (data not shown).
To analyze the rate of HIF-1α synthesis, serum-starved HEK293 cells were
pretreated with NOC18 or DFX for 30 min and then pulse-labeled with [35
S]Met-Cys for 20 or 40 min, followed by immunoprecipitation of HIF-1α (Fig.
4C). In contrast to control serum-starved cells (Fig. 4C, lane 1), 35S-labeled HIF-
1α was clearly increased in NOC18-treated cells (lanes 2 and 3), whereas, the
amount of labeled HIF-1α protein was not increased in cells treated with DFX
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-21-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
(lanes 4). Thus, both the cycloheximide addition and metabolic labeling
experiments provide evidence for increased synthesis of HIF-1α in response to
NOC18 treatment.
We also assayed the stability of a fusion protein, consisting of a nuclear
localization signal (NLS), ß-galactosidase (β-gal) sequences (encoded by the lac
Z gene), and HIF-1α residues 548603. The NLS-LacZ-HIF1α(548603)
expression vector was transfected into HEK293 cells and β-gal activity was
analyzed by X-gal staining after incubation of the cells in the presence of 500 µM
NOC18 or 100 µM DFX. There was essentially no X-gal staining in cells that were
transfected with empty vector, transfected with NLS-LacZ-HIF1α(548603)
without treatment, or transfected with NLS-LacZ-HIF-1α(548603) with NOC18
treatment (Fig. 4D). In contrast, significant X-gal staining was detected in NLS-
LacZ-HIF-1α(548603)-transfected cells that were treated with DFX, which
inhibits O2-dependent degradation mediated by the HIF-1α domain of the fusion
protein.
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-22-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
NOC18 does not affect the interaction between HIF-1α and VHL in vitro or in
vivo
Under hypoxic conditions, VHL-dependent ubiquitination of HIF-1α is
inhibited (12-14). To determine whether NOC18 treatment affects ubiquitination,
an in vitro assay was performed using lysates prepared from control and NOC18-
treated cells. As shown in Fig. 5A, there was no significant difference detected
between lysates from NOC18-treated or untreated cells with respect to their ability
to ubiquitinate HIF-1α.
Incubation of a GST-HIF-1α(429-608) fusion protein with lysate from
untreated cells resulted in prolyl hydroxylation of HIF-1α and interaction with
VHL (Fig. 5B. lane 2). Lysate from cells treated with DFX did not promote
interaction of GST-HIF-1α(429-608) with VHL (lane 6). In contrast, lysate from
cells treated with NOC18 promoted the interaction (lane 3), similar to control
lysates, again providing evidence that NOC18 treatment does not induce HIF-1α
expression by inhibiting VHL-mediated ubiquitination. Similar results were
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-23-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
obtained from experiments using rabbit reticulocyte lysates (which also have HIF-
1α prolyl hydroxylase activity) instead of HEK293 cell lysates (data not shown).
Remarkably, lysate from GSNO-treated cells partially inhibited the interaction of
GST-HIF-1α(429-608) with VHL (lane 4), whereas lysate from SNP-treated
cells dramatically increased the interaction (lane 5).
HEK293 cells were co-transfected with expression vectors encoding HA-
tagged VHL and FLAG-tagged HIF-1α. Aliquots of whole cell lysates were
analyzed for expression of the proteins directly or following immunoprecipitation
of HA-VHL or FLAG-HIF-1α. HIF-1α was present in anti-HA
immunoprecipitates from cells co-expressing HA-VHL and FLAG-HIF-1α (Fig.
5C, lane 3). Exposure of cells to NOC18 did not alter the interaction of HA-VHL
and FLAG-HIF-1α (Fig. 5C, lane 4 and 5), consistent with the inability of
NOC18 to inhibit VHL and HIF-1α interaction in vitro. In contrast, DFX
treatment inhibited the interaction (lane 6). FIH-1 is the asparagines hydroxylase
that negatively regulates HIF-1α transactivation domain function under non-
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-24-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
hypoxic conditions (16, 17). The interaction between HA-FIH-1 and FLAG-
HIF-1α was not affected by either NOC18 or DFX (Fig. 5D). Taken together,
results presented in Fig. 5 indicate that the molecular mechanism of NOC18 action
is distinct from the inhibition of hydroxylase activity that occurs in cells exposed to
hypoxia or DFX.
Impact of NO scavenger, guanyl cyclase inhibitor, and antioxidant on NOC18-
induced HIF-1α accumulation
To examine signal transduction pathways mediating effects of NO donors on
HIF-1α protein induction, the NO scavenger carboxyl-PTIO was utilized (35).
Carboxyl-PTIO significantly suppressed HIF-1α accumulation induced by
NOC18 but not by DFX (Fig. 6A). Carboxyl-PTIO by itself did not have any
effects. Next we examined the impact of guanylyl cyclase activity on HIF-1α
accumulation. NO stimulates the activity of guanylyl cyclase, which catalyzes the
production of cGMP, an important second messenger for signal transduction. In
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-25-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
HEK293 cells, the specific guanyl cyclase inhibitor ODQ did not affect NOC18-
induced HIF-1α accumulation (Fig. 6B), providing the evidence that the guanylyl
cyclase-cGMP pathway does not contribute to HIF-1α accumulation induced by
NOC18.
NO is a radical and equimolar amounts of O2- and NO form peroxynitrite
(ONOO-), which decomposes at physiological pH to generate oxidant with similar
reactivity to the hydroxyl radical. To examine whether intracellular redox state
modulates NOC18-induced HIF-1α accumulation, HEK293 cells were treated
with NOC18 in the presence of 50 mM N-acetyl cysteine (NAC) (Fig. 6C). NAC
treatment did not affect HIF-1α levels, suggesting that thiol-mediated redox status
does not play a critical role in NOC18-induced HIF-1α expression. Transient
overexpression of the intracellular redox regulator thioredoxin also did not affect
induction of HIF-1α expression by NOC18 (data not shown).
HIF-1α-mediated transactivation in response to NOC18 treatment
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-26-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
We next investigated the impact of NOC18 on HIF-1α transcriptional
activity. There are two independent transactivation domains (TADs) present in
HIF-1α which are designated as the amino-terminal (amino acids 531-575) and
carboxyl-terminal (amino acids 786-826) TADs (TAD-N and TAD-C,
respectively) (24). Steady-state levels of proteins consisting of the GAL4 DNA-
binding domain fused to HIF-1α TADs [GAL4-HIF-1α(531-575), GAL4-HIF-
1α(531-826), and GAL4-HIF-1α(786-826)] are similar under hypoxic and non-
hypoxic conditions (24). These GAL4-HIF-1α fusion constructs can thus be used
to examine the transcriptional activity of HIF-1α independent of its protein
expression (24,32). Transactivation mediated by GAL4-HIF-1α(531-826), which
contains both TAD-N and TAD-C, or GAL4-HIF-1α(531-575), which contains
only TAD-N, is increased in cells exposed to hypoxia or DFX (24). In contrast,
GAL4-HIF-1α(786-826), which contains only TAD-C, is constitutively active in
untreated cells. NOC18 treatment increased transactivation mediated by GAL4-
HIF-1α(531-826) or GAL4-HIF-1α(531-575) in a dose-dependent manner
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-27-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
whereas transactivation mediated by GAL4-HIF-1α(786-826) was not increased
by exposure of cells to NOC18 or DFX (Fig. 7). These results demonstrate that
NOC18 not only promotes accumulation of HIF-1α but also enhances HIF-1α
transcriptional activity.
Effect of kinase inhibitors on NOC18-induced HIF-1 activation
HEK293 cells were pretreated with LY294002, genistein, PD98059 or rapamycin, which
are selective pharmacologic inhibitors of PI3K, tyrosine kinases, MEK, and FRAP/mTOR kinase
activity, respectively. All the agents inhibited the induction of HIF-1α protein expression in
NOC18-treated cells (Fig. 8A). The combination of LY294002, PD98059 and
rapamycin markedly inhibited NOC18-induced HIF-1α expression (Fig. 8B). In
contrast to their effects on HIF-1α protein expression induced by NOC18
treatment, LY294002 or PD98059 had little inhibitory effect on the expression of
HIF-1α in DFX-treated HEK293 cells (Fig. 8A; lane 9-14).
LY294002 and rapamycin inhibited expression of the HIF-1-dependent
reporter gene p2.1 induced by NOC18 but not by DFX, whereas genistein and
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-28-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
PD98059 inhibited both NOC18- and DFX-induced reporter gene expression
(Fig. 8C, upper panel). Interestingly, the stimulation of HIF-1α transactivation
domain function by NOC18 was also blocked by kinase inhibitors, whereas only
genistein blocked DFX-induced transactivation (Fig. 8C, lower panel). These
results provide further evidence that NOC18 and DFX induce HIF-1 by distinct
molecular mechanisms. Moreover, NOC18-induced HRE-dependent gene
expression was suppressed by a dominant negative form of PI3K p85 subunit,
AKT, or Ras, indicating critical roles of these signaling proteins in transducing the
effects of NOC18 to HIF-1 (Fig. 8D).
NOC18-induced activation of MAPK, PI3K, and translational regulators
HIF-1 activity induced by the stimulation of receptor tyrosine kinases or G protein-
coupled receptors requires MAPK and PI3K signaling (10,36). To determine whether the MAPK
and PI3K pathways were activated in NOC-18-treated cells, the phosphorylation of
p42ERK2/p44ERK1 and AKT were analyzed in HEK293 cells and HCT116 cells. Increased
phosphorylation of p42ERK2/p44ERK1 (Fig. 9A) and AKT (Fig. 9B) was induced by NOC18
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-29-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
treatment in both cell types.
The signal transduction pathway involving PI3K, AKT, and mTOR has been shown to
regulate protein translation via phosphorylation of p70S6K, the S6 ribosomal protein, and 4E-
BP1. In both HCT116 cells (Fig. 10) and HEK293 cells (data not shown), the phosphorylation
of p70S6K , S6, and 4E-BP1 was induced by NOC18 stimulation in a dose- and time-
dependent manner. The mRNA cap-binding protein eIF-4E, was also phosphorylated by
NOC18 treatment of HCT116 cells (Fig. 10). This result is consistent with studies indicating that
ERK activates the MAPK signal integrating kinases, MNK1 and MNK2, which in turn
phosphorylate eIF-4E (37,38).
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-30-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Discussion
The studies reported above demonstrate that treatment of several different
cell types with the NO donor NOC18 induces HIF-1α protein expression and
HIF-1 transcriptional activation resulting in VEGF and GLUT1 mRNA
expression. NOC18 treatment did not increase the half-life of HIF-1α protein, did
not inhibit the interaction between HIF-1α and VHL, and did not inhibit the
ubiquitination of HIF-1α, indicating that the mechanism of NOC18 action does
not involve inhibition of HIF-1α prolyl hydroxylation. Rather than increasing the
stability of HIF-1α, the data suggest that NOC18 increases the rate of HIF-1α
protein synthesis.
Whereas exposure of cells to hypoxia or DFX decreases HIF-1α protein
degradation, exposure of cells to heregulin, IGF-1, insulin, or prostaglandin E2
increases HIF-1α protein synthesis (8-10,36). In previous studies of MCF-7 and
HCT116 cells, the effect on protein synthesis was documented by cycloheximide
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-31-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
inhibition and by pulse-chase experiments (8). In the present study, we also
confirmed that NOC18 treatment stimulated the synthesis of HIF-1α but had no
effect on HIF-1α protein stability in HEK293 cells. Thus, as in the case of growth
factor-treated cells, the increased expression of HIF-1α protein in NOC18-treated
cells is due to increased synthesis.
As previously observed in growth factor-treated cells, the effect of NOC18
is dependent upon its activation of the PI3K and MAPK pathways. Dependence on
MEK activity for phosphorylation of 4E-BP1 and p70S6K has been demonstrated
in other cellular contexts. In the case of IGF-1-stimulated colon cancer cells, both
MEK and PI3K are required for activation of p70S6K, with MEK inhibitors
preventing the phosphorylation of Thr-421/Ser-424 in the Thr-389 by mTOR
(39). ERK has been shown to phosphorylate 4E-BP1 in vitro (40). The MEK-
ERK pathway also stimulates the phosphorylation of eIF-4E, which is required for
its mRNA cap binding activity (37). Thus, NOC signaling both de-represses (via
phosphorylation of 4E-BP1) and activates (via phosphorylation of eIF-4E and
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-32-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
p70S6K) protein synthesis. The effects of NO donors may not be specific for HIF-1α.
The known targets for phosphorylation by mTOR are regulators of protein
synthesis. The translation of several dozen different mRNAs are known to be
regulated by this pathway and sequences in the 5’-untranslated region of the
respective mRNAs may determine the degree to which the translation of any
particular mRNA can be modulated by mTOR signaling. HIF-1α protein
expression is likely to be particularly sensitive to changes in the rate of synthesis
because of its extremely short half-life under non-hypoxic conditions.
HIF-1 activity is regulated not only by HIF-1α protein expression but also
by HIF-1α transcriptional activity. Our data analyzing transactivation mediated
by Gal4-HIF-1α-TAD fusion proteins demonstrate that NOC18 treatment also
induces HIF-1α TAD activity under non-hypoxic conditions. A regulatory switch
controlling TAD activity involves O2-dependent hydroxylation of Asn-803 by
FIH-1. NOC18 treatment did not promote dissociation of FIH-1 and HIF-1α.
TAD activity is also regulated by a MAPK-dependent mechanism (41). The
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-33-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
MEK-1 inhibitor PD98059 blocked NOC18-induced HIF-1 activation and
NOC18-induced MAPK activation, suggesting a link between NOC18,
MEK/ERK, and HIF-1α. Published data suggest that the direct target of
MEK/ERK may be the coactivators CBP and p300 which interact with the TADs
(42).
The action of NO in biological systems can be mediated directly by NO or
by conversion of NO to NO- or NO+ equivalents (43). Because two enzymes in
the ubiquitin-proteasome pathway, E1 and E2, contain thiols in their active sites,
these thiols were a priori candidates as targets of NO donors. However, our
experimental results do not support this mechanism of action for NOC18. Another
potential target is HIF-1α itself, as there is a report that GSNO induces
nitrosylation of HIF-1α (44). However, our results indicate that if NOC18 induces
nitrosylation of HIF-1α, this modification does not lead to accumulation of the
protein. NOC18 treatment had no effect on the interaction of HIF-1α and VHL,
whereas GSNO partially inhibited the interaction and SNP dramatically augmented
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-34-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
the interaction. SNP may stimulate the prolyl hydroxylation-ubiquitination system
and promote increased HIF-1α degradation. Consistent with this hypothesis, SNP
inhibited HIF-1α accumulation induced by DFX. Thus, different NO donors
activate or inhibit HIF-1 through different molecular mechanisms.
Recent studies have demonstrated that NO donors stimulate cellular
signaling cascades (45-47). Overexpression of a dominant negative form of Ras
significantly inhibited NOC18-induced HRE-dependent gene expression and the
tyrosine kinase inhibitor genistein almost completely abolished NOC18-induced
HIF-1α expression, suggesting that one or more protein tyrosine kinases or
phosphatases may be regulated by nitrosative modification. NOC18 treatment also
induced phosphorylation of both AKT and ERK. Thus, NOC18 treatment
modulates protein kinase signaling pathways similar to the effects of growth factor
treatment. The extent to which NO signaling to HIF-1 participates in
physiological and pathophysiological processes will require further investigation.
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-35-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Footnotes
This work was supported in part by a grant-in-aid for scientific research on
priority areas “Cancer” from ministry of education, culture, sports, science and
technology to KH.
1. The abbreviations used are: HIF-1, hypoxia-inducible factor 1; VEGF,
vascular endothelial growth factor; Glut1, glucose transporter 1; MAP,
mitogen-activated protein; MAP kinase, MAPK; PI3K, phosphatidylinositol 3-
kinase; NO, nitric oxide; elF-4E, eukaryotic initiation factor; 4E-BP1, elF-
4E-binding protein1; FRAP, FKBP/rapamycin-associated protein; mTOR,
mammalian target of rapamycin; VHL, von Hippel-Lindau; HRE, hypoxia
responsive element; DFX, desferrioxamine; TAD, transactivation domain; HA,
hemagglutinin; GST, glutathione S-transferase
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-36-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Acknowledgment
We are grateful to Drs. Wataru Ogawa, and Kaikobad Irani for providing plasmid
vectors, and Mrs. Keiko Nishio for technical assistance.
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-37-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
References
1. Hochachka, P. W., Buck, L. T., Doll, C. J., and Land, S. C. (1996) Proc.
Natl. Acad. Sci. USA 93, 9493-9498
2. Guillemin, K., and Krasnow, M. A. (1997) Cell 89, 9-12
3. Paulding, W. R., and Czyzyk-Krzeska, M. F. (2000) Adv Exp Med Biol
475, 111-121
4. Wang, G. L., Jiang, B. H., Rue, E. A., and Semenza, G. L. (1995) Proc Natl
Acad Sci U S A 92, 5510-5514
5. Semenza, G. L. (2000) Genes Dev 14, 1983-1991
6. Hirota, K. (2002) J. Anesthesia 16, 150-159
7. Carmeliet, P., and Jain, R. K. (2000) Nature 407, 249-257
8. Laughner, E., Taghavi, P., Chiles, K., Mahon, P. C., and Semenza, G. L.
(2001) Mol Cell Biol. 21, 3995-4004
9. Treins, C., Giorgetti-Peraldi, S., Murdaca, J., Semenza, G. L., and Van
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-38-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Obberghen, E. (2002) J Biol Chem 277, 27975-27981
10. Fukuda, R., Hirota, K., Fan, F., Jung, Y. D., Ellis, L. M., and Semenza, G. L.
(2002) J Biol Chem 277, 38205-38211.
11. Semenza, G. L. (1998) Curr. Opin. Genet. Dev. 8, 588-594
12. Jaakkola, P., Mole, D. R., Tian, Y.-M., Wilson, M. I., Gielbert, J., Gaskell,
S. J., von Kriegsheim, A., Hebestreit, H. F., Mukherji, M., Schofield, C. J.,
Maxwell, P. H., Pugh, C. W., and Ratcliffe, P. J. (2001) Science 292, 468-
472
13. Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A.,
Asara, J. M., Lane, W. S., and Kaelin, W. G., Jr. (2001) Science 292, 464-
468
14. Epstein, A. C., Gleadle, J. M., McNeill, L. A., Hewitson, K. S., O’Rourke,
J., Mole, D. R., Mukherji, M., Metzen, E., Wilson, M. I., Dhanda, A., Tian,
Y. M., Masson, N., Hamilton, D. L., Jaakkola, P., Barstead, R., Hodgkin, J.,
Maxwell, P. H., Pugh, C. W., Schofield, C. J., and Ratcliffe, P. J. (2001) Cell
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-39-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
107, 43-54
15. Semenza, G. L. (2001) Cell 107, 1-3
16. Mahon, P. C., Hirota, K., and Semenza, G. L. (2001) Genes. Dev. 15, 2675-
2685
17. Lando, D., Peet, D. J., Gorman, J. J., Whelan, D. A., Whitelaw, M. L., and
Bruick, R. K. (2002) Genes Dev 16, 1466-1471
18. Ignarro, L. J., Cirino, G., Casini, A., and Napoli, C. (1999) J Cardiovasc
Pharmacol 34, 879-886
19. Liu, Y., Christou, H., Morita, T., Laughner, E., Semenza, G. L., and
Kourembanas, S. (1998) J Biol Chem 273, 15257-15262.
20. Huang, L. E., Willmore, W. G., Gu, J., Goldberg, M. A., and Bunn, H. F.
(1999) J Biol Chem 274, 9038-9044.
21. Sogawa, K., Numayama-Tsuruta, K., Ema, M., Abe, M., Abe, H., and
Fujii-Kuriyama, Y. (1998) Proc Natl Acad Sci U S A 95, 7368-7373.
22. Palmer, L. A., Gaston, B., and Johns, R. A. (2000) Mol Pharmacol 58,
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-40-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
1197-1203.
23. Kimura, H., Weisz, A., Kurashima, Y., Hashimoto, K., Ogura, T.,
D’Acquisto, F., Addeo, R., Makuuchi, M., and Esumi, H. (2000) Blood 95,
189-197.
24. Jiang, B. H., Zheng, J. Z., Leung, S. W., Roe, R., and Semenza, G. L. (1997)
J Biol Chem 272, 19253-19260
25. Semenza, G. L., Jiang, B. H., Leung, S. W., Passantino, R., Concordet, J. P.,
Maire, P., and Giallongo, A. (1996) J Biol Chem 271, 32529-32537
26. Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. W., Koos, R.
D., and Semenza, G. L. (1996) Mol Cell Biol 16, 4604-4613
27. Jiang, B. H., Rue, E., Wang, G. L., Roe, R., and Semenza, G. L. (1996) J
Biol Chem 271, 17771-17778
28. Harada, H., Hiraoka, M., and Kizaka-Kondoh, S. (2002) Cancer Res. 62,
2013-2018
29. Higaki, M., Sakaue, H., Ogawa, W., Kasuga, M., and Shimokado, K. (1996)
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-41-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
J Biol Chem 271, 29342-29346
30. Kotani, K., Ogawa, W., Hino, Y., Kitamura, T., Ueno, H., Sano, W.,
Sutherland, C., Granner, D. K., and Kasuga, M. (1999) J Biol Chem 274,
21305-21312
31. Irani, K., Xia, Y., Zweier, J. L., Sollott, S. J., Der, C. J., Fearon, E. R.,
Sundaresan, M., Finkel, T., and Goldschmidt-Clermont, P. J. (1997) Science
275, 1649-1652
32. Hirota, K., and Semenza, G. L. (2001) J. Biol. Chem. 276, 21166-21172
33. Ang, S. O., Chen, H., Hirota, K., Gordeuk, V. R., Jelinek, J., Guan, Y., Liu,
E., Sergueeva, A. I., Miasnikova, G. Y., Mole, D., Maxwell, P., Stockton, D.
W., Semenza, G. L., and Prchal, J. T. (2002) Nature Genetics 32, 614-621
34. Itoh, T., Namba, T., Kazuhiko, F., Semenza, L. G., and Hirota, K. (2001)
FEBS Lett. 509, 225-229
35. Akaike, T., and Maeda, H. (1996) Methods in Enzymol 268, 211-221
36. Fukuda, R., Kelly, B., and Semenza, G. L. (2003) Cancer Res 63, 2330-
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-42-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
2334
37. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S.
R., and Cooper, J. A. (1999) Mol Cell Biol 19, 1871-1880
38. Morino, S., Imataka, H., Svitkin, Y. V., Pestova, T. V., and Sonenberg, N.
(2000) Mol Cell Biol 20, 468-477
39. Haystead, T. A., Haystead, C. M., Hu, C., Lin, T. A., and Lawrence, J. C., Jr.
(1994) J Biol Chem 269, 23185-23191
40. Waskiewicz, A. J., Flynn, A., Proud, C. G., and Cooper, J. A. (1997) EMBO
J 16, 1909-1920
41. Sodhi, A., Montaner, S., Miyazaki, H., and Gutkind, J. S. (2001) Biochem.
Biophys. Res. Commun. 287, 292-300
42. Sang, N., Stiehl, D. P., Bohensky, J., Leshchinsky, I., Srinivas, V., and Caro,
J. (2003) J Biol Chem 278, 14013-14019
43. Stamler, J. S., Single, D. J., and Loscalzo, J. (1992) Science 258, 1898-1902
44. Sumbayev, V. V., Budde, A., Zhou, J., and Brüne, B. (2003) FEBS lett. 535,
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-43-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
106-112
45. Lander, H. M., Ogiste, J. S., Pearce, S. F., Levi, R., and Novogrodsky, A.
(1995) J Biol Chem 270, 7017-7020
46. Lander, H. M., Milbank, A. J., Tauras, J. M., Hajjar, D. P., Hempstead, B.
L., Schwartz, G. D., Kraemer, R. T., Mirza, U. A., Chait, B. T., Burk, S. C.,
and Quilliam, L. A. (1996) Nature 381, 380-381
47. Marshall, H. E., Merchant, K., and Stamler, J. S. (2000) FASEB J 14, 1889-
1900
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-44-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure Legends
Fig. 1. Effect of NO donors on HIF-1α levels in HEK293 cells. A, HEK293 cells
were exposed to 500 µM NOR4 (lane 2 and 3), 500 µM NOR5 (lane 4 and 5), 500
µM NOC18 (lane 6 and 7), 500 µM GSNO (lane 8 and 9), 100 µM SNP (lane 10
and 11), or 100 µM DFX (lane 12 and 13) for the indicated periods and whole cell
lysates were subject to immunoblot assay for HIF-1α (upper panel) or HIF-1β
(lower panel) protein expression. B, HEK293 cells were exposed to 500 µM
NOC18 or 100 µM DFX for 30 min-8 h prior to immunoblot analysis of whole cell
lysates using monoclonal antibodies specific for HIF-1α (upper panel) or HIF-1β
protein (lower panel). C, Comparison of kinetics of HIF-1α induction by NOC12
and NOC18. Cells were exposed to 500 µM NOC12 (upper panel: lane 2, 3 and 4),
500 µM NOC18 (upper panel: lane 5, 6, and 7), 40 µM NOC12 (lower panel: lane
2, 3 and 4), or 500 µM NOC18 (lower panel: lane 5, 6, and 7) for 30 min-8 h prior
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-45-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
to immunoblot analysis.
Fig. 2. Effect of NOC18 on expression of HIF-1 target genes. HEK293 cells were
treated with NOC18 or DFX for 24 h and total RNA was isolated. Expression of
VEGF, GLUT1, and HIF-1α mRNA, and 18S rRNA was analyzed by RT-PCR.
Fig. 3. Effect of NO donors on HRE-dependent gene expression. HEK293 cells
were transfected with pTK-RL encoding Renilla luciferase and one of the
following plasmids encoding firefly luciferase: HRE reporter p2.1 (A, B, C,),
mutant HRE reporter p2.4 (B), or VEGF promoter reporter pVEGF-KpnI-Luc
(D). Cells were exposed to 20% or 1% O2 with or without NO donors for 16 h and
then harvested for luciferase assays. In C, cells were co-transfected with p2.1,
pTK-RL, and the indicated amount of expression vectors encoding either no
protein (EV) or a dominant negative form of HIF-1α (DN). The total amount of
expression vectors was adjusted to 500 ng with empty vector. The ratio of
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-46-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
firefly:Renilla luciferase activity (RLA) was determined and normalized to the value
obtained from non-hypoxic cells transfected with empty vector to obtain the
relative luciferase activity. Results shown represent mean ± S.D. of three
independent transfections.
Fig. 4. Effect of NOC18 and GSNO on HIF-1 protein stability and synthesis.
HEK293 cells were exposed to 500 µM NOC18 (A), 250 µM GSNO (B), or 100
µM DFX (A, B) for 4 h and then cycloheximide (CHX) was added to a final
concentration of 100 µM. The cells were incubated for 0-60 min, and whole cell
lysates were subject to immunoblot assay using anti-HIF-1α (upper panel) and
HIF-1β (lower panel) antibodies. C, Pulse-labeling of HEK293 cells. Serum-
starved cells were pretreated with no drug, NOC18, or DFX for 30 min in Met-
free medium. [35 S]Met-Cys was added, and the cells were incubated for 20 or 40
min prior to preparation of cell lysates and immunoprecipitation of HIF-1α. D,
HEK293 cells were transfected with plasmid pCH-NLS-HIF-1α(574-603)-LacZ
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-47-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
(b, c, and d) or empty vector (a) and treated with NOC18 (c) or DFX (d). The cells
were stained with X-gal to detect nuclear expression of β-gal.
Fig. 5. Analysis of HIF-1α ubiquitination and interaction with VHL. A, in vitro
ubiquitination assay. Lysates prepared from cells exposed to vehicle (-) or
NOC18 (+) for 4 h were incubated with in vitro translated HIF-1α in the presence
of ubiquitin and ATP for 0, or 150 min. Polyubiquitinated forms of HIF-1α (Ubi-
HIF-1α) were identified by their reduced mobility after PAGE. B, GST-HIF-
1α(429-608) fusion protein was incubated with in vitro translated VHL in the
presence of PBS or lysates untreated or treated with the indicated reagents.
Glutathione-Sepharose beads were used to capture GST-HIF-1α and the presence
of associated VHL in the samples was determined by PAGE. One-fifth of the
input VHL protein was also analyzed. C and D, FLAG-tagged HIF-1α and HA-
tagged VHL were expressed in HEK293 cells. Cells were treated or untreated with
250-500 µM NOC18 or 100 µM DFX for 2 h and harvested. Lysates were
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-48-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
incubated with anti-FLAG affinity beads and captured protein was eluted and
analyzed by SDS-PAGE. Epitopes were detected with anti-FLAG (upper) or
anti-HA (lower) antibody.
Fig. 6. Effect of NO scavenger, guanylate cyclase inhibitor, and antioxidant on
HIF-1α induction by NOC18. HEK293 cells were treated with 250 µM NOC18 or
100 µM DFX with or without carboxyl-PTIO (A), ODQ (B) or NAC (C) for 4 h
and harvested. Then the lysates were subjected to immunoblot assay with anti-
HIF-1α antibody.
Fig. 7. Effects of NOC18 on HIF-1α transactivation-domain function. Constructs
encoding the GAL4 DNA-binding domain (amino acids 1-147) fused to the
indicated amino acids of HIF-1α were analyzed for their ability to transactivate
reporter gene GAL4E1bLuc containing five GAL4-binding sites. HEK293 cells
were co-transfected with pTK-RL (50 ng), GAL4E1bLuc (100 ng), and GAL4-
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-49-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
HIF-1α fusion protein expression plasmids (100 ng). Cells were treated with 100
µM DFX or 100-500 µM NOC18 for 16h and then harvested. The ratio of
firefly:Renilla luciferase activity was determined and normalized to the value obtained from
untreated cells transfected with plasmid encoding GAL4(1-147) to obtain the
relative luciferase activity (RLA).
Fig.8. Effect of kinase inhibitors on the induction of HIF-1α protein and
transactivation. (A, B) HEK293 cells were exposed to vehicle, 500 µM NOC18, or
DFX in the presence (+) of 100 µM genistein (GEN), 50 µM LY294002 (LY), 50
µM PD98059 (PD), 100 nM wortmannin (WT) or 200 nM rapamycin (Rap) and
harvested after 4 h for analysis of HIF-1α protein. HRE-dependent gene
expression (C, upper and D) or HIF-1α transactivation domain function (C, lower)
were analyzed using p2.1 or Gal4-HIF-1α(531-826) and GAL4E1bLuc,
respectively. Cells were pre-treated with LY, GEN, PD, or Rap and exposed to
250 µM NOC18 or 100 µM DFX. D, Cells were transfected with an expression
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-50-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
vector encoding a dominant negative form of p85 PI3K, Akt, or Ras.
Fig.9 MAPK and PI3K pathway signaling in NOC18-treated cells. HEK293 and
HCT116 cells were exposed to 500 µM NOC18. Whole cell lysates were prepared
after 15 min, 30 min or 60 min and subject to immunoblot assays using antibodies
specific for phosphorylated (Thr-202/Tyr-204) or total p42ERK2/p44 ERK1
MAPK (A) and phosphorylated (Ser-473) or total AKT (B).
Fig.10 Phosphorylation of the translational regulators p70S6K, S6 ribosomal
protein, and elF-4E in NOC18-treated HCT116 cells. Serum-starved cells were
pretreated with inhibitors for 1 h prior to NOC18 treatment as indicated. Whole
cell extracts were prepared after 1 h of NOC18 stimulation and subjected to
immunoblot assays using antibodies specific for phosphorylated (Thr-421/Ser-
424) or total p70S6K (A), phosphorylated (Ser235/236) or total S6 ribosomal
protein (S6R) (B), phosphorylated (Ser-65) or total 4E-BP (C) and
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-51-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
phosphorylated (Ser-209) or total elF-4E (D).
synthesisαNitric oxide up-regulates HIF-1
.Kasuno et al
-52-
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Takehiko Adachi, Gregg L. Semenza and Kiichi HirotaKenji Kasuno, Satoshi Takabuchi, Kazuhiko Fukuda, Shinae Kizaka-Kondoh, Junji Yodoi,
kinase and phosphatidylinositol 3-kinase signalingNitric oxide induces hypoxia-inducible factor 1 activation that is dependent on MAP
published online November 4, 2003J. Biol. Chem.
10.1074/jbc.M308197200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 11, 2018
http://ww
w.jbc.org/
Dow
nloaded from