effect of cyp2c9 and vkorc1 genetic variations on …if-pan.krakow.pl/pjp/pdf/2013/5_1375.pdfeffect...

Effect of CYP2C9 and VKORC1 genetic

variations on warfarin dose requirements

in Indian patients

Sripriya Natarajan1, Chandrashekhar K. Ponde2, Rajesh M. Rajani2, Farah

Jijina2, Roopkumar Gursahani2, Pradnya P. Dhairyawan1, Tester F. Ashavaid1,3

1Research Laboratories,

2Department of Medicine,

3Department of Lab Medicine, P.D. Hinduja National Hospital

and Medical Research Centre, V. S. Marg, Mahim, Mumbai-400016, India

Correspondence: Tester F. Ashavaid, e-mail: [email protected] or [email protected]

Abstract:

Background: Warfarin, an oral anticoagulant is used in patients who are at increased risk of developing blood clots. The manage-

ment of warfarin therapy is challenging because it shows large inter and intra individual variability in patient response due to factors

like age, gender, diet, concurrent drug interactions and variations in CYP2C9 and VKORC1 genes. Studies implicate that polymor-

phisms in VKORC1 and CYP2C9 genes are associated with reduced doses of warfarin. The aim of our current study was to character-

ize the effects of VKORC1 and CYP2C9 gene variations that contribute to variability in warfarin dosing in Indian patients.

Methods: Genomic DNA was extracted from 103 patients undergoing warfarin therapy. Their mean daily warfarin dose, INR and

demographics were recorded and genotyping of VKORC1 and CYP2C9 gene was performed by PCR-RFLP method.

Results: Individuals with wild type genotypes required highest mean warfarin dosage of 4.72 mg/day while VKORC1 variants re-

quired 3.6 mg/day to maintain their therapeutic INR. CYP2C9*2 genotype was not found to affect the warfarin maintenance dosages.

The odds ratio for developing supra therapeutic INR in patients carrying VKORC1 variant allele when compared to wild types was

13.96 (95% CI; 4.85 – 44.65. Other factors affecting warfarin dosages were age and weight.

Conclusion: Inclusion of pharmacogenetic data along with clinical parameters would help better predict warfarin doses in Indian

patients.

Key words:

CYP2C9, genetic variations, Indians, VKORC1, warfarin

Abbreviations: APOE – apolipoprotein E gene, BMI – body

mass index, bp – base pair, CI – confidence interval, CYP1A1

– cytochrome P450 complex subunit 1A1, CYP1A2 – cyto-

chrome P450 complex subunit 1A2, CYP2C9 – cytochrome

P450 complex subunit 2C9, CYP3A4 – cytochrome P450 com-

plex subunit 3A4, DNA – deoxyribose nucleic acid, DVT –

deep vein thrombosis, df – degrees of freedom, EDTA – ethyle-

nediaminetetraacetic acid, GGCX – g-glutamyl carboxylase

gene, Htz – heterozygous, INR – international normalized ra-

tio, M – 50 base pair DNA ladder, Mut – homozygous mutant,

NC – negative control, OR – odds ratio, PCR-RFLP – po-

lymerase chain reaction-restriction fragment length polymor-

phism, UV – ultraviolet, VKORC1 – vitamin K epoxide reduc-

tase complex subunit 1, WT – wild type

Introduction

Warfarin has been in commercial use for medical pur-

pose since six decades, and till date it is the most popu-

lar oral anticoagulant in use. It is used for prophylaxis

of thromboembolic episodes in deep vein thrombosis

(DVT), pulmonary embolism, mechanical valve re-

placement and stroke due to atrial fibrillation [10].

Warfarin exerts its anticoagulant activity by inhib-

iting the C1 subunit of vitamin K epoxide reductase

enzyme (encoded by VKORC1 gene) and interfering

Pharmacological Reports, 2013, 65, 1375�1382 1375

Pharmacological Reports2013, 65, 1375�1382ISSN 1734-1140

Copyright © 2013by Institute of PharmacologyPolish Academy of Sciences

with cyclic interconversion of vitamin K and its 2,3-

epoxide. This decreases the available vitamin K epox-

ide in liver that is required for carboxylation and in

turn activation of coagulation factors II, VII, IX and X

[2, 8, 10, 18].

Warfarin is a racemic mixture of R- and S-warfarin

and they both differ in their potency and metabolism. S-

warfarin is 5 times more potent than R-warfarin and me-

tabolized mainly by CYP2C9 enzyme in liver to S-7-

hydroxywarfarin whereas R-warfarin is metabolized to

minor end products like R- 6-, 8- and 10-hydroxywarfarin

by CYP1A1, CYP1A2 and CYP3A4 [2, 8, 10].

Currently, the anticoagulation status of an individual

is monitored by blood prothrombin time using interna-

tional normalized ratio (INR). Warfarin has a narrow

range for INR [8] and maintaining this therapeutic

range is very important as a sub therapeutic INR

caused due to underdosing leads to thrombosis and

a supra therapeutic INR due to overdosing increases

the risk of bleeding. Physicians find it extremely prob-

lematic to adjust warfarin dosage as this treatment

shows a large inter- and intraindividual variability. The

cause of this is the complexity of coagulation cascade,

and numerous clinical factors like age, gender, BMI,

vitamin K intake and concomitant drugs [13, 15].

Evidence accumulated in the last decade attributes

almost 40% variability in warfarin dosage to genetic

variants in genes involved in warfarin metabolism and

activity. Aithal and his associates were the first to re-

port direct associations between warfarin dosage and

CYP2C9 gene variants in 1999 [1], while the informa-

tion on VKORC1 gene variants on warfarin doses be-

came available in 2004 [23].

The most reported and studied single nucleotide

polymorphisms in CYP2C9 gene are

CYP2C9*2(430C>T) and CYP2C9*3(1075A>C).

Both *2 and *3 alleles have impaired hydroxylation

of S-warfarin with 12% and less than 5% of wild type

activity, respectively. These variations decrease the

degradation and clearance of warfarin and therefore, a

low dosage is needed to maintain therapeutic INR

[16].

VKORC1-1639G>A, a promoter polymorphism,

present in linkage disequilibrium with VKORC

11173C>T is also an important factor in affecting

warfarin dosage. This polymorphism alters the bind-

ing site for VKORC1 transcription factor and leads to

lower VKORC1 mRNA expression in human liver. As

a result, the steady-state concentration of tissue

VKOR decreases making a person with this variation

more susceptible to inhibition by warfarin and caus-

ing warfarin sensitivity [7, 16].

African-Americans require the highest doses of war-

farin followed by Caucasians, and Asians are most sen-

sitive to warfarin [7]. Amongst Asians too, Indians re-

quire higher doses than Chinese, Japanese and Malays.

A part of this variability can be contributed to differ-

ences in frequency and effect of these genetic varia-

tions. The inhabitants of North India and South India

are ethnically and also genetically very different with

huge difference in the allele frequencies of VKORC1

and CYP2C9 gene variations [12, 19, 22]. Very few

data and that too especially from the South Indian

population is available on the effect of these variations

on warfarin dosage. Hence, due to lack of sufficient

data in a heterogeneous Indian population, the aim of

our study was to identify the magnitude of effect of

CYP2C9*2, CYP2C9*3, VKORC1-1639G>A and

VKORC11173C>T genetic variations on warfarin dos-

age in subjects residing in the metropolitan city of

Mumbai that includes inhabitants who are diverse eth-

nically, culturally and genetically and can thereby rep-

resent the whole of Indian population.

Materials and Methods

Patients

The study included 103 patients who were receiving

warfarin therapy at P. D. Hinduja National Hospital

and Medical Research Centre, Mumbai, India. The

clinical indications of warfarin therapy were mechani-

cal valve replacement, DVT, pulmonary embolism,

atrial fibrillation and stroke. Patients with liver, kid-

ney or gastrointestinal diseases were excluded from

the study. Clinical information including age, gender,

weight, concomitant drugs, mean daily warfarin dos-

age and mean INRs were noted down. The study was

approved by the institutional review board and re-

search ethics committee and informed consent was

obtained from all participants.

DNA extraction and genotyping

Whole blood samples were collected in EDTA tubes.

Genomic DNA was extracted using modified Miller et

al. method [17]. The extracted DNA was genotyped

for VKORC1-1639G>A, VKORC11173C>T, CYP2C9

1376 Pharmacological Reports, 2013, 65, 1375�1382

*2(430C>T) and CYP2C9*3(1075A>C) polymor-

phisms using PCR-RFLP technique. The restriction

enzyme digested products were separated on 3% aga-

rose gel and visualized with ethidium bromide under

UV illumination. The 50 µl reaction mixture for

VKORC1-1639G>A variation consisted of 1X PCR

buffer (Fermentas), 200 µM dNTPs, 3 mM MgCl2, 17

pmol of both forward and reverse primers, 1 unit of

Taq DNA polymerase (Fermentas) and 2 µl of tem-

plate DNA. The 50 µl reaction mixture for each

VKORC11173C>T, CYP2C9*2 and CYP2C9*3 varia-

tion consisted of 1X PCR buffer, 200 µM dNTPs, 1.5

mM MgCl2, 20 pmol of both forward and reverse

primers, 1 unit of Taq DNA polymerase and 2 µl of

template DNA. The primer sequences, PCR condi-

tions and restriction enzymes (Fermentas) used are

summarized in Table 1. The results were further vali-

dated by outsourcing representative samples of all the

variations for automated DNA sequencing by Sanger’s

method to Chromous Biotech, Bangalore. A represen-

tative gel picture and chromatogram for VKORC1 and

CYP2C9 genotypes are given in Figure 1.


Gene variants and warfarin dosing in IndiansSripriya Natarajan et al.

Tab. 1. PCR conditions for genetic analysis of CYP2C9 and VKORC1 variations. a The PCR conditions were repeated for 34 cycles. WT – wildtype; Htz – heterozygous; Mut – homozygous mutant; bp – base pairs

Variation PrimersPCR

conditionsaPCR

product sizeRestrictionenzyme (RE)

REdigestion product size

VKORC1-

1639G>A

F-5’GAGCCAGCAGGAGAGGGAAATAT3’R-5’GTTTGGACTACAGGTGCCTGCC 3’

94°C/1 min68°C/1 min72°C/1 min

291 bp Msp I WT-167 + 124 bpHtz-291 + 167 + 124 bp

Mut-291 bp

VKORC1

1173C>T

F-5’CTAAGATGAAAAGCAGGGCCTAC3’R-5’CTGCCCGAGAAAGGTGATTTCC3’


201 bp Sty I WT-127 + 74 bpHtz-201 + 127 + 74 bp

Mut-201 bp

CYP2C9*2(430C>T)

F-5’TCCTAGTTTCGTTTCTCTTCCTGT3’R-5’ATAGTAGTCCAGTAAGGTCAGTGA3’


221 bp Ava II WT-122 + 99 bpHtz-221 + 122 + 99 bp

Mut-221 bp

CYP2C9*3(1075A>C)

F-5’CACGAGGTCCAGAGATGCATTG3’R-5’CTTCGAAAACATGGAGTTGCAGT3’


135 bp Nsi I WT-116 + 19 bpHtz-135 + 116 + 19 bp

Mut-135 bp

Fig. 1. Representative gel picture andchromatogram showing VKORC1 andCYP2C9 genotypes. 1a: Agarose gel(3%) showing VKORC1 genotypes[Lane 1, 4 – Wild type for VKORC1-1639G>A and VKORC11173C>T, re-spectively; Lane 2, 5 – Heterozygousfor VKORC1-1639G>A and VKORC11173C>T, respectively; Lane 3, 6 –Homozygous mutant for VKORC1-1639G>A and VKORC11173C>T, res-pectively]; 1b-1c: DNA chromatogramfor VKORC1-1639G>A and VKORC11173CT, respectively; 2a: Agarose gel(3%) showing CYP2C9 genotypes[Lane 1, 4 – Wild type for CYP2C9*2and CYP2C9*3, respectively; Lane 2 –Heterozygous for CYP2C9*2; Lane 3 –Homozygous mutant for CYP2C9*2];2b-2c: DNA chromatogram for CYP-2C9*2(430C>T) and CYP2C9*3 (1075-A>C), respectively (Sequencing forCYP2C9*3 variation with reverse pri-mer). ¶ L – 50 base pair DNA ladder,NC – negative control, bp – base pair

Statistical analysis

The distribution of alleles for their accordance with

Hardy Weinberg equilibrium was calculated by c2

test. Comparisons of mean daily warfarin dosage be-

tween different genotypes was calculated by Mann-

Whitney test and odds ratio at 95% CI was also calcu-

lated where necessary. The effect of age, gender,

weight, medications and genotypes on the mean war-

farin dosage was calculated by multivariate logistic

regression analysis. All analysis was carried out using

statistical software Epi Info 3.5.3.

Results

A total of 103 patients (56 males and 47 females) who

were on warfarin therapy were included into the

study. The other baseline demographics are given in

Table 2.

The mean INR for majority of the patients (n = 54;

53%) was 2.0–3.5 irrespective of their clinical indica-

tion, whereas 49 patients (47%) had their mean INRs

lower than that required by clinical indication but

were considered stable by their physicians.

VKORC1-1639G>A and 1173C>T variation was

found to be present in complete linkage disequilib-

rium in our study sample. The genotypic frequencies

of VKORC1 and CYP2C9 genetic variants are given

in Table 3. The frequency of VKORC1 variant allele

was found to be 13.11% and its wild type allele was

found to be 86.89%. The allelic frequency of CYP2C9

wild type allele *1 was found to be 94.6%, whereas

it’s variant allele *2 was found to be present in 5.4%

of our study samples. The variant allele *3 of

CYP2C9 was not found in our study sample. All the

variations were found to be in accordance with Hardy

Weinberg equilibrium (p = 0.04 for VKORC1 and p =

1.86 for CYP2C9*2; df = 1).


Fig. 2. Mean warfarin dosage among VKORC1 and CYP2C9*2 genotypes. § – statistically significant

Tab. 2. Baseline characteristics of study population (n = 103). a Themost common concurrent medications interacting with warfarin andtheir frequency in the study sample. Many patients had more thanone concurrent interacting drugs

Mean age (years): 52 ± 14

Mean weight (kg): 66.5 ± 13.6

Gender:

Male 56 (54%)

Female 47 (46%)

Clinical indication:

Mechanical valve replacement 55 (53%)

Deep vein thrombosis 24 (23%)

Pulmonary embolism 7 (7%)

Atrial fibrillation 6 (6%)

Stroke 6 (6%)

Others 5 (5%)

Concurrent interacting medicationsa:Aspirin 25

Amiodarone 8

Thyroxine 7

Clopidogrel 9

Fenofibrate 2

Phenytoin 3

The mean daily warfarin dosage among different

genotypes is given in Figure 2. No significant differ-

ence (p = 0.67) was seen in the mean daily warfarin

requirements between CYP2C9*2 heterozygotes and

the wild types. Only one patient was found to be ho-

mozygous mutant for CYP2C9*2 variation and re-

quired 2 mg less warfarin dose per day than the wild

types. The mean daily warfarin dosage in patients

with VKORC1 variant allele was, however, found to

be significantly (p = 0.02) lower than those with the

presence of wild type alleles. Patients who were ho-

mozygous mutant for the VKORC1 variant allele re-

quired almost 2 mg/day less and those who were het-

erozygous for the VKORC1 variant allele required

1 mg/day less than their wild type counterparts. Also

one patient was found to be compound heterozygote

for VKORC1 and CYP2C9*2 variations and required

4.5 mg/day warfarin dose.

Along with the genotypic variation, certain clinical

parameters are also found to affect warfarin dosages.

A multiple logistic regression analysis was carried out

with weight, age and VKORC1 genotype with mean

daily warfarin dosage. The results of regression analy-

ses are presented in Table 4. The R2 for final multiple

regression analysis model is 21%.

When the patients carrying VKORC1 and CYP2C9

variations were compared with those having wild type

genotypes, it was found that the likelihood of devel-

oping a supra therapeutic INR within four standard

5 mg/day warfarin dose was 13.96 times higher

among those who carry a VKORC1 variant allele (OR

= 13.96; 95% CI; 4.85 – 44.65). None of the CYP2C9

heterozygote developed supra therapeutic INR, but

CYP2C9*2/*2 homozygote developed supra thera-

peutic INR within four doses of standard 5 mg/day

warfarin dosage.

Discussion

In this study, we characterized the effect of CYP2C9

and VKORC1 genetic variations and clinical parame-

ters on warfarin dose requirements in patients under-

going warfarin therapy.

Although a majority of patients (53%) had their

INR within therapeutic range, 47% of patients had

their INR in the sub-therapeutic range. These indi-

viduals have been on long term warfarin therapy. It is

reported that the risk of thrombosis in such patients is

markedly reduced by long term anticoagulation but is

associated with higher rate of major bleeding. This

risk is further increased with addition of antiplatelet

therapy [5, 14]. Hence, even though these patients’

INRs were less than what their clinical indication de-

manded, they were included into the study because

the physicians considered them stable.

About 90% of the Chinese population carries

VKORC1 variant allele, whereas only 20% of the

Caucasians have these variations [6, 20, 24, 30]. In In-

dians, VKORC1 variant allele is present in 12-14% of

population as given by earlier published articles [12,

19, 22]. The importance of the functional promoter

polymorphism, –1639G>A in VKORC1 gene on the

warfarin dose requirements has also been studied by

many [1, 6, 16, 20, 21, 24, 27, 30, 31]. Our results

were also consistent with their findings with patients

who were identified as harboring VKORC1 variant al-

lele (even as a single copy), requiring lower than stan-

dard warfarin doses to maintain their INR in the thera-

peutic range. In fact, even the presence of a single

copy of the variant allele made the individual sensi-

tive to warfarin therapy. This variant allele was found



Tab. 3. Distribution of VKORC1 and CYP2C9 genotypes (n = 103)

Gene Genotype Frequency (%)

VKORC1 VKORC1-1639GG and 1173CC(wild type)

78 (76)

VKORC1-1639GA and 1173CT(heterozygous)

23 (22)

VKORC1-1639AA and 1173TT(homozygous mutant)

2 (2)

CYP2C9 CYP2C9*1/*1 (wild type) 93 (90)

CYP2C9*1/*2 (heterozygous) 9 (9)

CYP2C9*2/*2 (homozygousmutant)

1 (1)

Tab. 4. Multiple regression analysis between weight, age andVKORC1 genotype with warfarin dosage. Model R2 = 21.0%

Predictor Coefficient p value

Intercept 3.291 –

Weight 0.048 0.008

Age –0.034 0.01

VKORC1 genotype –1.16 0.003

in 13.11% of our study population while the GA and

AA genotype was found in 22 and 2% of the study

population, respectively.

Seventy six percent patients with VKORC1 variant

allele developed supra therapeutic INR (> 4) within

four standard warfarin doses of 5 mg/day. Their INR

was, however, brought down to therapeutic range and

was maintained within it when their warfarin dose

was decreased to 2–3 mg/day. Thus, the likelihood of

developing a supra therapeutic INR for an individual

carrying VKORC1 variation was found to be 13.96

times higher than the wild types (OR = 13.96; 95%

CI: 4.85 – 44.65).

In Caucasians, CYP2C9*2 variation is found in

16% and CYP2C9*3 variation in 6.5% of the popula-

tion. It is very rare or absent in Chinese and Japanese

population, whereas it is found to be present in 3–8%

in specific Indian cohorts [6, 12, 20, 22, 24, 30]. In

our study sample, we found *2 variant allele to be

present in 5.4% of our study population whereas *3

variant allele was completely absent. This could be

due to the fact that even though this variant is not

completely absent in our population, it is present in

very low frequencies and therefore, may have been

undetected in our small sample size. The results were

also further validated by outsourcing 10% of the rep-

resentative samples in form of PCR products for each

of the variations, for automated DNA sequencing as

also mentioned in the methods section. These varia-

tions due to its rarity have not been studied and re-

ported much in Asians but have been associated with

reduced warfarin doses in Caucasian populations [21,

26, 27, 31]. However, in our study sample, individuals

having *2 variation did not have significant difference

in warfarin dosage over the wild types.

Individuals harboring the CYP2C9*3 variation are

said to have increased risk of supra therapeutic INR

and bleeding complications within 3 months of start

of warfarin therapy [26]. In our study sample

CYP2C9*3 allele was absent and none of the indi-

viduals having CYP2C9*2 variation in heterozygous

form developed supra therapeutic INR. In contrast,

patients harboring VKORC1 variation developed su-

pra therapeutic INR, and thus it can be suggested that

in our study sample, CYP2C9 gene variants had very

little or no effect as compared to VKORC1 variation,

on the warfarin dosage or the risk of developing supra

therapeutic INR and bleeding complications. This is

consistent with the earlier findings which state that re-

duced warfarin dosage by Asians may be contributed

mainly by VKORC1 genetic variations because

CYP2C9 gene variants are very rare or absent in them

[20, 30].

According to the literature, an individual, carrying the

*3 allele of CYP2C9 gene is more important than carry-

ing VKORC1 variant allele, since VKORC1 variant al-

lele only contributes to 25–30% reduction in warfarin

dosage as opposed to almost 95% reduction explained

by CYP2C9*3 variant [26–28]. But on a population

level, VKORC1 is more important simply because it is

found in higher frequency in our population.

Clinical parameters like age, weight, gender have

already been shown to affect warfarin dosage [8].

Hence, a univariate logistic regression analysis of

weight, age, gender, concurrent medications and

VKORC1 and CYP2C9 genotypes individually with

mean daily warfarin dosage was carried out. Of these,

only weight, age and VKORC1 genotype were found

to have p < 0.1. Thus, a multiple logistic regression

analysis was carried out with weight, age and

VKORC1 genotype with mean daily warfarin dosage.

Although it has been seen that females require lower

warfarin doses than males [8], in our present study it

was seen that gender had no effect on warfarin dos-

age. Also warfarin dose requirement increases propor-

tionally with weight, while with increase in age, war-

farin dose requirement decreases. Thus the warfarin

dosage required by a patient needs to be carefully esti-

mated.

Three individuals, in spite of being VKORC1 het-

erozygote, required higher warfarin doses compared

to other VKORC1 heterozygotes and likewise, few in-

dividuals having wild type genotypes required much

lower maintenance dose of warfarin. This can be at-

tributed to certain other variations in same genes or

other genes like CYP4F2, GGCX, APOE, clotting fac-

tor genes, etc. [3, 4, 11, 25, 29]. Hence, further studies

are required to identify these variations and their ef-

fect on warfarin doses.

As cited by Titus, earlier this year, several smaller

studies have drawn attention to the benefit of imple-

menting pharmacogenetic testing for warfarin ther-

apy. This idea is also being backed by various ongo-

ing trails – GIFT, COAG, EU-PACT, etc. [28].

In conclusion, we report that clinical parameters like

age and weight along with VKORC1 gene variants af-

fect the warfarin dosage in our study population. Pa-

tients who are having VKORC1 variations required

lower than 5 mg/day of warfarin dose to maintain INR

within therapeutic range, while majority of CYP2C9*2


heterozygotes and wild types maintained their thera-

peutic INR with the standard 5 mg/day of warfarin

dosage. Thus, along with clinical parameters, a prior

knowledge of the patient’s genotype can be used to de-

cide about initial warfarin dose required by an individ-

ual to maintain therapeutic INR and can thereby help in

reducing the risk of developing supra therapeutic INR

and bleeding complications in Indian patients.

Conflict of interest:

There is no actual or potential conflict of interest capable

of influencing the judgment on the part of any authors.

Acknowledgment:

This study was funded by National Health and Education Society

(NHES) of P. D. Hinduja National Hospital and Medical Research

Centre.

References:

1. Aithal G, Day C, Kesteven P, Daly A: Association of

polymorphisms in the cytochrome P450 CYP2C9 with

warfarin dose requirement and risk of bleeding compli-

cations. Lancet, 1999, 353, 717–719.

2. Ansell J, Hirsh J, Dalen J, Bussey H, Anderson D,

Poller L, Jacobson A et al.: Managing oral anticoagulant

therapy. Chest, 2001, 119, 22S–38S.

3. Caldwell MD, Awad T, Johnson JA, Gage BF, Falkowski

M, Gardina P, Hubbard J et al.: CYP4F2 genetic variant al-

ters required warfarin dose. Blood, 2008, 111, 4106–4112.

4. Caldwell MD, Berg RL, Zhang KQ, Glurich I, Schmel-

zer JR, Yale SH, Vidaillet HJ, Burmester JK: Evaluation

of genetic factors for warfarin dose prediction. Clin Med

Res, 2007, 5, 8–16.

5. Cannegieter SC, Rosendaal FR, Briët E: Thromboem-

bolic and bleeding complications in patients with me-

chanical heart valve prostheses. Circulation, 1994, 89,

635–641.

6. Dumas TE, Hawke RL, Lee CR: Warfarin dosing and

the promise of pharmacogenomics. Curr Clin Pharmacol,

2007, 2, 11–21.

7. Gage BF, Eby C, Johnson JA, Deych E, Rieder MJ,

Ridker PM, Milligan PE et al.: Use of pharmacogenetic

and clinical factors to predict the therapeutic dose of

warfarin. Clin Pharmacol Ther, 2008, 84, 326–331.

8. Garcia D, Regan S, Crowther M, Hughes RA, Hylek

EM: Warfarin maintenance dosing patterns in clinical

practice: implications for safer anticoagulation in the eld-

erly population. Chest, 2005, 127, 2049–2056.

9. Hirsh J, Dalen JE, Anderson DR, Poller L, Bussey H,

Ansell J, Deykin D, Brandt JT: Oral anticoagulants:

mechanism of action, clinical effectiveness, and optimal

therapeutic range. Chest, 2001, 119, 8S–21S.

10. Hirsh J, Fuster V, Ansell J, Halperin JL: American Heart

Association/American College of Cardiology Foundation

guide to warfarin therapy. J Am Coll Cardiol, 2003, 7,

1633–1652.

11. Huang SW, Xiang DK, Huang L, Chen BL, An BQ,

Li GF, Luo ZY: Influence of GGCX genotype on war-

farin dose requirements in Chinese patients. Thromb

Res, 2011, 127, 131–134.

12. Jose R, Chandrasekaran A, Sam SS, Gerard N, Chano-

lean S, Abraham BK, Satyanarayanamoorthy K et al.:

CYP2C9 and CYP2C19 genetic polymorphisms: frequen-

cies in the south Indian population. Fundam Clin Phar-

macol, 2005, 19, 101–105.

13. Kamali F, Pirmohamed M: The future prospects of phar-

macogenetics in oral anticoagulation therapy. Br J Clin

Pharmacol, 2006, 61, 746–751.

14. Kearon C: Long-term management of patients after ve-

nous thromboembolism. Circulation, 2004, 110, I10–I18.

15. Limdi NA, Veenstra DL: Warfarin pharmacogenetics.

Pharmacotherapy, 2008, 28, 1084–1097.

16. Linder MW, Bon Homme M, Reynolds KK, Gage BF,

Eby C, Silvestrov N, Valdes R Jr: Interactive modeling

for ongoing utility of pharmacogenetic diagnostic test-

ing: application for warfarin therapy. Clin Chem, 2009,

55, 1861–1868.

17. Miller SA, Dykes DD, Polesky HF: A simple salting out

procedure for extracting DNA from human nucleated

cells. Nucleic Acids Res, 1988, 16, 1215.

18. Moyer TP, O’Kane DJ, Baudhuin LM, Wiley CL, Fortini

A, Fisher PK, Dupras DM et al.: Warfarin sensitivity

genotyping: A review of the literature and summary of pa-

tient experience. Mayo Clin Proc, 2009, 84, 1079–1094.

19. Nahar R, Deb R, Saxena R, Puri RD, Verma IC: Variabil-

ity in CYP2C9 allele frequency: a pilot study of its pre-

dicted impact on warfarin response among healthy South

and North Indians. Pharmacol Rep, 2013, 65, 187–94.

20. Oner Ozgon G, Langaee TY, Feng H, Buyru N, Ulutin T,

Hatemi AC, Siva A et al.: VKORC1 and CYP2C9 poly-

morphisms are associated with warfarin dose require-

ments in Turkish patients. Eur J Clin Pharmacol, 2008,

64, 889–894.

21. Pavani A, Naushad SM, Rupasree Y, Kumar TR,

Malempati AR, Pinjala RK, Mishra RC, Kutala VK:

Optimization of warfarin dose by population-specific

pharmacogenomic algorithm. Pharmacogenomics J,

2012, 12, 306–311.

22. Rathore SS, Agarwal SK, Pande S, Mittal T, Mittal B:

Frequencies of VKORC1-1639G>A, CYP2C9*2 and

CYP2C9*3 genetic variants in North Indian Population.

Biosci Trends, 2010, 4, 333–337.

23. Rost S, Fregin A, Ivaskevicius V, Conzelmann E,

Hörtnagel K, Pelz HJ, Lappegard K et al.: Mutations in

VKORC1 cause warfarin resistance and multiple coagu-

lation factor deficiency type 2. Nature, 2004, 427,

537–541.

24. Sconce EA, Khan TI, Wynne HA, Avery P, Monkhouse

L, King BP, Wood P et al.: The impact of CYP2C9 and

VKORC1 genetic polymorphism and patient characteris-

tics upon warfarin dose requirements: proposal for a new

dosing regimen. Blood, 2005, 106, 2329–2333.

25. Shikata E, Ieiri I, Ishiguro S, Aono H, Inoue K, Koide T,

Ohgi S, Otsubo K: Association of pharmacokinetic

(CYP2C9) and pharmacodynamic (factors II, VII, IX,



and X; proteins S and C; and g-glutamyl carboxylase)

gene variants with warfarin sensitivity. Blood, 2004, 103,

2630–2635.

26. Takahashi H, Echizen H: Pharmacogenetics of CYP2C9

and interindividual variability in anticoagulant response

to warfarin. Pharmacogenomics J, 2003, 3, 202–214.

27. Takeuchi F, Kashida M, Okazaki O, Tanaka Y, Fukuda S,

Kashima T, Hosaka S et al.: Evaluation of pharmacoge-

netic algorithm for warfarin dose requirements in Japa-

nese patients. Circ J, 2010, 74, 977–982.

28. Titus K: Warfarin pharmacogenetics a waiting game.

CAP TODAY [Internet]. 2012 May [cited 2012 Oct.];

Available from: http://www.cap.org/apps/cap.por-

tal?_nfpb=true&cntvwrPtlt_actionOver-

ride=%2Fportlets%2FcontentViewer%2Fshow&_win-

dowLabel=cntvwrPtlt&cntvwrPtlt%7BactionForm.con-

tentReference%7D=cap_today%2F0512%2F0512a_war-

farin.html&_state=maximized&_pageLabel=cntvwr

29. Wadelius M, Chen LY, Downes K, Ghori J, Hunt S,

Eriksson N, Wallerman O et al.: Common VKORC1 and

GGCX polymorphisms associated with warfarin dose.

Pharmacogenomics J, 2005, 5, 262–270.

30. Yuan HY, Chen JJ, Lee MT, Wung JC, Chen YF, Charng

MJ, Lu MJ et al.: A novel functional VKORC1 promoter

polymorphism is associated with inter-individual and

inter-ethnic differences in warfarin sensitivity. Hum Mol

Genet, 2005, 14, 1745–1751.

31. Zhu Y, Shennan M, Reynolds KK, Johnson NA, Herrn-

berger MR, Valdes R Jr, Linder MW: Estimation of war-

farin maintenance dose based on VKORC1-1639G>A

and CYP2C9 genotypes. Clin Chem, 2007, 53,

1199–1205.

Received: November 21, 2012; in the revised form: April 12,

2013; accepted: April 18, 2013.


effect of cyp2c9 and vkorc1 genetic variations on …if-pan.krakow.pl/pjp/pdf/2013/5_1375.pdfeffect...

Documents