expression of metastasis-related nm23-hl and nm23-h2 genes in … · c-myc (21, 22), c-fms (23),...

[CANCER RESEARCH 54, 1825-1830, April 1. 1994]

Expression of Metastasis-related nm23-Hl and nm23-H2 Genes in OvarianCarcinomas: Correlation with Clinicopathology, EGFR, c-erbR-2,and c-erbB-3 Genes, and Sex Steroid Receptor Expression1

Masaki Mandai, Ikuo Konishi, Masafumi Koshiyama, Takahide Mori, Shinji Arao, Hironori Tashiro,Hitoshi Okamura, Hiroshi Nomura, Hiroshi Hiai, and Manabu Fukumoto2

Departments of Pathology Â¡M.M., S. A., H. N., H. H., M. F.], and (iynecology and Obstetrics Â¡M.M., l. K., M. K., T. M.], Faculty of Medicine, Kyoto University, Sakyo-ku,

Kyoto 606. und Department of Obstetrics and Gynecology, School of Medicine. Kumamoto University, Kitmamoto KnO /S. A., H. T., H. O,], Japan

ABSTRACT

To verify the role of metastasis-related nm23 genes in carcinogenesis

and progression of ovarian carcinoma, we analyzed the mRNA levels ofthe nm23 genes of both isoforms, -HI and -H2, together with those of theepidermal growth factor receptor, the c-erbB-2, and the c-erbB-3 genes in

45 ovarian carcinomas and 5 benign cystadenomas. Expressions of nm23gene products/nucleoside diphosphate kinases, epidermal growth factorreceptor, erbB-2 protein, and sex steroid receptor status in ovarian car

cinomas were also examined by immunohistochemistry. The mRNA levelsof HIH2.Ã•-II1and nm23-H2 were higher in carcinoma tissues comparedwith benign tumors (III. P < 0.01). The mRNA levels of c-erbÃŸ-2andc-erbB-3 were also elevated in carcinoma tissues, and there was a positivecorrelation between mRNA levels of the nm23-HÂ¡ and the o

nm23 EXPRESSION IN OVARIAN CARCINOMAS

Table 1 mRNA expression of the nm23 gene in relation to clinical stage andhistological subtype

The values of nm23-Hl and nm23-H2 expressions represent relative expressions ofthese genes to ÃŸ2-MGand ÃŸ-actinexpressions, respectively.

NormalovaryBenigntumor'LMP''CarcinomaStage

1Stage IIStage 111Stage IVSerousMucinousl-ndometrioidClear

celln"6544111

321625295nm23-Hlmean

Â±SD0.43

Â±0.060.55

Â±0.070.68

Â±0.260.90Â±0.35'0.92

Â±0.310.98 Â±0.250.95 Â±0.380.62 Â±0.33r

0.90 Â±0.360.45Â±0.321.01Â±0.300.83Â±0.24n"6512611

210

314183nm23-H2mean

Â±SD0.69

Â±0.101.04

Â±0.621.771.45

Â±0.981.11 Â±0.85

1.94 Â±0.501.91 Â±1.010.54 Â±0.537

1.60 Â±1.000.131.52

Â±1.001.04Â±0.51

" Total case number.h Cases in which nm23-H2 expression was determined.c Consisted of two serous, two mucinous, and one endometrioid.

Consisted of two serous and two endometrioid.' Significantly higher expression (P < 0.01) compared with benign tumor and normal

ovary.^Significantly lower expression (P < 0.05) compared with I-III stages.

ucts, and the references are listed in Table 2. Oligonucleotidc probes forSouthern and Northern hybridization were labeled with [y-12P]ATP by T4polynucleotide kinase according to the manufacturer's protocol (Nippon Gene,

Tokyo, Japan).RNA Preparation and Northern Blot Hybridization. Total RNA was

isolated by the method of Chomczynski and Sacchi (36). Fifteen Â¿igof totalRNA were separated by electrophoresis in 0.9% agarose-formaldehyde gels

and transferred onto nylon membranes. Oligonucleotide probes of 45 mer tothe 3' untranslated regions of both nm23-HI (bases 558-602) and nm23-H2

(bases 529-573; Ref. 31) complementary DNA were hybridized sequentiallyto the membranes at 50Â°Cin 5 X saline-sodium phosphate-EDTA, 1% sodiumdodecyl sulfate, 5 x Denhardt's solution, and 0.5 mg/ml salmon sperm DNA,

followed by final washes in 0.1 X standard saline citrate and 19Ã-sodiumdodecyl sulfate for 5 min at 6()Â°C.In order to normalize the amount of loaded

RNA. the filters were rehybridized to a chick ÃŸ-actinprobe (37). Radioactivity

was determined by a BAS 2000 Bioimage Analyzer (Fujix, Tokyo, Japan).RT-PCR. RT-PCR was performed according to the method of Noonan et

al. (33) with some modifications. Complementary DNA was prepared from 1fig of total RNA by random priming using a First-Strand cDNA synthesis kit(Pharmacia-LKB, Uppsala, Sweden). PCR was carried out in a Thermal Cycler(Perkin-Elmer Cetus, Northwalk, CT) with the mixture consisting of comple

mentary DNA derived from 50 ng of RNA, 8 pmol each of upstream anddownstream primers for both the target gene and the ÃŸ2-MGgene, 200 jumolof deoxynucleotide triphosphate, 37 kBq of [c*-'2P]dCTP, and 0.1 unit of Taq

DNA polymerase with reaction buffer (Wako Chemicals, Osaka, Japan) in afinal volume of 10 ju.1.The conditions for PCR were denaturation at 94Â°Cfor30 s, annealing at 55Â°Cfor 1 min, and extension at 72Â°Cfor 1 min. Thirty

cycles of PCR were performed for each specimen, and the products wereseparated on \2% polyacrylamide gels. Then radioactivity was measured byBAS 2000. In order to ascertain if PCR products were the target sequence,PCR was carried out without [a-32P)dCTP, electrophoresed in 6% polyacryl

amide gel. Southern transferred onto a nylon membrane, and hybridized to a 27mer probe corresponding to the sequence in-between the primers.

Immunohistochemistry. Rabbit polyclonal antibody against the rat NDPKwas provided by Dr. Narimichi Kimura, Department of Molecular Biology,Metropolitan Institute of Gerontology, Tokyo, Japan. This antibody is knownto react with both nm23-Hl and nm23-H2 proteins and to be suitable for

immunohistochemical analysis of human samples (38). Mouse monoclonalantibodies against the external domain of EGFR (Ab-1) and against theexternal domain of erbB-2 protein were purchased from Oncogene Science

(New York, NY) and Triton Diagnostics (Chicago, IL), respectively. Immunohistochemistry was performed on cryostat sections using a Histoscan RabbitSystem (Biomeda, Foster, CA) for NDPK and a Monoclonal Detector Kit(Biomeda) for EGFR and erbB-2 proteins. Immunohistochemistry for ER and

PR was performed on serial cryostat sections using ER-ICA and PgR-ICA

monoclonal kits (Abbott, North Chicago, IL).Statistical Analysis. Differences of mRNA levels between two indepen

dent groups were evaluated by Mann-Whitney's U test, and the results of

immunohistochemistry were analyzed by x2 test. The Spearman rank correla

tion coefficient was used to evaluate the correlation between the paired values.

RESULTS

mRNA Detection by Northern Blot Hybridization and RT-PCR. Expressions of the nm23-H2 gene were detected in all the casesexamined (Fig. IA ), whereas nm23-Hl transcript was not delectable

in any case by Northern blot analysis. On the other hand, the mRNAexpressions of nm23-Hl, EGFR, c-erbB-2, and c-erbB-3 were detected by RT-PCR in all the cases (Fig. IÃŸ).To determine the number

of PCR cycles appropriate for quantification, PCR was performedfrom 20 to 50 cycles at an increase of 5 cycles. The ratio of PCRproducts of target genes to those of the ÃŸ2-MGgene was reasonably

constant between 25 and 45 PCR cycles (data not shown). Therefore,in the subsequent experiments the values at 30 PCR cycles weredefined as the expression of target genes.

nm23 mRNA Levels in Ovarian Tumors. Table 1 shows themRNA levels of the nm23-Hl and the nm23-H2 genes in primarytumors. The expression levels of the nm23-H! gene were significantly

higher in carcinoma tissues compared with those in benign tumors(P < 0.01) and in normal ovaries (P < 0.01; Table 1; Fig. 2). Theexpression levels of the nm23-H2 gene were also higher in carcinomas

than in benign tumors and in normal ovaries, although the differenceswere not significant. In LMP cases, nm23-Hl expression was in-

between benign tumors and frank carcinomas.

Table 2 Sequences of amplification primers shown in 5' Â».?'orienlation

U and D indicate upstream and downstream primers.

GeneEGFR

c-erbft-2

c-erbB-3

nm23-Hl(3;-Microg]obulinPrimerU

CAAACTGCTGGGTGCGGAAD

TCCGTCATATGGCTTGGAT

UAATGTCGGCCAAGATTCCGGD

GCTGGGCCCAAGTCCTCATT

U TGATAAGCAGCTGCTATACAD

TGGTACTTCAGCCAATCGTAG

UAGTTCAAACCTAAGCAGCTGD

AGATCTTCGGAAGCTTGCAT

UACCCCCACTGAAAAAGATGAD

ATCTTCAAACCTCCATGATGPCRproduct

(bp)Â°175

100

178

169

120Reference''48

25

30

31

33

1Size of the amplified fragments obtained with each pair of primers.1 Referred articles to design the primers.

PM PM PM PM

nm23-H2>

n-actin *â€¢ â€¢â€¢â€¢â€¢ffff

-Â°'8kb

-2'0kb

BFig. 1. A, representative Northern blot hybridization of nm23-H2. P and A/, primary

ovarian tumor and peritoneal disseminated lesion of four matched cases, respectively.nm23-H2 expression (top) was shown as 0.8-kilobase bands, and ÃŸ-actin expression(bottom) was used as control. B, representative RT-PCR of nm23-Hl, EGFR, c-erbB-2.and c-erbB-3. Amplified fragments were electrophoresed on 12% polyacrylamide gels andstained with cthidium bromide. A 120-base pair band of each line indicates ÃŸ2-MG.

1826

on June 25, 2021. © 1994 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

nm23 EXPRESSION IN OVARIAN CARCINOMAS

i.UC

1.5-0WÂ£a5

1.0-^

ICMC

0.5-n

n -45

6â€¢i **Â»T

*11**'|â€¢iI**3Â§â€¢

*15â€¢itti*66Ã¯

1â€¢;â€¢

normalovary

benigntumor LMP

(LN-) (LN+)II I III I IV

-carcinoma-

Fig. 2. nm23-fll expressions in ovarian carcinoma of each stage in comparison withLMP, benign tumors, and normal ovaries. Bars, mean Â±SD. The numeral above eachgroup indicates case number. I.N, lymph node involvement; *. P < 0.05; â€¢*,P < 0.01.

eotaWSa.XO)

â€¢oCn

CMEe

5.0

4.0

3.0

2.0

1.0

0.0primary peritonealtumor dissemination

Fig. 3. nni23-Hl and nm23-H2 expressions in four matched pairs of primary ovariancarcinomas and peritoneal disseminated lesions. O, nm23~HI expression; â€¢,nm23-H2expression.

With respect to clinical stage of ovarian carcinomas, both nm23-Hland nm23-H2 showed almost similar levels of expression in stages \,

U, and III, respectively (Table I). Interestingly, stage IV carcinomasexhibited lower levels of expression of nm23-Hl and nm23-H2 compared with stage I-III carcinomas (P < 0.05, respectively). In fourcases of stage III carcinomas, the expressions of nm23-Hl andnm23-H2 could be compared between the primary tumors and their

corresponding peritoneal metastatic lesions. The expressions ofnm23-Hl and nm23-H2 were lower in the metastatic lesions in three

of four cases, although the difference were not significant. (Fig. 3).Among stage III carcinomas, nm23-Hl mRNA levels of primary

tumors were significantly lower in cases with lymph node metastasisthan in those negative for lymph node metastasis (P < 0.05; Fig. 2).On the other hand, nm23-H2 mRNA levels were not different, irre

spective of lymph node involvement.With regard to the histological subtype of ovarian carcinoma,

expressions of the nm23-Hl and the nm23-H2 genes were lower in

mucinous tumors compared with other histological subtypes. However, the difference was not statistically significant (Table 1). Neithernm23-Hl nor nm23-H2 mRNA level showed significant correlation

with the grade of histological differentiation of carcinomas (data notshown).

EGFR, c-erbB-2, c-erbB-3 mRNA Levels in Ovarian Tumors.Fig. 4 shows expression levels of EGFR, c-erbB-2, and c-erbB-3 in

the primary tumors. The expression levels of the EGFR gene showedno significant difference among all the ovarian tumors and normalovaries examined. In contrast, the expressions of the c-erbB-2 and thec-erbB-3 genes were significantly higher in frank carcinomas com

pared with benign tumors (P < 0.05) and with normal ovaries (P <0.01). Expressions of the c-erbB-2 and the c-erbB-3 genes in LMP

were also significantly higher than those in normal ovaries (P < 0.05).With regard to histological subtypes, mucinous carcinomas showedhigher EGFR expression compared with carcinomas of other types(data not shown).

Correlations of nm23-Hl expression with nm23-H2, EGFR, c-erbB-2, and c-erhB-3 expressions are shown in Fig. 5. Among these,

A.Ãœ.U-CoÂ«

1.5-â€¢0)L.Q.Â«

LO'Oc

H^20-5-i:T

â€¢[IITJa:il!normalbenign LMpcarcinomaovary

tumorc

B-Ofx"

1.0-0)CM

1So-5"0)

n n -,iT*.

, a ilu:0

. 0normal benign . .._ovary tumor LMPÂ«rcmomaC.2

n.UCoS

'-s-1X0)

LO

COi!

Â«-iUnn -..T

*1!â€¢

T *'i--I--

Â»I|I1-1-

â€¢1*

. I

normal benignovary tumor LMP carcinoma

Fig. 4. (A ), Edl-'R; (ÃŸ).c-cr/>B-2; and (C) c-cr/>B-3 expressions in ovarian carcinomas

in comparison with LMP. benign tumors, and normal ovaries, ÃŸÃ¼n.mean Â± SD;*. significantly higher than benign tumors (P < (1.01).

1827



nm2) EXPRESSION IN OVARIAN CARCINOMAS

aC

0'Soa.Xo

1-1In

-ODD

OD Â°a

a'

?Â«*'oÂ¿

-C

OmiaS

1-X1n

-u

oaB

Â°Baâ€¢aJtoÂ°

Boa0

"03Â°*0Dno^1D

12345

nm23-H2 expression

O 1 2

EGFR expression

iCoÂ«(00)Ã¤.S

i1In-aDSa

ana

a Qo*Â°Â°f:BD2-coâ€¢ia.S1-Xi1

,aa%

aOoÂ°

% D Â°Â° Â° Â°DÃ¼o

"u'Ã¯oD00 aAffTlÂ»0 a

fi GQDC*Â° 0

O 1 2

c-ertB-2 expressionO 1 2

c-erÃ²B-3 expression

Fig. 5. Individual correlations between nm23-HÂ¡ expression and expressions of nm23-H2. EGFR, c-erbB-2, and c-erbB-3. Moderately positive correlations (r = 0.58; P < 0.01)were found between nm23-Hl and c-t'roB-2 expressions. O, normal ovary; A, benign

tumor; U, LMP and carcinoma.

nm23-Hl expression showed moderately positive correlation withc-erbB-2 expression (r = 0.58; P < 0.01). However, the c-erbB-2

gene did not show significant reduction of mRNA levels as observedin nm23 expressions in association with distant metastasis.

liiuMiiiioliixicKlniiiii.il Detection of nm23 Product/NDPK,EGFR, and erbB-2 Proteins. Immunohistochemical localizations ofNDPK, EGFR, erbB-2 proteins, and ER/PR status were studied in 28carcinomas, 2 benign cystadenomas, and 2 normal ovaries. Immuno-

reactivity for NDPK was observed both in the cytoplasm and thenucleus, although background staining was rather high. In the normalovary, surface epithelial cells were stained weakly positive for NDPK,while other components were negative. Epithelial tumor cells ofserous and mucinous cystadenomas were moderately positive forNDPK. In carcinoma tissues, the staining intensity for NDPK wasvaried: negative or weakly positive in 5 (17.9%); moderately positivein 16 (57.1%); and strongly positive in 7 (25.0%) cases (Fig. 6).

EGFR staining was negative or very weak in 27 carcinomas(96.4%) and very strong in only 1 case of stage IV carcinoma. On theother hand, 26 carcinomas (92.9%) were positive for erbB-2 protein in

a cell membrane pattern (Fig. 6): moderately positive in 16 (57.1%)cases and strongly positive in 10 (35.7%) cases. Staining intensity oferbB-2 protein was well correlated with that of NDPK (P < 0.05).

This was consistent with the analysis of the transcriptional level in thecurrent study.

Sex Steroid Receptor Status in Ovarian Tumors. Immunoreac-

tivity for ER/PR was confined in the nuclei (Fig. 6). ER expression ofcarcinomas was positive in seven (25.0%) cases and PR expression infive (17.9%) cases; ER and/or PR positivity was observed in eight(28.6%) cases. ER/PR status was not significantly correlated witheither stage or histological subtype of ovarian carcinomas.

Table 3 indicates the relationship between ER/PR status and NDPKimmunoreactivity. All of the eight ER- and/or PR-positive carcinomas

showed moderate to strong staining for NDPK. On the other hand, in20 ER- and PR-negative carcinomas, NDPK expression was negative

in 5 (25.0%) cases and positive in 15 (75.0%) cases.

DISCUSSION

The present study demonstrated the expression levels of metastasis-related nm23 genes of both nm23-Hl and nm23-H2 isoforms in

ovarian epithelial carcinomas, benign tumors, and normal ovaries. ThemRNA levels of nm23-Hl were significantly higher in frank carcino

mas than in benign ovarian tumors. The expression levels of thenm23-H2 gene in ovarian carcinomas were also higher than in benign

tumors, although the difference was not significant. This suggests thatactivation of nm23 gene expression, especially that of nm23-Hl,

occurs during tumorigenesis of ovarian carcinoma, and this is consistent with the previous report regarding nm.23 expression in coloncarcinoma (14). In malignant melanoma (12) and gastric carcinoma(13), it is also reported that nm23 expression is higher in tumorscompared with corresponding normal tissues. LMP is a unique category of ovarian carcinoma intermediate between clearly benign andfrankly malignant tumors (39). In the present study, nm23-HI expres

sion levels of LMP ranged between those of benign tumors and frankcarcinomas, suggesting that nm23 gene expression is well correlatedwith the histopathological features of epithelial ovarian tumors.

Clinical stage is the most important prognostic factor for ovarian carcinoma (39), reflecting the pathways of expansion: direct spread by localextension (stage II); intraperitoneal dissemination (stage III); and regionallymph node metastasis (stage IIIc) or hematogenous distant metÃ¡stasis(stageIV). Our study showed that the expression levels of both the nm23-Hl andthe nm23-H2 genes were not significantly different between stage I carcino

mas and primary lesions of more advanced stage II and III carcinomas.Neither nm23-Hl nor im23-H2 mRNA level was significantly different

between primary tumors and peritoneal disseminated lesions in all of the fourmatched pairs in stage HI carcinomas. These findings suggest that nm23-HIand nm23-H2 expressions are not related to either direct extension or seeding

into the peritoneal cavity of the carcinoma cells. Interestingly, however,among stage III tumors, wn23-Hl expression in primary lesions of the

carcinomas with lymph node metastasis was significantly lower than that oftumors without nodal metastasis. On the other hand, expression of thenm23-H2 gene was not significantly different between these node-positiveand negative tumors. Expression levels of the nm23-Hl and the nm23-H2

genes of stage IV carcinomas were lower compared with those of otherstages (P < 0.05). Thus, it appears that the expression level of the nm23-Hl

gene in the primary tumor is inversely associated with lymph node metastasisand/or distant metastasis and that reduction ofnm23 expression levels may bea late event during the progression of ovarian carcinomas.

To date, there are only a limited number of reports on nm23expression in which the two isoforms of the nm23 genes are separatelymeasured, presumably due to their high homology in nucleotidesequences and/or due to low expression of the nm23-Hl gene. It has

been reported that the expressions of the two genes may be regulatedindependently (31). In the present study the expression of nm23-Hlrather than nm23-H2 appeared more closely related to tumorigenesis

and progression of ovarian carcinomas.Immunohistochemical study using polyclonal antibody against

NDPK revealed the intracytoplasmic localization of the nm23 geneproducts (NDPKs) both in normal and neoplastic cells of the ovary.The staining intensity for NDPKs in ovarian carcinoma cells wasstronger than that in the surface epithelial cells of normal ovaries fromwhich ovarian carcinoma is thought to arise. However, we needfurther study to determine correlation between transcriptional andtranslational levels of the nm23 genes using antiisoform-specific

antibodies against human NDPKs because the antibody used in thisstudy was raised against rat NDPK and reacts with both isoforms ofnm23-Hl and nm23-H2 products by immunoblotting (38).

NDPKs have been reported to be associated with a variety ofGTP-binding proteins and to regulate the function of G-proteins in

signal transduction (40). This prompted us to study the possible1S28



limi) lAPRI SSION IN OVARIAN l AR( INOMAS

Fig. 6. lmmunoh istoche mica l localization of NDPK. erbB-2 protein, and PR in a case of endometrioid adcnocarcinoma of the ovary. A, malignant tumor cells showing intracellularlocalization for NDPK. B, staining of erbB-2 protein observed on the cell membrane. C, PR positivity observed in the nucleus of the tumor cells. D, negative control of the same sample.Normal rabbit serum was used instead of anti-NDPK antibody. A-D, X 200.

Table 3 Relutionslup between NDPK positivity and ER/PR status in carcinomasStaining intensity was evaluated as negative (-), weakly positive (Â±), moderately

positive ( + ), and strongly positive ( + + ) by two independent observers. Since localizationof ER and PR in the tumors was heterogeneous, the percentage of positive cells wasgraded as (-) when none of the nuclei was stained, ( + ) when less than 50% of the nucleiwere stained, and (+ +) when 50% or more of the nuclei were stained.

NDPK

ER and/orPRTotal.~Â± (%)5(25)

0(0)5+

(%)11(55)

5(62)16+

+(%)4(20)

3(38)7Total20 828

relationship between nm23 mRNA levels and expression levels ofother signal transduction-related oncogenes such as EGFR familymembers. Overexpression of the c-erb-B2 gene in ovarian carcinoma

has been well documented in association with poor prognosis (26, 28).A previous study using immunohistochemistry has also shown higherexpression of erbB-2 protein in ovarian carcinomas than in normal

surface epithelium of the ovary and benign ovarian cystadenomas(41). In agreement with these reports, the current study revealedsignificantly higher mRNA levels of the c-erbB-2 gene in carcinoma

tissues than in benign tumors. The significance of EGFR in association with the behavior of ovarian carcinoma is controversial, i.e.,EGFR positivity reportedly indicates positive (42) and inverse (43)correlation with a better patient's prognosis. To the best of our

knowledge, systematic analysis of EGFR gene expression inovarian carcinoma has not been described. Expression of erbB-3

protein is histochemically observed in the germ cells of the fetalovary and granulosa cells of the adult ovary (44), but its expressionin ovarian carcinoma has not yet been reported. The current studyrevealed that the c-erbB-3 gene expression was elevated in ovarian

carcinomas compared with benign tumors and was closely relatedto c-erbii-2 expression. Therefore, activation of both the c-erbB-2and the c-erbB-3 genes may contribute to carcinogenesis of ovarian

carcinoma.It is reported that ovarian and breast cancer cell lines transfected with

c-erbB-2 exhibited reduced nnÂ¡23RNA level (45). In this study, however,

there was a significant positive correlation between the mRNA levels of thenm23-Hl and the c-erbB-2 genes in ovarian carcinoma. This correlationwas

also observed by immunohistochemical staining of the serial sections fornm23 products/NDPKs and erbB-2 protein. Further studies are needed toclarify the functional interaction between the ivn23 genes and the c-erhB-2

gene in ovarian carcinoma.In the present study, immunohistochemical expression of NDPK

was positive in all of the ER/PR positive carcinomas, whereas 33% ofthe cases of ER/PR negative tumors were negative for NDPK. This isconsistent with the study that breast carcinomas with high nm23expression exhibit ER positivity (46). Expressions of both thenm23-Hl and the nm23-H2 genes are also reportedly higher in estrogen-dependent MCF-7 cells compared with the estrogen-independentMDAMB-435 cell line (31).

In summary, fluctuation of metastasis-related nm23-Hl gene ex

pression may play an important role in progression and metastasis ofovarian carcinoma. Although the intracellular function of nm23 gene

1829



nm23 EXPRESSION IN OVARIAN CARCINOMA

products/NDPKs in relation to growth and metastasis of ovariancarcinoma remains undetermined, possible relationships have beensuggested between nm23 gene expression and c-erbB-2 and sex

steroid receptor expressions. Recently, point mutational inactivationof the nm23-HI gene in relation to metastasis has been found in

colorectal carcinoma (47), suggesting that the cell population possessing impaired nm23 function shows highly metastatic activity. A studyto analyze mutational changes of the nm23 genes in ovarian carcinoma is now under way in our laboratory.

ACKNOWLEDGMENTS

We thank Dr. Narimichi Kimura for providing the anti-NDPK antibody and

Dr. Patricia S. Stecg for her helpful advice.

REFERENCES

1. Fidler, 1. J. Critical factors in the biology of human cancer melaslasis: twenty-eighthG. M. A. Clowes Memorial Award Lecture. Cancer Res.. 50: 6130-6138. 1990.

2. Liolta. L. A. Tumor invasion and metastasisâ€”role of the extracellular matrix. CancerRes., -Jo: 1-7, 1986.

3. Liotta, L., Stecg, P. S.. and Stetler-Stevcnson. W. G. Cancer metastasis and angio-genesis: an imbalance of positive and negative regulation. Cell. 64: 327-336. 1991.

4. Yu, D., Mamada. J.. Zhang, H.. Nicolson. G. L., and Hung. M. C. Mechanisms ofc-cr/Ã-B2/m'Ã-Ã-oncogene-induced metastasis and repression of metastatic properties byadenovirus 5 EIA gene products. Oncogene. 7: 2263â€”2270. 1992.

5. Steeg, P. S.. Bevilacqua. G., Kopper. L.. Thorgeirsson. U. P., Talmadge, J. B., Liotta.L. A., and Sobel, M. E. Evidence for a novel gene associated with low tumormetastatic potential. J. Nati. Cancer Inst., 80: 2(H)-204, 1988.

6. Leone, A., Seeger, R. C., Hong, C. M.. Hu. Y. Y., Arboleda. M. J.. Brodeur. G. M.,Stram. D.. Slamon, D. J.. and Steeg, P. S. Evidence for nni23 RNA overexpression.DNA amplification and mutation in aggressive childhood neuroblastomas. Oncogene.8: 855-865. 1993.

7. Rosengard, A., Krul/sch. H.. Shearn. A.. Biggs. J.. Barker. E.. Margulies. !.. King, C.,Liotta. L., and Steeg, P. Reduced nm23/Awd protein in tumor metastasis and aberrantDrosophilu development. Nature (Lond.), 342: 177-180. 1989.

8. Hirayama, R., Sawai, S., Takagi, Y.. Mishima, Y., Kimura. N., Shimada, N.. Esaki.Y.. Kurajima, C., and Hirokawa. K. Positive relationship between expression ofanti-metastatic factor (nm23 gene product or nucleoside diphosphate kinase) and goodprognosis in human breast cancer. J. Nati. Cancer Insl.. 83: 1249-1250. 1991.

9. Barnes. R., Masood. S., Barker. E.. Rosengard, A. M., Coggin. D. L., Crowell, T.,King. C. R.. Porter-Jordan, K., Wargot/, E.. Liotta. L. A., and Steeg. P. S. Low nm23protein expression in infiltrating ductal breast carcinomas correlates with reducedpatient survival. Am. J. Pathol.. 139: 245-250. 1991.

10. Hennessy. C., Henry. J. A., May. F. E. B., Westlcy. B. R., Angus, B., and Lcnnard.T. W. J. Expression of the antimetastatic gene tiin23 in human breast cancer: anassociation with good prognosis. J. Nati. Cancer Inst.. 83: 281-285. 1991.

11. Nakayama, T., Ohtsum, A., Nakao, K.. Shima, M.. Nakata, K.. Watanabe. K.. Ishii.K.. Kimura. N.. and Nagataki. S. Expression in human hepatocellular carcinoma ofnucleoside diphosphate kinase, a homologue of the nm23 gene product. J. Nati.Cancer Inst., 84: 1349-1354. 1992.

12. Florenes, V. A., Aamdal, S.. Myklebost, O.. Maclandsmo. G. M., Bruland. O. S., andFodstad. O. Levels of nm23 messenger RNA in metastatic malignant melanomas:inverse correlation to disease progression. Cancer Res.. 52: 6088-6091, 1992.

13. Nakayama. H.. Yasui, W., Yokozaki, H., and Tahara. E. Reduced expression of nni23is associated with metastasis of human gastric carcinomas. Jpn. J. Cancer Res., 84:184-190, 1993.

14. Haut, M., Steeg, P. S.. Willson, J. K. V.. and Markowitz. S. D. Induction of nm23gene expression in human colonie neoplasms and equal expression in colon tumors ofhigh and low metastatic potential. J. Nail. Cancer Insl., 83: 712-716. 1991.

15. Hailal. N.. Keim, D. R.. Meinem, R. F.. Zhu. X. X., Eckerskorn. C.. Brodeur, G. M..Reynolds, C. P., Seeger, R. C.. Loltspeich, F.. Strahler, J. R.. and Hanash, S. M. Highlevels of pl9/nm23 protein in neuroblastoma are associated with advanced stagedisease and with N-mvf gene amplification. J. C'lin. Invest.. 88: 341-345. 1991.

16. Okamoto, A.. Sameshima. Y., Yokoyama. S.. Terashima. Y.. Sugimura, T., Terada.M.. and Yokota. J. Frequent allelic losses and mutations of the p53 gene in humanovarian cancer. Cancer Res., 51: 5171-5176, 1991.

17. Mazars. R., Pujol. P.. Maudelonc. T.. Jeanteur. P.. and Theillet. C. pS3 mutations inovarian cancer: a late event? Oncogene, fi: 1685-1690, 1991.

18. Feig. L. A., Bast, R. C., Knapp. R. C.. and Cooper. G. M. Somatic activation of thertisK gene in a human ovarian carcinoma. Science (Washington DC). 223: 698-700.

1984.19. Fukumolo, M., Estenson, R. D.. Sha, L.. Oakley, G. J., Twiggs, L. B.. Adocock,

L. L., Carson, L. F., and Roninson, I. B. Association of Ki-rÂ«.vwith amplified DNAsequences, detected in human ovarian carcinomas by a modified in-gel renaturationassay. Cancer Res., 49: 1693-1697, 1989.

20. Boltz, E. M.. Kcfford, R. F., Leary, J. A., Houghton, C. R., and Friedlander, M. L.Amplification of c-ra.v-Ki oncogene in human ovarian tumors. Int. J. Cancer, 43:428-430, 1989.

21. Barker, V. V., Borst. M. P., Dixon. D., Hatch, K. D., Shingleton, H. M., and Miller.D. c-myc amplification in ovarian cancer. Gynecol. Oncol.. 38: 340-342. 1990.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

Tashiro. H.. Miyazaki. K.. Okamura. H.. Iwai, A., and Fukumoto. M. c-myc over-expression in human primary ovarian tumors: its relevance to tumor progression. Int.J. Cancer, 50: 828-833. 1992.

Kacinski, B. M., Carter, D.. Mittal, K., Yee. L. D., Scala, K. A.. Donofrio, L.,Chambers. S. K.. Wang, K. I.. Yang-Feng, T., Rohrschneider. L. R., and Rothwcll.V. M. Ovarian adcnocarcinomas express /m.v-complementary transcripts and /msantigen, often with cocxpression of CSF-I. Am. J. Pathol.. Â¡37:135-147, 1990.

Owens, O. J., Stewart. C.. Brown. I., and Leak. R. E. Epidermal growth factorreceptors (EGFR) in human ovarian cancer. Br, J. Cancer. 64: 907-910. 1991.Yamamoto, T., Ikawa. S.. Akiyama. T.. Semba, K.. Nomura, N., Miyajima, N., Saito.T., and Toyoshima. K. Similarity of protein encoded by the human c-ir/>B-2 gene toepidermal growth factor receptor. Nature (Lond.)..?/": 230-234, 1986.Slamon. D. J.. Godolphin. W.. Jones, L. A.. HÃ¶h.J. A.. Wong. S. G.. Keith, D. E..Levin, W. J., Stuart. S. G.. Udove, J.. Ullrich. A., and Press, M. F. Studies ofHER-2lncii proto-oncogene in human breast and ovarian cancer. Science (WashingtonDC), 244: 707-712, 1989.Zhang. X., Silvia. E.. Gcrshenson. D.. and Hung. M. C. Amplification and rearrangement of c-rr/>B proto-oncogencs in cancer of human female genital tract. Oncogene,4: 985-989. 1989.

Berchuck. A.. Kamel. A.. Whitaker, R.. Kerns. B., Oil. G.. Kinney. R.. Soper. J. T.,Dodge. R.. Clarke-Pearson. D. L.. Marks. P.. McKenzie. S.. Yin, S., and Bast, R. C.Overexpression of HER-2/neu is associated with poor survival in advanced epithelialovarian cancer. Cancer Res., 50: 4087-4091, 1990.

Kraus, M.. Issing, W.. Miki, T., Popescu, N., and Aaronson, S. Isolation andcharacterization of AWf/f.Ã¯.a third member of the AWi/i/cpidcrmal growth factorreceptor family: evidence for overexpression in a subset of human mammary tumors.Proc. Nati. Acad. Sci. USA, 86: 9193-9197, 1989.Plowman, G. D.. Whitney, G. S.. Neubauer, M. G., Green. J. M.. McDonald, V. L.,Todaro, G. J.. and Shoyab. M. Molecular cloning and expression of an additionalepidermal growth factor receptor-related gene. Proc. Nati. Acad. Sci. USA. 87:4905-4909. 1990.

Stahl, J. A., Leone, A.. Rosengard. A. M., Porter. L.. King, C. R.. and Steeg, P. S.Identification of a second human nm23 gene. nm23-H2. Cancer Res.. 51: 445-449.1991.Gilles. A. M., Presecan, E., Vonica, A., and Lascu, I. Nuclcostde diphosphate kinasefrom human erythrocylcs. J. Biol. Chem.. 26o: 8784-8789, 1991.Noonan, K. E.. Beck. C., Holzmayer. T. A., Chin, J. E., Wunder. J. S.. Andruis, I. L.,Gazdar, A. F.. Willman. C. L.. Griffith. B.. Von Hoff, D. D., and Roninson, I. B.Quantitative analysis of MDKI (multidrug resistance) gene expression in humantumors by polymcrase chain reaction. Proc. Nati. Acad. Sci. USA. 87: 7160-7164.1990.Barber. H. R. K. New frontiers in ovarian cancer diagnosis and management. Yale J.Biol. Med.. 64: 127-141. 1991.PICK). Changes in definitions of clinical staging for carcinoma of the cervix andovary: International Federation of Gynecology and Obstetrics. Am. J. Obstet. Gynecol., 756: 263-264. 1987.Chomczynski. P.. and Sacchi. N. Single step method of RNA isolation by guani-diniiini-thiocyanate-phetiol-chloroform extraction. Anal. Biochem.. 162: 156-159.1987.Cleveland. D.. Lopata. M.. MacDonald. R.. Cowan. N.. Rutter. W.. and Kirschner. M.Number and evolutionary conservation of it- and ÃŸ-lubulinand cytoplasmic ÃŸ-andâ€¢y-aclingenes using specific cloned cDNA probes. Cell. 20: 95-105, 19KO.

Higashiyama, M., Doi. O.. Yokouchi, IL. Kodama. K.. Nakamori. S.. Tateishi, R.. andKimura. N. Immunohistochemical analysis of nm23 gene product/NDP kinase expression in pulmonary adenocarcinoma: lack of prognostic value. Br. J. Cancer. 66:533-536, 1992.Morrow, C. P., and Townsend. D. E. Tumors of the ovary: neoplasms derived fromcoelomic epithelium, in: C. P. Morrow and D. E. Townsend (eds.). Synopsis ofGynecologic Oncology, pp. 231-256. New York: John Wiley & Sons, 1987.Kimura. N., and Shimada. N. Evidence for complex formation between GTP bindingprotein (Gs) and membrane-associated nucleoside diphosphate kinase. Biochem.Biophys. Res. Commun., 168: 99-106, 1990.

Wang. D.. Konishi. !.. Koshiyama. M.. Nanbu. Y., Iwai. T.. Nonogaki, H.. Mori. T..and Fujii. S. Immunohistochemical localization of c-erhB-2 protein and epidermalgrowth factor receptor in normal surface epithelium, surface inclusion cysts, andcommon epithelial tumours of the ovary. Virchows Arch. A Pathol. Anat-, 421:393-400. 1992.

Bauknecht, T.. Runge, M., Schwall, M., and Pfleiderer, A. Occurrence of epidermalgrowth factor receptors in human adnexal tumors and their prognostic value inadvanced ovarian carcinomas. Gynecol. Oncol.. 29: 147-157, 1988.Berchuck, A.. Rodriguez. G. C.. Kamel. A.. Dodge, R. K.. Soper, J. T.. Clarke-Pearson. D. L.. and Bast, R. C. Epidermal growth factor receptor expression in normalovarian epithelium and ovarian cancer. Am. J. Obstet. Gynecol., Â¡64:669-674. 1991.

Prigent. S.. Lemoine. N.. Hughes. C.. Plowman. G.. Seiden. C., and Gullick. W.Expression of the c-er/7B-3 protein in normal human adult and fetal tissues. Oncogene, 7: 1273-1278, 1992.Slamon. D. Expression of the nm23 gene and breast cancer prognosis. J. Nati. CancerInst., 83: 229-231, 1991.Bevilacqua, G.. Sobel. M. E.. Liotta, L. A., and Steeg. P. S. Association of low nin23RNA levels in human primary infiltrating ductal breast carcinomas with lymph nodeinvolvement and other histopathological indicators of high metastatic potential.Cancer Res.. 49: 5185-5190. 1989.

Wang, L.. Palei. U.. Ghosh. L., Chen. H. C.. and Banerjee. S. Mutation in the nm23gene associated with metastasis in colorectal cancer. Cancer Res.. 5.?: 717-720. 1993.Ullrich. A.. Coussens. L.. and Hayflich. J. S. Human epidermal growth factor receptorcDNA sequence and aberrant expression of the amplified gene in A43I epidcrmoidcarcinoma cells. Nature (Lond.). 309: 418-425. 1984.

1830



1994;54:1825-1830. Cancer Res Masaki Mandai, Ikuo Konishi, Masafumi Koshiyama, et al. Expression

B-3 Genes, and Sex Steroid ReceptorerbB-2, and c-erb, c-EGFRin Ovarian Carcinomas: Correlation with Clinicopathology,

Genesnm23-H2 and nm23-H1Expression of Metastasis-related

Updated version

http://cancerres.aacrjournals.org/content/54/7/1825

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/54/7/1825To request permission to re-use all or part of this article, use this link

http://cancerres.aacrjournals.org/content/54/7/1825http://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/54/7/1825http://cancerres.aacrjournals.org/

expression of metastasis-related nm23-hl and nm23-h2 genes in … · c-myc (21, 22), c-fms (23),...

Documents