functional regulation of slug / snail2 is dependent on gsk-3β-mediated phosphorylation

Functional regulation of Slug ⁄ Snail2 is dependent onGSK-3b-mediated phosphorylationJin Young Kim1,*, Young Mee Kim1,*, Chang Hee Yang1, Somi K. Cho2, Jung Weon Lee3 andMoonjae Cho1,4

1 Department of Biochemistry, School of Medicine, Jeju National University, South Korea

2 Faculty of Biotechnology, College of Applied Life Sciences, Jeju National University, South Korea

3 Department of Pharmacy, College of Pharmacy, Seoul National University, South Korea

4 Institute of Medical Science, Jeju National University, South Korea

Keywords

epithelial–mesenchymal transition; GlcNAc;

GSK-3b; protein localization; protein

phosphorylation; Snail2

Correspondence

M. Cho, Department of Biochemistry,

School of Medicine, Cheju National

University, Jeju 690-756, South Korea

Fax: +82 64 725 2593

Tel: +82 64 754 3837

E-mail: [email protected]

*These authors contributed equally to this

work

(Received 20 February 2012, revised 15

May 2012, accepted 11 June 2012)

doi:10.1111/j.1742-4658.2012.08674.x

Snail family proteins regulate transcription of molecules for cell–cell adhe-

sion during epithelial–mesenchymal transition (EMT). Based on putative

glycogen synthase kinase 3b (GSK-3b) phosphorylation sites within the

Slug ⁄Snail2, we explored the significance of GSK-3b-mediated phosphory-

lation in Slug ⁄Snail2 expression during EMT. Mutation of the putative

GSK-3b phosphorylation sites (S92 ⁄ 96A or S100 ⁄ 104A) enhanced the

Slug ⁄Snail2-mediated EMT properties of E-cadherin repression and vimen-

tin induction, compared with wild-type Slug ⁄Snail2. S92 ⁄96A mutation

inhibited degradation of Slug ⁄Snail2 and S100 ⁄ 104A mutation extended

nuclear stabilization. Inhibition of GSK-3b activity caused similar effects,

as did the phosphorylation mutations. Thus, our study suggests that GSK-

3b-mediated phosphorylation of Slug ⁄Snail2 controls its turnover and

localization during EMT.

Introduction

The Snail family proteins, such as Snail, Slug ⁄Snail2,EF1(ZEB-1), SIP1(ZEB-2) and Twist, contain four

tandem C2-H2 zinc finger motifs at the COOH-termi-

nus and a highly conserved SNAG repression domain

(one to nine amino acids) that is important for

co-repressor interaction at the NH2-terminus [1]. The

zinc finger binds to a DNA target sequence called the

E-box motif (CANNTG), which is usually found in

tandem in Snail target genes, including E-cadherin [2].

Recent studies have shown that the E-cadherin pro-

moters serve as direct targets for Snail1, and the sup-

pression of E-cadherin causes epithelial–mesenchymal

transition (EMT) and is a major contributor to the

acquisition of an invasive, highly migratory phenotype

during human tumor progression [3]. Snail1 is upregu-

lated in a number of human tumors, including breast,

colon and gastric cancer, and overexpression of Snail1

correlates with tumor grade, nodal metastasis and

tumor recurrence [4,5]. Similarly, another Snail family

member, Slug ⁄Snail2, is also upregulated in breast can-

cer and in malignant mesothelioma [6], is a mediator

of EMT and metastasis [7] and is shown to be induced

by fibroblast growth factor and hepatocyte growth

factor [8].

Abbreviations

b-TrCP, b-transducin repeat containing protein; CHX, cycloheximide; EMT, epithelial–mesenchymal transition; GAPDH, glyceraldehyde-3-

phosphate dehydrogenase; GFP, green fluorescent protein; GSK-3b, glycogen synthase kinase 3b; TGF, transforming growth factor;

WT, wild-type.

FEBS Journal (2012) ª 2012 The Authors Journal compilation ª 2012 FEBS 1

Glycogen synthase kinase 3b (GSK-3b) is a ubiqui-

tously expressed serine ⁄ threonine kinase that is active

in resting epithelial cells [9]. GSK-3b can regulate

Snail1 function via phosphorylation at two consensus

motifs: phosphorylation at the first motif regulates its

ubiquitination by b-transducin repeat containing pro-

tein (b-TrCP), whereas phosphorylation at the second

motif controls its subcellular localization [10]. A non-

phosphorylated variant of Snail1 resides more stably

in the nucleus to exclusively induce EMT [5]. GSK-3bcan inhibit Snail1 expression via inhibiting its tran-

scription [11], as well as by regulating Snail1 degrada-

tion and nuclear translocation [5]. Snail1 is also

known to be stabilized by O-GlcNAc modification on

Ser112, which competes with O-phosphorylation in

hyperglycemic conditions [12]. Therefore, GSK-3bmaintains epithelial phenotypes via inhibiting the

expression and stabilization of Snail1 (mediator of

EMT) and thereby also helps in maintaining a high

E-cadherin expression [13]. However, the effects of

GSK-3b-mediated phosphorylation on Slug ⁄Snail2function remain undefined mainly because the subdo-

mains of Slug ⁄Snail2 with putative GSK-3b phos-

phorylation sites are different from those of Snail1.

Here, we report that GSK-3b-mediated phosphoryla-

tion appears to regulate the degradation and subcellu-

lar localization of Slug ⁄Snail2.

Results

Overexpression of Slug ⁄ Snail2 in MCF7 cells

caused EMT

The expressions of Snail1 and Slug ⁄Snail2 were ana-

lyzed in various cancer cell lines by RT-PCR. Of the

eight cancer cell lines, Huh7 hepatic and MDA-MB-

231 breast cancer cells showed the highest expression

of Slug ⁄Snail2 mRNA, compared with mRNA levels

in other carcinoma cell lines. Furthermore, Snail1

mRNA expression was high in SNU449 and Huh7

hepatic cancer cells and minimal in other cell lines.

The expression of both Snail1 and Slug ⁄Snail2 was

negligible in the MCF7 cell line (Fig. 1A); hence we

selected this cell line for further experiments to mini-

mize the compensatory effects of endogenous Snail1

while studying the expression of Slug ⁄Snail2. Overex-

pression of Slug ⁄Snail2 in MCF7 cells resulted in a

decrease in the mRNA and protein levels of E-cadher-

in, but an increase in the levels of the mesenchymal

marker vimentin, indicating that Slug ⁄Snail2 caused

EMT of the MCF7 cells (Fig. 1B,C).

Because O-GlcNAc modification at Ser112 in Snail1

stabilizes the protein and thus increases its repressor

function to attenuate E-cadherin mRNA expression

[12], we sought to determine whether Slug ⁄Snail2 was

A B

D

C

Fig. 1. Slug ⁄ Snail2 induces changes in epithelial and mesenchymal marker molecules. (A) Expressions of Snail1 or Slug ⁄ Snail2 were ana-

lyzed in various carcinoma cell lines. mRNAs were prepared to determine the expression of Snail1 or Slug ⁄ Snail2 mRNAs by RT-PCR. GAPDH

was used as a loading control. The bar graph indicates gene expression, as quantified by densitometry. Values shown represent the

mean ± standard deviation of three independent experiments. (B), (C) Expressions of Slug ⁄ Snail2 (Slug), E-cadherin (E-cad), a-smooth

muscle actin (a-SMA) and vimentin (Vim) in Slug ⁄ Snail2-MCF7 and vector control MCF7 cells were analyzed by RT-PCR (B) and western

blotting (C). HEK293 cells were transfected to express GFP-tagged Slug ⁄ Snail2 or Snail1 and immunoprecipitated using anti-GFP or anti-

Snail1 IgG that was probed with the anti-O-GlcNAc CTD110.6 IgM monoclonal antibody (D). Data shown represent three independent

experiments.

GSK-3b-mediated phosphorylation of Slug ⁄ Snail2 J. Y. Kim et al.

2 FEBS Journal (2012) ª 2012 The Authors Journal compilation ª 2012 FEBS

also modified with O-GlcNAc. To test this hypothesis,

HEK293 cells were transfected to express green fluo-

rescent protein (GFP) tagged Slug ⁄Snail2 and immu-

noprecipitated using anti-GFP IgG that was probed

with the O-GlcNAc-specific monoclonal CTD110.6.

We were unable to detect O-GlcNAc on Slug ⁄Snail2even with or without O-GlcNAc transferase overex-

pression (Fig. 1D). It is thus likely that O-GlcNAc

modification may not be involved in the functions of

Slug ⁄Snail2.

Mutations in the phosphorylation sites of

Slug ⁄ Snail2 enhance EMT

There are two GSK-3b phosphorylation motifs in

Snail1 that include the b-TrCP destruction motif

(DSGxxS) and the SxxxSxxxS motif (Fig. 2A). When

the Slug ⁄Snail2 sequence was compared with the Snail1

sequence to predict putative GSK-3b phosphorylation

motifs, we found a region with GSK-3b consensus

serine sequences (called the Slug domain) that was

A

B C

D

Fig. 2. Mutations in phosphorylation sites of Slug ⁄ Snail2 cause mesenchymal features. (A) Sequence comparison of Snail1 and Slug ⁄ Snail2

showing the positions of predicted GSK-3b phosphorylation sites. Schematic representations of Snail1 and Slug ⁄ Snail2 are shown at the top

and bottom. The amino acid sequences for Slug ⁄ Snail2 mutants used in this study are shown between the schematic diagrams. Consensus

GSK-3b phosphorylation sequences are indicated as SxxxSxxxS. (B) Various mutants of Slug ⁄ Snail2 were transiently expressed in MCF7

cells before analyzing the expression of Slug ⁄ Snail2 by RT-PCR and western blotting. (C) Expressions of E-cadherin (E-cad) and vimentin

(Vim) in MCF7 cells, after transient transfection with WT or mutant Slug ⁄ Snail2, were determined by RT-PCR and western blotting. GAPDH

were used an internal control to normalize data, and results are presented at the bottom as fold changes relative to mock-transfected MCF7

cells. Gene expressions were quantified by densitometry and are represented as values of mean ± standard deviation of three independent

experiments. (D) The E-cadherin promoter inserted into a reporter vector (pGL3 enhancer vector) was coexpressed with WT or with different

mutants of Slug ⁄ Snail2 or mock control plasmids in MCF7 cells. All constructs were cotransfected with 100 ng of pLR-null vector. Luciferase

activities were normalized to renilla (pLR-null) activity and are expressed as a percentage of the corrected luciferase activity of the mock con-

trol vector (means ± standard deviation of three independent experiments). *P < 0.05 and **P < 0.001 compared with the corresponding

WT Snail2 was considered significant.

J. Y. Kim et al. GSK-3b-mediated phosphorylation of Slug ⁄ Snail2


distinct from the two GSK-3b phosphorylation motifs

in Snail1 (Fig. 2A). To understand the role of GSK-3bphosphorylation sites in the function of Slug ⁄Snail2,we mutated the serine residues to alanines (S87A,

S92 ⁄96A or S100 ⁄104A) (Fig. 2A). We then compared

the mRNA and protein expression in the wild-type

(WT) and various mutants of Slug ⁄Snail2 (Fig. 2B).

There were no meaningful differences at the transcrip-

tional level (mRNA level) between the WT and mutant

Slug ⁄Snail2; however, the protein amounts of Snail2

mutants were higher than that of WT. This indicates

that GSK-3b phosphorylation may affect the stability

of the Slug ⁄Snail2 protein. Furthermore, the decrease

in E-cadherin and the increase in vimentin at both the

mRNA and protein levels were more marked in the

phosphorylation mutants than in the mock- or WT

Slug ⁄Snail2-expressing cells (Fig. 2C). These observa-

tions indicate that GSK-3b-mediated phosphorylation

of Slug ⁄Snail2 may facilitate the degradation of Slug ⁄Snail2, thus leading to inhibition or termination of the

EMT process. We next analyzed the effects of the phos-

phorylation site mutations on the transcriptional activ-

ity of the E-cadherin promoter. To determine how the

Slug ⁄Snail2 WT or mutants affect the transcriptional

activities of the E-cadherin gene, using a human

E-cadherin promoter-luciferase construct (Ecad-Luc,

)365 to +48), pcDNA3-mock, -Slug ⁄Snail2 WT or

mutants were transiently cotransfected into MCF7 cells

prior to luciferase assay. The WT and Slug ⁄Snail2mutants showed more efficient repression of the Ecad-

Luc activity than that shown by the pcDNA3 control

vector (Fig. 2D). Compared with WT or S87A Slug ⁄Snail2, the S92 ⁄ 96A or S100 ⁄ 104A mutants of Slug ⁄Snail2 caused a prominent decrease in the Ecad-Luc

activity (Fig. 2D). Thus, the results of the phosphoryla-

tion of Slug ⁄Snail2 (presumably by GSK-3b) can

contribute to the stabilization of Slug ⁄Snail2, which

thereby causes suppression of E-cadherin during EMT.

Phosphorylation of Slug ⁄ Snail2 regulates its

subcellular localization and stabilization

We next examined how phosphorylation of Slug ⁄Snail2 affects its intracellular localization by immuno-

fluorescence analysis of cells transfected with WT or

mutant Slug ⁄Snail2 tagged with GFP. In addition to

GFP-WT Slug ⁄Snail2, the S92 ⁄ 96A mutants of Slug ⁄Snail2 localized in both the cytoplasm and the nucleus,

whereas the S100 ⁄ 104A mutant of Slug ⁄Snail2 mainly

localized in the nucleus (Fig. 3A). Using a cell extract

fractionation approach, we observed that WT Slug ⁄Snail2 localized both in the nucleus and in the cytosol

at a nucleus : cytosol ratio of 2 : 1 (Fig. 3B). However,

the S92 ⁄ 96A mutant of Slug ⁄Snail2 was more stable

and predominantly located in the nucleus rather than

the cytosol compared with WT Slug ⁄Snail2 (Fig. 3B).

The S100 ⁄ 104A mutant of Slug ⁄Snail2 was transfected

and cells were treated with cycloheximide (CHX). The

cytosol and nuclei fractions were separated and then

analyzed with western blot and the band intensity was

quantified (Fig. 3C).

The immunofluorescence and cellular fractionation

studies indicated that although the S92 ⁄ 96A or

S100 ⁄ 104A mutants of Slug ⁄Snail2 were more stable

and predominantly located in the nucleus, it was the

S100 ⁄ 104A mutant that caused more obvious nuclear

accumulation (Fig. 3A–C).

We then examined the half-lives of WT and mutant

Slug ⁄Snail2 following the treatment of MCF7 cells

with CHX, a protein synthesis inhibitor. The half-life

of the S92 ⁄ 96A mutant was longer than that of the

WT or mutant S100 ⁄ 104A (Fig. 3D), suggesting that

phosphorylation at Ser92 ⁄ 96 may be important for the

half-life of Slug ⁄Snail2. Therefore, it may be likely that

Ser92 ⁄ 96 phosphorylation negatively affects the sta-

bility of Slug ⁄Snail2, whereas Ser100 ⁄ 104 phosphoryla-

tion causes its cytosolic localization in addition to

stabilization, and that both phosphorylations

(Ser92 ⁄96 and Ser100 ⁄ 104) can lead to a negative

impact on E-cadherin suppression.

GSK-3b regulates Slug ⁄ Snail2 localization and

degradation

Using a pharmacological inhibitor against GSK-3b, wenext examined whether the function of Slug ⁄Snail2was affected by GSK-3b activity. Cells were transiently

transfected with WT Slug ⁄Snail2 and then treated with

50 lm LiCl, which is a GSK-3b inhibitor. The mRNA

level of Slug ⁄Snail2 was slightly elevated in cells trea-

ted with LiCl compared with that in untreated cells

(Fig. 4A), which is consistent with the enhanced

Slug ⁄Snail2 expression level (i.e. stabilization) caused

by mutations in the putative GSK-3b phosphorylation

sites at Ser92 ⁄ 96 (Figs 2B and 3B). Furthermore, LiCl

treatment had a similar effect on the protein levels of

Slug ⁄Snail2 as on its mRNA levels (Fig. 4B). As

shown in Fig. 3A, in the absence of LiCl treatment,

the WT and S92 ⁄ 96A mutants localized in both the

cytosol and the nucleus, whereas the majority of Slug

proteins in S100 ⁄ 104A mutant were located in the

nucleus. In the presence of LiCl treatment, however,

more Slug ⁄Snail2 was located inside the nucleus

(Fig. 4C, lower panel). After LiCl treatment, cytosol

and nuclear fractions were analyzed by western blot-

ting. More Slug ⁄Snail2 was found in LiCl-treated cells



A

B

D

C

Fig. 3. Phosphorylation of Slug ⁄ Snail2 affects its subcellular localization and stability. (A) The GFP-Slug ⁄ Snail2 proteins were transiently

expressed in MCF7 cells for 24 h. The subcellular localization of Slug ⁄ Snail2 proteins (green) and nucleus (blue, Hoechst 33342) were exam-

ined under a fluorescent microscope. (B) Following transient transfection of WT or of mutant Slug ⁄ Snail2 plasmids for 24 h, MCF7 cells

were lysed and fractionated as described in Materials and methods. Then, Slug ⁄ Snail2 protein in each fraction was analyzed by western blot-

ting. GAPDH and lamin B1 were used as controls for fractionation and for equal loading of proteins in the cytoplasmic and nuclear fraction,

respectively. (C) MCF7 cells that were treated with 30 lM CHX for different time intervals following transient transfection of WT or of

S100 ⁄ 104A Slug ⁄ Snail2 for 24 h and cytosol and nuclear fraction were analyzed by western blotting and measured band intensity by densi-

tometry. (D) MCF7 cells that were treated with 30 lM CHX for different time intervals following transient transfection of WT or of mutant

Slug ⁄ Snail2 for 24 h were analyzed by western blotting. Relative band intensity was plotted (lower panel).



A

D

F

G

E

B C

Fig. 4. GSK-3b phosphorylation appears to regulate Slug ⁄ Snail2 localization and degradation. (A), (B) LiCl (50 lM) was added to MCF7 cells

for 6 h following transient transfection with WT or with Slug ⁄ Snail2 mutants for 24 h. Expressions of Slug ⁄ Snail2 (Slug), E-cadherin (E-cad)

and vimentin (Vim) were analyzed by RT-PCR (A) or western blotting (B). (C) GFP-Slug ⁄ Snail2 protein was transiently expressed in MCF7

cells for 24 h and then treated with LiCl (50 lM) for 6 h. Representative images of fluorescent microscopy show GFP-Slug ⁄ Snail2 proteins

(green). (D) GFP-Slug ⁄ Snail2 protein was transiently expressed in MCF7 cells for 24 h and then treated with LiCl (50 lM) for 6 h. The cells

were lysed and fractionated as described in Materials and methods. Then, the Slug ⁄ Snail2 protein in each fraction was analyzed by western

blotting. (E) MCF7 cells were treated with 30 lM CHX for different time intervals following transient transfection with WT Slug ⁄ Snail2 for

24 h with or without 50 lM LiCl treatment before western blot analysis. Relative band intensity was plotted (lower panel). (F) LiCl was added

to MCF7 cells for 6 h following transient transfection with WT Slug ⁄ Snail2 for 24 h. Luciferase activities were normalized to renilla (pLR-null)

activity and expressed as a percentage of the corrected luciferase activity of WT Slug ⁄ Snail2 (mean ± standard deviation of three indepen-

dent experiments). *P < 0.5 compared with WT Slug ⁄ Snail2 was considered significant. (G) HEK293 cells were transiently transfected with

pcDNA mock, pcDNA-Slug WT or S92 ⁄ 96 ⁄ 100 ⁄ 104A mutant for 30 h prior to harvesting of whole cell extracts using lysis buffer as above.

The extract was immunoprecipitated with anti-Slug IgG and incubated with protein A ⁄ G-sepharose. The collected immunoprecipitates were

processed for western blots using anti-Slug or anti-phosphoserine IgG. Data shown represent three independent experiments.



in both cytosol and nuclear fractions (Fig. 4D). Further-

more, LiCl treatment of WT Slug ⁄Snail2-transfectedcells resulted in a longer half-life of the Slug ⁄Snail2protein (Fig. 4E) and in enhanced suppression of the

transcriptional activity of the E-cadherin promoter,

compared with that of untreated cells (Fig. 4F). To

confirm whether the serines in the mutated sequence

were phosphorylated, WT and mutant Slug ⁄Snail2(S92 ⁄ 96 ⁄ 100 ⁄ 104A) were immunoprecipitated by

anti-Slug and detected by anti-phosphoserine. The

mutant Slug ⁄Snail2 showed enhanced expression level

(Fig. 4G, upper panel) and less phosphorylation

(Fig. 4G, lower panel). These results confirm that

GSK-3b-mediated phosphorylation of Slug ⁄Snail2 con-

trols the intracellular localization of Slug ⁄Snail2toward the cytosol, leading to inefficient E-cadherin

suppression (i.e. inhibition of EMT).

TGF-b exerts its effects on Slug ⁄ Snail2 through

GSK-3b inhibition

Given that the transforming growth factor b (TGF-b)signaling pathway is known to cause EMT, we investi-

gated the effect of TGF-b treatment on Slug ⁄Snail2expression and function. Compared with basal expres-

sion levels, Slug ⁄Snail2 mRNA and protein expression

levels were enhanced by TGF-b treatment of MCF7

cells (Fig. 5A). Accordingly, E-cadherin promoter

activity decreased upon TGF-b treatment alone (81%),

compared with that of untreated cells (100%), and

concomitant LiCl treatment in the presence of TGF-b

treatment caused enhanced suppression of the E-cadh-

erin promoter activity (68.3%, Fig. 5B).

To determine the relationship between GSK-3b,Slug ⁄Snail2 and vimentin in endogenous proteins, we

examined the MCF7-derived cancer stem cell line

(MCF7 ⁄CSC), which has partial mesenchymal cell

properties [14]. MCF7 ⁄CSC cells showed higher expres-

sion levels of Slug ⁄Snail2 and vimentin (Fig. 5C).

When GSK-3b was overexpressed in MCF7 ⁄CSC cells,

the level of Slug ⁄Snail2 protein and vimentin decreased

dramatically (Fig. 5C). These observations in

MCF7 ⁄CSC cells suggest that GSK-3b-mediated phos-

phorylation may suppress Slug ⁄Snail2 expression, lead-

ing to inhibition of the EMT process.

Discussion

This study provides evidence that GSK-3b-mediated

phosphorylation of Slug ⁄Snail2 results in localization

and degradation in the cytosol, leading to efficient

E-cadherin suppression and inhibition of EMT.

Slug ⁄Snail2 has a short region that contains the puta-

tive GSK-3b phosphorylation residues, indicating the

involvement of GSK-3b in the regulation of Slug ⁄Snail2 activity. In the present study, Slug ⁄Snail2appeared to be regulated by GSK-3b-mediated phos-

phorylation. Our conclusion is based on the following

findings: (a) the alanine mutants of the putative

GSK-3b phosphorylation residues caused alterations in

the Slug ⁄Snail expression level, stability, intracellular

localization and its function in E-cadherin suppression,

A B C

Fig. 5. TGF-b appears to exert its effect on Slug ⁄ Snail2 through GSK-3b inhibition. (A) TGF-b (10 ngÆmL)1) was added to MCF7 cells for 6 h

following transient transfection with WT Slug ⁄ Snail2 for 24 h. Protein expression of Slug ⁄ Snail2 was analyzed by western blotting. (B) Cells

were treated with 10 ng TGF-b for 6 h. In some cases, cells were pretreated with 10 ng TGF-b for 1 h before a 6-h LiCl treatment. Lucifer-

ase activities were normalized to renilla (pLR-null) activity and expressed as a percentage of the corrected luciferase activity of WT Slug ⁄Snail2 (mean ± standard deviation of three independent experiments). *P < 0.05 and **P < 0.005 compared with WT Slug ⁄ Snail2 were con-

sidered significant. (C) MCF and MCF ⁄ CSC cells were transiently transfected with pCDNA-GSK-3b for 24 h with or without LiCl treatment,

and expressions of Slug ⁄ Snail2 (Slug) and vimentin were analyzed by western blotting. Data shown represent three independent experi-

ments.



and (b) treatment with the GSK-3b inhibitor LiCl

mimicked the mutations of the putative GSK-3b phos-

phorylation residues in terms of E-cadherin suppres-

sion and restricted Slug ⁄Snail2 mainly to the nucleus,

leading to enhanced E-cadherin suppression. Thus,

GSK-3b-mediated phosphorylation of Slug ⁄Snail2 may

play inhibitory roles in the EMT process.

High expression of Snail1 is often found in breast

cancer and in malignant mesothelioma [6] and meta-

static cancer cells [15]. E-cadherin promoters are

directly targeted by Snail1, and hence the repression of

E-cadherin expression is a major contributor to the

acquisition of an invasive, highly migratory phenotype

via the triggering of EMT [16,17]. Downregulation of

E-cadherin in most carcinomas is a transient and

highly dynamic event, where Twist, Snail1 and Slug ⁄Snail2 have binding affinities toward the E-box motif

(CANNTG) that is usually found in the target genes

of the Snail family proteins [18]. Post-translational

modifications of Snail1 are a well-known mechanism

to regulate its functions. O-GlcNAc modification of

Ser112 is known to stabilize Snail1 by inhibiting its

phosphorylation [12]. The competition between O-Glc-

NAc modification and O-phosphorylation of Ser ⁄Thrresidues is important in regulating the function of

many signaling proteins and in degrading certain pro-

teins such as b-catenin [19]. Examples of the competi-

tion between O-GlcNAc and O-phosphorylation for

regulation of their signaling activities include Ser473 of

Akt1 and Ser85 of paxillin [20,21]. Snail1 proteins have

a highly conserved b-catenin-like consensus motif and

destruction box. GSK-3b phosphorylates motif 2 of

Snail1 and thereby induces its nuclear export, whereas

subsequent phosphorylation by GSK-3b at motif 1

results in the association of Snail1 with b-TrCP and

thus leads to the degradation of Snail1 [5,10,22]. It is

thus likely that phosphorylation by GSK-3b is a deter-

mining step in Snail1 metabolism [23]. The phosphory-

lation of Ser96, Ser104 and Ser107 in the destruction

box of Snail1 proteins is a prerequisite for the ubiqu-

itin-ligase b-TrCP; phosphorylation of Ser104 and

Ser107 can prime GSK-3b phosphorylation of Ser96

and Ser100 [23] and the primed phosphorylation is

carried out by casein kinase 1 [24].

In this study, we have demonstrated the inhibitory

effects of Slug ⁄Snail2 phosphorylation by GSK-3b on

EMT. However, our data showed that no O-GlcNAc

modification is found in Slug ⁄Snail2, indicating that

phosphorylation of Slug ⁄Snail2 may be a regulatory

mechanism for its expression, stability and intracellular

localization. We demonstrated that Slug ⁄Snail2 translo-

cated to the cytosol upon Ser100 ⁄ 104 phosphorylation

and presumably underwent proteasomal degradation,

but further phosphorylations at Ser92 ⁄ 96 resulted in its

accumulation in the cytosol. Slug ⁄Snail2 displays only

one of the distinct GSK-3b consensus motifs, whereas

Snail1 exhibits two such motifs (Fig. 2A). The first

GSK-3b phosphorylation sequence in Slug ⁄Snail2 is

located on the serine-rich domain site at Ser87 and

Ser92 ⁄ 96, which plays a regulatory role in the stability of

Slug ⁄Snail2, and the second site is located at Ser100 ⁄ 104which, depending on GSK-3b activity, regulates the

export of nuclear Slug ⁄Snail2 into the cytosol. Ser87 is

not a part of the classic GSK-3b recognition sequence

(SxxxS) and the effect of this mutation was not dramatic,

although it still affected the E-cadherin promoter activ-

ity (Fig. 4A) and expression of EMT-related molecules

(Fig. 2C). It may thus be likely that Ser87 phosphoryla-

tion alone is not enough for Slug ⁄Snail2 function.TGF-b1 is a well-known multifunctional cytokine

that plays important roles in EMT to enhance the met-

astatic potential [25] and causes an early and sustained

ERK5 activation that is required for the functional

inactivation of GSK-3b and for the stabilization of the

TGF-b1 target Snail1 [26]. In the present study, we

demonstrated that TGF-b1 induced the expression of

the Slug ⁄Snail2 protein, suggesting that TGF-b1 also

regulates the degradation of the Slug ⁄Snail2 protein,

presumably through GSK-3b inactivation.

Taken together, our study suggests that GSK-3b-mediated phosphorylation can regulate the function of

Slug ⁄Snail2 in controlling EMT. Our study not only

reveals a molecular mechanism underlying Snail2-

induced EMT, but also has valuable implications in

the development of effective treatment strategies for

metastatic cancer progression.

Materials and methods

Plasmids and antibodies

The following primary antibodies were used for standard

western blots: anti-Slug ⁄Snail2, anti-glyceraldehyde-3-phos-phate dehydrogenase (GAPDH), anti-vimentin (Cell Signal-

ing Technology, Beverly, MA, USA), anti-E-cadherin (BD

Biosciences, San Diego, CA, USA), anti-phosphoserine and

anti-lamin B1 (Abcam, Cambridge, UK). pEGFP-C3 was

purchased from Clontech (Palo Alto, CA, USA), pGL3 from

Promega (Madison, WI, USA), and pCDNA-GSK-3b was

provided by E. H. Cho (Seoul City University, South Korea).

Cell culture and transfection

Human breast adenocarcinoma (MCF7) cells or human

embryonic kidney 293 (HEK293) cells (ATCC, Manassas,

VA, USA) were cultured in RPMI with 10% fetal bovine



serum (Gibco, Grand Island, NY, USA). MCF7 cells

transfected with pcDNA3-Slug ⁄ Snail2 WT or S87A,

S92 ⁄ 96A or S100 ⁄ 104A mutant were selected by G418

(AG Scientific, San Diego, CA, USA) after transfection

using Lipofectamine� 2000 (Invitrogen, Carlsbad, CA,

USA) according to the manufacturer’s protocol. MCF7

and HEK293 cells were transiently transfected with

pEGFP-C3-Slug ⁄Snail2 WT, mutant plasmids or pCDNA-

GSK-3b using Lipofectamine� 2000 for 24 h before

analysis [27]. In some cases, cells were treated with 50 lm

LiCl (Sigma Chemical Co., St Louis, MO, USA) for 6 h

after transient transfection for 24 h as described above.

Cell images were acquired using a phase-contrast micro-

scope (BX41, Olympus, Tokyo, Japan).

Western blots and antibodies

Cells transfected with the indicated plasmids or treated with

LiCl were washed twice with ice-cold NaCl ⁄Pi and har-

vested in RIPA buffer (50 mm Tris ⁄HCl pH 8.1, 150 mm

NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS

and protease inhibitors). To measure the half-life of Slug ⁄Snail2, MCF7 cells were treated with 30 lm CHX for

different time intervals following transient transfection with

WT Slug ⁄ Snail2 for 24 h with or without 50 lm LiCl treat-

ment before western blot analysis. The amount of total

protein was measured using the bicinchoninic acid assay

(Pierce, Rockford, IL, USA). Samples containing 30 lg of

total protein were electrophoresed on 12% SDS-polyacryla-

mide gels and transferred onto a poly(vinylidene difluoride)

membrane. The membrane was incubated with specific anti-

bodies. The primary antibodies used included anti-Slug ⁄Snail2 (1 : 1000 dilution in NaCl/Tris containing 5%

skimmed milk anti-rabbit; Cell Signaling Technology), anti-

GAPDH (1 : 5000 dilution in NaCl ⁄Tris-T, anti-rabbit;

Cell Signaling Technology), anti-vimentin (1 : 1000 dilution

in NaCl ⁄Tris-T, anti-rabbit; Cell Signaling Technology),

anti-E-cadherin (1 : 1000 dilution in NaCl ⁄Tris-T, anti-rab-bit; BD Biosciences) and anti-lamin B1 (1 lgÆmL)1 dilution

in NaCl ⁄Tris-T, anti-rabbit; Abcam). Primary antibody

incubation was followed by washing in 0.1% Tween-20

NaCl ⁄Tris solution (TTBS) and then incubating with a sec-

ondary horseradish peroxidase-labeled anti-rabbit and

mouse IgG (1 : 5000; Vector Laboratories, Burlingame,

CA, USA) at room temperature. Signals were detected

using an enhanced chemiluminescent substrate (West-Zol,

iNtRON Biotechnology Inc., Seoul, South Korea).

For phosphoserine detection, HEK293 cells at 70% con-

fluence was transiently transfected with pcDNA mock,

pcDNA-Slug WT or S92 ⁄ 96 ⁄ 100 ⁄ 104A mutant for 30 h,

prior to harvesting of whole cell extracts using lysis buffer

as above. The extracts (1.0 mg for each condition) were

immunoprecipitated with anti-Slug IgG (2.0 mg for each

condition) overnight at 4 �C and incubated with protein

A ⁄G-sepharose (30 mL for each condition of 50% slurry,

Upstate Biotech, Lake Placid, NY, USA) for 2 h at 4 �C.The immunoprecipitates were washed with ice-cold lysis

buffer twice and NaCl ⁄Pi twice. The collected immunopre-

cipitates were boiled with 2· SDS ⁄PAGE sample buffer for

5 min, and then the samples were processed for western

blots using anti-Slug or anti-phosphoserine IgG.

RT-PCR analysis

Total RNA was isolated from cells using the TRIzol

reagent (Invitrogen) according to the manufacturer’s

instructions. Reverse transcription was carried out using

the reverse transcription system (Promega). PCR primers

for amplification were as follows: of E-cadherin, forward

5¢-TCCCATCAGCTGCCCAGAAA-3¢, reverse 5¢-TGACT

CCTGTGTTCCTGTTA-3¢; of vimentin, forward 5¢-AAT

GGCTCGTCACCTTCGTGAAT-3¢, reverse 5¢-CAGATT

AGTTTCCCTCAGGTTCAG-3¢; of GAPDH, forward

5¢-GAAGGTGAAGGTCGGAGTC-3¢, reverse 5¢-GAAGAT

GGTGATGGGATTTC-3¢; of Slug ⁄Snail2, forward 5¢-CCCGTTAACATGCCGCGCTCTTTC-3¢, reverse 5¢-TTTCTCGAGTCAGCGGGGACATCC-3¢. PCR was performed

using Taq polymerase (iNtRON Biotechnology Inc.).

PCR was initiated by incubating the samples at 95 �Cfor 5 min, followed by 30 cycles of 1 min denaturation

at 95 �C, 1 min annealing at 57 �C and 1 min elongation at

72 �C. Samples were analyzed by electrophoresis on 1% aga-

rose gels containing 0.002% nucleic acid staining solution

(RedSafe�; Biotechnology Inc., Seoul, South Korea).

Plasmid construction and site-directed

mutagenesis

A recombinant plasmid was made by inserting the human

SNAI2 gene into the pEGFP-C3 plasmid vector (Promega)

using BamHI and the XhoI restriction sites. The following

primers (Integrated DNA Technologies, Bioneer, Seoul,

South Korea) were used: Snail2-BamH1 forward

5¢-TTTGGATCCATGCCGCGCTCCTTC-3¢, Snail2-Xho1

reverse 5¢-GGGCTCGAGTCAGTGTGCTACACA-3¢ and

Snail2-Xho1 forward 5¢-AAACTCGAGATGCCGCGCT

CCTTC-3¢, Snail2-BamH1 reverse 5¢-TTTGGATCCCGG

TGTGCTACACAGCA-3¢. Mutagenesis PCR within the

Slug/Snail2 gene was performed using the following primer

sequences: S87A, forward 5¢-TCTTTGGGGCGAGTG

GCTCCCCCTCCTCCATCT-3¢, reverse 5¢-AGATGGAG

GAGGGGGAGCCACTCGCCCCAAAGA-3¢; S92 ⁄ 96A,

forward 5¢-CCTCCTCCAGCTGACACCTCCGCAAAG-

GACCAC-3¢, reverse 5¢-GTGGTCCTTTGATTCGGTGT-

CAGCTGGAGGAGGGGG-3¢; S100 ⁄ 104A, forward 5¢-TCCTCCAAGGACCACGCTGGCTCAGAAAGCCCC-3¢,reverse 5¢-GGGGCTTTCTGAGCCAGCGTGGTCCTTG-

GAGGA-3¢. Mutagenesis resulted in the formation of a

unique Dpn1 restriction site within the recombinant plas-

mid.



Generation of luciferase-reporter constructs and

transfection

To clone the E-cadherin promoter region in pGL3, E-cadher-

in genomic DNA was amplified with the primer sets

5¢)365GCGGTACCCTTGGGTGAAAGAGTGAGCC)3453¢(forward) and 5¢+48GCAGATCTTGAACTGACTTCCGC

AAGC+303¢ (reverse), and each of the primers had a Kpn1

and BglII site. The PCR products were cut with Kpn1 and

BglII and then cloned into the pGL3 enhancer vector

(Promega).

MCF7 cells were transfected with pcDNA3 or pcDNA3-

Slug ⁄Snail2 plasmid (4 lg), reporter construct (2 lg) in the

pGL3 enhancer vector, and 100 ng renilla luciferase null vec-

tor (as an internal control for transfection efficiency) using

10 lL Lipofectamine 2000 (Invitrogen), according to the

manufacturer’s protocol. One day after the transfection, cells

were harvested to be used in the luciferase assay for measur-

ing the activities of firefly and renilla luciferases using a lumi-

nometer (Luminmax-c; Biomedical Science Co. Ltd, Seoul,

South Korea) and the Dual Luciferase Reporter Assay Sys-

tem (Promega). The firefly luciferase activity was normalized

by using the renilla luciferase activity. The pGL3 enhancer

(promoterless) vector was used in all experiments as a nega-

tive control and as a baseline for data comparisons. The

pGL3 control vector (containing the SV40 promoter and the

SV40 enhancer) was used in all experiments as a positive con-

trol.

Subcellular fractionation

To obtain cytoplasmic and nuclear fractions, cells were

washed with ice-cold NaCl ⁄Pi and collected by scraping.

Cells were then pelleted by centrifugation at 300 g for

5 min at 4 �C. The cytosolic and nuclear fractionations

were performed using a nuclear extraction kit (Cayman

Chemical Co., Ann Arbor, MI, USA). The purity of the

fractions was confirmed by western blotting with an anti-

GAPDH IgG for the cytoplasmic fraction and with an

anti-lamin B1 IgG for the nuclear fraction.

Statistical analysis

All experiments were independently performed at least three

times. Data are presented as values of means ± standard

deviation. Data were analyzed using Student’s t test.

P < 0.05 was considered statistically significant.

Acknowledgements

This research was supported by the Basic Science

Research Program through the National Research

Foundation of South Korea (NRF) funded by the

Ministry of Education, Science and Technology (2011-

0003911 to Dr. MoonJae Cho).

References

1 Shih JY & Yang PC (2011) The EMT regulator slug

and lung carcinogenesis. Carcinogenesis 32, 1299–1304.

2 Comijn J, Berx G, Vermassen P, Verschueren K, van

Grunsven L, Bruyneel E, Mareel M, Huylebroeck D &

Van Roy F (2001) The two-handed E box binding zinc

finger protein SIP1 downregulates E-cadherin and

induces invasion. Mol Cell 7, 1267–1278.

3 Creighton CJ, Chang JC & Rosen JM (2010) Epithe-

lial–mesenchymal transition (EMT) in tumor-initiating

cells and its clinical implications in breast cancer.

J Mammary Gland Biol Neoplasia 15, 253–260.

4 Blanco MJ, Moreno-Bueno G, Sarrio D, Locascio A,

Cano A, Palacios J & Nieto MA (2002) Correlation of

Snail expression with histological grade and lymph node

status in breast carcinomas. Oncogene 21, 3241–3246.

5 Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M &

Hung MC (2004) Dual regulation of Snail by GSK-3b-mediated phosphorylation in control of epithelial–

mesenchymal transition. Nat Cell Biol 6, 931–940.

6 Catalano A, Rodilossi S, Rippo MR, Caprari P &

Procopio A (2004) Induction of stem cell factor ⁄ c-Kit ⁄slug signal transduction in multidrug-resistant malig-

nant mesothelioma cells. J Biol Chem 279, 46706–46714.

7 Casas E, Kim J, Bendesky A, Ohno-Machado L, Wolfe

CJ & Yang J (2011) Snail2 is an essential mediator of

Twist1-induced epithelial–mesenchymal transition and

metastasis. Cancer Res 71, 245–254.

8 Kang XQ, Zang WJ, Bao LJ, Li DL, Song TS, Xu XL

& Yu XJ (2005) Fibroblast growth factor-4 and hepato-

cyte growth factor induce differentiation of human

umbilical cord blood-derived mesenchymal stem cells

into hepatocytes. World J Gastroenterol 11, 7461–7465.

9 Papkoff J & Aikawa M (1998) WNT-1 and HGF

regulate GSK3 [beta] activity and [beta]-catenin

signaling in mammary epithelial cells. Biochem Biophys

Res Commun 247, 851–858.

10 Zhou BP & Hung MC (2005) Perspectives Wnt,

Hedgehog and Snail. Cell Cycle 4, 772–776.

11 Bachelder RE, Yoon SO, Franci C, de Herreros AG &

Mercurio AM (2005) Glycogen synthase kinase-3 is an

endogenous inhibitor of Snail transcription. J Cell Biol

168, 29–33.

12 Park SY, Kim HS, Kim NH, Ji S, Cha SY, Kang JG,

Ota I, Shimada K, Konishi N & Nam HW (2010)

Snail1 is stabilized by O-GlcNAc modification in

hyperglycaemic condition. EMBO J 29, 3787–3796.

13 Doble BW & Woodgett JR (2007) Role of glycogen

synthase kinase-3 in cell fate and epithelial–mesenchy-

mal transitions. Cells Tissues Organs 185, 73–84.

14 Van Phuc P, Khuong TTT, Le Van Dong TDK &

Tung T (2010) Isolation and characterization of breast

cancer stem cells from malignant tumours in

Vietnamese women. J Cell Anim Biol 4, 163–169.



15 Elloul S, Silins I, Trope CG, Benshushan A, Davidson

B & Reich R (2006) Expression of E-cadherin transcrip-

tional regulators in ovarian carcinoma. Virchows Arch

449, 520–528.

16 Cano A, Perez-Moreno MA, Rodrigo I, Locascio A,

Blanco MJ, del Barrio MG, Portillo F & Nieto MA

(2000) The transcription factor snail controls epithelial–

mesenchymal transitions by repressing E-cadherin

expression. Nat Cell Biol 2, 76–83.

17 Langer EM, Feng Y, Zhaoyuan H, Rauscher FJ III,

Kroll KL & Longmore GD (2008) Ajuba LIM

proteins are snail ⁄ slug corepressors required for

neural crest development in Xenopus. Dev Cell 14,

424–436.

18 Lopez D, Niu G, Huber P & Carter WB (2009) Tumor-

induced upregulation of Twist, Snail, and Slug represses

the activity of the human VE-cadherin promoter. Arch

Biochem Biophys 482, 77–82.

19 Kamemura K & Hart GW (2003) Dynamic interplay

between O-glycosylation and O-phosphorylation of nu-

cleocytoplasmic proteins: a new paradigm for metabolic

control of signal transduction and transcription. Prog

Nucleic Acid Res Mol Biol 73, 107–136.

20 Kang ES, Han D, Park J, Kwak TK, Oh MA, Lee S,

Choi S, Park ZY, Kim Y & Lee JW (2008) O-GlcNAc

modulation at Akt1 Ser473 correlates with apoptosis of

murine pancreatic [beta] cells. Exp Cell Res 314,

2238–2248.

21 Kwak TK, Kim H, Jung O, Lee SA, Kang M, Kim HJ,

Park JM, Kim SH & Lee JW (2010) Glucosamine treat-

ment-mediated O-GlcNAc modification of paxillin

depends on adhesion state of rat insulinoma INS-1 cells.

J Biol Chem 285, 36021–36031.

22 Wu Y, Deng J, Rychahou PG, Qiu S, Evers BM &

Zhou BP (2009) Stabilization of snail by NF-[kappa]B

is required for inflammation-induced cell migration and

invasion. Cancer Cell 15, 416–428.

23 Yook JI, Li XY, Ota I, Fearon ER & Weiss SJ (2005)

Wnt-dependent regulation of the E-cadherin repressor

snail. J Biol Chem 280, 11740–11748.

24 Xu Y, Lee S, Kim H, Kim N, Piao S, Park S, Jung Y,

Yook J, Park B & Ha N (2010) Role of CK1 in

GSK3b-mediated phosphorylation and degradation of

Snail. Oncogene 29, 3124–3133.

25 Korpal M & Kang Y (2010) Targeting the transforming

growth factor-[beta] signalling pathway in metastatic

cancer. Eur J Cancer 46, 1232–1240.

26 Marchetti A, Colletti M, Cozzolino AM, Steindler C,

Lunadei M, Mancone C & Tripodi M (2008) ERK5 ⁄MAPK is activated by TGF [beta] in hepatocytes and

required for the GSK-3 [beta]-mediated Snail protein

stabilization. Cell Signal 20, 2113–2118.

27 Yang CH, Song B-C & Cho M (2012) A natural

mutation of Hepatitis B virus X gene affects cell cycle

progression and apoptosis in Huh7 cells. J Korean Soc

Appl Biol Chem 55, 229–236.



functional regulation of slug / snail2 is dependent on gsk-3β-mediated phosphorylation

Documents