European Journal of Pharmacology 591 (2008) 211–218

Contents lists available at ScienceDirect

European Journal of Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /e jphar

Endothelin receptor antagonist CPU0213 and vitamin E reverse downregulation ofFKBP12.6 and SERCA2a: A role of hyperphosphorylation of PKCε☆

Na Li, Nan Jia, De-Zai Dai ⁎, Yin DaiResearch Division of Pharmacology, China Pharmaceutical University, 24 Tongjia Lane, Nanjing, 210009, China

☆ This work was financially supported by the NationChina (973 Programs: 2007CB512000/2007CB512006, to⁎ Corresponding author. Tel.: +86 25 83370156; fax: +

E-mail address: dezaidai@vip.sina.com (D.-Z. Dai).

0014-2999/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.ejphar.2008.06.080

A B S T R A C T

A R T I C L E I N F O

Article history:

Downregulation of FKBP12 Received 30 January 2008Received in revised form 18 June 2008Accepted 22 June 2008Available online 27 June 2008

Keywords:Endothelin receptor antagonistFKBP12.6SERCA2aPKCɛCPU0213Vitamin EH2O2

.6 and sarcoplasmic reticulum Ca2+ ATPase (SERCA2a) contributes to suddencardiac death and heart failure. We aimed to test the hypothesis that (i) downregulation of FKBP12.6 andSERCA2a can be taken as molecular markers for drug interventions and (ii) such downregulation is producedby crosstalk between endothelin-reactive oxygen species and β-adrenoceptors stimulation, mediated byhyperphosphorylation of protein kinase Cɛ (PKCɛ). Rat cardiomyocytes were incubated with isoproterenol(1 μM), endothelin-1 (0.1 μM) or hydrogen peroxide (10 μM) for 18 h, resulting in downregulation of mRNAand protein of FKBP12.6 and SERCA2a, as well as upregulation of PKCɛ mRNA and phosphorylated PKCɛprotein. These changes were reversed by an application of either propranolol (1 μM), endothelin receptorantagonist CPU0213 (1 μM) or vitamin E (1 μM). As indicated by the fluorescent dye Fluo3, diastolic [Ca2+]i inrat ventricular myocytes was increased after incubation with isoproterenol (0.1 μM). The increased [Ca2+]i indiastole was dramatically decreased by CPU0213. Thus, the downregulation of FKBP12.6 and SERCA2a, andhyperphosphorylation of PKCɛ, appear to be related to crosstalk between over-activated endothelin-reactiveoxygen species and a β-adrenoceptor pathway. CPU0213 is beneficial in treating cardiac insufficiency andpreventing cardiac arrhythmias possibly by normalizing hyperphosphorylation of PKCɛ and abnormalFKBP12.6 and SERCA2a. The antioxidant activity of vitamin E was sufficient to normalize the levels ofFKBP12.6 and SERCA2a and phosphorylation of PKCɛ. Thus by testing with biomarkers FKBP12.6 andSERCA2a, we have shown that the endothelin receptor antagonist CPU0213 and the antioxidant vitamin Emay relieve risk of lethal arrhythmias and heart failure by suppressing PKCɛ.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

Sudden cardiac death has become one of the major problemsaffecting humans, and is highly heterogenic in etiology and pathology.The prevalence of sudden cardiac death annually is about 1 in 1000 ofthe general population (Sen-Chowdhry and McKenna, 2006), andlethal cardiac arrhythmias often associate with ion channel disorders(channelopathies). However, to date, drug interventions for antiar-rhythmic activity are far from satisfactory (Choi et al., 2004).Abnormal repolarization resulting in lethal cardiac arrhythmiascorrelates with ion channel abnormalities in the sarcolemma orryanodine receptor 2 (an intracellular calcium release channel) and itsregulating protein calstabin 2 (FKBP12.6) in the sarcoplasmicreticulum (Wehrens et al., 2003). A high risk of sudden cardiacdeath associates with a rise in intracellular Ca2+ in diastole due to Ca2+

leak via unstable ryanodine receptor 2, in turn attributed to down-regulation/dissociation of FKBP12.6 from the ryanodine receptor 2

al Basic Research Program ofBF Yang).86 25 83302827.

l rights reserved.

complex. This leads to prolonged action potential duration, delayedafter-depolarization, torsades de pointes and a predisposition toventricular fibrillation (Lehnart et al., 2004). However, most channe-lopathies are secondary to pathological changes in the myocardium,where some transmembrane signaling pathways are altered as aconsequence of insults to the myocardium. Thus, an intervention ofupstream events with ACE inhibitors (ACEI) or angiotensin 1 blockingdrugs, rather than direct inhibition of ion channels, is effective indecreasing the incidence of sudden cardiac death (Tokuhisa et al.,2006). This provides us with a clue to understand that correction atrelevant upstream events may be effective in reversing abnormalexpression and function of the ion channels at the membrane orsarcoplasmic reticulum.

Endothelin-1, administrated by an intrapericardial injection in dogs,can induce ventricular arrhythmias that can be counteracted by theendothelin receptor antagonist bosentan (Horkay et al., 2000). Otherendothelin antagonists, such as darusentan and CPU0213 (1-butyl-3-(2,4-dis-(para-chlorobenzyloxy)-phenyl)-pyrazole-5-carboxylic acid),are also effective in suppressing arrhythmias as we reported (Fenget al., 2007a; Xia et al., 2006). Over-activation of the endothelin systemalways correlateswithan increase in reactive oxygenspecies, and in turnlocal genesis of endothelin can be promoted in the presence of reactive

Table 1Nucleotide sequences of primers used

Gene Forward primer (3′–5′) Reverse primer (3′–5′) Length (bp)

FKBP12.6 GTGAAGGCAGGAAGGAA GCAGCCAACAGAAGATAAG 427SERCA2a CCGTATCCGATGACAATG CCAGGCTCCAGGTAGTTT 638ETAR ATCGCTGACAATGCTGAGAG ATCGCTGACAATGCTGAGAG 225PKCε CGAGGACGACTTGTTTGAATCC CAGTTTCTCAGGGCATCAGGTC 38918S CGGACCAGAGCGAAAGC GGACATCTAAGGGCATCAAG 529

212 N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

oxygen species; thus, it is referred as the endothelin-reactive oxygenspecies pathway (Xu et al., 2004) ,which in turn is suppressed byendothelin receptor antagonists (Xia et al., 2006).However, it is not clearso far whether such activation of the endothelin system can facilitateevents such as, the downregulation of FKBP12.6 that underlies thesudden cardiac death syndrome and heart failure.

Occurrence of malignant arrhythmias may be attributed toFKBP12.6 dissociation resulting from hyperphosphorylation of ryano-dine receptor 2 by protein kinase A (PKA) consequent to profoundstimulation of β-adrenoceptors (Wehrens et al., 2003). Thus, wesuggest that endothelin and reactive oxygen species may individuallydownregulate FKBP12.6 and SERCA2a, via cross talk with the cAMP-PKA pathway from β-adrenoceptor stimulation. In addition, it isknown that the protein kinase C (PKC) pathway is actively involved inthe effects of endothelin receptors. Thus, we hypothesize thatdownregulation of FKBP12.6 and SERCA2a might be the consequenceof hyperphosphorylation of PKCɛ which crosstalks with eventsresulting from β-adrenoceptor activation. In this study, we haveindeed demonstrated that isoproterenol, endothelin-1 and reactiveoxygen species can induce hyperphosphorylation of PKCɛ, resulting indownregulation of FKBP12.6 which manifests as an increase of Ca2+ indiastole, and these changes could be completely reversed by blockadeof endothelin receptors by CPU0213 (Fig. 1).

2. Materials and methods

2.1. Reagents

CPU0213 (1-butyl-3-(2,4-dis-(para-chlorobenzyloxy)-phenyl)-pyra-zole-5-carboxylic acid), a dual endothelin receptor antagonist, wassynthesized and supplied by the Center of New Drug Research andDevelopment, China Pharmaceutical University. M-MLV (ProMega, USA)and Tag DNA Polymerase (Tiangen) were purchased from NanjingTianwei Corp, China. Polyclonal goat anti-FKBP12.6-immunoglobulin G(IgG), polyclonal goat anti-SERCA2a-IgG, and polyclonal rabbit anti-ETAR-IgG were purchased from Santa Cruz Biotechnology Inc., USA;polyclonal rabbit anti-PKCε(Ser729)-IgG from Upstate, USA; polyclonalrabbit anti-PKCɛ-IgG, polyclonal rabbit anti-Actin-IgG and horseradishperoxidase (HRP)-conjugated goat anti-rabbit IgG from Boster, China;HRP-rabbit anti-goat IgG from Dako, USA.

2.2. Ventricular myocytes

Our study conforms to the Guide for the Care and Use of LaboratoryAnimals published by the US National Institutes of Health (NIHPublication No. 85-23, revised 1996). Neonatal ventricular myocytes ofSprague–Dawley rats were obtained and cultured as described pre-viously. Briefly, ventricular myocytes were cultured in 20% FBS-DMEM/F12 culture media, with Brdu to suppress the growth of fibroblasts. Theculture media was changed to serum-free DMEM/F12 media when cellsreached confluence and regular cell beatings were observed (usually in

Fig. 1. The chemical structure of CPU0213 (1-butyl-3-(2, 4-dis-(para-chlorobenzyloxy)-phenyl)-pyrazole-5-carboxylic acid).

72 h). Except for control groups, myocytes were incubated withisoproterenol (1 μM), endothelin-1 (0.1 μM) or hydrogen peroxide(H2O2,10 μM) respectively. Propranolol (1 μM)andCPU0213 (1 μM)wereused for interventions in these groups, aswell as vitamin E (1 μM) in thehydrogen peroxide group.

2.3. Semi-quantitative RT-PCR

After 18 h incubation, RNA was extracted with Trizol solution, andcDNAwas obtained after reverse-transcription as described previously(Qi et al., 2006). Polymerase chain reactionwas performed in a volumeof 25 μL. After electrophoresis in 1% agarose gels, products werestained with ethidium bromide and visualized by violet (GDS8000,Sygene, England). The densitometry of each band was obtained usingprofessional image analysis software. The quantities of the target genetranscripts were adjusted using 18S RNA as an internal control. Thenucleotide sequences of primers and the length of amplified DNAfragments are listed in Table 1.

2.4. Western blots

After 18 h incubation, protein was extracted with a lysis buffercontaining (mM):NaCl 150, Tris–HCl 50, EDTA1, PMSF 1, TritonX-1001%andSDS0.5%, aspreviously described (Na et al., 2007). Afterdeterminingthe protein concentration, supernatants were stored at −20 °C beforeuse. The sampleswere heated at 95 °C in loading buffer and fractionatedusing 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis(SDS-PAGE). Following transfer to nitrocellulose filter and blockingwithnonfat milk (5% wt/vol), the blot was incubated overnight at 4 °C, withthe specific primary antibodies. After wash out, blots were incubatedwith horseradish peroxidase-conjugated IgG for 2 h at room tempera-ture. Antigenwas detected with a 3,3′-diaminobenzidine kit, visualizedby imaging acquisition and quantified by densitometry. Actin quantitywas used as an internal control to standardize equal protein sampleloadings.

2.5. Measurement of cytosolic [Ca2+]i

Adult rat cardiacmyocytes were enzymatically isolated fromwholeventricles as described before with some modification. In short, malerats (250±50 g) were heparinized and anaesthetized with ethylur-ethane (1.5 g/kg, ip). The heart was quickly excised and retrogradelyperfused (through an aortic cannula mounted on the Langendorffapparatus) with Ca2+-free tyrode solution (37 °C) for about 5 min.After blood was washed out and spontaneous beating ceased, theperfusate was switched to the same solution containing 0.33 mg/mLtype II collagenase (Worthington, USA) and perfused for 12±2 min.Then the ventricles were dissected and cardiacmyocytes collected anddispersed and stored in a high-K+, low-Cl− Kraft–Brühe (KB) solution.

Measurements of cytosolic [Ca2+]i were performed as describedpreviously (Kao et al., 1989; Tajima et al., 1999; Virag et al., 1999) withsome modifications. Briefly, Fluo3-loaded myocytes were transferredto a 300 μL perfusion chamber placed on an inverted microscope(Olympus IX71, Japan) and perfused with tyrode solution containingtested compounds or vehicle, gassed with 95%O2+5%CO2 at room

213N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

temperature. Myocyte contractions were induced by field electricstimulation, with square wave pulses of 40 V and 5 ms duration at0.5 Hz. Fluo3 fluorescence was recorded 5 min after perfusion oftested compounds or vehicle, and was converted into absolute [Ca2+]iby a calibration formula, [Ca2+]i=Kd⁎ (F−Fmin) / (Fmax−F). Here Kd

represents the dissociation constant for Ca2+-bound Fluo3, F wasobtained from F=Fcell−Fbak, where Fcell is the mean fluorescentintensity measured in myocytes, and Fbak is the fluorescent intensityof the background. Fmax represents the maximum fluorescence of cellspermeable to Ca2+, and was obtained by adding 5 mM A23187 in10 mM Ca2+-containing Tyrode's solution. Fmin was calculated fromFmin=1.25⁎FMn−0.25⁎Fmax, where FMn was obtained by adding 5 mMMnCl2 to 5 mM A23187-treated myocytes.

Normal tyrode solution contained (mM): NaCl 135, KCl 5.4, CaCl21.8, MgSO4 2, NaH2PO4 0.33, glucose 10 and HEPES 10 (pH adjusted to7.4 with NaOH). The Ca2+-free tyrode solution used for the cellisolation procedure was prepared by simply omitting CaCl2 from thenormal tyrode solution. The KB solution for cell preparation contained(mM): KCl 40, MgCl2 3, KH2PO4 20, L-glutamic acid 50, taurine 20, KOH70, glucose 10, EGTA 0.5 and HEPES 10 (pH adjusted to 7.3 with KOH).All solutions used during the procedure were oxygenated andmaintained at 37 °C. Isoproterenol (0.1 μM) was directed added intonormal tyrode solution before use. Propranolol and CPU0213 were

Fig. 2. Expression of FKBP12.6 (A) and SERCA2a mRNA (C) in neonatal rat cardiac myocytes wor H2O2 (10 μM). Both Pro (1 μM) and CPU0213 (1 μM) significantly reversed the abnormaliprotein (B) and SERCA2a protein (D) were almost the same as mRNA. n=4. ⁎⁎Pb0.01 vs. con

added into normal tyrode solution to reach final concentration of 1 μMand 0.1, 1, 10 μM before use.

2.6. Statistical analysis

All data were expressed as mean±S.E.M. Statistical differencesbetween groups were assessed by ANOVA. Differences were con-sidered statistically significant with Pb0.05.

3. Results

3.1. Downregulation of FKBP12.6 and SERCA2a

Downregulation of FKBP12.6 and SERCA2a was found in themyocardium previously by medication with isoproterenol in vivo. It isof interest to investigate whether changes in expression of FKBP12.6and SERCA2a occur in isolated cardiomyocytes incubated withisoproterenol, endothelin-1 and H2O2 in vitro. Indeed, we found thatexpression of calcium handling proteins FKBP12.6 and SERCA2a incardiac myocytes was significantly downregulated after 18 h incuba-tion with not only isoproterenol (1 μM), but also either endothelin-1(0.1 μM) or H2O2 (10 μM). Thus, isoproterenol, endothelin-1 and H2O2

respectively decreased expression (relative to normal) of FKBP12.6

as downregulated after 18 h incubationwith isoproterenol (1 μM), endothelin-1 (0.1 μM)ty and so did the antioxidant vitamin E (VE, 1 μM). Changes in expression of FKBP12.6trol; #Pb0.05, ##Pb0.01 vs. isoproterenol, endothelin-1 or H2O2 treatments.

214 N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

mRNA by 58.9%, 53.6% and 63% (Pb0.01), and FKBP12.6 protein by 73%,70% and 76% (Pb0.01) (Fig. 2A and B). These effects are thought to bedue to profound stimulation of β-adrenoceptors; thus, propranololshould serve as a positive reference drug to reverse this down-regulation of the two proteins. Indeed, propranolol (1 μM) wassufficient to elevate abnormal expression by isoproterenol dramati-cally toward normal. Unexpectedly, the endothelin receptor antago-nist CPU0213 markedly (as compared with propranolol) attenuateddownregulation of FKBP12.6 (with less effect on SERCA2a) in mRNAand protein expression caused by isoproterenol (Fig. 2C and D). Thus,the data likely indicate crosstalk between cAMP-PKA and endothelinpathways.

Furthermore, endothelin-1 at 0.1 μM produced a dramatic down-regulation of FKBP12.6 (Fig. 2A and B) and SERCA2a (Fig. 2C and D)mRNA and protein to a similar extent as for isoproterenol. WhenCPU0213 was added, the downregulated expression was significantlyreversed, and reversal by propranolol was also observed. Followingthe addition of H2O2 at 10 μM (no response to 1 μM), induceddownregulation of the two proteins was significant, comparable toisoproterenol and endothelin-1. This abnormal expression of FKBP12.6and SERCA2a by H2O2 was profoundly reversed by the antioxidant

Fig. 3. Isoproterenol (1 μM) and endothelin-1 (0.1 μM) increased expression of ETAR mRNA (Ainduced by isoproterenol and endothelin-1 than Pro (1 μM). H2O2 (10 μM) dramatically uprevitamin E (VE, 1 μM) significantly reversed the change by H2O2. n=4. ⁎⁎Pb0.01 vs. control;

vitamin E. Interestingly, the attenuation of downregulation ofFKBP12.6 and SERCA2a was significantly abolished by eitherCPU0213 or propranolol.

3.2. Over-expression of ETAR

As we assumed that activation of endothelin receptors likelycontributes to the abnormal expression of FKBP12.6 and SERCA2a it isof interest to conduct experiments on ETAR expression in the isolatedcardiomyocytes in vitro. Over-expression of ETAR mRNA and proteinwas found following incubation with isoproterenol; this wouldsuggest crosstalk between β-adrenoceptor activation and theendothelin system (Fig. 3A and C). By application of propranolol, areversal of mRNA of ETAR was noteworthy (Pb0.01), but the effect wasless with ETAR protein. Upregulation of ETAR mRNA and protein byisoproterenol was significantly normalized by CPU0213 (Pb0.01).

Endothelin-1 was applied in the medium to replace isoproterenolandanevidentupregulationof ETARwas found (Pb0.01) and suppressedby either CPU0213 or propranolol (Pb0.01). A recovery of ETAR proteinwas significant by either CPU0213 or propranolol; however, it wasgreater with CPU0213 than propranolol (Pb0.01) (Fig. 3A and C).

) and protein (C). CPU0213 (1 μM) was more effective in inhibiting upregulation of ETARgulated expression of ETAR mRNA (B) and protein (D). Pro (1 μM), CPU0213 (1 μM) and#Pb0.05, ##Pb0.01 vs. isoproterenol, endothelin-1 or H2O2 treatments.

215N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

Whenmyocyteswere incubatedwithH2O2, a predominant responseof upregulation of ETARwas found. Therewas a dramatic upregulation inexpression of ETAR mRNA (8-fold increase) or protein amount (15-foldincrease) compared to the controls (Pb0.01). Vitamin E reversed theseabnormalities dramatically (Pb0.01). Interestingly, a reversal of upre-gulation by H2O2 in vitro was also found by either propranolol orCPU0213,withanefficacyat least as effective asvitaminE (Fig. 3B andD).

3.3. Over-expression of phosphorylated PKCε

Downregulation of FKBP12.6 has been considered as a result ofhyperphosphorylation of PKA following β-adrenoceptor activation.Nevertheless, the endothelin-reactive oxygen species pathway, as wefound previously, may modulate downregulation of FKBP12.6 in closerelation to the PKC pathway. Thus, it indicates a possible link betweenPKC and downregulation of FKBP12.6. Isoproterenol, endothelin-1 andH2O2 produced significant over-expression of PKCε mRNA in themyocytes in vitro by 45%, 22% and 400% respectively compared tocontrols (Pb0.01). These changes were respectively alleviated bypropranolol, CPU0213 and vitamin E, suggesting that there is a

Fig. 4. Amount of PKCεmRNA (A) and phosphorylated PKCε (pPKCɛ) protein (Ser729) (C) in ca1 (0.1 μM). Hyperphosphorylation of pPKCɛ by isoproterenol and endothelin-1 was significaexpression of PKCε mRNA (B) and pPKCɛ protein; these were reversed by Pro (1 μM), CPU0##Pb0.01 vs. isoproterenol, endothelin-1 or H2O2 treatments.

crosstalk between activation of β-adrenoceptors and the PKC pathwaythat is involved in the endothelin-reactive oxygen species pathway.(Fig. 4A and B).

Considering that the phosphorylated form of PKCɛ (pPKCε) canpotentially phosphorylate FKBP12.6 and SERCA2a, we further mea-sured pPKCε protein levels in the cells after various treatments.Isoproterenol, endothelin-1 and H2O2 significantly induced over-expression of pPKCε protein. The ratio of pPKCε/PKCε in theisoproterenol and endothelin-1 groups was elevated to 1.74±0.07(Pb0.01) and 2.05±0.13 (Pb0.01) from the basal level of 0.96±0.08(Fig. 4C), while the ratio for H2O2 was even greater, up to 5-foldcompared to controls (Pb0.01) (Fig. 4D). Propranolol, CPU0213, andvitamin E significantly decreased the ratio of pPKCε/PKCε; amongthese CPU0213 was the most effective.

3.4. Calcium transients

In beating cardiac myocytes driven by electrical field stimulation,calcium transients functionally reflect calcium release by ryanodinereceptor 2 and the efficacy of the calcium re-uptake process through

rdiomyocytes increasedwhen incubatedwith either isoproterenol (1 μM) or endothelin-ntly reversed by Pro (1 μM) and CPU0213 (1 μM). H2O2 (10 μM) dramatically increased213 (1 μM) or vitamin E (VE, 1 μM), respectively. n=4. ⁎⁎Pb0.01 vs. control; #Pb0.05,

216 N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

SERCA2a into the sarcoplasmic reticulum. Typical records, as wedemonstrated, revealed an elevated peak (systolic) and trough(diastolic) calcium in the presence of isoproterenol (0.1 μM), andboth systolic and diastolic calcium were dramatically reversed bypropranolol (Fig. 5A). Interestingly, CPU0213 was more effective insuppressing the diastolic rather than the systolic levels at three testedconcentrations (0.1, 1 and 10 μM) (Fig. 5B). The data supported acrosstalk between β-receptor activation and over-activity of theendothelin-reactive oxygen species pathway, and a blockade ofendothelin receptors resulted in a relief in sequelae to β-adrenoceptorstimulation.

Fig. 5. Typical records of Ca2+ transients elicited by field electric stimulation at afrequency of 0.5 Hz in Fluo3 loaded cardiomyocytes were significantly increased byisoproterenol (0.1 μM) and were normalized by Pro (1 μM) (A). Isoproterenol causedincreases in systolic Ca2+ (peak) and diastolic (trough) Ca2+ concentrations; these effectswere reduced by Pro and CPU0213. CPU0213 was less effective in reducing the systoliccalcium, but sufficient to inhibit diastolic calcium (B). n=6. ⁎⁎Pb0.01 vs. control;#Pb0.05, ##Pb0.01 vs. isoproterenol.

4. Discussion

Antiarrhythmic agents suppressing either Na+ or K+ channels werenot successful in controlling life threatening arrhythmias, as revealedin CAST (cardiac arrhythmia suppressing trial) and SWORD (Survivalwith oral d-sotolol) (Pratt and Moye, 1990; Waldo et al., 1996).Furthermore, dofetilide with profound prolongation of action poten-tial duration actually induces torsades de pointes in heart failurepatients (Pedersen et al., 2007). Also azimilide (which possessesmulti-channel blocking activity including IKr) produces a similarincidence of torsades de pointes (Pratt et al., 2006), and itseffectiveness against ventricular tachyarrhythmias was not differentfrom placebo (VerNooy and Mangrum, 2005). Thus, agents blockingIKr are not sufficient to suppress ventricular tachyarrhythmias in adiseased heart where an increase in torsades de pointes is likely tooccur. It is interesting to search for new medication for effectivelysuppressing arrhythmias without suppressing IKr; and therefore,hopefully to be free from torsades de pointes. Indeed, the applicationof non-ion channel blockers (modulating the upstream events to ionchannels) has received attention in suppressing ventricular tachyar-rhythmias (Goette et al., 2007). In order to suppress these cardiacarrhythmias, we suggest that the endothelin pathway and reactiveoxygen species can be targeted by drugs that reverse the down-regulation of FKBP12.6. (Yano et al., 2003).

Occurrence of lethal cardiac arrhythmias correlates with a rise inCa2+ (due to calcium leak from ryanodine receptor 2) in diastoleresulting from dissociation (downregulation) of FKBP12.6 from theryanodine receptor 2 macromolecule. An elevated Ca2+ in diastole inturn prolongs action potential duration by retarding repolarization,and also serves as a depolarizing current causing the delayed after-depolarizations and torsades de pointes, finally predisposing toventricular fibrillation. Thus, FKBP12.6 protein has become a basicdrug target as a molecular marker implicated in the pathologies oflethal cardiac arrhythmias and heart failure (Yano et al., 2003). In thisrespect, lethal cardiac arrhythmias and worsened heart failure couldbe prevented by reversal of the downregulation of FKBP12.6.

Downregulation of SERCA2a in the myocardium leads to lesspumping of Ca2+ into the sarcoplasmic reticulum, leaving morecalcium in the cytosol during diastole; thus, downregulated SERCA2aco-contributes with downregulated FKBP12.6 to an elevated diastolicCa2+ which increases risk for both cardiac arrhythmias and impaireddiastolic function of the heart. Furthermore, with less Ca2+ beingstored with calsequestrin in the sarcoplasmic reticulum, less calciumis released to trigger excitation–contraction coupling, leading todecreasing contractility of affected hearts. Accumulated data suggestthat SERCA2a is also a key target for heart failure and cardiacarrhythmias (Erkasap, 2007; Minamisawa and Ikeda, 2006). Convin-cingly, downregulated SERCA2a actively participates in both cardiacfailure and arrhythmogenesis (Wilson et al., 2006).

Downregulated FKBP12.6 and SERCA2a are therefore importantmolecular markers with potential for the genesis of ventriculartachyarrhythmias and compromised cardiac performance. It is inter-esting to find that downregulation of these two calcium handlingproteinsmay be the early signs in affectedmyocardium, as observed indiabetic cardiomyopathy (Qi et al., 2006), injured myocardium fromseptic shock (He et al., 2007), isoproterenol medication-inducedcardiomyopathy (Feng et al., 2007b) and infarcted heart (Wang et al.,2004). Because downregulation of FKBP12.6 is a sustained and longlasting pathological change, it is a matter of concern that it couldcontribute to an abrupt occurrence of lethal cardiac arrhythmias. Toanswer this question, we provided evidence of molecular eventscontributing to ventricular fibrillation, which occur immediately onreperfusion in conjunction with further downregulation of FKBP12.6and upregulation of the endothelin system and PKA (Na et al., 2007).In these circumstances, FKBP12.6 is the most important biomarker, asit can respond suddenly by further downregulation, directly

217N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

contributing to abrupt manifestation of lethal cardiac arrhythmias in adiseased heart. Thus we verify that downregulation of FKBP12.6 is notonly a basic phenomenon in pathologies of the genesis of arrhythmias,but is also an important component in triggering the appearance oflethal cardiac arrhythmias within a short time scale. As mainmolecular makers, it is reasonable to elevate depressed expressionof FKBP12.6 and SERCA2a by drug intervention in order to preventsevere cardiac arrhythmias and cardiac insufficiency.

Naturally, investigation of the factors promoting the downregula-tion of FKBP12.6 and SERCA2a, as well as the possible ways to preventdownregulation, is fascinating topics. In the present study, isoproter-enol, endothelin–1 and hydrogen peroxide (one of the main toxicmolecules in reactive oxygen species) dramatically downregulatedFKBP12.6, resulting in calcium leak in diastole via unstable ryanodinereceptor 2. We showed that upregulation of FKBP12.6 by CPU0213clearly occurs, comparable in magnitude to the effect of propranolol.This upregulation then results in re-association of FKBP12.6 withryanodine receptor 2, stabilizing the calcium release channel and soleading to normalized calcium levels in diastole.

Both ETAR and ETBR are blocked by CPU0213, but it is still uncertainif a selective endothelin receptor antagonist would be superior to adual non-selective one. The activity of endothelin receptors is alteredunder pathological conditions as compared with normal conditions.The activity of endothelin frequently correlates with genesis ofreactive oxygen species, and an excess of endothelin is linked with astatus of oxidant stress which responds well to a dual blockerbosentan (Gupta et al., 2005). The genesis of reactive oxygen species isbelieved to be fromNADPH oxidase atmitochondria and is reversed bythe antioxidant vitamin C (Papparella et al., 2007). Activation ofNADPH oxidase by endothelin is mainly mediated by ETBR (Dong et al.,2005). Also an anti-inflammatory effect of ETAR blockade has beenobserved (Sasser et al., 2007), which may involve an effect againstoxidative stress. Thus, potency of an antioxidant activity may bestronger with a dual endothelin receptor antagonist such as CPU0213as compared with a selective one. To date, it is a matter of debate as towhether a selective or non-selective antagonist is best.

An excess of catecholamines downregulates SERCA2a dramati-cally; this may include downregulation of phospholamban (Feng et al.,2007b), resulting in a depressed Ca2+ pump activity and a reduction incalcium storage in the sarcoplasmic reticulum. PKA hyperphosphor-ylation by overactivation of β-adrenoceptors is the main mechanismleading to occurrence of lethal cardiac arrhythmias (Lehnart et al.,2004; Wehrens et al., 2003) and worsening of compromised cardiacperformance (Wehrens and Marks, 2004). In the present study, theinvolvement of PKCɛ has been made clear in the downregulation ofFKBP12.6 and SERCA2a in vitro, suggesting crosstalk between PKA andPKC pathways. Thus, PKCɛ hyperphosphorylation, and not merely PKA,is critical inmediating downregulation of the biomarkers that increasethe risk of lethal cardiac arrhythmias and worsening heart failure. Ourfindings are in line with findings that PKC is involved in the events ofcardiac hypertrophy (Dorn and Force, 2005) and in streptozotocin-induced diabetic rat heart. Indeed both candesartan and bisindolyl-maleimide I (a nonspecific PKC inhibitor) suppress downregulation ofFKBP12.6 (Yaras et al., 2007), while binding of FKBP12 is blocked byinhibition of PKC or mutation of the PKC phosphorylation site (Kimand Saffen, 2005). ETAR is a Gq-coupled receptor located in the cellmembrane, and PKCε is an important downstream mediator tightlyinvolved in the ETAR signaling pathway. Activation of ETAR causes thenon-active PKCε to be phosphorylated. Then phosphorylated PKCε isable to phosphorylate not only ion channels in themembrane, but alsothe calcium handling proteins in the sarcoplasmic reticulum. Porteret al. (2003) reported that, in wild type cardiac myocytes, PKCε wasover-expressed in association with decreased SERCA2a expression(Porter et al., 2003).

It is interesting to demonstrate that vitamin E likely initiates a re-association of FKBP12.6 at the ryanodine receptor 2 complex, leading

to alleviation of the mechanisms underlying lethal cardiac arrhyth-mias and failing hearts. We suggest that antioxidants sourced fromplant origins such as polyphenols and flavonoids would be likely toprovide protection from cardiac arrhythmias and heart failure. Thesecan be offered in tea (Rah et al., 2007) and diet to act on molecularmarkers in vivo (Ortega, 2006). pPKCɛ could be suppressed bypolyphenols and flavonoids providing a useful supplementarymechanism in relieving lethal cardiac arrhythmias and failing hearts.

Cardiac function worsened by isoproterenol infusion can bereversed with probucol which significantly counteracts oxidativestress, leading to improvement of energy supply in the myocardium(El-Demerdash et al., 2005). Evolving data support the idea thatreactive oxygen species promote the pathologies leading to theoccurrence of cardiac arrhythmias (Chen and Chow, 2005; Hicks et al.,2007). Arrhythmogenesis in L-thyroxin-induced cardiomyopathyclosely correlates with oxidative stress (Feng et al., 2007a; Na et al.,2007). Also amelioration of the pathological condition by CPU86017 isrelevant to its antioxidant activity (Dai, 2006), and furthermoreoxidant markers are present in arrhythmogenesis (Neuman et al.,2007). An increased incidence of ischemia/reperfusion arrhythmiaslikely results from unstablemitochondrial inner membranes damagedby reactive oxygen species, as well as from a reactive oxygen species-induced reactive oxygen species release mode in mitochondria (Zorovet al., 2006). An increase in reactive oxygen species activity adverselyinfluences FKBP12.6 expression leading to an increased incidence ofventricular fibrillation on reperfusion (Na et al., 2007). As wedemonstrated, vitamin E exerts an excellent effect in reversing thedownregulation of these biomarkers in vitro, indicating a potential tobe effective in suppressing life threatening arrhythmias and relievingfailing hearts. Thus, testing the effects of drugs on biomarkers such asFKBP12.6 may open avenues for obtaining information on compoundswith antioxidant activity that may reduce the risks of lethal cardiacarrhythmias and heart failure.

Regarding limitations of this study, we have not performedexperiments to directly show the cause–effect relationship betweenPKCɛ hyperphosphorylation and Ca2+ leak. Accumulated data havesuggested that Ca2+ leak is caused by hyperphosphorylation of PKA(Wehrens et al., 2003) and here we have confirmed that isoproterenol,endothelin–1 and hydrogen peroxide all cause hyperphosphorylation ofPKCɛ. The findings in the present study are in line with those reportedpreviously: isoproterenol indeed causes Ca2+ leak (Curran et al., 2007),and calcium leak can be triggered by oxidative stress (Tokuhisa et al.,2006).

In conclusion, crosstalk between the endothelin-reactive oxygenspecies and β-adrenoceptor pathways mediates downregulation ofFKBP12.6 and SERCA2a in association with hyperphosphorylation ofPKCɛ. These processes contribute to lethal cardiac arrhythmias andworsening heart failure. The endothelin receptor antagonist CPU0213and antioxidant vitamin E are effective, at least in part, in reversing thedownregulation of FKBP12.6 and SERCA2a by counteracting hyper-phosphorylation of PKCε.

Acknowledgements

We thank Professor DennisWray, Leeds University, UK, for his kindassistancewith English styling of themanuscript and Dr. Xupei Huang,associate Professor (with tenure), Dept. of Biomedical Science, FloridaAtlantic University for his helpful discussion during the preparation ofthe manuscript.

References

Chen, J.K., Chow, S.E., 2005. Antioxidants andmyocardial ischemia: reperfusion injuries.Chang Gung Med. J. 28, 369–377.

Choi, G.R., Porter, C.B., Ackerman, M.J., 2004. Sudden cardiac death and channelopa-thies: a review of implantable defibrillator therapy. Pediatr. Clin. North. Am. 51,1289–1303.

218 N. Li et al. / European Journal of Pharmacology 591 (2008) 211–218

Curran, J., Hinton, M.J., Rios, E., Bers, D.M., Shannon, T.R., 2007. Beta-adrenergicenhancement of sarcoplasmic reticulum calcium leak in cardiac myocytes ismediated by calcium/calmodulin-dependent protein kinase. Circ. Res. 100,391–398.

Dai, D.Z., 2006. CPU86017: a novel Class III antiarrhythmic agent with multiple actionsat ion channels. Cardiovasc. Drug Rev. 24, 101–115.

Dong, F., Zhang, X., Wold, L.E., Ren, Q., Zhang, Z., Ren, J., 2005. Endothelin-1 enhancesoxidative stress, cell proliferation and reduces apoptosis in human umbilical veinendothelial cells: role of ETB receptor, NADPH oxidase and caveolin-1. Br. J.Pharmacol. 145, 323–333.

Dorn, G.W., Force, T., 2005. Protein kinase cascades in the regulation of cardiachypertrophy. J. Clin. Invest. 115, 527–537.

El-Demerdash, E., Awad, A.S., Taha, R.M., El-Hady, A.M., Sayed-Ahmed, M.M., 2005.Probucol attenuates oxidative stress and energy decline in isoproterenol-inducedheart failure in rat. Pharmacol. Res. 51, 311–318.

Erkasap, N., 2007. SERCA in genesis of arrhythmias: what we already know and what isnew? Anadolu. Kardiyol. Derg. 7 (Suppl 1), 43–46.

Feng, Y., Dai, D.Z., Na, T., Cui, B., Wang, T., Zhang, Y., Dai, Y., 2007a. Endothelin receptorantagonist CPU0213 suppresses ventricular fibrillation in L-thyroxin inducedcardiomyopathy. Pharmacol. Rep. 59, 306–314.

Feng, Y., Tang, X.Y., Dai, D.Z., Dai, Y., 2007b. Reversal of isoproterenol induceddownregulation of phospholamban and FKBP12.6 is mediated by antagonism ofendothelin receptors of CPU0213. Acta Pharmacol. Sinica 28 Proofs.

Goette, A., Bukowska, A., Lendeckel, U., 2007. Non-ion channel blockers as anti-arrhythmic drugs (reversal of structural remodeling). Curr. Opin. Pharmacol. 7,219–224.

Gupta, S.K., Saxena, A., Singh, U., Arya, D.S., 2005. Bosentan, the mixed ETA-ETBendothelin receptor antagonist, attenuated oxidative stress after experimentalmyocardial ischemia and reperfusion. Mol. Cell Biochem. 275, 67–74.

He, H.B., Yu, F., Dai, D.Z., Dai, Y., 2007. Down-regulation of FKBP12.6 and SERCA2acontributes to acute heart failure in septic shock and is related to an up-regulatedendothelin signalling pathway. J. Pharm. Pharmacol. 59, 977–984.

Hicks, J.J., Montes-Cortes, D.H., Cruz-Dominguez, M.P., Medina-Santillan, R., Olivares-Corichi, I.M., 2007. Antioxidants decrease reperfusion induced arrhythmias inmyocardial infarction with ST-elevation. Front. Biosci. 12, 2029–2037.

Horkay, F., Geller, L., Kiss, O., Szabo, T., Vago, H., Kekesi, V., Juhasz-Nagy, A., Merkely, B.,2000. Bosentan the mixed endothelin-A- and -B-receptor antagonist suppressesintrapericardial endothelin-1-induced ventricular arrhythmias. J. Cardiovasc.Pharmacol. 36, S320–322.

Kao, J.P., Harootunian, A.T., Tsien, R.Y., 1989. Photochemically generated cytosoliccalcium pulses and their detection by fluo-3. J. Biol. Chem. 264, 8179–8184.

Kim, J.Y., Saffen, D., 2005. Activation of M1 muscarinic acetylcholine receptorsstimulates the formation of a multiprotein complex centered on TRPC6 channels.J. Biol. Chem. 280, 32035–32047.

Lehnart, S.E., Wehrens, X.H., Laitinen, P.J., Reiken, S.R., Deng, S.X., Cheng, Z., Landry, D.W.,Kontula, K., Swan, H., Marks, A.R., 2004. Sudden death in familial polymorphicventricular tachycardia associated with calcium release channel (ryanodinereceptor) leak. Circulation 109, 3208–3214.

Minamisawa, S., Ikeda, Y., 2006. Sarcoplasmic reticulum function and heart failure: anovel therapeutic target for heart failure. Clin. Calcium 16, 37–44.

Na, T., Huang, Z.J., Dai, D.Z., Zhang, Y., Dai, Y., 2007. Abrupt changes in FKBP12.6 andSERCA2a expression contribute to sudden occurrence of ventricular fibrillation onreperfusion and are prevented by CPU86017. Acta Pharmacol. Sinica 28, 773–782.

Neuman, R.B., Bloom, H.L., Shukrullah, I., Darrow, L.A., Kleinbaum, D., Jones, D.P., DudleyJr., S.C., 2007. Oxidative stress markers are associated with persistent atrialfibrillation. Clin. Chem. 53, 1652–1657.

Ortega, R.M., 2006. Importance of functional foods in the Mediterranean diet. PublicHealth Nutr. 9, 1136–1140.

Papparella, I., Ceolotto, G., Berto, L., Cavalli, M., Bova, S., Cargnelli, G., Ruga, E., Milanesi,O., Franco, L., Mazzoni, M., Petrelli, L., Nussdorfer, G.G., Semplicini, A., 2007.Vitamin C prevents zidovudine-induced NAD(P)H oxidase activation and hyperten-sion in the rat. Cardiovasc. Res. 73, 432–438.

Pedersen, H.S., Elming, H., Seibaek, M., Burchardt, H., Brendorp, B., Torp-Pedersen, C.,Kober, L., 2007. Risk factors and predictors of Torsade de pointes ventriculartachycardia in patients with left ventricular systolic dysfunction receivingDofetilide. Am. J. Cardiol. 100, 876–880.

Porter, M.J., Heidkamp, M.C., Scully, B.T., Patel, N., Martin, J.L., Samarel, A.M., 2003.Isoenzyme-selective regulation of SERCA2 gene expression by protein kinase C inneonatal rat ventricular myocytes. Am J Physiol. Cell Physiol. 285, C39–C47.

Pratt, C.M., Al-Khalidi, H.R., Brum, J.M., Holroyde, M.J., Schwartz, P.J., Marcello, S.R.,Borggrefe, M., Dorian, P., Camm, A.J., 2006. Cumulative experience of azimilide-associated torsades de pointes ventricular tachycardia in the 19 clinical studiescomprising the azimilide database. J. Am. Coll. Cardiol. 48, 471–477.

Pratt, C.M., Moye, L.A., 1990. The Cardiac Arrhythmia Suppression Trial: background,interim results and implications. Am. J. Cardiol. 65, 20B–29B.

Qi, M.Y., Xia, H.J., Dai, D.Z., Dai, Y., 2006. A novel endothelin receptor antagonist CPU0213improves diabetic cardiac insufficiency attributed to up-regulation of the expres-sion of FKBP12.6, SERCA2a, and PLB in rats. J. Cardiovasc. Pharmacol. 47, 729–735.

Rah, D.K., Han, D.W., Baek, H.S., Hyon, S.H., Park, B.Y., Park, J.C., 2007. Protection of rabbitkidney from ischemia/reperfusion injury by green tea polyphenol pretreatment.Arch. Pharm. Res. 30, 1447–1454.

Sasser, J.M., Sullivan, J.C., Hobbs, J.L., Yamamoto, T., Pollock, D.M., Carmines, P.K., Pollock,J.S., 2007. Endothelin A receptor blockade reduces diabetic renal injury via an anti-inflammatory mechanism. J. Am. Soc. Nephrol. 18, 143–154.

Sen-Chowdhry, S., McKenna, W.J., 2006. Sudden cardiac death in the young: a strategyfor prevention by targeted evaluation. Cardiology 105, 196–206.

Tajima, M., Weinberg, E.O., Bartunek, J., Jin, H., Yang, R., Paoni, N.F., Lorell, B.H., 1999.Treatment with growth hormone enhances contractile reserve and intracellularcalcium transients in myocytes from rats with postinfarction heart failure.Circulation 99, 127–134.

Tokuhisa, T., Yano, M., Obayashi, M., Noma, T., Mochizuki, M., Oda, T., Okuda, S., Doi, M.,Liu, J., Ikeda, Y., Yamamoto, T., Ohkusa, T., Matsuzaki, M., 2006. AT1 receptorantagonist restores cardiac ryanodine receptor function, rendering isoproterenol-induced failing heart less susceptible toCa2+-leak induced byoxidative stress. Circ. J.70, 777–786.

VerNooy, R.A., Mangrum, J.M., 2005. Azimilide, a novel oral class III antiarrhythmic forboth supraventricular and ventricular arrhythmias. Curr. Drug Targets Cardiovasc.Haematol. Disord. 5, 75–84.

Virag, L., Scott, G.S., Antal-Szalmas, P., O'Connor, M., Ohshima, H., Szabo, C., 1999.Requirement of intracellular calcium mobilization for peroxynitrite-induced poly(ADP-ribose) synthetase activation and cytotoxicity. Mol. Pharmacol. 56, 824–833.

Waldo, A.L., Camm, A.J., deRuyter, H., Friedman, P.L., MacNeil, D.J., Pauls, J.F., Pitt, B.,Pratt, C.M., Schwartz, P.J., Veltri, E.P., 1996. Effect of d-sotalol onmortality in patientswith left ventricular dysfunction after recent and remote myocardial infarction. TheSWORD Investigators. Survival With Oral d-Sotalol. Lancet 348, 7–12.

Wang, H.L., Dai, D.Z., Gao, E., Zhang, Y.P., Lu, F., 2004. Dispersion of ventricular mRNA ofRyR2 and SERCA2 associated with arrhythmogenesis in rats. Acta Pharmacol. Sinica25, 738–743.

Wehrens, X.H., Lehnart, S.E., Huang, F., Vest, J.A., Reiken, S.R., Mohler, P.J., Sun, J.,Guatimosim, S., Song, L.S., Rosemblit, N., D'Armiento, J.M., Napolitano, C., Memmi,M., Priori, S.G., Lederer, W.J., Marks, A.R., 2003. FKBP12.6 deficiency and defectivecalcium release channel (ryanodine receptor) function linked to exercise-inducedsudden cardiac death. Cell 113, 829–840.

Wehrens, X.H., Marks, A.R., 2004. Molecular determinants of altered contractility inheart failure. Ann. Med. 36 (Suppl 1), 70–80.

Wilson, L.D., Wan, X., Rosenbaum, D.S., 2006. Cellular alternans: a mechanism linkingcalcium cycling proteins to cardiac arrhythmogenesis. Ann. N.Y. Acad. Sci. 1080,216–234.

Xia, H.J., Dai, D.Z., Dai, Y., 2006. Up-regulated inflammatory factors endothelin,NFkappaB, TNFalpha and iNOS involved in exaggerated cardiac arrhythmias in l-thyroxine-induced cardiomyopathy are suppressed by darusentan in rats. Life Sci.79, 1812–1819.

Xu, F.P., Chen, M.S., Wang, Y.Z., Yi, Q., Lin, S.B., Chen, A.F., Luo, J.D., 2004. Leptin induceshypertrophy via endothelin-1-reactive oxygen species pathway in culturedneonatal rat cardiomyocytes. Circulation 110, 1269–1275.

Yano, M., Kobayashi, S., Kohno, M., Doi, M., Tokuhisa, T., Okuda, S., Suetsugu, M., Hisaoka,T., Obayashi, M., Ohkusa, T., Kohno, M., Matsuzaki, M., 2003. FKBP12.6-mediatedstabilization of calcium-release channel (ryanodine receptor) as a novel therapeuticstrategy against heart failure. Circulation 107, 477–484.

Yaras, N., Bilginoglu, A., Vassort, G., Turan, B., 2007. Restoration of diabetes-inducedabnormal local Ca2+ release in cardiomyocytes by angiotensin II receptor blockade.Am. J. Physiol. Heart Circ. Physiol. 292, H912–920.

Zorov, D.B., Juhaszova, M., Sollott, S.J., 2006. Mitochondrial ROS-induced ROS release: anupdate and review. Biochim. Biophys. Acta 1757, 509–517.