Clinica Chimica Acta 304 (2001) 153–158www.elsevier.com/ locate /clinchim

Short communication

Human xanthine dehydrogenase cDNA sequence and protein in anatypical case of type I xanthinuria in comparison with normal

subjectsa , a b a b*Tetsuya Yamamoto , Yuji Moriwaki , Yuichi Shibutani , Kiyoshi Matsui , Taro Ueo ,

a a aSumio Takahashi , Zenta Tsutsumi , Toshikazu HadaaThird Department of Internal Medicine, Hyogo College of Medicine, Mukogawa-cho 1-1, Nishinomiya, Hyogo 663-8501, Japan

bDepartment of Internal Medicine, Division of Endocrinology, Nishi-Kobe Medical Center, Nishi-Kobe, Japan

Received 29 August 2000; received in revised form 9 November 2000; accepted 20 November 2000

Abstract

To investigate the properties of xanthine dehydrogenase /xanthine oxidase (XDH/XO) deficiency in a patient with atypicaltype I xanthinuria, as indicated by oxypurine data, a cDNA sequence encoding XDH, XDH/XO immunoblot analysis and acompetitive PCR assay were performed, and the results were compared with those of normal subjects. The xanthinedehydrogenase cDNA sequence of the patient was consistent with the controls, while immunologically reactive 150 kDXDH/XO protein was not present in the xanthinuric duodenal mucosa, unlike the control duodenal mucosa. In addition, adecrease in XDH/XO messenger RNA was found by competitive PCR. These results suggest that atypical type I xanthinuriais due to a decrease in messenger RNA of XDH/XO. Furthermore, it was considered that this decrease could explain thenormal plasma level and near normal urinary excretion of hypoxanthine seen in this case of xanthinuria, though XDH/XOactivity and protein were not detected spectrophotometrically and immunologically, respectively. 2001 Elsevier ScienceB.V. All rights reserved.

Keywords: Hypouricemia; Oxypurines; Xanthinuria; Xanthine dehydrogenase cDNA; Xanthine oxidase deficiency

1. Introduction flavin hydroxylase that oxidizes a variety of purinesand pterins, such as hypoxanthine to uric acid via

Xanthine dehydrogenase /xanthine oxidase (XDH/ xanthine, allopurinol (a xanthine oxidase inhibitor) toXO, EC 1.1.1.204) is a molybdenum iron-sulphur oxypurinol, and pyrazinamide (an antituberculous

agent) to 5-hydroxypyrazinamide [1,2]. It is anabundant enzyme in the liver and intestine. In

Abbreviations: cDNA, complementary deoxyribonucleic acid; previous studies [3–5], the cloning of cDNA encod-kDa, kiloDalton; M molecular weight ratio; mRNA, messengerr ing XDH has been performed in rats, mice, andribonucleic acid; PCR, polymerase chain reaction; XDH, xanthine humans, while the chromosomal location of thedehydrogenase; XO, xanthine oxidase

XDH gene has been demonstrated in humans [5,6].*Corresponding author. Tel.: 181-798-456-472; fax: 181-798-The cDNA encoding XDH has an open-reading456-474.

E-mail address: tetsuya@hyo-med.ac.jp (T. Yamamoto). frame of 3999 nucleotides and encodes a protein of

0009-8981/01/$ – see front matter 2001 Elsevier Science B.V. All rights reserved.PI I : S0009-8981( 00 )00413-7

154 T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 –158

1333 amino acids with a calculated M of 146 604 in ence range, 1.1–3.0), plasma xanthine was 11.2r

humans. A deficiency of XDH, xanthinuria, is classi- mmol / l (reference range, 0.7–1.2), urinary hypoxan-fied into two groups, type I and II [1,2,7]. Patients thine excretion was 6.1 mmol /h (reference range,with type I xanthinuria lack XDH/XO activity, but 4–5.7), urinary xanthine excretion was 72.4 mmol /hpossesses aldehyde oxidase activity, suggesting a (reference range, 3.5–4.6), and urinary uric aciddefect of the XDH protein, while patients with type excretion was below the limits of detection. Al-II xanthinuria lack both XDH/XO and aldehyde though the plasma concentration of hypoxanthineoxidase activities [1,2,7], suggesting a defect in the was within a normal range and the urinary excretionsulfuration of desulfo molybdenum. Patients with of hypoxanthine was near normal after fasting, 2 htype I xanthinuria can convert allopurinol to oxy- after taking food containing 75 mg purine, thesepurinol and pyrazinamide to 5-hydroxypyrazinamide, values rose to 10 mmol / l and 40.0 mmol /h, respec-since they lack XDH/XO activity but possess alde- tively. The XDH/XO activity of the patient’s duode-hyde oxidase activity. In type I xanthinuria, the nal mucosa was below the limits of detection.molybdenum cofactor is normal, since aldehyde Further, this patient was diagnosed as having type Ioxidase activity is present. Recently, two kinds of xanthinuria by allopurinol and pyrazinamide loadingmutations in the human XDH gene have been tests, which have been described previously [1,2].reported to be responsible for classical type I xanth- These results together suggested a subtype of type Iinuria [8], which cause no production of XDH xanthinuria, since the plasma concentration of hypo-protein. We incidentally found a case of atypical type xanthine was within a normal range and the urinaryI xanthinuria, in whom the plasma concentration of excretion of hypoxanthine was near normal afterhypoxanthine was within the normal range and fasting.urinary excretion was near normal after fasting.Therefore, to investigate whether a mutation of XDH 2.2. Determination of hypoxanthine, xanthine, andis present in xanthinuria, and if so, whether it causes uric acidthe disappearance of XDH/XO activity, we se-quenced the cDNA encoding XDH from our patient. The concentrations of hypoxanthine, xanthine andIn addition, since the sequence of cDNA encoding uric acid were measured as described previouslyXDH in humans was found to be different in part in [1,2].three recent studies [5,9,10], we also sequenced thesame from normal subjects. To further investigate 2.3. Direct sequencing of cDNA and competitivewhether xanthinuria is produced by a defect in PCRmessenger RNA and/or in the XDH protein syn-thesis, a competitive PCR assay and an immunoblot RNA was obtained from duodenal mucosa by theanalysis were performed, respectively. chloroform–phenol extraction method and cDNA

was then reverse transcribed from the total RNA ofthe obtained materials. The primers for PCR are

2. Materials and methods shown in Table 1 and were used under the followingconditions. cDNA was denatured at 948C for 5 min,

2.1. Patients and specimens followed by 30 cycles of denaturation at 948C for 30s, annealing at 608C for 30 s, and extension at 728C

After informed consent was obtained from the for 1 min, with a final extension step of 7 min. Thexanthinuric patient and five healthy subjects, duode- PCR was carried out in a volume of 25 ml containingnal mucosa specimens from each were biopsied 50 mmol / l KCl, 10 mmol / l Tris–HCl (pH 8.8), 1.5using a gastrointestinal fiberscope. After fasting, the mmol / l MgCl , 0.1% Triton X-100, 200 mmol / l2

plasma concentrations and urinary excretion of both each of dATP, dCTP, dGTP, dTTP, 0.1 mg of cDNA,uric acid and oxypurines were normal in the healthy 10 pmol of each primer, and 1.5 U of Taq poly-subjects. In the patient, plasma uric acid was 5.9 merase in a DNA thermal cycler (Perkin-Elmermmol / l, plasma hypoxanthine was 2.6 mmol / l (refer- Cetus). Amplified DNA products were sequenced by

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 –158 155

Table 1Primers for XDH mRNA RT-PCR

Primer Sequence (59 to 39) Position Amplifiedproduct (bp)

XDH1-F TTAGGAGTGAGGTACCTGGAG 244 to 224 421XDHA2 AGGATGCAGCCTCGTCTTGG 281–300XDH2F GTCTGCAGAACAAGATCGTC 179–198 371XDHYR CTGGTTCATGCAGCAATTTGG 529–549XDH3F TGGAGGAGATTGAGAATGCC 407–426 605XDH4R AAACCAGCGCAGCTGCTCCA 992–1011XDH5F AGCCTGGATCCCTGAGCTG 843–861 431XDH5R AGGCCTGCTTGAATGCTGAG 1254–1273XDH6F GCCAAGCTGACACTAGTGTC 1108–1127 413XDH6R AAGTCCACCATGCCACCAGG 1501–1520XDH7F CTTTGCTATGGTGGAATGGC 1360–1379 362XDH7R ACCATGTCCTCCTCAGACTG 1702–1721XDH8IF GAACCTGGAAGACAAGTGTGG 1590–1610 343XDH8IR ACTCCCAGGAACATCATCAGC 1912–1932GAGXDH9F TGAGAGAATGAGCTGTCTCTCCG 1801–1820 666XDH10R GCGGCCGGTCTTATATGCAG 2447–2466XDH11F CACAGAACACCATGAAGACC 2300–2319 432XDH11R CCGTGTTGGAGGGAAGGTTG 2712–2731XDH12F GACAGTTGTGGCTCTTGAGG 2565–2584 647XDH13R TGTTAGTGCTTGTCTCGCTG 3192–3211XDH14IF TGTACACAGATGGCTCTGTGC 3071–3091 318XDH14IR CAGACAAGCTCACTGTGTCCA 3368–3388XDH15F CCGTCTATGCGGCTTGTCAG 3269–3288 376XDH15R GAATAGTGTAGCTCCTCTAGG 3624–3644XDH16F AATCGACTGCCTAACAGGAG 3492–3511 361XDH16R AGCTCGAGCTGCACGGATGG 3833–3852XDH17F TACAAGATCCCGGCATTTGGC 3682–3702 384XDHichidaR TGTTCCTCCTGCTCCATGGAAG 4044–4065

the dye-termination method using a DNA sequencing (Bio-Rad Laboratories, Hercules, CA, USA). Afterkit (Perkin-Elmer, Foster, CA, USA) with the same incubation with Block Ace (Dainippon Pharmaceu-primers as for the PCR, and analyzed using an ABI ticals, Osaka) overnight at 48C, the PVDF membranePRISM 310 (Applied Biosystems, Foster, CA, USA). was washed with 50 mmol / l Tris-buffered salineThe RNA competitor to XDH cDNA was con- (pH 7.4) (TBS) and then incubated for 3 h at roomstructed using a Takara competitive DNA construc- temperature with a 1:200 dilution of anti-humantion kit (Takara Biomedics, Osaka, Japan) and the xanthine oxidase rabbit serum [11] in TBS con-competitive PCR was performed with various con- taining 10% (v/v) Block Ace. The PVDF membranecentrations of the competitor, as described in the was washed 3 times with TBS, 10 min per wash, andProtocols section of the kit. then incubated with a 1:500 dilution of a secondary

antibody (biotinylated anti-rabbit IgG; Vector Lab-2.4. Immunoblots of XDH /XO protein oratories, Burlingame, CA, USA) for 3 h at room

temperature. Next, the PVDF membrane was washedUsing postmitochondrial supernatants from the 4 times with TBS and then incubated with avidin–

samples, immunoblotting was performed as follows. biotin complex (Vectastain ABC Elite kit; VectorXDH/XO was transferred electrophoretically from a Laboratories). Finally, the XDH/XO peptide was7.5% SDS–polyacrylamide gel to a PVDF mem- visualized by incubation with 0.01% H O in TBS2 2

2brane at 1 mA/cm for 90 min, using Trans Blot SD containing 0.05% diaminobenzidine.

156 T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 –158

2.5. Enzyme activity

The activity of XDH/XO was measured as de-scribed previously [12]. Briefly, the reaction mix-tures contained 50 mmol / l phosphate buffer (pH8.5), 20% cell or tissue homogenate, and 1 mmol / l

Fig. 1. XDH/XO cDNA PCR product after competitive PCR.NAD in a final volume of 200 ml. After preincuba-RNA at 0.5 mg was added to the reaction mixture, and RT was

tion for 5 min at 378C, the reaction was initiated by performed as described in Section 2. After the addition of variousthe addition of 100 ml of 1 mmol / l xanthine. After concentrations of the competitor, PCR was performed for 28either 5 or 20 min, the reaction was stopped by the cycles in the case of normal duodenal mucosa and 32 cycles for

xanthinuric mucosa, using the primers L8IF and L8IR. N, normaladdition of 25 ml of 20% HClO , followed by4duodenal mucosa; X, xanthinuric duodenal mucosa; o, no additionneutralization with 25 ml of 1 mol / l K CO . The 22 3 of competitor; 1, 10 copies of competitor; 2, 10 copies of

solution was then passed through a 4A Chromatodisc 3 4competitor; 3, 10 copies of competitor; 4, 10 copies of com-5 6(Kurabo, Osaka) for high-performance liquid chro- petitor; 5, 10 copies of competitor; 6, 10 copies of competitor;

matography (HPLC). The HPLC apparatus consisted IS, internal standard (competitor, 292 bases); XO, xanthinedehydrogenase /xanthine oxidase.of an LC-6A chromatograph (Shimadzu, Kyoto,

Japan), an SPD-6AV UV-Vis spectrophotometricdetector (Shimadzu, Kyoto, Japan), a C-R6A primers. Next PCR was performed for 32 cycles inChromatopac (Shimadzu, Kyoto, Japan), and a the case of xanthinuric duodenal mucosa and 28Wakosil 18C-200 column (Wako, Osaka, Japan). The cycles in the case of normal duodenal mucosa aftermobile phase consisted of 20 mmol / l potassium the addition of various concentrations of the com-phosphate buffer (pH 2.2), with a flow rate of 1 petitor. The PCR products from the xanthinuric

2ml /min and absorbance at 254 nm. XDH/XO ac- duodenal mucosa were between 10 and 10 copies,5tivities were expressed as nmol /min per mg protein. while those from the normal subject were 10 copies,

indicating that the mRNA of XDH was decreased inthe xanthinuric patient (Fig. 1).

3. Results3.3. Immunoreactive XDH /XO protein

3.1. Sequence of XDH cDNA from duodenalmucosa of the patient and five normal subjects An immunoblot analysis was performed after

electrophoresis, using the postmitochondrial super-The XDH cDNA of the xanthinuric duodenal natants from the xanthinuric and normal duodenal

mucosa was different from XDH cDNA previously mucosa specimens. A 150-kDa band was found inreported by Ichida et al. [5] at five points. At codons the normal duodenal mucosa, but not in that from the191, 231, 374, 1150, and 1296, CAC (His), AGG xanthinuric patient, indicating that immunoreactive(Arg), CTA (Leu), CGC (Arg), and CGG (Arg) were XDH/XO protein is not produced in this patientdisplaced to GTC (Leu), GGG (Gly), CTT (Leu), (Fig. 2).CCC (Pro), and CGG (Arg), respectively. However,the XDH cDNA sequences of the xanthinuric duode-nal mucosa were identical to those of the duodenal 4. Discussionmucosa from the five normal subjects.

Using RNA obtained from the duodenal mucosa of3.2. PCR product obtained from XDH /XO mRNA normal subjects, the present study had the same

cDNA XDH sequence results as reported previouslyThe RNA samples from the xanthinuric and by Saksela et al. [10], however, they differed from

normal duodenal mucosa were adjusted to the same those reported by Ichida et al. [5] at five separateconcentration in their respective RT reaction mix- points, resulting in three amino acid changes in thetures, and RT was performed using L8IF and L8IR polypeptide. The differences at these positions may

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 –158 157

case of xanthinuria can be ascribable to a decrease inthe mRNA of XDH without a mutation. XDH,having a lower K for hypoxanthine than for xan-m

thine, converts hypoxanthine to xanthine more thanxanthine to uric acid. Although the present study didnot demonstrate any activity or protein of XDH,small amounts of XDH will convert a greater amountof hypoxanthine to xanthine than xanthine to uricacid. Therefore, it is suggested that a decrease in themRNA of XDH may explain the findings in atypicalxanthinuric patients, who have normal plasma con-centrations and near normal urinary excretion ofhypoxanthine at rest. However, further investigationis needed, since an abnormality of the promoterregion in the XDH gene or that of transcription ofthe XDH gene to mRNA may cause a decrease in

Fig. 2. Immunoblot of XDH/XO. Postmitochondrial supernatant mRNA of XDH leading to the absence of the(50 mg protein) obtained from duodenal mucosa was applied. N, immunologically reactive XDH/XO protein.normal duodenal mucosa; X, xanthinuric duodenal mucosa.

Referencesrepresent a genetic polymorphism, or could beascribable to artifacts caused by reverse transcription

[1] Yamamoto T, Higashino K, Kono N, Kawachi M, Nanahoshior PCR amplification. The present study also demon-M, Takahashi S, Suda M, Hada T. Metabolism of

strated that the XDH cDNA sequence in an atypical pyrazinamide and allopurinol in hereditary xanthine oxidasexanthinuric patient was identical to that in normal deficiency. Clin Chim Acta 1989;180:169–76.

[2] Yamamoto T, Kario K, Suda M, Moriwaki Y, Takahashi S,subjects. However, the PCR product obtained fromHigashino K. A case of xanthinuria: a study on the metabo-XDH cDNA indicated that XDH mRNA is reducedlism of pyrazinamide and allopurinol. Jpn J Med

in xanthinuria, as compared with the duodenal 1991;30:430–4.mucosa from a normal subject. In addition, the 150- [3] Amaya Y, Yamazaki K, Sato M, Noda K, Nishino T, Nishino

T. Proteolytic conversion of xanthine dehydrogenase fromkDa XDH protein was present in the controls, butthe NAD-dependent type to the O -dependent type. J Biol2not in the atypical type I xanthinuric patient. TheseChem 1990;65(2):14170–5.results suggest that in xanthinuria, the promoter [4] Terao M, Cazzaniga G, Ghezzi P, Bianchi M, Falciani F,

region of the XDH gene or the transcription of the Perani P, Garattini E. Molecular cloning of a cDNA codingfor mouse liver xanthine dehydrogenase. Biochem JXDH gene to mRNA may be disturbed, resulting in a1992;183:863–70.decrease in XDH mRNA, and leading to neither

[5] Ichida K, Amaya A, Noda K, Minoshima S, Hosoya T, Sakaiprotein nor XDH/XO activity.O, Shimizu N, Nishino T. Cloning of the cDNA encoding

Xanthinuria is classified into two groups, type I human xanthine dehydrogenase (oxidase): structural analysisand II [1,2,7]. In patients with type I, a defect of the of the protein and chromosomal location of the gene. Gene

1993;133:279–84.XDH protein is suggested, while in type II, there[6] Xu P, Zhu XL, Huecksteadt TP, Brothman AR, Hoidal JR.appears to be a defect in the sulfuration of desulfo

Assignment of human xanthine dehydrogenase gene tomolybdenum is suggested. In fact, a recent study [8] chromosome 2P22. Genomics 1994;23:289–91.of three patients with type I xanthinuria demon- [7] Reiter S, Simmonds HA, Zollner N, Braun SL, Knedel M.strated that the immunologically reactive XDH/XO Demonstration of a combined deficiency of xanthine oxidase

and aldehyde oxidase in xanthinuric patients not formingprotein was not present with a mutation of XDH/XOoxypurinol. Clin Chim Acta 1990;187:221–34.cDNA. In contrast, in the present patient, our results

[8] Ichida K, Amaya Y, Kamatani N, Nishino T, Hosoya T,regarding the XDH/XO gene and immunoreactive Sakai O. Identification of two mutations in human xanthineXDH/XO, including the plasma concentration and dehydrogenase gene responsible for classical type I xanth-urinary excretion of purine bases, indicate that this inuria. J Clin Invest 1997;99:2391–7.

158 T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 –158

[9] Xu P, Huecksteadt TP, Hoidal JR. Molecular cloning and [12] Moriwaki Y, Yamamoto T, Yamakita J, Takahashi S, Tsut-characterization of the human xanthine dehydrogenasse gene siumi Z, Higashino K. Effect of interferon-g on purine(XDH). Genomics 1996;34:173–80. catabolic and salvage enzyme activities in rats. Biochim

[10] Saksela M, Raivio KO. Cloning and expression in vitro of Biophys Acta 1999;1427:385–91.human xanthine dehydrogenase /oxidase. Biochem J1996;315:235–9.

[11] Moriwaki Y, Yamamoto T, Suda M, Nasako Y, Takahashi S,Agbedana OE, Hada T, Higashino K. Purification andimmunohistochemical tissue localization of human xanthineoxidase. Biochim Biophys Acta 1993;1164:327–30.