identification of novel keratinocyte-secreted peptides dermokine-α/-β and a new stratified...

www.elsevier.com/locate/ygeno

Genomics 84 (2004) 384–397

Identification of novel keratinocyte-secreted peptides dermokine-a/-h and

a new stratified epithelium-secreted protein gene complex on human

chromosome 19q13.1$

Takeshi Matsui,a,1 Fumie Hayashi-Kisumi,a,1 Yoko Kinoshita,a Sayaka Katahira,a

Kazumasa Morita,b Yoshiki Miyachi,b Yuichi Ono,a Toshio Imai,a Yoko Tanigawa,a,2

Tohru Komiya,a,3 and Shoichiro Tsukitac,*

aKAN Research Institute, Inc., Shimogyo-ku, Kyoto 600-8815, JapanbDepartment of Dermatology, Graduate School of Medicine, Kyoto University, Sakyo-ku, Kyoto 606-8507, Japan

cDepartment of Cell Biology, Faculty of Medicine, Kyoto University, Yoshida-Konoe, Sakyo-ku, Kyoto 606-8501, Japan

Received 10 February 2004; accepted 30 March 2004

Abstract

We performed high-throughput in situ hybridization screening of sections of mouse epidermis using an equalized skin cDNA library as

probes and identified a novel gene giving rise to two splicing variants, both of which are expressed in the spinous layer. This gene was

mapped between two genes encoding keratinocyte-related peptides, suprabasin and keratinocyte differentiation-associated protein (Kdap), on

human chromosome 19q13.1. These gene products appeared to carry functional signal sequences. We then designated these two splicing

variants as dermokine-a and -h. Northern blotting and quantitative RT-PCR revealed that dermokine-a/-h, suprabasin, and Kdap were highlyexpressed in stratified epithelia. In mouse embryonic development, dermokine-a/-h began to be expressed during the period of stratification.

Also, in differentiating primary cultured human keratinocytes, transcription of dermokine-a/-h, suprabasin, and Kdap was induced. These

findings indicated that dermokine-a/-h, suprabasin, and Kdap are secreted from the spinous layer of the stratified epithelia and that these

genes form a novel gene complex on the chromosome.

D 2004 Elsevier Inc. All rights reserved.

Keywords: Keratinocyte; Epidermis; Skin; In situ hybridization; Dermokine; Suprabasin; Kdap; Secreted peptide; Gene complex; Differentiation

The epidermis is a keratinized stratified squamous tion of keratinocytes with concomitant morphological

epithelium composed of basal, spinous, granular, and

cornified cell layers. Epidermal cells (keratinocytes) move

upward from the basal to the cornified cell layer. This

movement is accompanied by a characteristic differentia-

0888-7543/$ - see front matter D 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.ygeno.2004.03.010

$ Sequence data from this article have been deposited with the GenBank

Data Library under Accession Nos. AY622962 through AY622965.

* Corresponding author. Fax: 81-75-753-4660.

E-mail address: [email protected] (S. Tsukita).1 These authors contributed equally to this work.2 Present address: Tsukuba R&D Center, Celestar Lexico-Sciences,

Inc., To-ko-dai, Tsukuba, Ibaraki 300-2635, Japan.3 Present address: Graduate School of Science, Osaka City University,

Sumiyoshi, Osaka 538-8535, Japan.

changes: As a final stage in the differentiation, keratino-

cytes lose intracellular organellae and become flattened to

constitute the cornified layer. Therefore, the spatial and

temporal changes to gene expression patterns during the

keratinocyte differentiation have attracted interest among

not only dermatologists but also cell biologists [1–3].

Keratinocytes in the basal layer are highly proliferative

and express a basal-type pair of keratins, K5/K14. As

keratinocytes detach from the basement membrane, they

undergo differentiation, characterized by a change in

keratin expression from K5/K14 to a suprabasal pair, K1/

K10 [4–7]. In the upper spinous and granular layers,

keratinocytes begin to synthesize precursor proteins of

the cornified envelope (CE) and a cross-linking enzyme,

Fig. 1. High-throughput in situ hybridization (HT-ISH). (A) Evaluation of the equalization of the mouse back skin cDNA library. The starting library (E0) and

the equalized library (E1 and E2) were analyzed by quantitative real-time PCR in duplicate. All data were normalized to an internal standard, loricrin.

Compared to E0, in E2, both keratin 14 and keratin 5 cDNAs (abundant cDNAs) were decreased in amount by f5-fold, whereas integrin a-M cDNA (rare

cDNA) was increased in amount by f42-fold. (B) Examples of HT-ISH signals. The cRNA probes prepared from the equalized cDNA library (E2) were

hybridized to sections of the adult mouse foot pad epidermis using a 96-well format. (a) Cyclophilin A (NM008907) was expressed specifically in the basal and

suprabasal layers. (b) Kdap was detected in the suprabasal cell layer. (c) Prothymosin a (NM008972), (d) diazepam-binding inhibitor (BC028874), (e) a gene

product similar to the tubulin h2 chain homolog (AK015901), (f) lamin A (BC015302), (g) nuclear distributed C homolog (NM010948), (h) desmoplakin

(BC033467), (i) keratin-associated protein 16-5 (NM130857), and (j) nucleoside diphosphate kinase C (AF288691) were expressed in the spinous layer. (k)

The transcripts of small proline rich-like 2 (NM028625) were detected in spinous and granular layers. (l) Loricrin (U09189) mRNAwas detected exclusively in

the granular layer. No specific signal was observed with the sense probe for each clone (data not shown). Dashed lines represent the border between the

epidermis and the dermis. Scale bar, 50 Am.

T. Matsui et al. / Genomics 84 (2004) 384–397 385

T. Matsui et al. / Genomics 84 (2004) 384–397386


transglutaminase (TGase) 1: the CE is a highly insoluble

structure on the cytoplasmic side of plasma membranes of

keratinocytes in the cornified layer and is composed of

various distinct types of proteins, which are cross-linked

by TGase 1 [8–11].

From the viewpoint of the epidermal barrier, the com-

ponents of the CE have been well characterized, including

involucrin, small proline-rich protein family members

(SPRRPs), and loricrin as well as cystatin, desmoplakin,

envoplakin, elafin, filaggrin, and keratins [11]. In addition,

repetin, hornein, and periphilin were identified as putative

CE precursor proteins [12–14]. Interestingly, many of

these CE-related proteins are encoded by genes clustered

in the so-called ‘‘epidermal differentiation complex’’

(EDC) on human chromosome 1q21 [15–17] and mouse

chromosome 3 [18,19], although some CE protein genes

encoding periplakin, sciellin, envoplakin, hornein, and

periphilin are not located at the EDC [20–22,13,14]. The

EDC contains at least 32 genes that contribute to the

cornification process, and these genes can be subclassified

into three groups based on their structures [23]. The first

group contains the genes for involucrin, loricrin, and

SPRRPs, each of which bears a short tandem repeat in

its central region [24]. The second group, the genes for

profilaggrin, trichohyalin, and repetin, is called the fused

gene subgroup, and they have an EF-hand domain in their

N-terminal region followed by multiple tandem repeats.

The third group contains the S100 family members with an

EF-hand motif.

Now that all genes have been identified in the human as

well as the mouse genome, the spatial and temporal

changes in gene expression patterns during the differenti-

ation of keratinocytes should be analyzed more systemat-

ically in a genome-wide manner. For this purpose, a

recently established gene screening method, ‘‘high-

throughput in situ hybridization’’ (HT-ISH), is highly

effective [25]. This method enables one to analyze the

expression patterns of genes in individual layers of kera-

tinocytes in the ‘‘intact’’ epidermis without dissecting cell

layers. By applying this method to the sections of the

mouse foot sole epidermis, we successfully identifiedf100 genes showing a layer-specific expression in the

intact epidermis. We have here identified and characterized

two splicing variants of a single novel gene, dermokine-a

Fig. 2. Identification of dermokine-a and -h. (A) HT-ISH signal obtained with

antisense SK063F08 probe gave intense signals from the spinous layer of epidermi

HE, hematoxylin–eosin staining. Dashed lines represent the border between the e

SK063F08 sequence and their human homolog ESTs. One mouse EST (AK0036

(AK081753) shared the same sequence as AK003695 in the 3V-end region, bp 98–

these ESTs were splicing variants (corrected AK081753: a single nucleotide deleti

1133, and a 48-bp deletion of position 1197–1244 were identified when the

AK081753 were found as two ESTs, AL832080 and BC035311, respectively. The

situ hybridization (see Figs. 5 and 6). (C) Amino acid sequences of mouse and h

AL832080 and corrected AK081753/BC035311. Putative signal sequences predict

a and -h are boxed. The glycine- and serine-rich domain of dermokine-h is indic

arrows. A conserved potential N-glycosylation site is denoted by an arrowhead.

and -h, which are secreted peptides specifically expressed

in the spinous layer of the epidermis. A search for the

dermokine-a/-h gene in genomic databases revealed that

the gene was located at a genomic locus encoding two

other keratinocyte proteins, suprabasin [26] and keratino-

cyte differentiation-associated protein (Kdap) [27]. We

found that suprabasin and Kdap were also secreted pep-

tides and that dermokine-a/-h, suprabasin and Kdap were

expressed primarily in stratified epithelia. These findings

revealed the existence of a new stratified epithelium-related

gene cluster, tentatively named SSC (stratified epithelium

secreted peptides complex).

Results

High-throughput in situ hybridization screening of genes

expressed in mouse epidermis

To generate cRNA probes for in situ hybridization of

sections of mouse skin, we prepared a cDNA library from

the back skin of 8-week-old female Balb/c mice and

equalized it as described under Materials and methods.

Equalization is required for this type of screening to pick

up efficiently genes that are transcribed at low level. To

confirm that the cDNA libraries were successfully equalized,

we performed a quantitative real-time PCR analysis with

gene-specific primers for mouse keratin 14 (NM016958),

keratin 5 (NM027011), integrin a-M (NM008401), and

loricrin (NM008508), with the expectation that keratin 14

and keratin 5 would be expressed in large amounts, while

the expression level of integrin a-M would be relatively low.

For normalizing the variation among the cDNA templates,

amounts of loricrin cDNA were determined with specific

primers for mouse loricrin. As shown in Fig. 1A, after

equalization of the library, both keratin 14 and keratin 5

decreased in amount byf5-fold, whereas integrin a-M was

increased in amount by f42-fold. The efficiency of equal-

ization was also evaluated by DNA sequencing of f500

clones randomly picked from the library before and after

equalization. Cluster analysis showed that preliminary re-

dundancy rates for the nonequalized and equalized libraries

were 35.3 and 1.3%, respectively. These findings indicated

that the equalization procedure successfully reduced

the SK063F08 probe in sections of adult mouse foot pad epidermis. The

s (Antisense), whereas no signal was detected with the sense probe (Sense).

pidermis and the dermis. Scale bar, 50 Am. (B) Mouse ESTs containing the

95) contained the whole sequence of SK063F08, and another mouse EST

657 in AK003695 and bp 1484–2043 in corrected AK081753, suggesting

on (guanine) at position 743, a 27-bp insertion between positions 1132 and

corresponding clone was isolated). Human homologs of AK003695 and

ORF is represented as boxes. h-Probe was used for Northern blotting and in

uman dermokine-a and -h deduced from the respective ESTs, AK003695/

ed by the SignalP server are underlined, and identical regions in dermokine-

ated by a dashed line. Conserved cysteines of dermokine-h are denoted by


amounts of highly abundant cDNA species, i.e., clone

redundancy.

The mouse foot pad epidermis is thicker than interfollic-

ular epidermis such as back skin and in morphology is

similar to the human epidermis. Thus, to examine the layer-

specific expression of genes in HT-ISH screening, we used

sections of mouse foot pad epidermis (8-week-old Balb/c

mice). After the plating of sections onto individual wells of

96-well plastic plates (100 plates; 9600 sections in total),

DIG-labeled cRNA probes prepared from the equalized

cDNA library were hybridized. Among 9600 sections,

hybridization signals were observed in f1000. Subsequent

sequencing eliminated redundant cDNA clones, leavingf600 unique genes. We assessed the reproducibility of in

situ hybridization for these genes, eliminated clones that

stained the nucleus, and finally selected 116 unique clones

that were expressed in a layer-specific manner in mouse foot

pad epidermis. These clones, of course, contained genes that

were well characterized previously: the HT-ISH signals for

cyclophilin A, Kdap, prothymosin a, diazepam binding

inhibitor, tubulin h-2 chain homolog, lamin A, nuclear

distribution C homolog, desmoplakin, keratin-associated

protein 16-5, nucleoside diphosphate kinase C, small proline

rich-like 2, and loricrin are shown in Fig. 1B as examples. In

Fig. 3. Organization of the dermokine-a and -h gene. (A) Exon organization of h

boxes represent the exons for coding and noncoding regions of the mRNA, respe

indicated as ATG and TGA, respectively. Exons 2–6 of dermokine-a are utiliz

sequence and 3V noncoding region. (B) The mouse and human loci containing

associated protein (Kdap). Arrows indicate directions of transcription. Testis-specif

locus; GPR43, G-protein-coupled receptor 43 gene locus.

good agreement with previous reports, the expression of

cyclophilin A, Kdap, and loricrin was restricted to the basal/

suprabasal, suprabasal, and granular layers, respectively

[27–29]. These findings indicated that the HT-ISH screen-

ing had worked well.

Identification of a novel gene expressed in the spinous layer

Among these 116 clones, we identified a novel cDNA

fragment (SK063F08), the in situ hybridization signal of

which was specifically detected in the spinous layer (Fig.

2A). To obtain a full-length cDNA clone, we searched the

mouse publicly available EST database and identified an

EST clone (AK003695) that contained the whole sequence

of SK063F08 (Fig. 2B). The expression of AK003695 in

mouse skin was verified by RT-PCR. The AK003695 EST

was composed of a short 5V untranslated region (UTR) of 22

bp, an open reading frame (ORF) of 315 bp encoding a

protein of 104 amino acids, and a 3VUTR of 324 bp

including a polyadenylation signal.

We further found another longer EST (AK081753) in the

database, which shared the same sequence as AK003695

at the 3Vend (98–657 bp), suggesting these ESTs were

splicing variants (Fig. 2B). The expression of AK081753

uman dermokine-a and -h gene on chromosome 19q13.1. Closed and open

ctively. Locations of the putative translation start and termination sites are

ed by dermokine-h as exons 12–16, resulting in an identical C-terminal

genes for suprabasin, dermokine-a/-h, and keratinocyte differentiation-

ic GAPDH, testis-specific glyceraldehyde-3-phosphate dehydrogenase gene


in mouse skin was also verified by RT-PCR. Close exam-

ination of the nucleotide sequence of several cloned cDNAs

corresponding to AK081753 identified a single nucleotide

deletion at position 743, a 27-bp insertion between position

1132 and position 1133, and a 48-bp deletion of position

1197–1244 bp. The corrected AK081753 EST sequence

contained a short 5V UTR of 170 bp and an ORF of 1554 bp

encoding a protein of 517 amino acids and a 3V UTR of 320

bp including a polyadenylation signal (Fig. 2B).

In a human EST database, we identified two ESTs,

AL832080 and BC035311, which are similar to mouse

ESTs AK003695 and AK081753: 63 and 55% identity at

the nucleotide sequence level, respectively (Fig. 2B). At the

amino acid sequence level, they both showed 54% identity

to corresponding mouse ESTs (Fig. 2C). The neighboring

Fig. 4. Secretion of dermokine-a/-h, Kdap, and suprabasin. (A) Schematic represen

Kdap, and suprabasin (0.7-kb transcript). Arrowheads represent the predicted cl

contained. Note that the predicted secreted form of dermokine-a and the correspond

(B) Exogenous expression of four SEAP(His)6 fusion proteins, dermokine-a-SE

SEAP(His)6, in 293/EBNA-1 cells. Dermokine-a, dermokine-h, Kdap, and suprabalacking its own signal peptide with a (His)6 C-terminal tag. These fusion protei

suprabasin were transiently expressed in 293/EBNA-1 cells. The cultured medi

immunoblotting with anti-His antibody. Fusion proteins in the medium are marked

medium, showing less mobility than the calculated molecular masses, 65, 103, 67

SEAP(His)6 were also detected as other bands with higher and lower molecular ma

SEAP(His)6, Kdap-SEAP(His)6, and suprabasin-SEAP(His)6 from the culture medi

were collected, and fusion proteins were purified using TALON Superflow Meta

followed by Coomassie brilliant blue staining and subjected to N-terminal amino a

SEAP(His)6, dermokine-h-SEAP(His)6, Kdap-SEAP(His)6, and suprabasin-SEA

respectively, as predicted in A.

sequences of mouse and human ESTs, AK003695,

AK081753, AL832080, and BC035311 around the initiation

codon were consistent with the translation initiation start site

proposed by Kozak [30].

Deduced amino acid sequences from AK003695,

AK081753, AL832080, and BC035311 showed no similar-

ity to any other sequences in GenBank. There were two

conserved cysteine residues (arrows in Fig. 2C) and a

conserved potential N-glycosylation site (arrowhead in

Fig. 2C) in dermokine-h and several potential N-myristoy-

lation sites in dermokine-a/-h. Interestingly, the SignalP

server predicted a typical signal sequence in the amino acid

sequences deduced from all these ESTs at their N-terminal

(http://www.cbs.dtu.dk/services/SignalP-2.0/#submission).

Furthermore, the portion shared by the two splicing variants

tations of putative signal peptides at the N-termini of human dermokine-a/-h,eavage sites. The pI values were calculated from the amino acid residues

ing C-terminal region of dermokine-h showed a fairly high pI value (pI 10.3).

AP(His)6, dermokine-h-SEAP(His)6, Kdap-SEAP(His)6, and suprabasin-

sin were fused to the N-terminus of a secreted alkaline phosphatase (SEAP)

ns carrying predicted signal sequences of dermokine-a and -h, Kdap, andum (10 Ag for each lane) was resolved by SDS–PAGE and subjected to

by arrowheads. Note that all four of the fusion proteins were secreted into the

, and 73 kDa, respectively. The secreted Kdap-SEAP(His)6 and suprabasin-

sses (asterisks). (C) Purification of dermokine-a-SEAP(His)6, dermokine-h-um. Culture media of 293/EBNA-1 cells containing secreted fusion proteins

l Affinity Resin. Purified proteins (arrows) were resolved by SDS–PAGE

cid sequencing. N-terminal amino acid sequences of secreted dermokine-a-

P(His)6 were determined as WGADA, GPLQS, ATLGG, and ASDDP,

http:\\www.cbs.dtu.dk\services\SignalP-2.0\


had a very high pI value (pI 10.3; see (Figs. 2B, 2C, and

4A)), which is common in various cytokines, such as bone

morphogenetic proteins (BMPs), eotaxin, fibroblast growth

factors (FGFs), interferon-h, interleukins, platelet-derived

growth factor (PDGF), and Wnts. Thus, considering that

mRNAs of these peptides are expressed in large amounts in

the skin as described below, we tentatively designated the

short and long splicing variants as dermokine-a and -h,respectively (Fig. 2C).

Organization of the dermokine-a/-b gene

The Ensembl Human Genome Browser located the gene

for human dermokine-a and -h on chromosome 19q13.1

(ENSG00000161249), spanning f14 kb. As shown in Fig.

3A, human dermokine-a and -h are encoded by 6 and 16

exons, respectively. Interestingly, exon 1 of the dermokine-

a gene contains both the putative translation start site and

the signal sequence and is flanked by exons 11 and 12 of

the dermokine-h gene, suggesting that they are transcribed

Fig. 5. Expression patterns of dermokine-a/-h, Kdap, and suprabasin in tissues. (A

mouse tissues were probed with DIG-labeled cRNA fragments specific for each g

and the corresponding C-terminal region of dermokine-h (arrow), generating two b

to dermokine-h, gave only one band (Dermokine-h) (see Fig. 2B). Membranes we

(Suprabasin), and control GAPDH-specific probe (GAPPH). All the genes were e

Expression patterns of dermokine-a/-h, Kdap, and suprabasin within the epidermis

(Antisense) and sense (Sense) probes specific for the dermokine-a/C-terminal reg

Dermokine-h), Kdap (Kdap), and suprabasin (Suprabasin). Hematoxylin–eosin

Dermokine-a/-h-, dermokine-h-, and suprabasin-specific hybridization signals w

whereas Kdap-specific signals were restricted to the suprabasal region of the spino

sense probes. Dashed lines represent the border between the epidermis and the d

by distinct promoters. The putative termination codon is

contained in exon 5 of dermokine-a, i.e., exon 15 of

dermokine-h. The mouse dermokine-a/-h gene was

mapped to chromosome 7 as ENSMUSG00000036665 in

the Ensembl Mouse Genome Browser, a region of shared

synteny with 19q13.1 in human. The precise organization

of the mouse dermokine-h gene could not be determined

due to incomplete information from the available genomic

database, but the same genomic organization was con-

firmed at the mouse dermokine-a gene locus (data not

shown).

On human chromosome 19q13.1 as well as mouse

chromosome 7, two genes for keratinocyte-related peptides,

suprabasin and Kdap, have been mapped (Fig. 3B): both

proteins were recently reported to be highly expressed in

stratified epithelia [26,27]. Interestingly, the suprabasin,

dermokine-a/-h, and Kdap genes were aligned in this order

with the same direction of transcription. The genes for

testis-specific glyceraldehyde-3-phosphate dehydrogenase

and GPR43, which do not encode keratinocyte-specific

) Northern blotting. Nylon membranes blotted with total RNA (20 Ag) fromene. The SK063F08 probe hybridized with both dermokine-a (arrowhead)

ands (Dermokine-a/-h), whereas the h probe, which specifically hybridized

re hybridized with a Kdap-specific probe (Kdap), suprabasin-specific probe

xpressed in the skin and stomach. Kdap was also detected in the lung. (B)

. Serial sections of mouse foot pad epidermis were hybridized with antisense

ion of dermokine-h (SK063F08; Dermokine-a/-h), dermokine-h (h probe;

staining of sections hybridized with sense probes is also shown (HE).

ere detected throughout the spinous layer of mouse foot pad epidermis,

us layer. No specific signals were detectable in sections hybridized with the

ermis. Scale bar, 50 Am.

Table 1

Quantitative real-time RT-PCR analyses of the expression of dermokine-a,

dermokine-h, Kdap, and suprabasin in various epithelial tissues

Tissue Dermokine-a Dermokine-h Kdap Suprabasin

Back skin +++ ++++ +++ +++

Foot pad skin ++++ +++++ ++++ ++++

Tongue +++ ++++ +++ +++

Esophagus +++ ++++ ++++ +++

Forestomach ++++ ++++++ +++++ ++++

Glandular stomach ++ ++ ++ +

Vagina +++ +++ +++ ++

Trachea ++++ +++ ++ ++

Lung +++ +++ � ++

Urinary bladder + + + +

Thymus ++ ++ + +

Small intestine � � � �Liver � � � �Total RNA was prepared from various epithelial tissues of 8-week-old

female Balb/c mice, and SYBR green-based quantitative real-time RT-PCR

was performed with specific primers for mouse dermokine-a and -h, Kdap,and suprabasin. All data were normalized to an internal GAPDH mRNA

control. Data represent means of three independent experiments. �, +, ++,

+++, ++++, +++++, and ++++++ represent expression levels as ratios to

GAPDH (�10�3) of 0–0.1, 0.1–1, 1–10, 10–100, 100–1000, 1000–

2000, and 2000–3000.


proteins, are located upstream of suprabasin and down-

stream of Kdap, respectively [31,32], but are transcribed

in the direction opposite to that of suprabasin, dermokine-

a/-h, and Kdap. This finding, i.e., the existence of a novel

cluster of keratinocyte-related genes, suggested that the

transcription of suprabasin, dermokine-a/-h, and Kdap

mRNA is regulated in a coordinated manner.

Secretion of dermokine-a/-b, Kdap, and suprabasin

As shown in Fig. 4A, the SignalP server predicted that

not only dermokine-a/-h but also Kdap and suprabasin bear

putative signal sequences in their N termini (Fig. 4A). This

was previously pointed out in Kdap [27], whereas the N-

terminal hydrophobic sequence in suprabasin has been

discussed as a potential transmembrane domain [26]. How-

ever, as the dermokine-a/-h, Kdap, and suprabasin genes

form a gene complex, it is tempting to speculate that all of

their products are secreted from keratinocytes. We then

examined using cultured cells whether these putative signal

sequences are functional, i.e., whether N-terminally pro-

cessed human dermokine-a/-h, Kdap, and suprabasin (0.7-

kb transcript) proteins were secreted into the culture medi-

um. To express a highly positively charged protein like

dermokine-a exogenously in large amounts, we used a

system in which proteins fused with a stable secreted

protein, secreted alkaline phosphatase (SEAP), were tran-

siently expressed in cultured 293/EBNA-1 cells. Human

dermokine-a/-h, Kdap, and suprabasin (0.7-kb transcript)

cDNAs were inserted into a mammalian expression vector,

pcDNA3.1-SEAP (His)6, to express fusion proteins tagged

with SEAP lacking its own signal peptide with a (His)6 at

their C-termini. These fusion proteins were then transiently

expressed in cultured 293/EBNA-1 cells and were detected

by immunoblotting with anti-His antibody in the culture

medium (Fig. 4B) [48]. Interestingly, compared to the

calculated molecular masses of fusion proteins, those in

the medium shifted upward significantly in the SDS–

PAGE gels, suggesting the posttranslational modification

of secreted proteins possibly due to their glycosylation and/

or intermolecular disulfide bond.

Next, we examined whether the N-terminal putative

signal sequences are removed from these secreted fusion

proteins. Each secreted fusion protein was purified from the

culture medium using TALON Superflow Metal Affinity

Resin to near homogeneity (Fig. 4C): Under the transfec-

tion and culture conditions used in this study, dermokine-a-

SEAP(His)6, dermokine-h-SEAP(His)6, Kdap-SEAP(His)6,and suprabasin-SEAP(His)6 were purified with yields of up

to 0.15, 0.3, 13.5, and 15 mg/liter, respectively. The direct

amino acid sequencing of the N-termini of these purified

proteins revealed that these secreted proteins lacked puta-

tive N-terminal signal sequences precisely as predicted in

Fig. 4A (Fig. 4C). These findings indicated that dermo-

kine-a/-h, Kdap, and suprabasin are cleaved at their N-

termini, further modified posttranslationally, and then

secreted.

Expression patterns of dermokine-a/-b, Kdap, andsuprabasin in tissues

The expression of dermokine-a/-h, Kdap, and suprabasintranscripts in various mouse tissues was examined by North-

ern blotting (Fig. 5A). The SK063F08 probe, which hybrid-

izes with both dermokine-a and dermokine-h (see Fig. 2B),

detected two bands of 0.6 and 2.0 kb intensely in the skin and

weakly in the stomach (Dermokine-a/h in Fig. 5A); under a

long exposure, these bands were also detectable in the lung

(data not shown). Judging from their sizes, these bands may

correspond to dermokine-a and -h, respectively. Indeed,

when the dermokine-h-specific probe (h probe in Fig. 2B)

was used, only the 2.0-kb band was detected (Dermokine-hin Fig. 5A). Kdap was expressed in the stomach and skin in

large amounts and in the lung in small amounts (Kdap in Fig.

5A). The expression patterns of the 0.7- and 2.2-kb splicing

variants of the suprabasin gene were very similar to those of

dermokine-a/-h (Suprabasin in Fig. 5A). Furthermore, we

examined the expression of these proteins by quantitative

RT-PCR (qRT-PCR) (Table 1). In good agreement with the

Northern blots, dermokine-a/-h, Kdap, and suprabasin were

expressed in large amounts in stratified epithelia such as the

skin, tongue, esophagus, forestomach, and vagina. They

were expressed in the trachea and urinary bladder as well

as in the thymus, which was consistent with a report that

Kdap was expressed in trachea and urinary bladder and

suprabasin was expressed in the thymus [27,26]. Even by

RT-PCR, they were undetectable in typical simple epithelia

such as the liver and small intestine. Therefore, we conclud-

ed that dermokine-a/-h, Kdap, and suprabasin can be

Fig. 6. SSC products and keratinocyte differentiation. (A) Expression of dermokine-a/-h during mouse embryonic development. Mouse Embryo Full Stage

Blot (Seegene) was probed with DIG-labeled cRNA fragments of SK063F08. Dermokine-h (arrow) began to be expressed at E15.5. Dermokine-a (arrowhead)

first appeared at E16.5, and its expression increased to E17.5 and then decreased by E18.5. The bottom is the ethidium bromide-stained membrane (EtBr). (B)

In vitro differentiation of primary cultured human keratinocytes. Human primary keratinocytes were cultured under different Ca2+ concentrations (0.15 and

1.50 mM Ca2+) for 2 days or at different cell densities (2, 4, and 6 days) with 0.15 mM Ca2+. The differentiation was induced by raising the Ca2+ concentration

(from 0.15 to 1.50 mM) or by increasing the cell density (from a 2- to a 6-day culture) at 0.15 mM Ca2+. Total RNAwas prepared from these cells, and SYBR

green-based quantitative real-time RT-PCR analysis was performed with specific primers for dermokine-a and -h, Kdap, suprabasin, differentiation-specificgenes (keratin 10, involucrin, and TGase 1), and the control h-actin gene. All data were normalized to an internal GAPDH mRNA control. Similar to

differentiation-specific genes, the transcription of dermokine-a and -h, Kdap, and suprabasin genes was significantly upregulated when the differentiation was

induced. The transcription level of the control h-actin gene did not change. Bars represent means with standard deviations of three independent experiments.


regarded as stratified epithelium-specific secreted proteins,

although with some exceptions, especially in some pseudos-

tratified epithelia. This conclusion is highly consistent with

the notion that the expression of these genes, which form a

complex on a chromosome, is regulated coordinately in a

stratified epithelium-specific manner. Therefore, we propose

here that this gene complex be designated SSC (stratified

epithelium secreted peptides complex).

Next, we compared the expression of SSC products in

detail within the stratified epithelium; we performed an in

situ hybridization analysis on serial sections of the mouse

foot pad epidermis. Eight serial sections of epidermis were

hybridized with antisense or sense cRNA probes for

dermokine-a/-h, Kdap, and suprabasin. As shown in Fig.

5B, the antisense probe for dermokine-a/-h (SK063F08 in

Fig. 2B), dermokine-h (h probe in Fig. 2B), and supra-


basin produced hybridization signals evenly throughout the

spinous layer of the epidermis. By contrast, the Kdap-

specific probe hybridized exclusively to the suprabasal

portion of the spinous layer as reported previously by

Oomizu et al. [27]. These results suggested that the

expression of the SSC products was activated at the onset

of stratification of keratinocytes during the differentiation

within the epidermis.

SSC products and keratinocyte differentiation

The expression of dermokine-a/-h in the skin during

embryonic development was examined by Northern blot-

ting with the SK063F08 probe. As shown in Fig. 6A,

dermokine-h began to be expressed at E15.5: This timing

coincided well with the epidermal stratification. Dermo-

kine-a became detectable at E16.5, increased up to E17.5,

and decreased by E18.5. These findings suggested that the

expression of dermokine-a/-h is associated with the

stratification of the epidermis in vivo in early mouse

development.

Finally, to examine further the relationship between SSC

products and keratinocyte differentiation, we pursued the

change in the expression levels of SSC products by qRT-

PCR during the in vitro differentiation of primary cultured

human keratinocytes. The differentiation was induced by

raising the Ca2+ concentration (from 0.15 to 1.50 mM) or by

increasing the cell density (from a 2- to a 6-day culture) at

0.15 mM Ca2+: In human keratinocytes, the latter method

was reported to be more effective in terms of the induction

of terminal differentiation [33], and this was confirmed by

measuring the mRNA levels of keratin 10, TGase 1, and

involucrin by qRT-PCR (Fig. 6B). Interestingly, the expres-

sion of all of the SSC products was clearly induced as the

terminal differentiation proceeded in vitro.

Discussion

The terminal differentiation of keratinocytes in the

epidermis is accompanied by morphological and functional

changes to the cytoskeleton and cell–cell adhesion, based

on a dramatic and differential induction of many genes

[1–3]. To analyze the expression patterns of genes in

individual layers of the ‘‘intact’’ epidermis, we performed

a HT-ISH screening using sections of mouse foot pad

epidermis with a probe source made from an equalized

back skin cDNA library [25]. This screening gave us

information not only on the expression level but also on

the layer expressing individual cDNAs. As all experimental

procedures were carried out using a 96-well format, a large

number of cDNAs were screened very rapidly. As probes

for hybridization were selected randomly from an equalized

cDNA library in which the highly abundant cDNA species

were reduced in amount, this screening was very effective.

After the initial screening, f1000 of f10,000 genes

showing specific HT-ISH signals were identified, indicating

that specific signals were undetectable in f90% of the

sections. This was probably due to a limitation of sensitiv-

ity with the present in situ hybridization system as dis-

cussed for HT-ISH screening in the small intestine [25].

The sequence of the mouse genome revealed that it containsf30,000 protein-coding genes [34]. This means that in this

series of experiments, we have presumably screened almost

one-third of all genes in the mouse genome. Therefore,

theoretically, if we improve the sensitivity of HT-ISH, we

could have an overall picture of the gene expression profile

in each layer of intact epidermal keratinocytes.

In this study, through HT-ISH screening, we focused on

one novel gene that gives rise to two splicing variants,

dermokine-a and -h, which were expressed in the spinous

layer of the epidermis. This gene was located on human

chromosome 19q13.1 (mouse chromosome 7), where it

was sandwiched by two other keratinocyte-related genes,

the suprabasin [26] and Kdap genes [27]. We found that,

similar to Kdap and suprabasin, dermokine-a and -h were

expressed primarily in stratified epithelia and that all these

proteins were secreted peptides. Therefore, we designated

this gene cluster (SSC) s tratified epithelium s ecreted

peptides c omplex. Interestingly, the expression of all of

the SSC products was induced at the onset of stratification

of keratinocytes both in vivo and in vitro, indicating that

the transcription of the genes of SSC is regulated coordi-

nately in a differentiation-dependent manner. As to the

complex of keratinocyte-related genes, the EDC located on

human chromosome 1q21 (mouse chromosome 3) has

been well characterized: EDC contains at least 32 genes

expressed during epidermal differentiation [23]. Expression

patterns of EDC genes change gradually from a broad

tissue distribution and limited differentiation specificity in

the telomeric region, including S100 genes, to a strong

tissue- and differentiation-specific expression in the more

centromeric region, in which trichohyalin and filaggrin

genes are located [35]. These genes are involved directly

in cornification, which plays a crucial role in the epidermal

barrier, one of the most important functions of the epider-

mis [8]. Therefore, although it is a lot smaller than EDC,

SSC also has likely evolved to accomplish important

functions in the epidermis as well as other types of

stratified epithelia. A precise analysis of the promoter/

enhancer region of SSC will provide further insight into

the function of SSC products.

Not only dermokine-a/-h but also Kdap and suprabasin

were biochemically shown to be secreted from cells after

processing of their N-terminal signal peptides when their

cDNAs were transfected into 293/EBNA-1 cells. It is well

known that keratinocytes secrete various cytokines, growth

factors, etc., such as IL-1/-6/-8, TNF-a, colony-stimulating

factors, transforming growth factor-a/-h, NGF, PDGF, sev-eral FGF family members, and phospholipases A2 [36–39].

The antimicrobial peptides cathelicidin and defensin gene

family members are also secreted from keratinocytes, which


have been implicated in mediation of the innate defense

against bacterial infection [40]. However, the expression of

these secreted peptides is not specific to stratified epithelia,

including keratinocytes. To date, only galectin-7, a secreted

peptide, has been reported to be expressed in a stratified

epithelium-specific manner [41,42]. However, galectin-7 is

expressed in all cell layers of the epidermis and its expres-

sion in cultured keratinocytes was not influenced by a shift

in Ca2+ concentration in the medium [43]. Therefore, we

concluded that dermokine-a/-h, Kdap, and suprabasin are

unique secreted peptides and that SSC is the first example of

a gene complex encoding secreted proteins that are

expressed primarily in stratified epithelia in a differentia-

tion-dependent manner. Of course, to show conclusively

that these SSC products are secreted from keratinocytes in

situ, we must raise specific antibodies. Studies are currently

being conducted along this line.

The physiological roles of dermokine-a/-h, Kdap, andsuprabasin must be clarified as a next step, but the amino

acid sequences of these proteins provide some insight into

their functions. It is generally known that many cytokines

like BMPs, eotaxin, FGFs, interferon-h, interleukins,

PDGF, and Wnts have high pI values. Interestingly, the

secreted form of dermokine-a and the corresponding C-

terminal domain of dermokine-h showed high pI values

(pI 10.3), suggesting some functions shared by other

cytokines. By contrast, the secreted forms of Kdap and

suprabasin have pI values of 5.7 and 6.4, respectively,

suggesting that they function via modes of action different

from that of dermokine-a/-h. Another characteristic amino

acid sequence was found in the central portion of dermo-

kine-h, where glycine and serine residues are abundant.

Considering that a similar glycine/serine-enriched domain

occurs in several cell envelope precursor proteins like

filaggrin, LEP/XP-5, and loricrin, the possible involvement

of dermokine-h in cornification should be examined

further [11]. The generation of mice lacking the expression

of dermokine-a/-h, Kdap, or suprabasin will lead directly

to a better understanding of the physiological roles of

these SSC products. Studies are being conducted along

this line.

Materials and methods

Cell cultures and antibody

Normal human epidermal keratinocytes derived from

neonatal foreskin were purchased from Kurabo, Inc. (Osaka,

Japan) and cultured in serum-free medium, Humedia KG2,

as recommended by Kurabo, Inc. 293/EBNA-1 cells were

purchased from Invitrogen (San Diego, CA, USA) and

maintained in Dulbecco’s modified Eagle’s medium (Sigma)

supplemented with 10% fetal calf serum. Anti-His antibody

(Penta � His Antibody, BSA free) was purchased from

Qiagen (Valencia, CA, USA).

Construction and equalization of a mouse skin cDNA

library and preparation of DIG-labeled RNA probe

A cDNA library was constructed and equalized according

to methods described previously [25]. Briefly, mouse skin

cDNA was constructed using an oligo(dT) primer with a

NotI restriction site from total RNA of mouse back skin (8-

week-old female Balb/c mice). The cDNAwas amplified by

PCR, and then two rounds of equalization were carried out

as described previously [44,45]. In each equalization step

(E1 and E2), the Cot value was 10 and 100, respectively.

Equalization was assessed by quantitative real-time PCR

analysis in duplicate as described below. Gene-specific

primer pairs for mouse keratin 14 (5V-GGACGCC-

CACCTTTCATCTTC-3V, forward; 5V-ATCTGGCGG-

TTGGTGGAGG-3V, reverse), mouse keratin 5 (5V-CAG-TTCTACATTTGTGTTGCACGTC-3V, forward; 5V-TTG-GACAGACTCTGGAGGAAGTCAG-3V, reverse), mouse

integrin a-M (5V-TTGAAAGGACCCCAGTGCTGA-

ACTGC-3V, forward; 5V-ATGGAGCTGCCCACAATGA-GTGGTACAG-3V: reverse), and mouse loricrin (5V-CCT-ACCTGGCCGTGCAAG-3V, forward; 5V-CATGAG-

AAAGTTAAGCCCATCG-3V, reverse) were designed from

respective cDNA sequences NM016958, NM027011,

NM008401, and NM008508. The same amounts of equal-

ized libraries (E1 and E2) and the starting library (E0) were

used as PCR templates. All data were normalized to an

internal standard (loricrin, DCt method, User Bulletin 2,

Applied Biosystems, Foster City, CA, USA).

The E2 library was digested with NotI and SalI and the

resulting fragments were cloned into pBlueScript KS(�)

(Stratagene, La Jolla, CA, USA). Colonies were randomly

chosen and the cDNA inserts were amplified by PCR with

vector primer pairs using Native Pfu DNA polymerase

(Stratagene). The amplified fragments have additional T3

and T7 RNA polymerase promoter sequences, which were

derived from the vector. The cRNA transcription was

carried out in Nunc MicroWell Plates (Nunc, Roskilde,

Denmark) using T7 RNA polymerase for generating anti-

sense probes (Stratagene). Sense probes were generated

using T3 RNA polymerase (Stratagene).

High-throughput in situ hybridization

HT-ISH in a 96-well plate was performed as described

previously [25]. Briefly, adult mouse foot pad skin was

freshly isolated from 8-week-old female Balb/c mice. Iso-

lated skin was fixed with 1% diethylpyrocarbonate in

phosphate-buffered saline for 1 h at room temperature.

Then, samples were dehydrated, embedded, sectioned,

mounted, and hybridized in a 96-well plate.

Northern blotting

Total RNA was prepared from various adult mouse

tissues according to the method described by Chomczynski


and Sacchi [46]. The total RNA (20 Ag) was electrophoresedand transferred onto Hybond-N+ membranes (Amersham

Pharmacia Biotech, Little Chalfont, UK). cDNA fragments

of dermokine-a/-h (SK063F08 in Fig. 2B), dermokine-h (hprobe in Fig. 2B), Kdap (XM149907), and suprabasin

(318–765 bp of BC051531) were labeled with DIG using

a DIG RNA labeling kit (Roche Applied Science). Hybrid-

ization with DIG-labeled RNA probes was performed

according to the protocol described by the manufacturer

(Roche Applied Science). The expression of dermokine-a/-hin various stages of embryonic development was examined

using the Mouse Embryo Full Stage Blot (Seegene, Seoul,

Korea).

cDNA cloning and construction of SEAP fusion proteins

First-strand cDNA was prepared with Superscript II

reverse transcriptase (Invitrogen) from human skin total

RNA (Stratagene). The DNA fragments encoding ORFs of

human dermokine-a and -h were amplified by PCR using

5VSalI-dermokine-a primer (GTCGACGCCACCATGAA-

CATGAAGCCGGCCACTGC)/3VNotI-dermokine-a primer

(GCGGCCGCCCAAAACTTCACCCACTGCAGCAGG)

and 5VSalI-dermokine-h primer (GTCGACGCCACCAT-

GAAGTTCCAGGGGCCCCTGG)/3VNotI-dermokine-hprimer (GCGGCCGCCCAAAACTTCACCCACTGCAG-

CAGG), respectively. The cDNAs of human Kdap and

suprabasin (0.7-kb fragment [26]) were obtained by PCR

using 5VSalI-Kdap primer (GTCGACGCCACCATGAA-

GATCCCGGTCCTTCCTGCC)/3VNotI-Kdap primer

(GCGGCCGCCTGGGCATCAGGAGTTGCGCTC) and

5VSalI-suprabasin primer (AATTGTCGACGCCACCATG-

CATCTTGCACGTCTGGTCGG)/3VNotI-suprabasin primer

(ATATGCGGCCGCGCAGCTGGTTGGCCTCC-

TTGCTGG), respectively. These primers were designed

based on sequences with the following GenBank accession

numbers: AK003695 (dermokine-a), BC035311 (dermo-

kine-h), BX112106 (Kdap), and BC063640 (suprabasin).

These cDNAs were fused to the 5V end of cDNA encod-

ing SEAP(His)6. A SEAP(His)6 expression vector, termed

pcDNA3.1-SEAP(His)6, was constructed from pDREF-

SEAP(His)6 [47]. After digestion with SalI and NotI, the

cDNAs of dermokine-a, dermokine-h, Kdap, and supra-

basin were subcloned into the SalI–NotI sites of pcDNA3.1-

SEAP(His)6 to yield pcDNA3.1-dermokine-a-SEAP(His)6,

pcDNA3.1-dermokine-h-SEAP(His)6, pcDNA3.1-Kdap-

SEAP(His)6, and pcDNA3.1-suprabasin-SEAP(His)6, re-

spectively. These expression vectors were introduced into

293/EBNA-1 cells using TransIT LT1 (Mirus, Madison,

WI, USA). The SEAP fusion proteins that were tran-

siently expressed and secreted into the medium were

purified as described previously, except that TALON

Superflow Metal Affinity Resin (BD Biosciences Clon-

tech, Palo Alto, CA, USA) was used [48]. Purified SEAP

fusion proteins were subjected to N-terminal amino acid

sequencing.

In vitro differentiation of keratinocytes

In vitro differentiation of keratinocytes was performed as

described by Poumay et al. with a slight modification [33].

Subconfluent normal human epidermal keratinocytes were

plated onto culture dishes (2.5 � 103 cells/cm2) in Humedia

KG2 medium (0.15 mM Ca2+ concentration) containing

bovine pituitary extract (BPE) and cultured for 2 days. Cells

were then washed several times with a normal-Ca2+ medium

(0.15 mM Ca2+) or high-Ca2+ medium (1.5 mM Ca2+) in the

absence of BPE. Keratinocytes were next cultured in the

normal-Ca2+ medium for 2/4/6 days or in the high-Ca2+

medium for 2 days. Total RNA was prepared from these

cells using the RNeasy Mini Kit (Qiagen).

Quantitative real-time RT-PCR

For quantitative real-time RT-PCR analysis of mouse

tissues, total RNAwas prepared from various mouse tissues

(8-week-old female Balb/c mice) using an RNeasy Fibrous

Tissue Mini Kit (Qiagen). First-strand cDNA templates

were prepared from the total RNA using an RNA PCR

Kit (AMV) ver.2.1 (Takara, Shiga, Japan) with random 9-

mer primers. Quantitative real-time PCR was performed in

duplicate by monitoring the increase in fluorescence of

SYBR Green I dye with a QuantiTect SYBR Green PCR

Kit (Qiagen) and ABI Prism 7700 Sequence Detection

System (Applied Biosystems). Primers were designed to

be compatible with a single real-time PCR thermal profile

(95jC for 15 min and 40 cycles of 95jC for 15 s and 60jCfor 1 min) such that multiple transcripts could be analyzed

simultaneously. All data were normalized to an internal

standard (glyceraldehyde-3-phosphate dehydrogenase

mRNA, DCt method, User Bulletin 2, Applied Biosystems).

Primer sets were as follows: mouse dermokine-a

(AK003695), forward primer (5V-GACTGTACGAGAGCA-CAACCATG-3V) and reverse primer (5V-CTGAACCC-CAGCTGTGGC-3V); mouse dermokine-h (AK081753),

forward primer (5V-CATGCCCCATCTCCCAGC-3V) and

reverse primer (5V-CCCTCAATCTGTTTCCAGTTGAAG-3V); mouse Kdap (XM149907), forward primer (5V-ACTGG-CACGTCATCACTGATATGTTC-3V) and reverse primer

(5V-GGAATCAGGAGCGGCACTTC-3V); mouse supraba-

sin (AY115494), forward primer (5V-GTCAACAAGC-CATTTATCAACTTCC-3V) and reverse primer (5V-GTGTGACAACCGGAGCATTC-3V); mouse GAPDH

(NM008084), forward primer (5V-AAGGTGGTGAAG-CAGGCATCTGAG-3V) and reverse primer (5V-GGAA-GAGTGGGAGTTGCTGTTGAAGTC-3 V) ; human

dermokine-a (AL832080), forward primer (5V-ATGAA-CATGAAGCCGGCCAC-3V) and reverse primer (5V-CGTTTCTGCAGTGATGACGCG-3V); human dermokine-

h (BC035311), forward primer (5V-AAAGGCCATTGG-CAAAGAGGCC-3 V) a n d r e v e r s e p r im e r ( 5 V-ACCCTGTTGCCCAAAGCATCTG-3V); human Kdap

(BX112 1 0 6 ) , f o rw a r d p r im e r ( 5 V-AACTGG-


CACGCCCTCTTTGAGTCTATC-3V) and reverse primer

(5V-ATGGTCACTGGGCATCAGGAGTTG-3V); human

suprabasin (BC063640), forward primer (5V-AAC-

CAGCTGCTGAATGGCAACCA-3V) and reverse primer

(5V-ATGAAAGGCGTGTTGACCGAGG-3V); human kera-

tin 10 (J04029), forward primer (5V-CTTGGCAGAAA-CAGAAGGTCGCTAC-3V) and reverse primer (5V-CGG-TTTCAGCTCGAATCTCTTGC-3V); human involucrin

(M13903), forward primer (5V-CCACCCAAACATAAA-TAACCACCCG-3V) and reverse primer (5V-TAGCG-

GACCCGAAATAAGTGGAGC-3V); human TGase 1

(NM000359), forward primer (5V-ATGTCTCAGGC-

CACGTCAAG-3V) and reverse primer (5V-CTGCTCCCAG-TAACGTGAGG-3V); human h-actin (NM001101), forward

primer (5V-ATCAAGATCATTGCTCCTCCTGAG-3V) and

reverse primer (5V-TGCTTGCTGATCCACATCTGC-3V);and human GAPDH (NM002046), forward primer (5V-ACTTCAACAGCGACACCCACTC-3V) and reverse primer

(5V-CCTGTTGCTGTAGCCAAATTCG-3V).

Acknowledgments

We thank Ms. Keiko Mizuno and Yoko Inoue (KAN

Research Institute) for their excellent experimental assis-

tance, Dr. Masakazu Takeuchi and Ms. Megumi Chiba

(KAN Research Institute) for critically reading the manu-

script, and Drs. Yoshio Matsubara and Hiroshi Yamauchi

(KAN Research Institute) for their encouragement through-

out this study. Thanks are also due to Drs. Kenji Yamamoto

and Eiji Majima (Apro Science Co., Tokushima, Japan) for

their help in the N-terminal amino acid analysis.

References

[1] F.M. Watt, Terminal differentiation of epidermal keratinocytes, Curr.

Opin. Cell Biol. 1 (1989) 1107–1115.

[2] R.L. Eckert, Structure, function and differentiation of the keratino-

cyte, Physiol. Rev. 69 (1989) 1316–1346.

[3] R.L. Eckert, J.F. Crish, N.A. Robinson, The epidermal keratinocyte as

a model for the study of gene regulation and cell differentiation,

Physiol. Rev. 77 (1997) 397–424.

[4] E. Fuchs, H. Green, Changes in keratin gene expression during ter-

minal differentiation of the keratinocyte, Cell 19 (1980) 1033–1042.

[5] R. Moll, W.W. Franke, B. Volc-Platzer, R. Krepler, Different keratin

polypeptides in epidermis and other epithelia of human skin: a spe-

cific cytokeratin of molecular weight 46,000 in epithelia of the pilo-

sebaceous tract and basal cell epitheliomas, J. Cell Biol. 95 (1982)

285–295.

[6] E. Fuchs, C. Byrne, The epidermis: rising to the surface, Curr. Opin.

Genet. Dev. 4 (1994) 725–736.

[7] E. Fuchs, Keratins and the skin, Annu. Rev. Cell Dev. Biol. 11 (1995)

123–153.

[8] D. Roop, Defects in the barrier, Science 267 (1995) 474–475.

[9] A. Ishida-Yamamoto, H. Iizuka, Structural organization of cornified

cell envelopes and alterations in inherited skin disorders, Exp. Der-

matol. 7 (1998) 1–10.

[10] A. Kalinin, L.N. Marekov, P.M. Steinert, Assembly of epidermal

cornified cell envelope, J. Cell Sci. 114 (2001) 3069–3070.

[11] A.E. Kalinin, A.V. Kajava, P.M. Steinert, Epithelial barrier function:

assembly and structural features of the cornified cell envelope, Bio-

Essays 24 (2002) 789–800.

[12] P. Krieg, et al., Repetin (Rptn), a new member of the ‘‘fused gene’’

subgroup within the S100 gene family encoding a murine epidermal

differentiation protein, Genomics 43 (1997) 339–348.

[13] T. Makino, M. Takaishi, M. Morohashi, N. Huh, Hornein, a novel

profilaggrin-like protein and differentiation-specific marker isolated

from mouse skin, J. Biol. Chem. 276 (2001) 47445–47452.

[14] S. Kazerounian, S. Aho, Characterization of periphilin, a wide-

spread, highly insoluble nuclear protein and potential constituent

of the keratinocyte cornified envelope, J. Biol. Chem. 278 (2003)

36707–36717.

[15] A. Volz, et al., Physical mapping of a functional cluster of epidermal

differentiation genes on chromosome 1q21, Genomics 18 (1993)

92–99.

[16] D. Mischke, B.P. Korge, I. Marenholtz, A. Volz, A. Ziegler, Genes

encoding structural proteins of epidermal cornification and S100 cal-

cium-binding proteins form a gene complex (‘‘epidermal differentia-

tion complex’’) on human chromosome 1q21, J. Invest. Dermatol.

106 (1996) 989–992.

[17] I. Marenholz, et al., Genetic analysis of the epidermal differentiation

complex (EDC) on human chromosome 1q21: chromosomal orienta-

tion, new markers, and a 6-Mb YAC contig, Genomics 37 (1996)

295–302.

[18] J.A. Rothnagel, et al., Characterization of the mouse loricrin gene:

linkage with profillagerin and the flaky tail and soft coat mutant loci

on chromosome 3, Genomics 23 (1994) 450–456.

[19] H. Song, et al., Mouse Sprr2 genes: a clustered family of genes

showing differential expression in epithelial tissues, Genomics 55

(1999) 28–42.

[20] S. Aho, W.H.I. McLean, K. Li, J. Uitto, cDNA cloning, mRNA

expression, and chromosomal mapping of human and mouse peripla-

kin genes, Genomics 48 (1998) 242–247.

[21] M. Champliaud, R.E. Burgeson, W. Jin, H.P. Baden, P.F. Olson,

cDNA cloning and characterization of sciellin, a LIM domain protein

of the keratinocyte cornified envelope, J. Biol. Chem. 273 (1998)

31547–31554.

[22] A. Maatta, C. Ruhrberg, F.M. Watt, Structure and regulation of the

envoplakin gene, J. Biol. Chem. 275 (2000) 19857–19865.

[23] I. Marenholz, et al., Identification of human epidermal differentiation

complex (EDC)-encoded genes by subtractive hybridization of entire

YACs to a gridded keratinocyte cDNA library, Genome Res. 11

(2001) 341–355.

[24] C. Backendorf, D. Hohl, A common origin for cornified envelope

proteins? Nat. Genet. 2 (1992) 91.

[25] T. Komiya, Y. Tanigawa, S. Hirohashi, A large-scale in situ hybrid-

ization system using an equalized cDNA library, Anal. Biochem. 254

(1997) 23–30.

[26] G.T. Park, S.E. Lim, S.I. Jang, M.I. Morasso, Suprabasin, a novel

epidermal differentiation marker and potential cornified envelope pre-

cursor, J. Biol. Chem. 277 (2002) 45195–45202.

[27] S. Oomizu, et al., Kdap, a novel gene associated with the stratification

of the epithelium, Gene 256 (2000) 19–27.

[28] W.I. Al-Daraji, K.R. Grant, K. Ryan, A. Saxton, N.J. Reynolds, Lo-

calization of calcineurin/NFAT in human skin and psoriasis and inhi-

bition of calcineurin/NFAT activation in human keratinocytes by

cyclosporin A, J. Invest. Dermatol. 118 (2002) 779–788.

[29] T. Mehrel, et al., Identification of a major keratinocyte cell envelope

protein, loricrin, Cell 61 (1990) 1103–1112.

[30] M. Kozak, An analysis of 5V-noncoding sequences from 699 verte-

brate messenger RNAs, Nucleic Acids Res. 15 (1987) 8125–8148.

[31] J.E. Welch, E.C. Schatte, D.A. O’Brien, E.M. Eddy, Expression of a

glyceraldehyde-3-phosphate dehydrogenase gene specific to mouse

spermatogenic cells, Biol. Reprod. 46 (1992) 869–878.

[32] M. Sawzdargo, et al., A cluster of four novel human G protein-cou-

pled receptor genes occurring in close proximity to CD22 gene on


chromosome 19q13.1, Biochem. Biophys. Res. Commun. 239 (1997)

543–547.

[33] Y. Poumay, M.R. Pittelkow, Cell density and culture factors regulate

keratinocyte commitment to differentiation and expression of supra-

basal K1/K10 keratins, J. Invest. Dermatol. 104 (1995) 271–276.

[34] R. Waterson, et al., Initial sequencing and comparable analysis of the

mouse genome, Nature 420 (2002) 520–562.

[35] X.P. Zhao, J.T. Elder, Positional cloning of novel skin-specific genes

from the human epidermal differentiation complex, Genomics 45

(1997) 250–258.

[36] T.A. Lugar, T. Schwarz, The role of cytokines and neuroendocrine

hormones in cutaneous immunity and inflammation, Allergy 50

(1995) 292–302.

[37] T.S. Kupper, R.W. Groves, The interleukin-1 axis and cutaneous in-

flammation, J. Invest. Dermatol. 105 (1995) 62S–66S.

[38] J. Schroder, Cytokine networks in the skin, J. Invest. Dermatol. 105

(1995) 20S–24S.

[39] S. Gurrieri, et al., Differentiation-dependent regulation of secreted

phospholipases A2 in murine epidermis, J. Invest. Dermatol. 121

(2003) 156–164.

[40] R.L. Gallo, M. Murakami, T. Ohtake, M. Zaiou, Biology and clinical

relevance of naturally occurring antimicrobial peptides, J. Allergy

Clin. Immunol. 110 (2002) 823–831.

[41] T. Magnaldo, D. Fowlis, M. Darmon, Galectin-7, a marker of all types

of stratified epithelia, Differentiation 63 (1998) 159–168.

[42] P.M. Timmons, C. Colnot, I. Cail, F. Poirier, T. Magnaldo, Expression

of galectin-7 during epithelial development coincides with the onset

of stratification, Int. J. Dev. Biol. 43 (1999) 229–235.

[43] T. Magnaldo, F. Bernerd, M. Darmon, Galectin-7, a human 14-kDa S-

lectin, specifically expressed in keratinocytes and sensitive to retinoic

acid, Dev. Biol. 168 (1995) 259–271.

[44] M.S.H. Ko, An ‘equalized cDNA library’ by the reassociation of

short double-stranded cDNAs, Nucleic Acids Res. 18 (1990)

5705–5711.

[45] N. Takahashi, M.S.H. Ko, Toward a whole cDNA catalog: construc-

tion of an equalized cDNA library from mouse embryos, Genomics

23 (1994) 202–210.

[46] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by

acid guanidium thiocyanate –phenol– chloroform extraction, Anal.

Biochem. 162 (1987) 156–159.

[47] W. Ikeda, et al., Tage4/Nectin-like molecule-5 heterophilically trans-

interacts with cell adhesion molecule nectin-3 and enhances cell mi-

gration, J. Biol. Chem. 278 (2003) 28167–28172.

[48] T. Imai, et al., The T cell-directed CC chemokine TARC is a highly

specific biological ligand for CC chemokine receptor 4, J. Biol.

Chem. 272 (1997) 15036–15042.

identification of novel keratinocyte-secreted peptides dermokine-α/-β and a new stratified...

Documents