downloaded from on may 31, 2020 by guest · 4 karukriti kaushik ghosh 1, aman prakash 1, anusua...

of 42

Evaluating the moonlight role of supramolecule ErpY-like lipoprotein of Leptospira in 1

thrombin-catalyzed fibrin clot inhibition, binding to complement factors H & -I, and its 2

diagnostic potential 3

Karukriti Kaushik Ghosh1*

, Aman Prakash1*

, Anusua Dhara1, Md Saddam Hussain

1, Prateek 4

Shrivastav1, Pankaj Kumar

2, Vinayagamurthy Balamurugan

3, Manish Kumar

1# 5

1Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 6

Guwahati -781039, Assam, India 7

8

2ICAR Research Complex for Eastern Region- ICAR Parisar, Patna, India 9

3Indian Council of Agricultural Research - National Institute of Veterinary Epidemiology and 10

Disease Informatics (ICAR-NIVEDI), Bengaluru, India 11

12

*Equal contribution. 13

14

#corresponding author: 15

Manish Kumar 16

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 17

Guwahati-781039, Assam, India 18

Email: [email protected] 19

Phone: +91-361-258-2230 20

Fax: +91-361-258-2249 21

22

Keywords: Leptospira, Lipoprotein, antibodies, ELISA, recombinant protein, extracellular 23

matrix component, LIC11966 24

Running Title: Characterization of rErpY-like protein of Leptospira interrogans 25

IAI Accepted Manuscript Posted Online 23 September 2019Infect. Immun. doi:10.1128/IAI.00536-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.

on June 23, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

of 42

Abstract 26

Leptospirosis is one of the most widespread zoonoses caused by pathogenic Leptospira spp. 27

In this study, we report that the LIC11966/ErpY-like lipoprotein is a surface-exposed outer 28

membrane protein exclusively present in pathogenic species of Leptospira. The recombinant 29

ErpY-like protein is recognized by the immunoglobulins of confirmed leptospirosis sera of a 30

diverse host (human, bovine and canine), suggesting the expression of the native leptospiral 31

surface protein during infection. Circular dichroism of pure rErpY-like protein showed the 32

secondary structural integrity to be uncompromised during the purification process. Analysis 33

of the rErpY-like protein by native-polyacrylamide gel electrophoresis, chemical cross-34

linking, dynamic light scattering, and field-emission transmission electron microscopy 35

demonstrate it to undergo supramolecular assembly. The rErpY-like protein can bind to 36

diverse host extracellular matrices, among which, it presented a saturable and stronger 37

binding affinity (dissociation constant/KD of 70.45±4.13 nM) to fibrinogen, a central host 38

plasma component involved in blood clotting. In the presence of rErpY-like supramolecule, 39

the thrombin catalyzed fibrin clot formation is inhibited up to 7%, implying its possible role 40

in inhibiting blood coagulation during Leptospira infection. Besides, binding of rErpY-like 41

supramolecule to complement factors H and -I suggests the protein may also contribute to 42

evading Leptospira from innate host defense during infection by inactivating alternative 43

complement pathway. This study reveals that rErpY-like protein is functionally active in 44

supramolecular state and performs moonlighting activity under the given in vitro conditions. 45

46

47


.org/D

ownloaded from

http://iai.asm.org/

of 42

Introduction 48

Leptospirosis, a widespread zoonosis, especially in the tropical regions of the world, is caused by 49

the pathogenic species of the spirochete Leptospira (1). It is an endemic infectious disease of 50

farmers, veterinarians, abattoir workers, and people working in close contact with animals with 51

more than one million cases reported each year (2). Leptospirosis is among the most under-52

diagnosed disease owing to its wide range of symptoms ranging from jaundice to renal failure 53

(1). The most severe forms of leptospirosis are known as Weil’s syndrome, where pulmonary 54

hemorrhage may end up to 70% mortality rates (3-5). The molecular understanding of 55

pathogenicity and virulence of leptospires are still under early stages. The origin of 56

pathophysiological symptoms of leptospirosis and the severity of disease remain virtually 57

unknown (6, 7). 58

Comprehensive interrogation of host-pathogen interplay targeting outer membrane proteins to 59

understand the pathophysiology of Leptospira has been actively under study. However, to date, 60

only a few virulence factors of Leptospira have been functionally characterized and well-61

understood. It is now established that Leptospira adherence with the host cells, extracellular 62

matrix, and plasma proteins contribute to bacterial dissemination and host immune evasion (8). 63

Various evidence for the exploitation of host plasma proteins like complement factors (9, 10), 64

plasminogen (10, 11), ferritin (12), and fibrinogen (Fg) (13) by the leptospires have been 65

reported. The advent of the whole genome sequence of Leptospira established that a large share 66

of genes represent putative proteins with no identified function or is exclusively present only in 67

pathogenic species of Leptospira (14). Several such leptospiral proteins (13, 15, 16) have been 68

reported to interact with human fibrinogen (Fg) and complement regulatory proteins. Such 69

binding proteins benefits the bacteria in intervening thrombin-catalyzed clot formation or 70


.org/D

ownloaded from

http://iai.asm.org/

of 42

inhibiting complement activation essential for successful establishment in the host and impeding 71

innate defense system. In a recent study, a protein annotated as ErpY-like (LIC11966) in 72

Leptospira has been demonstrated to be Fg-binding protein with diagnostic and subunit vaccine 73

potential (17-19). The ErpY protein annotation originated from outer surface protein E/F- related 74

proteins of another pathogenic spirochete, Borrelia burgdorferi (20). In the genus Borrelia, erp 75

genes have been subdivided into three distinct gene families as ospE, ospF, and elp group where 76

ErpY belongs to OspF protein family (21). These erp genes possess well-conserved leader 77

polypeptide sequences and encode highly charged lipoprotein (high number of lysine and 78

glutamate residues) localized to the bacterial outer surface (22).The first description of 79

LIC11966 as ErpY-like lipoprotein of Leptospira (17) was given due to its 26% sequence 80

identity with ErpY of B. burgdorferi. The ErpY-like protein with no known function is 81

conserved among pathogenic Leptospira spp., with up to 99% pairwise sequence identity. The 82

evaluation of recombinant ErpY-like protein as a diagnostic antigen for leptospirosis has been 83

not done extensively in bovines and canines till date. Moreover, being a conserved protein 84

exclusively in pathogenic Leptospira, it may be associated with virulence. The present study 85

deals with the characterization of a putative ErpY-like lipoprotein of Leptospira interrogans 86

emphasizing its sub-cellular location, diagnostic importance, and virulence activity. 87

88

Materials and Methods 89

Bacterial strains, culture media, and serum samples 90

The pathogenic Leptospira reference strains (L. interrogans serovar Copenhageni strain Fiocruz 91

L1-130, L. interrogans serovar Lai strain Lai and L. interrogans serovar Canicola strain Hond 92

Utrecht IV) and a non-pathogenic Leptospira strain (L. biflexa serovar Patoc strain Patoc 1) were 93


.org/D

ownloaded from

http://iai.asm.org/

of 42

grown as described before (23). Serum samples positive (+) /negative (_) for leptospirosis in a 94

diverse host (human, bovine and canine) by microscopic agglutination test (MAT) were obtained 95

from the Indian Council of Agricultural Research-National Institute of Veterinary Epidemiology 96

and Disease Informatics (ICAR-NIVEDI), Bengaluru, Karnataka, India. The serum samples were 97

screened for MAT using the methodology described before (23). The Escherichia coli strains 98

DH5α or BL21 (DE3) were grown at 37 °C in Luria-Bertani (LB) broth medium (HiMedia 99

#M1245) or LB agar (HiMedia #M1151) with or without ampicillin (SRL #61314) or kanamycin 100

(SRL #99311) at a concentration of 100 μg mL−1

for gene cloning and protein expression studies. 101

In silico analysis of protein 102

The LIC11966/ErpY-like (new locus tag; LIC_RS10040) is annotated as a hypothetical protein 103

of L. interrogans serovar Copenhageni by NCBI (National Center for Biotechnology 104

Information) database. The amino acid sequence of the ErpY-like protein was retrieved using its 105

reference sequence ID (WP_000716642.1) from the NCBI protein database and was analyzed to 106

identify the signal peptide as reported previously (24). NCBI protein BLAST (Basic Local 107

Alignment Search Tool) was used to identify orthologs of ErpY-like among Leptospira species. 108

Phylogenetic analysis of Leptospira was performed based on ErpY-like protein as described 109

previously (23). Analysis of theoretical secondary structures of the recombinant protein was 110

performed using a web server PSIPRED version 3.3 (25). 111

Cloning, protein overexpression, purification, and polyclonal antibody generation 112

Genomic DNA (gDNA) was isolated from Leptospira as described previously in our laboratory 113

(23). All the enzymes used for DNA manipulations were purchased from New England Biolabs 114

or Thermo Fisher Scientific. The coding sequence (CDS) of the erpY-like gene without its signal 115

peptide encoding sequence was PCR-amplified (414 bp) from gDNA using gene-specific 116


.org/D

ownloaded from

http://iai.asm.org/

of 42

primers, erpY-like forward: 5’CTAGCTAGCTGCAAACAAGATCCAGTAGAT’(NheI) and 117

reverse: 5’CCGCTCGAGTTATTGAGAAGCGTATTCTTTC3’ (XhoI). The pTZ57R/T plasmid 118

construct (Thermo Fisher Scientific #K1214) was used to facilitate the erpY-like gene cloning 119

into a pET28a expression vector (Novagen #69864). The sequencing of the cloned DNA insert in 120

pET28a was done from Eurofins Genomics India Pvt Ltd, Bengaluru, India. Induction of 121

expression and purification of the recombinant ErpY-like (rErpY-like; 17.8 kDa) protein in E. 122

coli BL21 (DE3) strain was done as described previously (26). Similarly, the recombinant 123

LIC10191/Loa22 (rLoa22) used in this study was purified as described elsewhere (27). Female 124

BALB/c mice (n=5) of 4-6 week old were immunized with recombinant protein for the 125

generation of specific polyclonal antibodies as described before (23). The immunization 126

experiments were performed at the department of microbiology, College of Veterinary Science, 127

Assam Agricultural University, Guwahati, India, after approval by the Institutional Animal 128

Ethics Committee (approval no.770/ac/CPCSEA/FVSC/AAU/IAEC/13-14). The antibodies 129

against OmpL54, LipL31, and LipL32 raised in rabbits were obtained as a generous gift from Dr. 130

David Haake (Division of Infectious Diseases, California, USA). 131

Circular dichroism spectroscopy 132

A circular dichroism (CD) spectropolarimeter (model J-815 from JASCO, Japan) was used to 133

measure the molar ellipticity (Ф) of rErpY-like protein in terms of degrees cm2 dmol

−1 as 134

described previously in our laboratory (23). 135

Chemical cross-linking of rErpY-like protein of Leptospira 136

Purified rErpY-like protein (4 μg per reaction) was cross-linked with glutaraldehyde solution 137

(0.1%) in a cross-linking buffer (50 mM phosphate buffer, 100 mM KCl, 5 mM MgCl2, 5% 138

glycerol; pH 7.6) at room temperature. The reactions were terminated at various time intervals 139


.org/D

ownloaded from

http://iai.asm.org/

of 42

(0-45 min), resolved on 12% SDS-PAGE with or without adding reducing agent dithiothreitol 140

(DTT) and visualized by Coomassie Blue staining as described previously (28) 141

Native polyacrylamide gel electrophoresis (Native-PAGE) of rErpY-like protein 142

Various amounts of pure rErpY-like protein (0.5-2 μg) were mixed with 3X native sample buffer 143

(240 mM Tris-HCl, 30% glycerol, 0.03% bromophenol blue; pH 6.8). The rErpY-like protein 144

subunits assembly was analyzed on a 4-20% gradient gel (Bio-Rad MiniProtean, catalog no. 456-145

1096) after resolving for 2 h at 120 V. The resolved proteins in native gradient gel were 146

visualized with Coomassie-blue stain and the size was estimated with standard protein markers 147

(Invitrogen# 928387) of native-PAGE. 148

Dynamic Light Scattering (DLS) 149

Untreated or heat denatured (30 min, 100 °C) rErpY-like protein (0.5 μg μL-1

) after overnight 150

incubation at 4°C in a phosphate buffer (50 mM sodium phosphate buffer, pH 7.4) was used in 151

DLS experiment to record the scattering as described previously (28). A total of thirty 152

autocorrelation functions were recorded for each of the protein samples, and intensity-weighted 153

hydrodynamic diameters were determined. The profile corresponding to average sizes is reported 154

and discussed. The hydrodynamic diameter and molecular weight of rErpY-like protein were 155

generated assuming a globular conformation model using the Malvern Zetasizer software. 156

Field Emission Transmission electron microscopy 157

The rErpY-like protein sample (5 μL of 40 ng μL-1

) was drop-casted on a UV-irradiated carbon-158

coated grid (Agar scientific #AGS147-4H), adsorbed, stained with Uranyl acetate solution for 159

field emission transmission electron microscopy (FETEM, JEOL-JEM-2100F) as described 160

previously (29). Images were acquired at an instrumental magnification of 40,000X and 200 161


.org/D

ownloaded from

http://iai.asm.org/

of 42

keV. Selective particles of the image were enlarged using MS-Office image viewer tool for 162

clarity. 163

Triton X-114 extraction and phase partitioning of membrane proteins 164

A viable culture of L. interrogans serovar Copenhageni (5×109 cells) in mid-log phase (7-day-165

old) was harvested, washed with PBS, and subjected to detergent (Triton X-114) extraction and 166

phase-partitioning as described previously in our laboratory (23). Briefly, the whole lysates and 167

the phase partitioned fractions were resolved on SDS-polyacrylamide gel and then subjected for 168

immunoblot analyses using anti-ErpY-like (1:1000) or anti-LipL32 (1:5000) or anti-LipL31 169

(1:2000) antibodies. 170

Immunoblot assays 171

The spirochete whole cell lysate, detergent mediated phase-partitioned fraction, and the 172

recombinant proteins (rErpY-like and rLoa22) were immunoblotted as described before in our 173

laboratory (23). The membranes were probed for 2 h at room temperature with specific 174

polyclonal antisera (anti-ErpY-like at 1:1000; anti-Loa22 at 1:1000; anti-LipL32 at 1:5000; anti-175

LipL31 at 1:2000) as primary antibodies against the recombinant proteins or with the pooled sera 176

(1:400) of respective host (human/bovine/canine) testing MAT-positive/negative for 177

leptospirosis. The horseradish peroxidase (HRP) -conjugated secondary antibodies (goat anti-178

mouse IgG/goat anti-rabbit IgG/goat anti-human IgG/rabbit anti-bovine IgG/rabbit anti-dog IgG) 179

was used (1:5000) to probe bound primary antibodies. 180

Protease-accessibility assay 181

A viable culture of L. interrogans serovar Copenhageni (2.5×109 cells) in mid-log phase was 182

harvested, washed, and re-suspended in 5 mL of PBS. Each 1 mL suspension of live leptospires 183


.org/D

ownloaded from

http://iai.asm.org/

of 42

(5×108

cells) was incubated with 5 μg of proteinase K (PK, SRL #36331) for 0, 1, 3 or 5 h before 184

the inhibition of PK activity by 1 mM phenylmethylsulfonyl fluoride (PMSF; HiMedia 185

#RM1592) as described previously in our laboratory (23). The bound bacteria in the microtiter 186

plate were probed individually with anti-OmpL54 (1:50), anti-ErpY-like (1:1000) or anti-LipL31 187

(1:1000) antibodies. The HRP-conjugated secondary antibodies (anti-mouse/anti-rabbit; 1:5000) 188

were added to detect bound primary antibodies. The absorbance obtained were analyzed and 189

plotted, as described before (23). 190

Binding of recombinant protein to host ligands 191

Binding of the rErpY-like protein to the host ligands, ECM or plasma components were analyzed 192

by indirect ELISA (enzyme-linked immunosorbent assay) as described previously (23). The 193

ECM components selected in this study are laminin (Sigma #L2020), collagen type-I (Sigma 194

#C9791 and Merck #08-115), chondroitin sulfate A & B (Sigma #C9819 & C3788), elastin 195

(Sigma #E1625), hyaluronic acid (Sigma #H7630) and heparan sulfate (Sigma #H7640). The 196

host plasma components used in this study are fibronectin (Sigma #F4759), fibrinogen (Fg, 197

Sigma #F3879), plasminogen (Sigma #P7999), complement factor H (CFH, Sigma #C5813) and 198

complement factor I (CFI, Sigma #C5938). Additionally, glycoprotein fetuin (New England 199

Biolabs #P6042) and bovine serum albumin fraction V (BSA, SRL #97350) are included as 200

control ligands. Briefly, 1 µg of each host ligand in PBS were coated and then each well was 201

blocked with BSA. The recombinant proteins (rErpY-like and rLoa22) was added individually in 202

each ligand coated well, and the binding was determined by specific primary (anti-ErpY-203

like/anti-Loa22 antibody) and secondary antibody (anti-mouse or anti-rabbit antibody). 204

Serological assay using sera testing MAT-positive or negative for leptospirosis 205


.org/D

ownloaded from

http://iai.asm.org/

of 42

The sera testing MAT-positive+ / negative

− for leptospirosis (human: n=50

+/20

−; bovine: 206

n=50+/20

−; canine: n=18

+/11

−) was used to check its immunoglobulins reactivity to recombinant 207

antigens (rErpY-like and rLoa22; 400 ng each) on microtitre plate by ELISA. The percent 208

sensitivity and specificity of the assay were calculated as described previously (23). The 209

absorbance of MAT-negative serum samples of each host group for each antigen was used as a 210

control in ELISA to calculate the background cut-off value (mean+2SDs). 211

Dose-response curve of rErpY-like protein binding to fibrinogen 212

The rErpY-like protein in increasing concentrations (0.05-5 µM) was added individually into Fg-213

coated microtitre wells and was probed with specific primary and secondary antibody as 214

described in the ‘binding of recombinant protein to host ligands’ section. The obtained ELISA 215

data were plotted in the ‘OriginLab’ software to calculate the dissociation constant (KD) through 216

fitted Michaelis–Menten curve. Similarly, increasing concentrations (0.25-5 μM) of rErpY-like 217

protein (control) or its heat-denatured form (95 °C, 10 min) was used to measure the effect of 218

heat denaturation of rErpY-like protein in binding to human fibrinogen. 219

Antibody inhibition assay 220

A microtiter plate was coated with Fg and blocked with BSA. The rErpY-like protein (1 µg) was 221

pre-incubated with specific anti-ErpY-like antibody or non-specific anti-Loa22 antibody (1:100) 222

in PBS-T (0.05%) for 1 h, as described previously (13). The pre-incubated antibody-blocked 223

rErpY-like protein (1 µg) complex and the pure rErpY-like protein (1 µg) were added 224

independently into Fg-coated wells in triplicates and incubated for 2 h. After washing, the wells 225

were probed with monoclonal anti-his antibody (1:1000) (Merck #05-949). Further analysis of 226

protein interaction to the Fg was performed as described in the ‘binding of recombinant protein 227


.org/D

ownloaded from

http://iai.asm.org/

of 42

to host ligands’ section. The obtained ELISA data of antibody inhibition assay were plotted in 228

relative percentage presuming the binding of the pure rErpY-like protein to Fg as 100%. 229

Inhibition of live leptospires adherence to fibrinogen in the presence of rErpY-like protein 230

Increasing concentrations of rErpY-like protein (0.05-5 µM) were added separately in triplicates 231

into Fg-coated wells. After three times of washings, live L. interrogans serovar Copenhageni 232

(4×107) were incubated into each well for 90 min. Each well was washed with PBS-T (0.05%) 233

before the addition of anti-Loa22 antibody (1:1000). After 2 h of incubation, secondary antibody 234

(1:5000) was used to detect inhibition of leptospires binding as described before in our lab (23). 235

Fibrin clot inhibition assay 236

Inhibition of thrombin-catalyzed fibrin clot formation from Fg in the presence of recombinant 237

proteins of Leptospira was performed as described previously (13). Briefly, increasing 238

concentrations of rErpY-like protein (0.05-5 µM) and a single highest concentration of rLoa22 (5 239

µM) were added independently to a soluble Fg (1 mg mL−1

) in PBS (300 µL). An aliquot (90 240

µL) of these complex solutions were added onto a microtiter plate in triplicates. Thrombin (0.1 241

units/10 µL) (Merck # 69671-3) was added to each well, and in every 2 min, the absorbance (595 242

nm) was recorded for 40 min at 25 °C. A graph of absorbance (595 nm) vs time (min) was 243

plotted in the ‘OriginLab’ software. The relative percentage of fibrin clot formation in the 244

presence of rErpY-like protein was calculated presuming the absorbance obtained in the positive 245

control of the assay to be 100%. 246

Far-Western blot 247

The whole-cell lysate of L. interrogans serovar Copenhageni, the recombinant proteins (rErpY-248

like protein & rLoa22: 1 µg each) and CFH (1 µg) were subjected to SDS-polyacrylamide gel 249


.org/D

ownloaded from

http://iai.asm.org/

of 42

electrophoresis (12%) and far-Western blotting. The electroblotted membrane was overlaid with 250

10% human plasma (Sigma #P9523), as a source of CFH or 100 ng/µl of recombinant protein, 251

for 90 min after blocking with 5% nonfat dry milk for 2 h and was subsequently probed with 252

specific primary antibody (1:1000) of human CFH (anti-CFH antibody, Sigma # SAB1401172) 253

or anti-ErpY-like/Loa22 (1:1000) antibodies and the HRP-conjugated secondary IgG (1:5000). 254

Statistical analysis 255

All data point in graphs is representative of the mean±SD. Two-tailed Student’s paired t-test was 256

used to determine the significance of the differences between the mean. The P values between 257

0.05-0.01 (*), 0.001-0.01 (**) and less than 0.0001 (***) were considered to be statistically 258

significant, very significant, and extremely significant, respectively. Two independent 259

experiments were performed, each one in duplicate or triplicate as described. Statistical 260

agreement between the ELISA and MAT tests was determined using Cohen’s kappa coefficient 261

as described previously (23) 262

RESULTS 263

In silico analysis of LIC11966/ErpY-like protein 264

Bioinformatics analysis of LIC11966 using the SignalP 5.0 program (30) predicted a signal 265

peptide with the cleavage site between the 22nd

and 23rd

residues at the N-terminus. Also, the 266

amino acid sequence of LIC11966 (159 residues) was analyzed manually to identify its signal 267

peptide with the criteria set for spirochetal lipoproteins (31). The signal peptide cleavage site in 268

LIC11966 lipoprotein by signal peptidase (Lsp) was consistent with the findings predicted 269

through SignalP 5.0 program. The signal peptide (22 residues) of LIC11966 fulfills all the 270

criteria set for spirochete protein to be categorized as a lipoprotein. The PSORT program (32), 271


.org/D

ownloaded from

http://iai.asm.org/

of 42

predicted LIC11966 to be localized more towards periplasmic region than the outer membrane of 272

Leptospira. The orthologs of LIC11966 were found to be highly conserved among the serovars 273

of L. interrogans with 99-100% sequence identity on BLAST search analysis. The phylogenetic 274

tree constructed using the 14 representative leptospiral LIC11966 orthologs shows a high level of 275

sequence conservation among pathogenic spp. of Leptospira and with the lowest sequence 276

identity of 57% (Table 1, Fig. 1). 277

ErpY-like protein is encoded exclusively in pathogenic Leptospira genome and is a 278

predominant outer membrane surface-exposed protein 279

Immunoblot assay using anti-ErpY-like antibody specifically detected the native ErpY-like 280

protein (~15 kDa) in the lysates (1×109 cells) of pathogenic L. interrogans serovars 281

(Copenhageni, Lai and Canicola) (Fig. 2A). However, there was no detection of native ErpY-like 282

protein in the lysate (1×109 cells) of non-pathogenic L. biflexa serovar Patoc. Immunoblot assay 283

detected the rErpY-like (~18 kDa) protein at relatively larger molecular size than the native 284

ErpY-like (~15 kDa) protein due to the presence of an additional N-terminal vector fusion of 2.5 285

kDa in recombinant protein (Fig. 2A). These results suggest that the in vitro-cultured Leptospira 286

(IVCL) expresses the native ErpY-like protein and share a common immunogenic epitope with 287

the recombinant protein. 288

To determine the ErpY-like protein subcellular location, 289

detergent extraction and phase partition of L. interrogans serovar Copenhageni was performed 290

using Triton X-114. Immunoblot assay of the phase-partitioned fractions of Leptospira detected 291

the ErpY-like protein predominantly in the hydrophobic detergent phase, advocating the ErpY-292

like protein to be an outer membrane protein (Fig. 2B). To validate the subcellular localization 293

experiment in Leptospira using Triton X-114, a known LipL32 and LipL31 protein, located in 294


.org/D

ownloaded from

http://iai.asm.org/

of 42

the outer (23) and cytoplasmic membrane (33) respectively, was probed with its specific 295

antibodies in the phase-partitioned fraction. Besides, the assessment of ErpY-like protein as a 296

surface-exposed protein of Leptospira was executed by protease accessibility assay using 297

proteinase K treatment at different time intervals on live spirochetes. At a range of 1-5 h of 298

proteinase treatment on live spirochetes, a gradual decrease in the absorbance for detection of 299

ErpY-like protein in the ELISA suggested it to be a surface-exposed protein of Leptospira (Fig. 300

2C). Moreover, a known leptospiral surface-exposed protein OmpL54 and a cytoplasmic-301

membrane protein LipL31 (34) were used as controls to validate the protease accessibility assay 302

in Leptospira. During the various intervals of proteinase treatment on leptospires, an 303

insignificant change in the serological detection of LipL31 dictates that the cellular integrity of 304

Leptospira inner membrane was uncompromised (Fig. 2C). On the other hand, the reduction in 305

absorbance for detecting OmpL54 post-proteinase treatment validates the quality of protease 306

accessibility assay performed in this study and agrees to elsewhere (34). 307

Recognition of rErpY-like protein by serum obtained during natural Leptospira infection 308

The naturally infected hosts of Leptospira were evaluated for its ability to recognize rErpY-like 309

protein as an antigen. Indirect ELISA was conducted for comparing the recognition of rErpY-310

like antigen with the serum of broad host range (human, bovine, and canine) that tested positive 311

for leptospirosis by the MAT. As a control, serum samples that tested negative for leptospirosis 312

by the MAT of each host (humans, bovine, and canines) were included for assessment of 313

recognition of rErpY-like antigen. Besides, antigen rLoa22, a known serological diagnostic 314

candidate of Leptospira (35), was added to validate the MAT results and compare the 315

sensitivity/specificity of rErpY-like protein as a potential antigen. To further substantiate our 316

assessment, immunoblots were performed with the pooled serum samples of the host 317


.org/D

ownloaded from

http://iai.asm.org/

of 42

(human/bovine/canine) tested positive or negative for leptospirosis by MAT. The calculated 318

sensitivity and specificity of the indirect ELISA to recognize antigens (rErpY-like and rLoa22) 319

with human serum were 100% (Fig. 3A and Fig. 3B). However, the measured cut-off value of 320

absorbance for detecting rErpY-like antigen (0.29) was lower than rLoa22 (0.49) in humans 321

naturally infected with Leptospira (Table 2). On the same note, immunoblots performed with 322

MAT-positive pooled serum of human could remarkably detect rLoa22 and rErpY-like antigens 323

in comparison to MAT-negative pooled serum for leptospirosis (Fig. 3C). It is now well 324

established that Leptospira has a wide host range where it can sustain itself, and these hosts 325

respond immunologically in diverse ways during leptospirosis; therefore, it was interesting to 326

evaluate the reactivity of immunoglobulins from sera of infected hosts to rErpY-like protein. 327

Under the similar experimental condition, immunoassay was performed with the serum samples 328

of bovine tested positive or negative for leptospirosis by MAT. In the same trend to that of 329

human serum for detecting antigens (rErpY-like and rLoa22) in this study, the bovine 330

leptospirosis serum also scored 100 percent of sensitivity and specificity (Fig. 3D and Fig. 3E). 331

In agreement with the ELISA results, immunoblot performed with the pooled bovine serum 332

(MAT-positive) detected rLoa22 and rErpY-like antigen (Fig. 3F). The serum samples 333

displaying MAT-positive for leptospirosis in canines also detected antigens (rErpY-like and 334

rLoa22) with each specificity and sensitivity of 100% (Fig. 3G and Fig. 3H). Among the tested 335

serum of various host in this study, canine serum used for serological detection of leptospirosis 336

demonstrated the lowest cut-off to detect both rErpY-like antigen (0.17) and rLoa22 (0.30) 337

(Table 2). Nevertheless, immunoblot with canines serum samples (MAT-positive) could detect 338

rLoa22 and rErpY-like antigen at an adequate level in comparison to MAT-negative serum 339

samples (Fig. 3I). The obtained data for detecting rErpY-like antigen by ELISA were compared 340


.org/D

ownloaded from

http://iai.asm.org/

of 42

with those for the MAT using Cohen’s kappa coefficient value. The calculated kappa value 341

(kappa 1.0; 95% CI) for detecting leptospirosis in the serum samples of the different host 342

(human, bovine, and canine) interpreted a “very good” strength of agreement. 343

Interaction of rErpY-like protein to host ECM and plasma components 344

Several leptospiral surface proteins have been established to mediate pathogen colonization and 345

dissemination in host tissues by adhering to extracellular matrix (ECM) proteins (13, 36). 346

Moreover, Leptospira binding to host-specific plasma component through its surface-exposed 347

membrane proteins may cause an imbalance in the physiological process like blood coagulation 348

and complement activation cascade in the host (37). Before attempting to understand the role of 349

ErpY-like protein as an outer membrane protein of Leptospira, we first evaluated the secondary 350

structure integrity of rErpY-like protein by circular dichroism (CD) spectroscopy (Fig. 4A). The 351

obtained experimental CD spectra data for rErpY-like protein using the K2D2 program (38) 352

predicted 87.6% α-helix and 0.5% β-strand. The secondary structure prediction for native ErpY-353

like protein using the PSIPRED program (39, 40) was close to the experimental CD data, 354

indicating its suitability for downstream biochemical studies. Using ELISA, we evaluated the 355

binding capability of rErpY-like protein to a spectrum of host ECM and plasma components. 356

Among all the host ligands (laminin, fibronectin, collagen type I, chondroitin sulphate A and B, 357

hyaluronic acid, heparan sulphate, elastin, fibrinogen, plasminogen, factor H and factor I) 358

examined for interaction with rErpY-like protein using ELISA, a higher absorbance for binding 359

to Fg, complement Factor H (CFH), and factor I (CFI) was evident (Fig. 4B). This binding study 360

of rErpY-like protein to ECM leads us to hypothesize that during natural Leptospira infection 361

ErpY-like protein might play a moonlighting role in disrupting blood coagulation process and 362

evading complement-mediated lysis of Leptospira. 363


.org/D

ownloaded from

http://iai.asm.org/

of 42

Interestingly, the binding of the rErpY-like protein to another plasma component like 364

plasminogen was statistically insignificant in comparison to ligands fetuin and BSA (negative 365

control) (Fig. 4B). Moreover, a negative control protein, rLoa22 used in the assay showed 366

moderate binding with all the examined ECM and plasma components of the host (Fig. 4B) and 367

agrees to an earlier report (41). The moderate binding of rLoa22 to ECM components validates 368

the experimental procedures and the quality of ligands used in this assay. Binding of the rErpY-369

like protein to host plasma components like CFH/I and Fg prompted us to evaluate if rErpY-like 370

tends to undergo supramolecular assembly. To determine the self-assembly property of rErpY-371

like, the purified recombinant protein was resolved on native-PAGE and stained with 372

Coomassie-blue. In native-PAGE gel, the proteins migrate not only according to their size but 373

also to their shape and hydrodynamic properties and therefore may not represent the actual size 374

of protein. The apparent molecular weight of rErpY-like protein resolved on native-PAGE was 375

found to be around 300 kDa (Fig. 4C). The ability of the rErpY-like protein to form 376

supramolecule, as evident by native-PAGE image, encouraged us to find if chemical cross-377

linking with glutaraldehyde could detect the transient assembly of rErpY-like protein subunits on 378

denaturing polyacrylamide gel. As expected, multiple transient bands of cross-linked rErpY-like 379

protein corresponding to 1-, 2-, 4-, and 8-mers were evident on SDS-PAGE stained with 380

Coomassie-blue until 45 min of cross-linking reaction (Fig. 4D). In contrast, cross-linked 381

product of two control proteins β-casein and a recombinant protein LIC13341 of Leptospira, 382

previously studied in our laboratory (23), show only one transient cross linked band (Fig. 4D, 383

right panel). Among all the multiple bands visualized, 2-mer band of rErpY-like protein 384

appeared in majority when resolved in the absence of reducing agent, dithiothreitol (DTT). We 385

further looked into the hydrodynamic size of the supramolecule rErpY-like protein by dynamic 386


.org/D

ownloaded from

http://iai.asm.org/

of 42

light scattering as the 12 % SDS-PAGE cannot resolve the cross-linked product of more than 387

170-200 kDa. 388

Dynamic light scattering and field emission transmission electron microscopy of rErpY-like 389

protein 390

Dynamic light scattering (DLS) was performed to determine the size distribution profile of the 391

purified rErpY-like oligomeric protein or its heat-denatured form in solution. The size 392

distribution profile of purified rErpY-like protein using DLS demonstrated a homogenous 393

distribution of single major population species of mean hydrodynamic diameter (DH) 394

10.88±5.18 nm and with an estimated molecular weight of 177±84.3 kDa (Table 3). On the other 395

hand, the heat-denatured rErpY-like protein demonstrated a heterogeneous size distribution, 396

composed of a significant population with DH of 163.6±57.92 nm and a minor population with 397

mean DH of 6.94±1.03 nm. Such a shift in size distribution profile of heat-denatured rErpY-like 398

protein suggests rErpY-like protein has aggregated, whereas, the pure rErpY-like protein in 399

solution tends to form a supramolecule with homogenous size distribution (Fig. 5A). The values 400

of particle polydispersity, polydispersity index, count rate, volume & intensity % and estimated 401

MW (molecular weight) of major peaks of rErpY-like protein have been shown (Table 3). The 402

supramolecule rErpY-like protein topography was also imaged using FETEM. Negative stain 403

FETEM image of r-ErpY-like supramolecule demonstrate the homogenous distribution of the 404

particles with identical spherical shape and size (~20 nm diameter) throughout the grid (Fig 5B). 405

Characterization of rErpY-like protein interaction to human fibrinogen 406

The optimal binding of the rErpY-like protein to human Fg was evaluated on a quantitative basis 407

through indirect ELISA. A dose-dependent and saturable binding curve were obtained when 408

increasing concentration of the rErpY-like protein (0-5 µM) was allowed to bind to a fixed 409


.org/D

ownloaded from

http://iai.asm.org/

of 42

amount of human Fg (1 µg) onto a microtitre plate. The rErpY-like protein binding to Fg ligand 410

achieved saturation at 5 µM concentration of recombinant protein, demonstrating the interaction 411

to be specific (Fig. 6A). The value of calculated dissociation constant (KD) of rErpY-like protein 412

binding to ligand Fg was 70.45±4.13 nM (Fig. 6A). To address, if the structural epitopes of 413

rErpY-like protein were critical for the binding to Fg, the recombinant protein was heat-414

denatured for 10 min at 95 °C prior it's binding to the ligand. Severe reduction in binding of the 415

heat-denatured rErpY-like protein at a different concentration to Fg was observed in contrast to 416

the structurally intact rErpY-like protein (Fig. 6B). The binding assay of the structurally intact or 417

heat-denatured rErpY-like protein to Fg along with the DLS data suggest that ligand binding are 418

dependent on both, structural conformation and assembly of supramolecule subunits of 419

recombinant protein. Also, the role of immunogenic epitopes of rErpY-like protein to interact 420

with host Fg was assessed by allowing the rErpY-like protein to bind with its specific 421

immunoglobulins (serum-containing anti-rErpY-like) before determining the binding reaction to 422

Fg. The specific immunoglobulins inhibited (51%) the interaction of rErpY-like protein to ligand 423

Fg in comparison to the control where no serum was used (Fig. 6C). The serum anti-Loa22 424

utilized as a source of non-specific antibody demonstrated insignificant inhibition (5%) of 425

rErpY-like protein binding to the Fg (Fig. 6C), suggesting that immunogenic epitopes of rErpY-426

like protein are essential in the binding to Fg. 427

It was interesting to evaluate the effect of rErpY-like protein on adherence of live Leptospira, 428

expressing the native ErpY-like surface protein, to Fg. Indirect ELISA quantified the impact of 429

the presence of rErpY-like protein on adherence of leptospires to Fg. Live leptospires were 430

allowed to competitively adhere to Fg pre-incubated with different concentrations of rErpY-like 431

protein (0-5 µM). Fibrinogen bound leptospires were quantified using antiserum against Loa22, a 432


.org/D

ownloaded from

http://iai.asm.org/

of 42

predominant surface-exposed leptospiral membrane protein (42). A dose-dependent reduction in 433

the number of leptospires adhering to Fg pre-incubated with increasing rErpY-like protein 434

concentration indicates specific interaction of ErpY-like protein to the Fg. It turned out to be that 435

only 53% of leptospires could bind to Fg in the presence of saturable binding concentration (5 436

µM) of the rErpY-like protein (Fig. 6D). 437

Inhibition of fibrin clot formation catalyzed by thrombin 438

The binding ability of the rErpY-like protein to plasma component Fg prompted us to address 439

whether the presence of rErpY-like protein can interfere in the thrombin-catalyzed conversion of 440

soluble fibrinogen into insoluble fibrin, a physiological reaction essential for initiating blood clot 441

formation. The enzymatic conversion of soluble fibrinogen into insoluble fibrin can be detected 442

by measuring the increase in absorbance (595 nm). Therefore, the kinetics of fibrin formation 443

from fibrinogen, catalyzed by thrombin in the presence or absence of increasing concentration 444

(0-5 µM) of rErpY-like protein was measured (Fig. 7A). The thrombin-catalyzed clot formation 445

in the absence of rErpY demonstrated the maximal clotting (100%; positive control), whereas the 446

fibrinogen clot reaction with no added thrombin showed a lack of any measurable clotting 447

(negative control). The rLoa22, a known protein of Leptospira with a moderate binding ability to 448

Fg, was used as another control in the thrombin-catalyzed clot formation. The kinetics of clot 449

formation in the presence of rLoa22 (5 µM) was similar to the positive control of the assay (Fig. 450

7A). On the other hand, the kinetics of clot formation regularly decreased (47-7%) in the 451

presence of an increasing concentration of rErpY (0.05-5 µM) (Fig. 7B). 452

Leptospira rErpY-like protein is a complement factor H binding protein 453

It is a known fact that few pathogens can evade the host’s innate immune responses more 454

efficiently by the complement inactivation, thus being able to survive and enhance host 455


.org/D

ownloaded from

http://iai.asm.org/

of 42

colonization. The alternative pathway of complement activation is an essential arm of vertebrate 456

innate immunity, which rapidly clears susceptible microorganisms from the host in the absence 457

of antibody (43). In this study, we observed that CFH and CFI show relatively higher interaction 458

to rErpY-like protein than plasminogen, another soluble plasma component. Interestingly, CFH 459

is a soluble glycoprotein present in normal plasma at a concentration of 0.3–0.5 mg mL-1

and is 460

also a cofactor for CFI, a serine protease of the alternative pathway of complement (43). 461

Therefore, it was interesting to find if the recombinant and the native ErpY-like protein of 462

Leptospira could bind to the CFH present in the normal human plasma. To address this, we 463

performed far-Western blotting of rErpY-like protein as bait proteins on nitrocellulose 464

membrane and human plasma (10%) as prey protein component. The rErpY-like protein (18 465

kDa) could bind to the CFH (prey protein) present in the human plasma overlay and when 466

probed with an anti-CFH antibody (Fig. 8A, bottom panel). In contrast, the same amount of 467

rLoa22 failed to bind CFH during the overlay experiment (Fig. 8A, bottom panel). Similarly, 468

human CFH was used as bait and rErpY-like as prey to identify the protein-ligand interaction 469

through far-Western blot. Human CFH was resolved on SDS-PAGE (Fig. 8B, top panel), 470

electroblotted and the membrane was overlaid with recombinant proteins. It was evident that 471

rErpY-like protein showed interaction with CFH (~150 kDa) (Fig. 8B, middle panel) whereas, an 472

equivalent amount of rLoa22 did not show any interaction with CFH (Fig. 8B, bottom panel). 473

The whole-cell lysate of L. interrogans serovar Copenhageni used as bait could bind to the CFH 474

component present in human plasma. Detection at an approximately 15 kDa in the far-Western 475

blot probably corresponds to the native ErpY-like protein of Leptospira (Fig. 8C, middle panel). 476

Additionally, two other Leptospira proteins (~50 and 30 kDa) were detected (Fig. 8C, middle 477

panel) and agreed to a previous report (44). Detection of the native protein in Leptospira lysate 478


.org/D

ownloaded from

http://iai.asm.org/

of 42

using anti-ErpY-like antibody (Fig. 8C, right panel) indicates that the CFH bound protein 479

detected at approximately 15 kDa in far-Western blot (Fig. 8C, middle panel) is, in fact, the 480

ErpY-like protein of Leptospira. The binding of rErpY-like protein (18 kDa) to CFH by far-481

Western was in agreement with the binding ability of native ErpY-like protein (15 kDa) of 482

Leptospira. 483

484

DISCUSSION 485

To date, the role of ErpY-like protein in Leptospira pathogenesis is not known; however, it is a 486

potential vaccine and diagnostic candidate for leptospirosis in the specific host (18, 19). We 487

demonstrate that ErpY-like protein of Leptospira is a surface-exposed outer membrane 488

lipoprotein and its recombinant form of antigen can be implemented in serological diagnosis of 489

leptospirosis in humans, bovines, and canines. The serological diagnosis using rErpY-like 490

protein in this study is in agreement with the previous reports for detecting leptospirosis in 491

humans (17), swine (18), and rabbits (17). This serological study in reconciliation with the other 492

reports establishes the expression of ErpY-like protein during Leptospira natural infection 493

evokes an immune response in a broad host range, including bovines and canines. In this study, 494

we also compared the diagnostic potential of rErpY-like antigen with rLoa22, a known 495

diagnostic antigen. The diverse Leptospira host (humans, bovines, and canines) positive for 496

leptospirosis by MAT demonstrated superior serological reactivity with rLoa22 than rErpY-like 497

antigen in terms of the ELISA cut-off value. Nevertheless, the immunoblot performed on these 498

two antigens with the pooled sera of diverse host did not find any difference in serological 499

reactivity. 500


.org/D

ownloaded from

http://iai.asm.org/

of 42

A study done on golden Syrian hamsters infected with L. interrogans serovar Pomona failed to 501

detect ErpY-like protein expression in the liver samples using immunofluorescence technique; in 502

contrast, human serum positive for leptospirosis showed reactivity to rErpY-like protein using 503

ELISA (17). Failure of polyclonal antibodies reactivity to ErpY-like antigen in hamster’s model 504

may be either due to the low expression of antigen in L. interrogans serovar Pomona or due to 505

the low immune response in hamster against ErpY-like protein. Moreover, the expression of 506

ErpY-like protein in L. interrogans serovar Pomona under in vitro growth has been reported to 507

be modulated by iron-limitation and the presence of serum (17). Interestingly, an attenuated 508

strain of L. interrogans serovar Manilae (M1352, defective in lipopolysaccharide biosynthesis) 509

immunized to hamsters conferred protection against leptospirosis and demonstrated serological 510

recognition of rLA1939 (ErpY-like protein ortholog) (45). In a follow up of a similar study, the 511

rErpY-like protein was shown to protect hamsters (62.5%) against mortality but not against 512

tissue lesions developed during laboratory-generated Leptospira infection (19). 513

Pathogenic species of Leptospira exclusively express the ErpY-like protein; hence, we speculate 514

it to be one of a virulence factor required during the pathogenesis of Leptospira. Biophysical 515

interaction studies reported earlier have demonstrated Erp proteins in spirochetes to bind with 516

host Fg and CFH (19, 22). Moreover, bacterial adhesion to host extracellular matrix (ECM) 517

components or plasma protein is assumed to be an indispensable step in the pathogenesis of 518

spirochete infection. In accordance, the ErpY protein of B. burgdorferi had been demonstrated as 519

a binding partner to factor H complement regulating protein from rodents, dogs, and cats (22). 520

The Leptospira ErpY-like protein, a predominant OMP, is having 26% identity to ErpY protein 521

of Borrelia. Therefore, we pursued to evaluate if the secondary structure of the recombinant 522

protein is retained in the purified rErpY-like protein before pursuing any interaction study with 523


.org/D

ownloaded from

http://iai.asm.org/

of 42

host extracellular and plasma protein components. The CD spectra of rErpY-like protein 524

suggested the secondary structure of the purified protein is retained. The interaction of the 525

rErpY-like protein with the host ECM component was compared with the interaction of another 526

Leptospira protein (rLoa22) known to have a low/moderate binding property to ECM 527

components as described before in our laboratory (23). In this study, the binding assay of rErpY-528

like protein to host ECM or plasma component endorses it to facilitate Leptospira in adhesion. 529

Interestingly, the rErpY-like protein showed a higher preference for specific plasma proteins (Fg, 530

CFH, and CFI). Such host plasma protein components are known to form oligomeric structure 531

(46-48). This raised an interest to find if ErpY-like protein also undergoes supramolecular 532

assembly. Native gel electrophoresis, chemical cross-linking, DLS and TEM imaging of rErpY-533

like protein demonstrated the tendency of this protein to oligomerize in solution and further 534

comprehensive analysis of such protein structure is warranted. 535

The plasma component Fg plays a central role in coagulation and thrombosis in host blood. 536

Several important pathogens, including spirochetes, exploit host Fg through a diverse mechanism 537

to enhance its survival and colonization in the host (49-52). The Fg-binding protein also 538

contributes in increasing the virulence of pathogens during wound infection (53). In Leptospira, 539

till date, multiple Fg-binding proteins viz, LigA, LigB (16, 54), OmpL37 (55), rLIC12238 (56), 540

Lsa33, Lsa25 (57), Lsa30, OmpL1, rLIC11360 and rLIC11975 (13) with different binding 541

affinity to Fg have been established. Also, many of such recombinant proteins along with the live 542

virulent L. interrogans strains have been demonstrated to have a direct role in inhibiting 543

thrombin-catalyzed fibrin clot formation (13, 16, 54). Such a large repertoire of Fg-binding 544

proteins encoded in virulent Leptospira genome is discrete in nature. However, in this study, we 545

demonstrate the binding of the rErpY-like protein to Fg biochemically to be dose-dependent, 546


.org/D

ownloaded from

http://iai.asm.org/

of 42

saturable, and specific in nature. The measured KD value (70.45±4.13 nM) of rErpY-like protein 547

to Fg demonstrated a stronger affinity relative to other reported Fg-binding proteins like 548

rLIC12238 and Lsa33 (733±277 to 128±90 nM) of Leptospira. Moreover, in the presence of 549

rErpY-like protein the thrombin-catalyzed fibrin clot formation from fibrinogen and the binding 550

of live L. interrogans to Fg get inhibited in a dose-dependent manner. Thus, Leptospira in 551

reconciliation with the other reports and, alike other pathogens, encode multiple Fg-binding 552

proteins (49, 58) including the rErpY-like protein that may enhance its survival, colonization, 553

and dissemination in the host during infection. 554

The activation of the alternative complement pathway in a host leads to C3b opsonization on the 555

surfaces of invading microbes that may result in bacterial destruction (59). However, such 556

complement activation is not deleterious to host cells due to the presence of regulatory CFH that 557

coats the host cell surface and either thwarts C3b opsonization on its cell surface or promote 558

degradation of bound C3b with the help of CFI. Inspired by the vertebrate host cell of self-559

defense from its complement-mediated killing, several pathogens including Leptospira have 560

evolved a mechanism of hijacking CFH to evade complement-mediated execution (37, 44, 60-561

63). It has been demonstrated that pathogenic Leptospira possesses the capacity to recruit and 562

bind not only the host CFH but also, factor H-like 1 (FHL-1), factor H-related 1 (FHR-1), and 563

C4b binding protein (C4BP) to avoid complement-mediated killing (9, 44, 64, 65). Till date, as 564

there is already established multiple OMPs of Leptospira that can adhere to complement 565

regulator FH, the precise contributory role of ErpY-like protein for alternative complement 566

system inactivation is further required to be evaluated. 567

In this study, we have identified a conserved immunogenic ErpY-like lipoprotein localized on 568

the outer membrane of pathogenic L. interrogans. The rErpY-like protein of Leptospira that 569


.org/D

ownloaded from

http://iai.asm.org/

of 42

tends to form supramolecule structure can be serologically detected by antibodies present in the 570

serum of human, bovine, and canine infected naturally with Leptospira. Our experimental 571

analyses suggest rErpY-like protein interfere in fibrin clot formation and possibly in the evasion 572

of complement-mediated killing by binding to CFH and CFI. Further investigation on ErpY-like 573

protein may give its exact role in evading complement-mediated execution and inhibition of 574

blood clot during infection. Moreover, deciphering the structure of the rErpY-like protein as 575

supramolecule may provide a better insight into its molecular interaction with host plasma 576

components. The characterization of novel diagnostic rErpY-like protein as antigen for 577

diagnosing leptospirosis and its possible role as an adhesin to diverse host ECM component may 578

help in developing new strategies for disease intervention. 579

Acknowledgements 580

The authors gratefully acknowledge ICMR, Port Blair India for providing the Leptospira strains 581

and Dr Nitin Chaudhary, Department of Biosciences and Bioengineering (BSBE), Indian 582

Institute of Technology Guwahati (IIT Guwahati) for providing help in recording and analyzing 583

the DLS experiments. We appreciate the efforts made by Dr Shankar Prasad Kanaujia (BSBE) 584

for refining the manuscript. We acknowledge central instruments facility, IIT Guwahati for 585

electron microscopy. We would also like to thank the department of microbiology, College of 586

Veterinary Science, Guwahati, for generating polyclonal antibodies. 587

Funding 588

The present work was financially supported by the Department of Science and Technology 589

(DST), Science and Engineering Research Board (SERB) and ICMR Government of India, 590

bearing project number SERB/EMR/2015/000255 and Leptos/10/2013-ECD-I, respectively. 591


.org/D

ownloaded from

http://iai.asm.org/

of 42

592

Conflict of interest statement: None declared 593

594

595

596

Table 1: Comparative analyses of the LIC11966/ErpY-like protein orthologs among 597

Leptospira species 598

Leptospira

species (serovar)

Query coverage

(%)

Sequence

identity

(%)

NCBI accession number

L. interrogans (Canicola) 100 100 OCC30350.1

L. interrogans (Lai) 100 99 NP_712120.1

L. interrogans (Linhai) 100 99 AJR14687.1

L. interrogans (Manilae) 100 99 EYU63405.1

L. interrogans (Bataviae) 100 99 OAM75663.1

L. interrogans (Pomona) 100 99 EMI70432.1

L. kirschneri 100 92 WP_004755938.1

L. noguchii 100 85 WP_002151500.1

L. mayottensis 100 79 WP_117340238.1

L. santarosai 100 78 WP_004476249.1

L. weilii 98 80 WP_002622075.1

L. alstonii 98 71 WP_020772825.1

L. kmetyi 98 57 WP_040912836.1

L. alexanderi 76 64 WP_078128751.1

599

600


.org/D

ownloaded from

http://iai.asm.org/

of 42

601

602

603

Table 2: Measured ELISA data for the recognition of antigens (rErpY-like protein and 604

rLoa22) using sera of host (human, bovine, and canine) testing positive or negative for 605

leptospirosis by MAT 606

Host MAT-sera

(samples)

Recombinant-

proteins Mean OD±SD

Cut-off

(mean+2SDs)

Sensitivity

(%)

Specificity

(%)

Human

Positive

(n=50)

rErpY-like 0.3587±0.0230 _ 100 _

rLoa22 0.6339±0.0360 _ 100 _

Negative

(n=20)

rErpY-like 0.2268±0.0308 0.2883 _ 100

rLoa22 0.4478±0.0212 0.4903 _ 100

Bovine

Positive

(n=50)

rErpY-like 0.3684±0.0373 _ 100 _

rLoa22 0.6404±0.0194 _ 100 _

Negative

(n=20)

rErpY-like 0.2431±0.0236 0.2902 _ 100

rLoa22 0.4401±0.0223 0.4846 _ 100

Canine

Positive

(n=18)

rErpY-like 0.2497±0.0143 _ 100 _

rLoa22 0.4215±0.0191 _ 100 _

Negative

(n=11)

rErpY-like 0.1291±0.0198 0.1687 _ 100

rLoa22 0.2578±0.0207 0.2992 _ 100

607


.org/D

ownloaded from

http://iai.asm.org/

of 42

608

609

610

Table 3: Dynamic light scattering data of r-ErpY-like protein 611

612

613

614

615

616

617

618

619

620

621

Sample

Particle

polydispersity

( Pd) in nm

Pd

index

Count rate

in

counts per

sec

(cps)

Volume %

(Mass %)

Intensity

% Est. MW (kDa)*

(Mean ± SD)

*[Major peak]

rErpY-like 5.348 0.282 2,32,700

99

89.7 177±84.3

Heat-

treated

rErpY-like

70.38 0.33 5,33,300

91.4

92.6 1.01x10

5±1.49x10

4


.org/D

ownloaded from

http://iai.asm.org/

of 42

622

623

624

REFERENCES 625

1. Bharti, A. R., J. E. Nally, J. N. Ricaldi, M. A. Matthias, M. M. Diaz, M. A. Lovett, P. 626

N. Levett, R. H. Gilman, M. R. Willig, and E. Gotuzzo. 2003. Leptospirosis: a zoonotic 627

disease of global importance. The Lancet infectious diseases 3:757-771. 628

2. Costa, F., J. E. Hagan, J. Calcagno, M. Kane, P. Torgerson, M. S. Martinez-Silveira, 629

C. Stein, B. Abela-Ridder, and A. I. Ko. 2015. Global morbidity and mortality of leptospirosis: 630

a systematic review. PLoS Negl Trop Dis 9:e0003898. 631

3. Nicodemo, A. C., M. I. S. Duarte, V. A. Alves, C. F. Takakura, R. T. Santos, and E. 632

L. Nicodemo. 1997. Lung lesions in human leptospirosis: microscopic, immunohistochemical, 633

and ultrastructural features related to thrombocytopenia. The American journal of tropical 634

medicine and hygiene 56:181-187. 635

4. Marchiori, S. E., B. Netto, and W. Tavares. 1992. Pulmonary compromise in 636

leptospirosis. Revista da Sociedade Brasileira de Medicina Tropical 25:21-30. 637

5. Segura, E. R., C. A. Ganoza, K. Campos, J. N. Ricaldi, S. Torres, H. Silva, M. J. 638

Céspedes, M. A. Matthias, M. A. Swancutt, and R. L. Linán. 2005. Clinical spectrum of 639

pulmonary involvement in leptospirosis in a region of endemicity, with quantification of 640

leptospiral burden. Clinical infectious diseases 40:343-351. 641

6. Vieira, M. L., C. Naudin, M. Mörgelin, E. C. Romero, A. L. T. Nascimento, and H. 642

Herwald. 2016. Modulation of Hemostatic and Inflammatory Responses by Leptospira Spp. 643

PLoS neglected tropical diseases 10:e0004713. 644

7. Evangelista, K. V., and J. Coburn. 2010. Leptospira as an emerging pathogen: a review 645

of its biology, pathogenesis and host immune responses. Future microbiology 5:1413-1425. 646

8. Evangelista, K. V., B. Hahn, E. A. Wunder Jr, A. I. Ko, D. A. Haake, and J. Coburn. 647

2014. Identification of cell-binding adhesins of Leptospira interrogans. PLoS neglected tropical 648

diseases 8:e3215. 649

9. Castiblanco-Valencia, M. M., T. R. Fraga, L. B. d. Silva, D. Monaris, P. A. E. Abreu, 650

S. Strobel, M. Józsi, L. Isaac, and A. S. Barbosa. 2012. Leptospiral immunoglobulin-like 651

proteins interact with human complement regulators factor H, FHL-1, FHR-1, and C4BP. Journal 652

of Infectious Diseases 205:995-1004. 653

10. Cavenague, M. F., A. F. Teixeira, S. Antonio Filho, G. O. Souza, S. A. Vasconcellos, 654

M. B. Heinemann, and A. L. Nascimento. 2019. Characterization of a novel protein of 655

Leptospira interrogans exhibiting plasminogen, vitronectin and complement binding properties. 656

International Journal of Medical Microbiology. 657

11. Santos, J. V., P. R. Pereira, L. G. Fernandes, G. H. Siqueira, G. O. de Souza, A. 658

Souza Filho, S. A. Vasconcellos, M. B. Heinemann, E. G. Chapola, and A. L. Nascimento. 659 2018. Binding of human plasminogen by the lipoprotein LipL46 of Leptospira interrogans. 660

Molecular and cellular probes 37:12-21. 661


.org/D

ownloaded from

http://iai.asm.org/

of 42

12. Lo, M., G. L. Murray, C. A. Khoo, D. A. Haake, R. L. Zuerner, and B. Adler. 2010. 662

Transcriptional response of Leptospira interrogans to iron limitation and characterization of a 663

PerR homolog. Infection and immunity 78:4850-4859. 664

13. Oliveira, R., R. F. Domingos, G. H. Siqueira, L. G. Fernandes, N. M. Souza, M. L. 665

Vieira, Z. M. de Morais, S. A. Vasconcellos, and A. L. Nascimento. 2013. Adhesins of 666

Leptospira interrogans mediate the interaction to fibrinogen and inhibit fibrin clot formation in 667

vitro. PLoS neglected tropical diseases 7:e2396. 668

14. Picardeau, M. 2015. Genomics, proteomics, and genetics of leptospira, p. 43-63. 669

Leptospira and Leptospirosis. Springer. 670

15. Siqueira, G. H., A. F. Teixeira, L. G. Fernandes, G. O. de Souza, K. Kirchgatter, E. 671

C. Romero, S. A. Vasconcellos, M. L. Vieira, and A. L. T. Nascimento. 2015. The 672

recombinant LIC10508 is a plasma fibronectin, plasminogen, fibrinogen and C4BP-binding 673

protein of Leptospira interrogans. Fems Pathogens and Disease 74:ftv118. 674

16. Lin, Y. P., S. P. McDonough, Y. Sharma, and Y. F. Chang. 2011. Leptospira 675

immunoglobulin‐like protein B (LigB) binding to the C‐terminal fibrinogen αC domain inhibits 676

fibrin clot formation, platelet adhesion and aggregation. Molecular microbiology 79:1063-1076. 677

17. Eshghi, A., P. A. Cullen, L. Cowen, R. L. Zuerner, and C. E. Cameron. 2009. Global 678

proteome analysis of Leptospira interrogans. Journal of proteome research 8:4564-4578. 679

18. Padilha, B. C. R., H. Q. Simão, T. L. Oliveira, and D. D. Hartwig. 2019. The use of 680

ErpY-like recombinant protein from Leptospira interrogans in the development of an 681

immunodiagnostic test for swine leptospirosis. Acta tropica. 682

19. Oliveira, T. L., R. A. Schuch, G. R. Inda, B. C. Roloff, A. C. P. S. Neto, M. Amaral, 683

O. A. Dellagostin, and D. D. Hartwig. 2018. LemA and Erp Y-like recombinant proteins from 684

Leptospira interrogans protect hamsters from challenge using AddaVax™ as adjuvant. Vaccine 685

36:2574-2580. 686

20. Stevenson, B., W. Zuckert, and D. R. Akins. 2000. Repetition, conservation, and 687

variation: the multiple cp32 plasmids of Borrelia species. Journal of molecular microbiology and 688

biotechnology 2:411-422. 689

21. Akins, D. R., M. J. Caimano, X. Yang, F. Cerna, M. V. Norgard, and J. D. Radolf. 690

1999. Molecular and Evolutionary Analysis ofBorrelia burgdorferi 297 Circular Plasmid-691

Encoded Lipoproteins with OspE-and OspF-Like Leader Peptides. Infection and immunity 692

67:1526-1532. 693

22. Stevenson, B., N. El-Hage, M. A. Hines, J. C. Miller, and K. Babb. 2002. Differential 694

binding of host complement inhibitor factor H by Borrelia burgdorferi Erp surface proteins: a 695

possible mechanism underlying the expansive host range of Lyme disease spirochetes. Infection 696

and immunity 70:491-497. 697

23. Ghosh, K. K., A. Prakash, P. Shrivastav, V. Balamurugan, and M. Kumar. 2018. 698

Evaluation of a novel outer membrane surface-exposed protein, LIC13341 of Leptospira, as an 699

adhesin and serodiagnostic candidate marker for leptospirosis. Microbiology 164:1023-1037. 700

24. Cullen, P. A., D. A. Haake, and B. Adler. 2004. Outer membrane proteins of 701

pathogenic spirochetes. FEMS microbiology reviews 28:291-318. 702

25. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific 703

scoring matrices. Journal of molecular biology 292:195-202. 704

26. Dixit, B., K. K. Ghosh, G. Fernandes, P. Kumar, P. Gogoi, and M. Kumar. 2016. 705

Dual nuclease activity of a Cas2 protein in CRISPR-Cas subtype I-B of Leptospira interrogans. 706

FEBS Lett 590:1002-1016. 707


.org/D

ownloaded from

http://iai.asm.org/

of 42

27. Ghosh, K. K., A. Prakash, V. Balamurugan, and M. Kumar. 2018. Catecholamine-708

Modulated Novel Surface-Exposed Adhesin LIC20035 of Leptospira spp. Binds Host 709

Extracellular Matrix Components and Is Recognized by the Host during Infection. Appl Environ 710

Microbiol 84. 711

28. Dhara, A., M. S. Hussain, D. Datta, and M. Kumar. 2019. Insights to the Assembly of 712

a Functionally Active Leptospiral ClpP1P2 Protease Complex along with Its ATPase Chaperone 713

ClpX. ACS omega 4:12880-12895. 714

29. Lin, M.-H., Y.-C. Chang, C.-D. Hsiao, S.-H. Huang, M.-S. Wang, Y.-C. Ko, C.-W. 715

Yang, and Y.-J. Sun. 2013. LipL41, a hemin binding protein from Leptospira santarosai serovar 716

Shermani. PLoS One 8:e83246. 717

30. Almagro Armenteros, J. J., K. D. Tsirigos, C. K. Sønderby, T. N. Petersen, O. 718

Winther, S. Brunak, G. von Heijne, and H. Nielsen. 2019. SignalP 5.0 improves signal 719

peptide predictions using deep neural networks. Nature Biotechnology 37:420-423. 720

31. Setubal, J. C., M. Reis, J. Matsunaga, and D. A. Haake. 2006. Lipoprotein 721

computational prediction in spirochaetal genomes. Microbiology (Reading, England) 152:113. 722

32. Nakai, K., and P. Horton. 1999. PSORT: a program for detecting sorting signals in 723

proteins and predicting their subcellular localization. Elsevier Current Trends. 724

33. Abreu, P. A., A. C. Seguro, D. Canale, A. M. G. da Silva, L. do RB Matos, T. B. 725

Gotti, D. Monaris, D. A. de Jesus, S. A. Vasconcellos, and T. de Brito. 2017. Lp25 membrane 726

protein from pathogenic Leptospira spp. is associated with rhabdomyolysis and oliguric acute 727

kidney injury in a guinea pig model of leptospirosis. PLoS neglected tropical diseases 728

11:e0005615. 729

34. Pinne, M., and D. A. Haake. 2009. A comprehensive approach to identification of 730

surface-exposed, outer membrane-spanning proteins of Leptospira interrogans. PLoS One 731

4:e6071. 732

35. Chalayon, P., P. Chanket, T. Boonchawalit, S. Chattanadee, P. Srimanote, and T. 733

Kalambaheti. 2011. Leptospirosis serodiagnosis by ELISA based on recombinant outer 734

membrane protein. Transactions of the Royal Society of Tropical Medicine and Hygiene 735

105:289-297. 736

36. Atzingen, M. V., A. S. Barbosa, T. De Brito, S. A. Vasconcellos, Z. M. de Morais, D. 737

M. Lima, P. A. Abreu, and A. L. Nascimento. 2008. Lsa21, a novel leptospiral protein binding 738

adhesive matrix molecules and present during human infection. BMC Microbiol 8. 739

37. Siqueira, G. H., M. V. Atzingen, G. O. de Souza, S. A. Vasconcellos, and A. L. 740

Nascimento. 2016. Leptospira interrogans Lsa23 protein recruits plasminogen, factor H and 741

C4BP from normal human serum and mediates C3b and C4b degradation. Microbiology 742

162:295-308. 743

38. Perez-Iratxeta, C., and M. A. Andrade-Navarro. 2008. K2D2: estimation of protein 744

secondary structure from circular dichroism spectra. BMC structural biology 8:25. 745

39. LaBreck, C. J., S. May, M. G. Viola, J. Conti, and J. L. Camberg. 2017. The Protein 746

Chaperone ClpX Targets Native and Non-native Aggregated Substrates for Remodeling, 747

Disassembly, and Degradation with ClpP. Frontiers in Molecular Biosciences 4:26. 748

40. Buchan, D. W., F. Minneci, T. C. Nugent, K. Bryson, and D. T. Jones. 2013. Scalable 749

web services for the PSIPRED Protein Analysis Workbench. Nucleic acids research 41:W349-750

W357. 751


.org/D

ownloaded from

http://iai.asm.org/

of 42

41. Barbosa, A. S., P. A. Abreu, F. O. Neves, M. V. Atzingen, M. M. Watanabe, M. L. 752

Vieira, Z. M. Morais, S. A. Vasconcellos, and A. L. Nascimento. 2006. A newly identified 753

leptospiral adhesin mediates attachment to laminin. Infection and immunity 74:6356-6364. 754

42. Malmström, J., M. Beck, A. Schmidt, V. Lange, E. W. Deutsch, and R. Aebersold. 755

2009. Proteome-wide cellular protein concentrations of the human pathogen Leptospira 756

interrogans. Nature 460:762. 757

43. Brissette, C. A., A. E. Cooley, L. H. Burns, S. P. Riley, A. Verma, M. E. Woodman, 758

T. Bykowski, and B. Stevenson. 2008. Lyme borreliosis spirochete Erp proteins, their known 759

host ligands, and potential roles in mammalian infection. International Journal of Medical 760

Microbiology 298:257-267. 761

44. Verma, A., J. Hellwage, S. Artiushin, P. F. Zipfel, P. Kraiczy, J. F. Timoney, and B. 762

Stevenson. 2006. LfhA, a novel factor H-binding protein of Leptospira interrogans. Infection 763

and immunity 74:2659-2666. 764

45. Srikram, A., K. Zhang, T. Bartpho, M. Lo, D. E. Hoke, R. W. Sermswan, B. Adler, 765

and G. L. Murray. 2011. Cross-protective immunity against leptospirosis elicited by a live, 766

attenuated lipopolysaccharide mutant. Journal of Infectious Diseases 203:870-879. 767

46. Perkins, S. J., A. S. Nealis, and R. B. Sim. 1991. Oligomeric domain structure of human 768

complement factor H by X-ray and neutron solution scattering. Biochemistry 30:2847-2857. 769

47. Goldberger, G., G. Bruns, M. Rits, M. Edge, and D. Kwiatkowski. 1987. Human 770

complement factor I: analysis of cDNA-derived primary structure and assignment of its gene to 771

chromosome 4. Journal of Biological Chemistry 262:10065-10071. 772

48. Mosesson, M. 2005. Fibrinogen and fibrin structure and functions. Journal of 773

Thrombosis and Haemostasis 3:1894-1904. 774

49. Rivera, J., G. Vannakambadi, M. Höök, and P. Speziale. 2007. Fibrinogen-binding 775

proteins of Gram-positive bacteria. Thrombosis and haemostasis 98:503-511. 776

50. Houston, S., R. Hof, T. Francescutti, A. Hawkes, M. J. Boulanger, and C. E. 777

Cameron. 2011. Bifunctional role of the Treponema pallidum extracellular matrix binding 778

adhesin Tp0751. Infection and immunity 79:1386-1398. 779

51. Haapasalo, M., K. Müller, V. Uitto, W. Leung, and B. McBride. 1992. 780

Characterization, cloning, and binding properties of the major 53-kilodalton Treponema 781

denticola surface antigen. Infection and immunity 60:2058-2065. 782

52. Flick, M. J., X. Du, J. M. Prasad, H. Raghu, J. S. Palumbo, E. Smeds, M. Höök, and 783

J. L. Degen. 2013. Genetic elimination of the binding motif on fibrinogen for the S. aureus 784

virulence factor ClfA improves host survival in septicemia. Blood 121:1783-1794. 785

53. Shannon, O., and J.-I. Flock. 2004. Extracellular fibrinogen binding protein, Efb, from 786

Staphylococcus aureus binds to platelets and inhibits platelet aggregation. Thrombosis and 787

haemostasis 91:779-789. 788

54. Choy, H. A., M. M. Kelley, J. Croda, J. Matsunaga, J. T. Babbitt, A. I. Ko, M. 789

Picardeau, and D. A. Haake. 2011. The multifunctional LigB adhesin binds homeostatic 790

proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans. PLoS 791

One 6:e16879. 792

55. Pinne, M., H. A. Choy, and D. A. Haake. 2010. The OmpL37 surface-exposed protein 793

is expressed by pathogenic Leptospira during infection and binds skin and vascular elastin. PLoS 794

neglected tropical diseases 4:e815. 795


.org/D

ownloaded from

http://iai.asm.org/

of 42

56. Vieira, M. L., M. V. Atzingen, T. R. Oliveira, R. Oliveira, D. M. Andrade, S. A. 796

Vasconcellos, and A. L. Nascimento. 2010. In vitro identification of novel plasminogen-797

binding receptors of the pathogen Leptospira interrogans. PLoS One 5:e11259. 798

57. Domingos, R. F., M. L. Vieira, E. C. Romero, A. P. Gonçales, Z. M. de Morais, S. A. 799

Vasconcellos, and A. L. Nascimento. 2012. Features of two proteins of Leptospira interrogans 800

with potential role in host-pathogen interactions. BMC microbiology 12:50. 801

58. Sun, H. 2006. The interaction between pathogens and the host coagulation system. 802

Physiology 21:281-288. 803

59. Janeway Jr, C. A., P. Travers, M. Walport, and M. J. Shlomchik. 2001. The 804

complement system and innate immunity. Immunobiology: The Immune System in Health and 805

Disease. 5th edition. Garland Science. 806

60. Joiner, K. A. 1988. Complement evasion by bacteria and parasites. Annual Reviews in 807

Microbiology 42:201-230. 808

61. Lindahl, G., U. Sjöbring, and E. Johnsson. 2000. Human complement regulators: a 809

major target for pathogenic microorganisms. Current opinion in immunology 12:44-51. 810

62. da Silva, L. B., L. dos Santos Miragaia, L. C. D. Breda, C. M. Abe, M. C. B. 811

Schmidt, A. M. Moro, D. Monaris, J. N. Conde, M. Józsi, and L. Isaac. 2015. Pathogenic 812

Leptospira species acquire factor H and vitronectin via the surface protein LcpA. Infection and 813

immunity 83:888-897. 814

63. Fraga, T. R., L. Isaac, and A. S. Barbosa. 2016. Complement evasion by pathogenic 815

Leptospira. Frontiers in immunology 7:623. 816

64. Barbosa, A. S., P. A. Abreu, S. A. Vasconcellos, Z. M. Morais, A. P. Gonçales, A. S. 817

Silva, M. R. Daha, and L. Isaac. 2009. Immune evasion of leptospira species by acquisition of 818

human complement regulator C4BP. Infection and immunity 77:1137-1143. 819

65. Meri, T., R. Murgia, P. Stefanel, S. Meri, and M. Cinco. 2005. Regulation of 820

complement activation at the C3-level by serum resistant leptospires. Microbial pathogenesis 821

39:139-147. 822

823

LEGEND TO FIGURES 824

Fig. 1. Phylogenetic analysis of Leptospira spp. based on the amino acid sequence of 825

LIC11966/ErpY-like protein of L. interrogans serovar Copenhageni by maximum 826

likelihood method. The amino acid sequence of ErpY-like protein was retrieved from NCBI-827

protein database, and a total of 14 orthologs of ErpY-like protein were retrieved through NCBI-828

protein BLAST. The obtained sequences were aligned, and the phylogenetic tree was constructed 829

using MEGA version 7.0.26 program. The tree with the highest log likelihood (-987.90), inferred 830

following 1000 bootstrap replications, is shown where the bootstrap value greater than 50 831


.org/D

ownloaded from

http://iai.asm.org/

of 42

indicates the reliability of the data. The tree was drawn to scale, with branch lengths measured in 832

the number of substitutions per site. The resulting phylogram shows that ErpY-like protein (red 833

box) is exclusively present in pathogenic species of Leptospira with a high level of sequence 834

conservation. 835

Fig. 2. Characterization of the recombinant Leptospira ErpY-like protein. 836

(A). Immunoblot analysis of recombinant and native ErpY-like antigen using anti-ErpY-like 837

protein antibody. Laboratory animal (mice) generated polyclonal antisera (1:1000) after 838

immunization with rErpY-like protein can detect both the native ErpY-like antigen in the 839

pathogenic Leptospira (L. interrogans serovars; Copenhageni, Lai or Canicola) and the purified 840

rErpY-like antigen (200 ng). The lysates of a non-pathogenic L. biflexa serovar Patoc was used 841

as a negative control in the immunoblot. (B). Phase-partitioning of whole-cell protein of L. 842

interrogans serovar Copenhageni using Triton X-114 and its immunoblot with the anti-rErpY-843

like antibody. Live leptospires were subjected to 1% Triton X-114 to partition proteins into 844

detergent (Det) and aqueous-phase (Aq) fractions. Phase partitioned proteins were resolved on 845

12% SDS-polyacrylamide gel, electroblotted on nitrocellulose membrane, and probed with anti-846

ErpY-like (1:1000) or anti-LipL32 (1:5000) or anti-LipL31 (1:2000) antibodies. The ErpY-like 847

protein was detected (15 kDa) predominantly in the detergent phase (top panel). LipL32, a 848

known outer membrane protein of Leptospira, was detected predominantly in the detergent phase 849

(middle panel) whereas a leptospiral cytoplasmic membrane protein LipL31 was detected in the 850

aqueous phase (bottom panel). Whole-cell lysate of L. interrogans serovar Copenhageni (W) was 851

used in the immunoblot as a marker for ErpY-like protein, LipL32 and LipL31. (C). Protease 852

accessibility assay of L. interrogans serovar Copenhageni using proteinase K (PK). Live 853


.org/D

ownloaded from

http://iai.asm.org/

of 42

leptospires suspensions (5×108

cells per suspension) were incubated with 5 µg of PK at indicated 854

time points. The suspensions were harvested, washed, resuspended in PBS, and coated on a 855

microtiter plate (5×107

cells per well). In ELISA, the reactivity of ErpY-like protein with its anti-856

serum showed a perpetual decrease in signal from 0-5 h of PK treatment. A similar trend of 857

reduction in signal was observed for OmpL54, a known surface-exposed outer membrane protein 858

of Leptospira. The serological detection of antigen LipL31, a known cytoplasmic membrane 859

protein of Leptospira, demonstrate the uncompromised integrity of leptospires inner membrane 860

during treatment with PK. Error bars represent SDs from three replicates and are indicative of 861

two independent experiments. Statistical analysis was performed using Student's t-test by 862

comparing the signals obtained for 0 h and other time points of treatment with proteinase K 863

(*P<0.05, **P<0.01, and ***P<0.001). 864

Fig. 3. Leptospirosis-positive sera of various hosts recognize recombinant-ErpY-like 865

protein. ELISA was performed with two antigens (rErpY-like and rLoa22) independently to 866

determine the reactivity of human, bovine and canine sera testing MAT-positive or -negative for 867

leptospirosis. Serum samples reactivity against the two antigens was recorded in triplicate. The 868

mean of absorbance values obtained from each serum sample is demarcated as empty circles or 869

as empty triangles for leptospirosis MAT-positive or -negative samples, respectively. Solid-black 870

horizontal lines represent the mean of each group. The cut-off value (dashed-black horizontal 871

lines) of the assay was derived from the mean of the absorbance values obtained from 872

leptospirosis MAT-negative samples (control group) plus two SDs (standard deviations) for the 873

antigen used. (A). ELISA to detect rErpY-like antigen (400 ng) using MAT-positive (n=50) and -874

negative (n=20) serum samples of human (1:100) for leptospirosis. Infected human sera 875

recognized the rErpY-like protein with 100% sensitivity and specificity. (B). ELISA to detect 876


.org/D

ownloaded from

http://iai.asm.org/

of 42

rLoa22 (400 ng) antigen using MAT-positive and -negative human serum samples for 877

leptospirosis. Infected human sera recognized the rLoa22 antigen with 100% sensitivity and 878

specificity. (C). Immunoblot of antigens (rErpY-like and rLoa22) using the pooled human 879

serum. Pooled human serum testing MAT-positive for leptospirosis recognized both antigens 880

(left panel). In contrast, there was no recognition of both antigens using a pooled human serum 881

testing negative for leptospirosis (right panel). (D). ELISA to detect rErpY-like antigen using 882

bovine serum samples testing MAT-positive (n=50) or -negative (n=20) for leptospirosis. (E). 883

ELISA to detect rLoa22 antigen using bovine serum samples testing MAT-positive or -negative 884

for leptospirosis. (F). Immunoblot using pooled bovine serum testing MAT-positive or -negative 885

for leptospirosis (G). ELISA to detect rErpY-like antigen using canine serum samples testing 886

MAT-positive (n=18) or -negative (n=18) for leptospirosis. (H). ELISA to detect rLoa22 antigen 887

using canine serum samples testing MAT-positive or -negative for leptospirosis. (I). Immunoblot 888

using pooled canine serum testing MAT-positive or -negative for leptospirosis. 889

Fig. 4. Recombinant ErpY-like protein binds to host extracellular matrix and plasma 890

components. 891

(A). Far-ultraviolet (190-240 nm) CD spectra of rErpY-like protein. The analysed CD spectra 892

data shows the predominance of α-helix (87.6%) which is in agreement to theoretically predicted 893

the secondary structure of the rErpY-like protein. The spectra represented as an average of three 894

scans with a scanning speed of 100 nm min−1

. (B). Interaction between rErpY-like protein and 895

commercial host ECM components. The binding of rErpY-like protein to ECM components 896

(laminin, fibronectin, collagen type I, chondroitin sulfate A &B, hyaluronic acid, heparan sulfate, 897

and elastin or plasma components; fibrinogen, plasminogen, factor H, and factor I) were 898


.org/D

ownloaded from

http://iai.asm.org/

of 42

analyzed through ELISA. The plasma components; fetuin (highly glycosylated protein) and 899

bovine serum albumin fraction V (non-glycosylated protein) were included as negative controls 900

for ligands. The rLoa22 that is known to interact moderately with host ECM components was 901

included in the assay as a negative control protein. Protein-specific antisera (anti-ErpY-like 902

protein or anti-Loa22 antibody) were used to measure the interaction of recombinant proteins 903

with host ligands. The rErpY-like protein was recorded to interact preferentially to plasma 904

fibrinogen followed by factor H and other host ligands. The bar represents mean absorbance 905

value (450 nm) for a ligand. Error bars are indicative of SDs from two independent experiments 906

each performed in triplicate. For statistical analyses, the binding of rErpY-like protein with host 907

ligands was compared to that with fetuin or BSA by the two-tailed t-test (***P<0.001). (C). Pure 908

rErpY-like protein forms supramolecule. The purified rErpY-like protein (0.5, 1 and 2 μg) were 909

resolved on a 4-20% native-PAGE and stained with Coomassie-blue. The standard native 910

molecular weight marker (M) was run in lane 1. The rErpY-like protein resolved at around 300 911

kDa. The gel in this figure has been spliced for labelling purpose. (D). Denaturing 912

polyacrylamide gel electrophoresis of rErpY-like protein after glutaraldehyde (GLD) cross-913

linking. Chemical cross-linking of rErpY-like protein with glutaraldehyde (0-45 min) show 914

multiple higher molecular weight bands when resolved in the presence (+) or absence (-) of DTT. 915

In the right panel, cross-linked product of two control proteins, β-casein and rLIC13341 916

demonstrate only one band of higher size. 917

Fig. 5: Analyses of rErpY-like supramolecule by DLS and FETEM. (A).Size distribution 918

profile of purified rErpY-like protein by dynamic light scattering. The purified rErpY-like 919

protein shows a single major peak with an average hydrodynamic diameter of 10.88±5.18 nm 920

whereas, the heat-denatured protein show a shift in the size distribution of the major peak with 921


.org/D

ownloaded from

http://iai.asm.org/

of 42

an average diameter of 163.6±57.92 nm and a minor peak corresponding to the non-aggregated 922

rErpY-like protein (red striped bars). The representative size distribution data of the 30 scans is 923

presented here. (B). Negative stain FETEM image of r-ErpY-like protein. FETEM image 924

demonstrates the self-assembly of the r-ErpY-like protein monomer into spherical particles of 925

nearly uniform shape and size (~20 nm diameter) throughout the grid. Sample image was 926

acquired at 40,000X magnification. Micrograph scale bar = 100 nm. For clarity particle-1 and -2 927

magnified images are shown. 928

Fig. 6. Binding characterization of the rErpY-like protein to human fibrinogen. (A). Dose-929

dependent binding of the rErpY-like protein to human fibrinogen. Fibrinogen (1 µg/well) coated 930

microtiter plates were incubated with increasing concentrations of rErpY-like protein (0.05-5 931

µM) and the ligand interaction was detected by anti-ErpY-like antibody (1:1000). The mean 932

absorbance values of rErpY-like protein binding to fibrinogen as a function of rErpY-like protein 933

concentration is shown. Binding saturation was recorded at 5 µM of rErpY-like protein with a 934

dissociation constant (KD) of 70.45±4.13 nM. (B). Heat-denatured rErpY-like protein fails to 935

bind human fibrinogen. The rErpY-like protein was heat-denatured for 10 minutes at 95 °C. The 936

untreated (control) or heat-denatured rErpY-like protein (0.25-5 µM) was allowed to interact 937

with fibrinogen-coated microtiter plates. In contrast to dose-dependent binding of the untreated 938

rErpY-like protein to fibrinogen, no significant change in binding to fibrinogen was observed 939

with increasing concentration of heat-denatured rErpY-like (ΔrErpY-like) protein. (C). Specific 940

antibody-mediated inhibition of rErpY-like antigen binding to human fibrinogen. The rErpY-like 941

protein was incubated individually with the antibody against rErpY-like/rLoa22/blank before its 942

interaction to fibrinogen-coated microtiter plates. The specific antibody-antigen complex 943

generation showed a reduction in interaction to fibrinogen (51%) relative to control with no 944


.org/D

ownloaded from

http://iai.asm.org/

of 42

antibody supplementation. In contrast, a relative reduction of 5% was observed when serum 945

against rLoa22 antigen was used as a non-specific antibody control. (D). Presence of rErpY-like 946

protein inhibits live leptospires adherence to human fibrinogen. Adhesion of leptospires to 947

fibrinogen was reduced in the presence of an increasing concentration of rErpY-like protein. 948

Fibrinogen bound leptospires were quantified by anti-Loa22 antibody, and the absorbance 949

obtained in the absence of rErpY-like protein was measured as 100%. The live leptospires 950

adherence to fibrinogen was reduced to 53% in the presence of saturated concentration (5 µM) of 951

rErpY-like protein. The binding measurements were performed in three replicates, and the data 952

shown are representative of two independent experiments. Statistical analyses were performed by 953

the two-tailed t-test (***P<0.001). 954

Fig. 7. Inhibition of thrombin-catalyzed fibrin clot formation in the presence of rErpY-like 955

protein. (A). Recombinant ErpY-like protein dose-dependent inhibition of fibrin clot reaction. 956

Increasing concentrations of rErpY-like protein (0.05-5 µM) were pre-incubated with human 957

fibrinogen (Fg; 1 mg mL-1

) in a microtiter plate for 2 hours at 37 °C before initiating the 958

thrombin (Thr; 10 mU/well) catalyzed fibrin clot formation. The clotting reaction in the well-959

containing fibrinogen plus thrombin is taken as a positive control, while the reaction containing 960

only fibrinogen is the negative control. The rLoa22 was used to check the specificity of clot 961

inhibition assay. The absorbance obtained during thrombin-catalyzed fibrin clot reaction was 962

measured at every 2 minutes for 40 min. The recorded absorbance (595 nm) versus time (min) 963

plot shows inhibition of thrombin catalyzed fibrin clot formation from fibrinogen in the presence 964

of rErpY-like protein. (B). Reduction in the percentage of fibrin clot formation in the presence of 965

rErpY-like protein. The absorbance obtained during fibrin clot formation in the positive control 966

of the assay shown in Fig 7A was taken as 100%. The fibrin clot formation at a saturation time 967


.org/D

ownloaded from

http://iai.asm.org/

of 42

point (40 min) in the presence of an increasing concentration of rErpY-like protein was 968

calculated in percentage. The thrombin catalyzed fibrin clot formation was reduced to 7% in the 969

presence of a saturated concentration of r-LIC11966 (5 µM). The measurements were performed 970

in triplicates, and the data shown is the representative of two independent experiments. Statistical 971

analysis was performed by the two-tailed t-test (***P<0.001). 972

Fig. 8. The recombinant and native ErpY-like protein interacts with complement factor H 973

present in human plasma. (A). Comparison of far-Western and Coomassie-Blue stained gel of 974

rErpY-like and rLoa22 proteins. The recombinant proteins (rErpY-like protein and rLoa22) 975

resolved on SDS-polyacrylamide gel was stained with Coomassie-blue to demonstrate the equal 976

loading of the recombinant proteins (top panel). An equivalent amount of recombinant proteins 977

were electroblotted onto the nitrocellulose membrane to perform Far-Western blot with anti-CFH 978

antibody after overlaying it with 10% human plasma. Far-Western blot demonstrated the rErpY-979

like protein (~18 kDa, blue arrowhead) interaction with CFH component of human plasma 980

whereas, rLoa22 (negative control) did not show any interaction with CFH (bottom panel). (B). 981

Comparison of far-Western and Coomassie-Blue stained gel of CFH. The human CFH (1 µg) of 982

150 kDa size was resolved on SDS-polyacrylamide gel and stained with Coomassie-Blue (top 983

panel). An equivalent amount of CFH was electroblotted onto nitrocellulose membrane and 984

overlaid with 100 ng/µl of rErpY-like protein (middle panel) or rLoa22 (bottom panel). Far-985

Western blot demonstrated the rErpY-like protein interaction with CFH (~150 kDa) whereas, 986

rLoa22 (negative control) did not show any interaction with CFH. (C). Comparison of far-987

Western blot and Coomassie-Blue stained gel of whole-cell lysate of Leptospira. The whole-cell 988

lysate of L. interrogans serovar Copenhageni was resolved on SDS-polyacrylamide gel for 989

Coomassie-Blue staining (left panel) and far-Western blot (middle panel). Detection at 990


.org/D

ownloaded from

http://iai.asm.org/

of 42

approximately 15 kDa (red arrowhead) demonstrates the possible interaction of native ErpY-like 991

protein of Leptospira to CFH present in of human plasma (middle panel). Detection of the native 992

protein (15 kDa, red arrowhead) in Leptospira lysate using anti-ErpY-like antibody (right panel). 993

The gels in this figure have been spliced for labelling purposes. 994

995

996

997


.org/D

ownloaded from

http://iai.asm.org/


.org/D

ownloaded from

http://iai.asm.org/

downloaded from on may 31, 2020 by guest · 4 karukriti kaushik ghosh 1*, aman prakash 1*, anusua...

Documents

downloaded from on may 31, 2020 by guest · 4 karukriti kaushik ghosh 1, aman prakash 1, anusua...