effects of kangquan recipe (康泉方) on sex steroids and cell proliferation in rats with benign...

7/27/2019 Effects of Kangquan Recipe ( ) on sex steroids and cell proliferation in rats with benign prostatic hyperplasia

1/4

289 Chin J Integr Med 2009 Aug;15(4):289-292

Benign prostatic hyperplasia (BPH) is a common

disease in old males. Epidemiological investigations

reveal that the incidence of BPH in males over 60

years of age was more than 50%, and 15% to 30%

of those are suffering from the lower urinary tract

symptoms (LUTS). BPH greatly affects people's health

and the quality of life. Chinese medicine has been

widely applied to treat BPH because of its reliable

effects, low cost, and few adverse reactions(1,2).

Our previous studies showed that Kangquan

Recipe (, KQR) could obviously inhibit thepathological hyperplasia of the prostate gland

and gland epithelium, decrease the number of the

epithelial papillary structureand effectively regulate

the mRNA expressions of bax and bcl-2 in prostate

tissues to accelerate the cell apoptosis of the prostate

in experimental BPH rats(3). On this basis, we further

studied its effect on the levels of plasma testosterone

(T) and estradiol (E2) and the mRNA expression of

proliferating cell nuclear antigen (PCNA) in prostate

tissues of BPH rats. The report is as follows.

METHODSExperimental Animals

Seventy-two male Sprague-Dawley rats, clean

grade, and weighing 230-260 g were provided by

the Shanghai Shilaike Experimental Animal Co.,

Ltd., China, with a certificate serial number SCXK

(Shanghai) 20030003.

Drugs and Reagents

KQR, composed of Radix morinda officinalis15 g,

eupolyphaga seu steleophaga 15 g, pheretima 15 g, Radix

et Rhizoma Rhei5 g, Ramulus Cimmamomi5 g, andcaulis trachelospermi20 g, was provided by the Fujian

EXPERIMENTAL RESEARCH

Effects of Kangquan Recipe () on Sex Steroids and Cell

Proliferation in Rats with Benign Prostatic HyperplasiaHUANG Yuan-peng ()12, DU Jian ( )2, HONG Zhen-feng ()2,

Chen Zhi-qing ()1, Wu Jin-fa ()1, and Zhao Jin-yan ()2

Supported by the Foundation of Traditional Chinese Medicineof Fujian Province (No. wzy0616), the Foundation of KeyProjects from Science and Technology Department of FujianProvince (No. 2008Y0049), and the Foundation of Science andTechnology Department of Xiamen (No. 3502Z20084014)1. Department of Traditional Chinese MedicineZhongshanHospital, Xiamen University, Fujian (361004), China; 2.Academy of Integrative Medicine, Fujian College of TraditionalChinese Medicine, Fuzhou (350108), ChinaCorrespondence to: Prof. HONG Zhen-feng, Tel/Fax:86-591-22861012, E-mail: [email protected]: 10.1007/s11655-009-0289-3

ABSTRACTABSTRACT Objective:Objective: To investigate the effects of Kangquan Recipe (, KQR) on sex steroids and cellTo investigate the effects of Kangquan Recipe (, KQR) on sex steroids and cellproliferation in an experimental benign prostatic hyperplasia (BPH) model in rats.proliferation in an experimental benign prostatic hyperplasia (BPH) model in rats. Methods:Methods: Seventy-two SD ratsSeventy-two SD ratswere randomly divided into six groups: the normal group, the model group, the finasteride group, and the low-,were randomly divided into six groups: the normal group, the model group, the finasteride group, and the low-,middle-, and high-dose KQR groups, 12 in each group. Except those in the normal group, the rats were injectedmiddle-, and high-dose KQR groups, 12 in each group. Except those in the normal group, the rats were injectedwith testosterone after castration for the establishment of BPH model and then given respectively with normalwith testosterone after castration for the establishment of BPH model and then given respectively with normalsaline, finasteride, and low-, middle-, and high-dose of KQR for 30 days. The levels of plasma testosterone (T)saline, finasteride, and low-, middle-, and high-dose of KQR for 30 days. The levels of plasma testosterone (T)and estradiol (Eand estradiol (E2) were determined by enzyme-linked immunosorbent assay (ELISA), and the mRNA expression) were determined by enzyme-linked immunosorbent assay (ELISA), and the mRNA expressionof proliferating cell nuclear antigen (PCNA) in prostate tissue was detected by reverse transcription-polymeraseof proliferating cell nuclear antigen (PCNA) in prostate tissue was detected by reverse transcription-polymerasechain reaction (RT-PCR) after administration.chain reaction (RT-PCR) after administration. Results:Results: Compared with the model group, the prostate weight, theCompared with the model group, the prostate weight, theplasma T, and the mRNA expression of PCNA were significantly lower, and the plasma Eplasma T, and the mRNA expression of PCNA were significantly lower, and the plasma E 2 and the ratio of Eand the ratio of E2/T/Twere higher in the three KQR groups (were higher in the three KQR groups (P


2/4


Tongchun Medicament Stock Company, China. The

preparation room of the Fujian College of Traditional

Chinese Medicine was responsible for its preparation

and quality control. The drugs were decocted and

concentrated, each milliliter containing 1.3 g of crude

drugs. Proscar (batch No. 260970): each contains

5 mg finasteride, provided by Merck Sharp & Dohme

Limited, UK. After griding, it was added into 80

distilled water to solve.

Enzyme-linked immunosorbent assay (ELISA)

kits for T and E2 were both purchased from the Beijing

North Institute of Biological Technology, China. Trizol

was obtained from Invitrogen Company, USA. DNTP

and M-MLV reverse transcriptase were bought from

Promega Company, USA. Taq polymerase and RNase

inhibitor were obtained from Amresco Company, USA.

Experimental Apparatus

Type 9600 PCR instrument was manufactured

by Eppendorf Company, Germany. Type Gel DOC

2000 gel digital imaging and analysis system was by

Bio-Rad Company, USA. Electrophoresis instrument

and horizontal shafts electrophoresis (Type DYY-12)

was by Bio-Rad Company, USA. Type DU-650 RNA/

DNA quantitative detector was by Beckman Company,

USA. Type 230SEL Enzyme-linked immunosorbent

analyzer was by Organon Teknika, Holland.

Grouping, Modeling, and Administration

Seventy-two SD rats were randomly divided

into six groups after 1 week of adaptive breeding: the

normal group (normal saline, 10 mL/kg), the model

group (normal saline, 10 mL/kg), the finasteride group

(0.8 mg/kg, equivalent to 10 times the dose for a

human adult), the low-dose KQR (LKQR) group (6.5 g/

kg, equivalent to 5 times the dose for a human adult),

the middle-dose KQR (MKQR) group (13.0 g /kg,

equivalent to 10 times the dose for a human adult),

and the high-dose KQR (HKQR) group (19.5 g /kg,

equivalent to 15 times the dose for a human adult).

BPH model was induced by subcutaneously injecting

testosterone propionate, 3.5 mg/kg once a day for 30

days after castration in all rats(4), except those in the

normal group, and then, saline or corresponding drugs

were administrated by gastrogavage once daily for 30

days. On the next day, after the last administration,

the rats were decapitated. The whole prostate tissue

was isolated and stored in a -80 refrigerator.

During the observation period, one rat in the model

group and the finasteride group died accidentally

during the gastrogavage.

Measurement of Indexes of Prostate

Prostate exponent (PE) was calculated based on

the following formula: PE= prostate weight (PW)/body

weight (BW)100%.

Determination of T and E2 in Plasma

Two milliliter blood samples were collected using

heart puncture in rats. The levels of T and E2 were

determined by ELISA according to the instructions of

the kits.

Determination of mRNA Expression of PCNA in

Prostate Tissue

Total RNA was extracted by Trizol reagent.

R N A c o n c e n t r a t i o n w a s m e a s u r e d b y U V

spectrophotometer at 260/280 nm. Agarose gel

denaturated with 1% formaldehyde electrophoresis

was used to identify RNA quality. PCNA mRNA and

internal reference -actin primer were designed

and supplied by Invitrogen Limited. PCNAmRNA:

sense: 5'- GACACATACCGCTGCGATCG - 3' ,

antisense: 5'- TCACCACAGCATCTCCAATAT' - 3 ',

and the product length was 307 bp. -actin sense:

5'-GGCATTGTGATGGACTC-3 ', antisense: 5'-CAG

CACTGTGTTGGCATAGA-3', and the product lengthwas 201 bp. Reaction parameters: predegeneration

lasted at 95 for 5 min, degeneration at 94 for 30

s, annealing at 59 for 40 s, extension at 72 for

30 s, and terminal extension at 72 for 7 min, which

was 30 cycles in total. PCR products were examined

by electrophoresis with 1.5% agarose gel. The optical

density of DNA bands was scanned using the gel

imaging system. The ratio between PCNA mRNA and

-actin was calculated. The experiment was repeated

for five times.

Statistical Analysis

An analysis was performed using SPSS 12.0

statistical software. Data were expressed as mean

standard deviation. Statistical significance was

analyzed with One-way ANOVA and q-test. P value

less than 0.05 was taken as statistically significant.

RESULTS

Comparison of BW, PW, Prostate Volume, and

PE among Groups

There was no significant difference in BW


3/4


among all groups, which was comparable among

groups before administration (P>0.01). Compared

with the normal group, PW, PV, and PE in the model

group were significantly higher (P


4/4


For BPH, KQR i s one o f t he e f fec t i ve

prescriptions proved by our long-term clinical practice.

Through literature research and theoretical analysis,

we consider that the basic pathologensis of BPH

from the view of Chinese medicine is Shen ()

deficiency, blood stasis, heat, and toxin obstructing

the collaterals(7)

. KQR prescription, conforming to

the rule of tonifying Shen but without prolonging

pathogenic factors and eliminating pathogenic factors

but without damaging vital qi, has effects on tonifying

Shen, promoting blood flow, removing the obstruction

of collaterals, clearing away heat, and resolving mass.

This study shows that KQR could effectively reduce

prostate weight, prostate volume, and regulating sex

hormones levels in experimental BPH rats.

Prostate is a sex steroid-dependent organ.

Studies showed that the occurrence of BPH is related

to the interaction between androgen and estrogen.

The imbalance between E2 and T plays an important

role in the pathogenesis of BPH(8). This study shows

that the plasma T in the model group was significantly

higher, and the plasma E2 and ratio of E2/T were

significantly lower compared with the normal group.

Compared with the model group, the levels of the

plasma T were significantly lower in the three KQR

groups; the levels of the plasma E2 were significantly

higher in the middle and high dose KQR groups;and the ratios of E2/T were significantly higher in the

three KQR groups. These indicated that one of the

mechanisms of KQR in inhibiting BPH in experimental

rats might be related with regulating the balance of

plasma E2 and T, which might be consistent with the

theory of its effect of tonifying Shen.

Cell proliferation and death are bound to achieve

a dynamic balance to maintain a normal structure

and function of the prostate, which are both involved

in the occurrence process of BPH(9, 10)

. PCNA is a

36 kD ribonucleoprotein that can be used as an

important indicator of proliferation activity (11). Our

studies show that the expression of PCNA mRNA in

the model group was significantly higher compared

with the normal group, implying that cell proliferation

was involved in the process of BPH occurrence.

The expressions of PCNA mRNA were obviously

lower in the three KQR groups compared with the

model group. The indexes were obviously higher in

the middle-and low-dose KQR groups but that in the

high-dose KQR group was insignificantly different

compared with the finasteride group, indicating that

one possible mechanism of KQR therapeutic effects

in rats with BPH might be related with decreasing the

expression of PCNA mRNA in the prostate tissue to

inhibit the cell proliferation of the prostate, but the

effects of the low- and middle-dose KQR to inhibit the

cell proliferation of the prostate were not as good as

that of finasteride.

In summary, KQR shows multitarget effects

in BPH rats. It can significantly increase plasma E2,

reduce plasma T and regulate the balance of T and

E2, as well as decrease PCNA mRNA expression in

the prostate tissue to inhibit the cell proliferation of

prostate in a dose-dependent manner.

REFERENCESGu FL, ed. Modern prostate diseases. 1st ed. Beijing:

People's Military Medical Press; 2003:3-187.

Guo J, Chang DG, eds. Integrated traditional and Western

medical treatment of andrology. 1st ed. Beijing: People's

Military Medical Press; 2003:243-271.

Huang YP, Du J, Hong ZF, Chen ZQ, Zhao JY, Li TJ, et al.

Effect of Kangquan Recipe on apoptosis regulatory genes

bax and bcl-2mRNA in prostate of rats. Chin J Integr Tradit

West Med (Chin) 2007;27:711-714.

Ministry of Health, P.R. China. Guidance on principle of pre-

clinical research on new drugs. Beijing: People's Medical

Publishing House; 1993:101-103.

Berry SJ, Coffey DS, Walsh PC, Ewing LL. The

development of human benign prostatic hyperplasia with

age. J Urol 1984;132:474-479.

Gu FL. Preliminary study of the frequency of benign

prostatic hyperplasia and prostatic cancer in China. Chin J

Surg (Chin) 1993;31:323-326.

Huang YP, Wu JF. On relation of collaterals diseases in

TCM and benign prostatic hyperplasia. Chin J Tradit Chin

Med Pharm (Chin) 2006;21:45-46.

Zhu G, Wang JY, Liu JD. Effects of estrogen and androgen

on prostatic stromal cell proliferation. Chin J Urol (Chin)

2000;21:361-363.

Deng FM, Gu FL, Xia TL, Kong XT. Proliferation and

apoptosis in BPH. Chin J Surg (Chin) 1996;34:620-622.

Peng J, Zhang Q, Yu W, Guo YL, Jin J. Effect of

angiotensin on prostatic cell proliferation and apoptosis

in rats. Chin J Urol (Chin) 2006;27:615-617.

Hall PA, Levison DA, Woods AL, Yu CC, Kellock DB,

Watkins JA, et al. Proliferating cell nuclear antigen (PCNA)

immunolocalization in paraffin sections: an index of cell

proliferation with evidence of deregulated expression in

some neoplasms. J Pathol 1990;162:285-293.

(Received September 5, 2008)

Edited by GUO Yan

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

effects of kangquan recipe (康泉方) on sex steroids and cell proliferation in rats with benign...

Documents