molecular cloning characterization human cardiac...

Molecular Cloning and Characterization of HumanCardiaca- and ,B-Form Myosin Heavy Chain Complementary DNAClonesRegulation of Expression during Development and Pressure Overload in HumanAtrium

Masahiko Kurabayashi, Hidetsugu Tsuchimochi, Issel Komuro, Fumimaro Takaku, and Yoshio YazakiThe Third Department of Internal Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113, Japan

Abstract

Wehave constructed and characterized two types of myosinheavy chain (MHC) cDNA clones (pHMHC2, pHMHC5)from a fetal human heart cDNA library. Comparison of thenucleotide and deduced amino acid sequences betweenpHMHC2and pHMHC5shows 95.1 and 96.2% homology,respectively. The carboxyl-terminal peptide and 3'-untrans-lated (3'-UT) regions are highly divergent and specific for thesecDNA clones. By using the synthetic oligonucleotide probesthat are complementary to the unique 3'-UT regions of thesecDNA clones, we demonstrate that pHMHC2is exclusivelytranscribed in the atrium, whereas the mRNAfor pHMHC5ispredominantly expressed in the ventricle. This result indicatesthat pHMHC2and pHMHC5code for a- and j-form MHCs,respectively. Furthermore, we show that ,-form MHCmRNAis expressed in adult atrium at a low level but scarcely ex-pressed in fetal atrium. Finally, we demonstrate that MHCisozymic transition in pressure-overloaded atrium is, at least inpart, regulated at a pretranslational level.

Introduction

Mammalian cardiac muscle cells contain at least two isozymesof myosin heavy chains (MHCs),' a- and f3-MHC, specifying asubunit of the high ATPase VI isomyosin and a component ofthe low ATPase V3 isomyosin, respectively (1-5). The myosinisozyme content of cardiac fiber is thought to affect contractileproperties (6); the changes in myosin isozyme compositionwere interpreted as an adaptation of myocardial cell to newfunctional requirements.

The distribution of cardiac myosin isozymes in the ventri-cle of small animals changes not only during normal develop-ment but also in response to thyroid hormone (7-11, 12, 13),insulin (14), or increased hemodynamic load (1 1, 15-17). Sofar, the ventricular a- and fl-MHC mRNAsequences and theircorresponding genes have been isolated and characterized inrat (18, 19) and rabbit (20, 21). From the observations in theseanimals, it has been shown that the two types of MHCsare

Address reprint requests to Dr. Masahiko Kurabayashi, The ThirdDepartment of Internal Medicine, Faculty of Medicine, University ofTokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113, Japan.

Receivedfor publication 18 September 1987 and in revisedform 17March 1988.

1. Abbreviations used in this paper: MHC,myosin heavy chain; 3'-UT,3'-untranslated region.

J. Clin. Invest.© The American Society for Clinical Investigation, Inc.0021-9738/88/08/0524/08 $2.00Volume 82, August 1988, 524-531

products of different genes and these two genes are organizedin tandem (19). That is, the ,B-MHC gene is located upstreamfrom the a-MHCgene. In addition, the MHCisozyme transi-tion in the hypertrophied ventricle is mainly regulated at thepretranslational level (22).

In man, however, in whom normal ventricular myosincontains ,B-MHC almost exclusively, myosin isozyme switchesfrom a- to fl-MHC do not or hardly contribute to adaptationto chronic hemodynamic overload (23). In a previous immu-nofluorescence study, we have shown the evidence of the tran-sition from a- to ,B-MHC in pressure-overloaded human atrialmuscle and suggested that myosin isozymic redistributionmight have a functional implication in the atrium (24). Re-cently, human a- and ,B-MHC genes have been isolated andpartially characterized (25). They have a similar genomic orga-nization to that seen in rat.

This study was undertaken to clarify the existence of MHCisozymes at the amino acid sequence level and to understandthe molecular basis of the MHCisozyme transition in pres-sure-overloaded human atrium. For this purpose, we have iso-lated and characterized human cardiac a- and fl-MHC mRNAsequences and analyzed their expression in normal and dis-eased human hearts. Wealso showed that the expression ofMHCisozyme is developmentally regulated.

Methods

Preparation and screening of a Xgtl l humanfetal heart cDNA library.Human fetal heart was kindly provided by Dr. K. Yoshida, Depart-ment of Obstetrics, San-ikukai Hospital, Tokyo, Japan. The heart wasstored at -70'C until use. RNAwas extracted by the LiCl methodessentially as described (26). Total polyadenylated RNAwas selectedby oligo(dT)-cellulose chromatography (27). Synthesis of the cDNAwas carried out using the method of Gubler and Hoffmann (28). Ap-proximately 1 ,ug of the cDNAwas used to construct a Xgtl 1 librarycontaining - 500,000 independent recombinant plaques. The librarywas screened with mouse a-MHCcDNAplasmid, pMHC101(29), asaprobe which was a generous gift from M. E. Buckingham, PasteurInstitute, Paris. Hybridization with 1 X 106 cpm/ml 32P-labeled cDNAwas performed at 42°C for 16-24 h in a solution containing 50%(vol/vol) formamide, 2X SSC (IX SSC is 150 mMNaCl and 15 mMsodium citrate), 5X Denhart's solution (I X Denhart's solution is 0.02%Ficoll, 0.02% polyvinylpyrrolidine, and 0.02% BSA), 0.1 %SDS, I mMEDTA, and 100 gg/ml salmon sperm DNA. Filters were washed to astringency of 0. IX SSCand 0.1 %SDSat 55°C and exposed for 24-48 hat -70°C to XAR-5 film. Positive recombinant phages were purifiedby sequential screening at low plaque density. Phage DNAwas purifiedaccording to Maniatis et al. (27). Eco RI-excised cDNA inserts weresubcloned into a plasmid vector pUCl 3 and characterized by restric-tion endonuclease mapping.

Nucleotide sequencing. Restriction fragments were subcloned intobacteriophage M13 mp18 and mp19 and sequenced by the dideoxynu-cleotide chain-termination method (30), using a universal sequencingprimer.

524 Kurabayashi et al.

Tissue sources. Northern blot analysis reported in this paper wasperformed on RNAsamples extracted from autoptic specimens ob-tained from one fetus, one adult patient without clinical and pathologi-cal evidence of heart disease, and nine adult patients with hypertro-phied atria. Fetal tissue was a specimen from a fetus that died as a resultof an induced abortion at 17 wk gestation. It had no evidence ofcardiac pathology. For the fetal heart, the total atrium and total leftventricle were used. For the analysis of diseased hearts, atrial tissue wasobtained from nine cardiac patients, whose pertinent information islisted in Table I. As a control specimen, normal heart was obtainedfrom a 27-yr-old womanwho died of breast cancer. In the adult hearts,tissue samples were excised from the anterior wall of the right atrium,the posterior wall of the left atrium, and the free wall of the left ventri-cle. All tissue samples obtained were frozen at -800C no later than 6 hpostmortem.

Preparation of synthetic oligonucleotide probes. Oligonucleotideswere synthesized by an oligonucleotide synthesizer (model 380A; Ap-plied Biosystems, Inc., Foster City, CA) and purified in a preparativedenaturing 15% polyacrylamide gel followed by DEAE-cellulose col-umnchromatography (31). The positions and sequences of oligonucle-otides on their corresponding mRNAsare presented in Fig. 2. Theprobes were labeled at the 5' end using T4 polynucleotide kinase to aspecific activity of 1-8 X 108 cpm/sg.

Northern blot technique with the oligonucleotide probes. Total cel-lular RNAwas prepared from human tissues by the LiCl method (26)and quantified by absorbance at 260 nm. Samples were denatured at650C for 10 min and size-separated by an 1.2% agarose formaldehydegel (31). The fractionated RNAwas then transferred to nylon mem-brane filters (Hybond N; Amersham Corp., Arlington Heights, IL) andhybridized for 16-24 h to 32P-labeled fl-MHC specific oligonucleotideprobe (specific activity > 1 X 108 cpm/,gg) at 370C in a solution con-taining 5X SSPE(0.9 MNaCl, 40 mMNaOH, 50 mMNaH2PO4, and5 mMEDTA), 5X Denhart's solution, 0.1% SDS, and 100 ;tg of soni-cated salmon sperm DNAper milliliter. The final hybridization washwas 2X SSC/0. 1% SDSat 50°C. Filters were then exposed to XAR-5film at -70°C, and densitometric scanning was performed. The filterswere subsequently stripped and rehybridized with a-MHC specificoligonucleotide probe and subjected to the same autoradiographic anddensitometric scanning process.

Table I. Sources of Cardiac Samples Examined

Hemodynamic data

Patient no. Age/Sex Mean PCW Mean RA Diagnosis

mmHg

I 26/F 13 4 MR2 20/M 6 14 TOF3 26/F 6 15 PPH4 46/F 13 10 MS, MR, TR5 43/M 20 12 MS, AR, TR6 70/M 18 6 AS, AR, MS, MR7 54/F 16 5 AR, MS, MR8 74/M 18 5 IHD9 25/M 10 11 PS, ASD

Control 27/F ND ND Breast cancer

Normal range <12 <6

Abbreviations used in this table: AR, aortic regurgitation; AS, aorticstenosis; ASD, atrial septal defect; IHD, ischemic heart disease; MR,mitral regurgitation; MS, mitral stenosis; PCW, pulmonary capillarywedge pressure; PPH, primary pulmonary hypertension; PS, pulmo-nary stenosis; RA, right atrial pressure; TOF, tetralogy of Fallot; TR,tricuspid regurgitation.

Indirect immunofluorescence technique. The MAbs we used in thisstudy were CMAl9 and HMC14, specific for a- and f3-MHC, respec-tively. These were obtained as previously described (24). Specimens ofhuman heart were obtained at autopsy from the patients with primarypulmonary hypertension (patient 3, Table I). Several blocks of cardiacmuscle were excised from the anterior wall of the right atrium and theposterior wall of the left atrium within 6 h postmortem. Indirect im-munofluorescence staining was performed according to the methodsdescribed previously (24).

Results

Identification of cardiac MHCcDNA clones. A cDNA libraryof 5 X l05 independent recombinants was constructed inthe vector Xgtl 1 by using 1 Mg of poly(A) RNAisolated fromfetal human heart. About 20,000 recombinants were screenedand 30 independent plaques were identified. The three cardiacMHCcDNA clones (pHMHC2, pHMHC4, and pHMHC5)that contain the long insert (> 1,000 bp) were selected forfurther analysis. Fig. 1 shows that pHMHC4and pHMHC5have identical restriction maps in regions in which they over-lap. They probably represent the same MHCmRNAse-quence. The third clone, pHMHC2, has several altered restric-tion enzyme sites, although substantial homology is presentbetween the two different cDNA sequences.

DNA sequence analysis. To establish unequivocally thattwo clones, pHMHC2and pHMHC5, contained MHCmRNAsequences, nucleotide sequences were determined bythe dideoxy method. Nucleotide and deduced amino acid se-quences are shown in Fig. 2. Clone pHMHC2consists of 1,644MHCmRNA-derived nucleotides coding for 532 amino acids,whereas pHMHC5contains 1,682 nucleotides coding for 524animo acids of MHC. Each clone encodes the light meromyo-sin portion of MHC, including the entire 3'-untranslated (3'-UT) region and a portion of the poly(A) tail. Direct compari-son of the DNAsequences of clone pHMHC2and pHMHC5demonstrates that these cDNAs are quite homologous, exhib-iting 95% nucleotide homology within the translated regions.However, we observed numerous nucleotide mismatcheswithin this region. In particular, 77 nucleotides out of 1,596compared in this study are divergent. These differences aresummarized in Table II, which includes percentages of silentand replacement site divergence. Compared with the generally

&aHC

pHMHC2

lMI

S VP P V P V B PVP S PI I I I I I5,-

4C

phifV P B V P V B PVP SPAP

5' 1 1 if 11f

3'

3'

S P VP V P B V P V B P VP S PAP

p S l l I0f lI I 3'

0 500 1000 1500

bp

Figure 1. Restriction map of cDNA inserts in clones pHMHC2,pHMHC4, and pHMHC5coding for a- and #-form MHCs. Themap is drawn to scale. The direction of translation is from left toright. Hatched rectangle, coding region. Open rectangle, 3Y-UT re-gions. Restriction endonuclease sites: S, Sst I; V, Pvu II; P, Pst I; B,Bgl I; A, Acc I.

Molecular Cloning of Human Cardiac Myosin Heavy Chain Messenger RNAs 525

i

21 :1

Gih Ala Val Asn Ala Lys Cys Ser Ser Leu Glu Lys Thr Lys His Arg Leu Gin Asn Glu Ile Glu Asp Leu let Val Asp Val Clu ArtGAG GCT GTT AAT GCC AAA TGC TCC TCA CTG GAG AAG ACC AAG CAC CGG CTA CAG AAT GAG ATA GAG GAC TTG ATG GTG GAC GTA GAG CGC 90

Scr Asn Ala Ala Ala Ala Ala Leu Asp Lys Lys GIn Arg Asn Phe Asp Lys Ile Leu Ala Glu Trp Lys Gin Lys Tyr Glu Glu Ser GinTCC AAT GCT GCT GCT GCT GCT CTG GAC AAG AAG CAG AGG AAC TTT GAC AAG ATC CTG GCC GAG TGG AAG CAG AAG TAT GAG GAG TCG CAG 180

-~~~~~~~~~~~~~~-C-

Ser Glu Leat Glu Ser Ser Gin Lys Glu Ala Arg Ser Lesi Ser Thr Clu Lett Phe Lys LoU Lys Asn Ala Tyr Glit Glu Ser Lei Glu HisTCT GAG CTG GAG TCC TCA CAG AAG GAG GCT CGC TCC CTC AGC ACA GAG CTC TTC AAG CTC AAG AAC GCC TAC GAG GAG TCC CTG GAGCAC 270--G - -G---A --- --- --- --- --T ---A --T

Lett Glu Thr Phe Lys Arg Glu Asn Lys Asn Lett Cin Glu Clu lie Ser Asp Leu Thr Glu Gin Leu Gly Glu Gly Gly Lys Asn Val HisCTA GAG ACC TTC AAG CGG GAG AAC AAG AAC CTT CAG GAG GAA ATC TCG GAC CTT ACT GAG CAG CTA GGA GAA GGA GGA AAG AAT GTG CAT 360--- --A --- G --- --- -- --C --- T-G --- --- --- T-G --T TCC A-C --- --- -C- H-C------ --- --- --- --- ------ --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- Ser Arg --- --- Thr lle

Glu Leu Glu Lys Val Arg Asn Gin Leu Glu Val Glu Lys Met Glu Lsu Gin Ser Ala Leu Glu Glu Ala Glu Ala Ser Leu Glu His Cl IGAG CTG GAG AAG GTC CGA AAC CAG CTG GAG GTG GAG AAG ATG GAG CTG CAG TCA GCC CTG GAGGAG GCA GAG GCC TCC CTG GAG CAC GAG 450---- -- --- -- C- CC -C-

--- --- --- --- --- --- Lys -Ala --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

Clu Gly Lys lie Leat Arg Ala Gin Leu Glu Phe Asn Gin lie Lys Ala Glu Ile Glu Arg Asn Val Ala Glu Lys Asp Gln Glu Het GlnGAG GGC AAG ATC CTC CCG GCC CAG CTA GAG TTC AAC CAG ATC AAG GCA GAG ATC GAG CGG AAC GTG GCA GAG AAG GAC GAG GAG ATG GAA 540

-6~~~~~~~~-G

Gin Ala Lys Arg Asn His Gin Arg Val Val Asp Ser Leu Gin Thr Ser Leu Asp Ala Glu Thr Arg Ser Arg Asn Clu Val Leu Art ValCAG GCC AAG CGC AAC CAC CAG CGG GCT GTG GAC TCG CTG CAG ACC TCC CTG GAT CCA GAG ACA CGC AGC CGCAAC GAG GTC CTG AGG GTG 630

--- ------ ------ ----T- -- -.------------------C --- --- --- --- --- --- --- --- - C---------- --- --- --- --- --- Le-Ala --- --- ---

Lys Lys Lys Met Glu Gly Asp Leu Asn Glu Met Glu Ile Gin Leu Ser His Ala Asn Arg Met Ala Ala Glu Ala Gin Lys Gin Val LysAAG AAC AAG ATG GAA GGA GAC CTC AAT GAG ATG GAG ATC CAC CTC AGC CAC CCC AAC CCC ATG GCT GCC GAG CCC CAG AAC CAA GTC AAG; ?20

-~~~~~~~~~~~~~~~~~~~~~~-C-

Ser Leu Gin Ser Leu Leu Lys Asp Thr Gin Ile Gin Leu Asp Asp Ala Val Arg Ala Asn Asp Asp Leu Lys Glu Asn Ile Ala Ile ValACC CTC CAG ACC TTI CTC AAG CAC ACCCAC ATC COG CTG COC GAT GCG GTC CCT CCC AAC CAC GAC CTG AAG GAG AAC ATC CCC ATC GTG 810

--- ----- -- ---T-- -- ---- ----T -- ---- ----A----------------------------

Glu Arg Arg Asn Asn Lea Leu Gin Ala Glu Leu Glu Glu Leu Arg Ala Val Val Glu Gin Thr Glu Arg Ser Arg Lys Leu Ala Glu GInGAG CGG CCC AAC AAC CTG CIT( COG CCT CAG CTG GAG GAG TTG CCC CCC CTG GTG GAG CAG ACC GAG CCG TCC CCG AAG CTG GCG COG CAG 900

.H.--- --- --- --- --- --A.

Glu Leu Ile Glu Thr Ser Glu Arg Val Gin Leu Leu His Ser Gin Asn Thr Ser Leu Ile Asn Gin Lys Lys Lys Met Asp Ala Asp LeuGAG CTG ATT CAG ACT ACT GAG CCC GTG CAG CTG CTG CAT TCC CAG AAC ACC ACCCTC ATC AAC CAG AAG AAG AAG ATC CAT GCT GAC CTG 910

C -C

Ser Gin Leu GIn Ser Glu Val Glu Clu Ala Val Gin Glu Cys Arg Asn Ala Glu Glu Lys Ala Lys Lys Ala Ile Thr Asp Ala Ala MetTCC CAG CTC CAG TCCCAA GTC GAG CAG CCA GTG CAG CAG TGC AGO AAC CCC COA GAC AAG CCC AAC AAG GCC ATC ACC CAT GCC CCC A07 1000------ --- --- A-T -C --T --T---

- --- --- ---Thr-

Met Ala Clu Glu Lea Lys Lys Glu Gin Asp Thr Sar Ala His Leun lu Arg Met Lys Lys Asn Met Glu Gin Thr lie Lys Asp Leu GinATG GCCAGCOGA CTC HOG HAG GAGCAGGACACC 0CC CCC CAC CTG GAG CCC ATG AAG AAG AAC ATG CAG CAG ACC ATT AAG CAC CTG CAG 1170

-o-.---- --- --- --- --- --- --- --- --- --- --- --A Figure 2. Nucleotide and deducedamino acid sequences of pHMHC2

His Arg Leii Asp GIu Ala Glu Gin Ile Ala Leu Lys Gly Gly Lys Lys Gin Leu Gin Lys Leu Clu Ala Art Val Art Glu LusluG Gly and pHMHC5. Nucleotides are num-CAC CCC CTG GAC GAG GCC CAG CAG ATC CCC CTC AAG CCC CCC AAG AAG CAG CTG CAG AAG CTGCOO CCCCCC GTG CGC COG CTG CAG GGT 1260 bered to the right of each line. Line 1,

-H~~ ~~~~~~~~~~~~~~~~~~~~~~~asnamino acid sequence of pHMHC2;Line 2, nucleotide sequence of

Glu Leu GIit Ala GInu Gin Lys Art Asn Ala CIii Ser Val Lys Gly Mat Arg Lys Ser CIiit Art Art le Lys ClIi Leat Thr Tyr Gin Thr pHMHC2; Line 3, nucleotide se-GAG CTC GAC CCC CAG CAG AAG CGC AAC GCA CAG TCC GTG AAG CGC ATG AGC AAG ACC GAG CCC CCC ATC AAG CAG CTC ACC TAC CAG ACA 1350

,; quence of pHMHC5;and Line 4,amino acid sequence of pHMHC5.Nucleotides and amino acids are writ-

GIu GIin Asp Lys Lys Asn Leu Leu Art Leu Gln Asp Leu Val Asn Lys Leu Gin Leu Lys Hal Lys Ala Tyr Lys Gly Gin Ala lu Gi liGAG COAG AC AAAAA0 AAC CTC CTG CCC CTG CAG GAC CTC GTA AAC AAG CTC CAA CTC AAHG GC AAG rCC TAC AAG CCC CGCGCCCAA GCG 1440 ten only where different from that of--- --- --- -CC----A-C- C --- C-- --- pHMHC2. The dashed line indicates--- --- --- Art-Asp- Arg-an identical sequence to that of

Ala CGii CIii Arg Ala Asn Thr Asn Leu Ser Lys Phe Arg Lys Val Gin His Glu Leu Asp Clu Ala Glu CluArG Ala Asp lie Ala Glu pHMHC2. The underlined 26 basesCCC GAG GAG CCA CCC AAC ACC AAC CTG TCC AAG TTC CCc AAG GTC CAG CAT CAG CTG GAT CAG GGOCAGCOGCCCCCC CGAOTC GCT CAG 1530 represent the complementary se-----C-- A- --- --- --- --- --- --- --- --- --- --- --- --- -- - quences of the oligonucleotides syn-

-Gin-thesized for probes. Wavy lines indi-

Ser Gin Val Asn Lys Leu Arg Ala LYs Ser Are Asp lie Gly Ala Lys Lys Met His Asp Glu Glu END cate the polyadenylation signal se-TCC CAG GIC HOCAAG CTT CCA GCC AA0 ACC CGT CGAC ATT 66T CCC AAG AAA ATC CAC CAT CAG CAG TGA CACTCCCTCCCGAACCTCACTCCTGf1619--- --- --- --- --- --C --G-C-GC-C A-C - CCC -- A-T --C --- T-- CTT TG-CG-A--TT--T-TC-T-A--GCC quence. Shaded boxes show bases

--- -- --- --- ------ --- --- --- --- --- --- --- --- Thr --- Gly Leu Asn Glu --- END different from the nucleotide se-

CCAACCT(;TAATAAATATGAGTGCCC()nquences reported by M. A. Jandreski

TG-GGTCC-(C- --GCCCCA---TGGAGCCTCTrTAACATCTcrCCTTGcrCAOCAAGCACAATAOAGCAATTTCCTTGAACCCG(A)n et al. (33).


Table II. Nucleotide and Amino Acid Sequence Comparison of HumanCardiac a-MHC(pHMHC2) to Humanf3-(pHMHC5),Rat a-(pCMHC21), and Rat Wl-(pCMHC5) MHCs

Homology in coding region NucleotideConservative Nonconservative homology in

MHCcDNAclone Nucleotide Amino acid nucleotide change nucleotide change 3-UT region

% n %

pHMHC5 95.1 96.2 44 33 32.7pCMHC21 90.8 93.2 74 40 66.1pCMHC5 91.8 95.4 75 27 34.0

Percentages of overall nucleotide and amino acid sequence homology were calculated by aligning the analogous region in such a way as to max-imize homology and minimize the number of deletion. Sequences of rat ventricular MHCsare from Mahdavi et al. (18).

high levels of homology observed for the translated sequencesof pHMHC2and pHMHC5, the corresponding 3'-UT regionsshow extensive sequence divergence. Alignment of DNAse-quences to obtain maximum homology reveals the 3'-UT re-gions of pHMHC2and pHMHC5to be at least 67%divergent.However, when the pHMHC2cDNA clone was comparedwith the previously described a-form MHCcDNAclones fromrat (Table II, reference 18), rabbit (20), significant homologywas seen among the 3'-UT regions. Similar results were ob-tained when pHMHC5was compared with the ,8-form MHCcDNAclones from other species (data not shown).

Expression of pHMHC2and pHMHC5during develop-ment. Since the nucleotide sequences of pHMHC2andpHMHC5are highly homologous, it is difficult to identify thespecific MHCmRNAexpressed in different muscle types at aparticular stage of development by RNAblot analysis usingcDNA coding sequence. To overcome these difficulties, syn-thetic oligonucleotide probes complementary to the unique3'-UT regions of pHMHC2and pHMHC5were used inNorthern blot analysis. Fig. 3 examines the expression of the

pHMHC2and pHMHC5mRNAin several muscle tissues atfetal and adult stages. The strong hybridization of fetal andadult ventricular RNAs with pHMHC53'-UT region probeindicates that the major MHCmRNAin the ventricle in bothfetal and adult life must be that which contains the same 3'-UTregions as pHMHC5. Therefore, the mRNArepresented bypHMHC5is not preferentially fetal specific. This conclusion isfurther reinforced by the fact that MHCcDNAclones isolatedfrom an adult ventricular cDNA library (33) have identicalnucleotide sequence to that of pHMHC5, including 3'-UT re-gions, except for three nucleotide mismatches (nucleotide po-sitions 513, 567, and 1,068 in Fig. 2). Nucleotide position 513is a replacement change and nucleotide changes of positions567 and 1,068 are silent. Three single-base differences in thecoding region may result from sequencing or enzymatic errorsduring the construction of the library. Since we have se-quenced this region three times, it seems more likely that amisreading of reverse transcriptase may be responsible forthose differences. An alternative explanation for the sequencedifference might be that the f3-MHC gene occurs as an allelic

A pHMHC2

MHC-w

.-0 4ai 4*0 4'oczpQ M B pHMHC5

4-* 4.' 4-.a 'a

00g

..wF

... _1 2345

Figure 3. Autoradiographs of Northern blot showing the tissue andstage specificity of pHMHC2and pHMHC5specific probes. Hybrid-ization of (A) 32P-labeled pHMHC23'-UT or (B) pHMHC53'-UToligonucleotide probes to Hybond N membranes containing humanmuscle RNAwas performed. 10 ,ug of total RNAwas loaded in each

3' probe - - , , *

*0 * =0 nW = =

MHC- s-

1 2345

lane. The MHCmRNAband is marked on the side of the figure(MHC). Lane 1, RNAisolated from fetal atrium. Lane 2, RNAiso-lated from fetal ventricle. Lane 3, RNAisolated from adult leftatrium. Lane 4, RNAisolated from adult left ventricle. Lane 5, RNAisolated from adult psoas muscle.

Molecular Cloning of HumanCardiac Myosin Heavy Chain Messenger RNAs 527

3 probe -

coG)G).U0 a

4-0 G.-M 4-0 4.0 ACoc :00 oc >0 cn

variant in some individuals. Further investigations are neededto determine the reason for these differences. Compared withthe pHMHC5probe, fetal and adult ventricles show very little,if any, hybridization with pHMHC2probe. This indicates thatpHMHC2mRNAis expressed at a low level, if at all, in theventricle in both fetal and adult life.

In the atrium, however, the extent of hybridization withthe two probes differs between fetal and adult tissues. TheRNAthat is complementary to pHMHC2remains the mainform, whereas that which is complementary to pHMHC5isapparently detected only in adult atrial muscle. Here, we ob-serve that differential accumulation of mRNArepresented bypHMHC5occurs during atrial muscle development. WhenmRNAfrom the skeletal muscle, such as psoas muscle, ishybridized with both probes, we observe that this contains thepHMHC5mRNA,but not the pHMHC2mRNA.These datacorrelate very well with the presence of a- and A-form MHCs.Therefore, together with the result of nucleotide sequence, weconclude that pHMHC2and pHMHC5represent a- and fi-form MHCsequences, respectively. Sequence analysis stronglysuggests that a- and fl-MHCs are products of different genesrather than differential splicing of a transcript from a singlegene, since sequence divergence and restriction map differ-ences are distributed throughout the clones.

Expression of pHMHC2and pHMHCSin diseasedatrium. Northern blot analyses were used to characterize ex-pression of a- and fl-MHC genes in pressure-overloadedhuman atria and to assess the relative amounts of both a- andfl-MHC mRNAsin diseased atria compared with normal atria.As shown in Table I, the right atria of patients 1, 6, 7, and 8,and the left atria of patient 3 were normal pressure chambers.The right atria of patients 2, 3, 4, 5, and 9 and left atria ofpatients 1, 4, 5, 6, 7, and 8 were pressure-overloadedchambers. Although cardiac catheterization was not per-formed on the control patient, she was considered to havenormal atria on the basis of clinical and pathological findings.Wethus analyzed 7 normal and 11 pressure-overloaded atriain this study. RNAprepared from atria subjected to normaland elevated pressure load was hybridized with oligonucleo-tide probes specific for the mRNAencoding a- or fl-MHC. Asdemonstrated in Fig. 4, all the pressure-overloaded atria hadan increased fl-MHC mRNAcontent compared with the con-trol atrium. When the blots were analyzed by densitometry,the difference of fl-MHC mRNAcontent between the normaland pressure-overloaded atria was statistically significant (100vs. 247.9±32.3% SEM; P < 0.01, Fig. 5). In contrast to theincrease of f3-MHC, the expression of a-MHCmRNAin pres-sure-overloaded atria was significantly lower than that in nor-mal atria (100 vs. 34.7±6.3% SEM; P < 0.001, Fig. 5). Thesefindings indicated that fl-MHC gene is up-regulated anda-MHCgene is down-regulated by pressure overload.

To ascertain whether the changes in the pHMHC2andpHMHC5mRNAlevel under the pressure-overloaded condi-tion are reflected in the MHCprotein phenotype, the degree oftransition analyzed by Northern blot was compared with thatvisualized by antimyosin immunofluorescence in the tissuesection obtained from the same patient, since pyrophosphategel analysis failed to separate individual isozymes of humancardiac myosin. Immunofluorescence procedure was per-formed on the cryostat section of the right and left atria from

75C

o 1 2 3 4

R L R L R R L R L

fi-MHC -

a-MHC-

fi-MHC -

o 5 6 7 8 9RR L R LRL RLr RRRL R L R L ~~~~~~~~~~RL R

a-MHC--*r

Figure 4. Detection of a- and f3-MHC mRNAin total cellular RNAfrom normal and diseased human atria. The same RNAblot was se-

quentially hybridized with labeled oligonucleotides specific for,B-MHC mRNAand exposed for 24 h; a-MHCmRNAwas exposedfor 24 h. Normal atrial RNAcontrols are shown in the left lanes ofthe figures. The lanes containing 10 jig right (R) and left (L) atrialRNAfrom patients 1-9 are indicated. The MHCmRNAband ismarked on the side of the figures (,B-MHC, a-MHC).

atrium were strongly reactive with anti-fl-MHC antibody andmost of them were unreactive with anti-a-MHC antibody.The left atrium showed a moderate degree of redistribution.Although we determined only semiquantitative amounts of a-

and ,B-MHC proteins by immunofluorescence study, these re-

sults are consistent with the observations in Northern blot.Changes in a- and f,-MHC mRNAlevel thus seem to be asso-

ciated with corresponding changes in the relative proportion ofMHCprotein.

at

,O-MHC

0<0.01

patient No. 3. As shown in Fig. 6, all myocytes in the right

Figure 5. Steady state mRNAcontentfor a- and j3-MHCs in normal (N)and pressure-overloaded (P) atria.Data from each group are presented

a-MHC as mean±SEM. mRNAcontent ineach atrium was quantitated bymeans of densitometric analysis ofautoradiograms of Northern blots hy-bridized with the appropriate 32P-la-beled probes as described in Methods.

P<0.OO1 Results are expressed as percentage ofm7 values in normal atria. A t test indi-

cated that the fl-MHC mRNAlevelwas significantly higher and thea-MHCmRNAlevel was signifi-

N / cantly lower in pressure-overloaded7 11 atria compared with normal atria.


SIM- I a W.I.Itf

Figure 6. Indirect immunofluorescence staining of the left and rightatrium from the patient with primary pulmonary hypertension (pa-tient 3). (A) Cryostat section of left atrium stained with CMA19.Most myofibers are labeled. (B) As in A, except that the myofibersare stained with HMC14. The heterogeneous pattern of reactivity

Discussion

Wehave now isolated and sequenced human a- and 13-MHCcDNAclones and used them to examine the tissue distributionand developmental regulation of their gene expression. Thisinvestigation also indicates that a- and fl-MHC genes are regu-lated by pressure overload in human atria.

The successful cloning of a- and ,3-MHC cDNAs has es-tablished the existence of the two molecular variants in humanheart. Comparison of the nucleotide sequences between a- andf3-MHC cDNAclones reveals striking homology (96%). Apartfrom the human cardiac cDNAsequences described above, theavailable cardiac MHCsequence data are from rat (18), rabbit(20), and mouse (29). The sequence homology between widelyseparated species extends into the 3'-UT regions, when com-pared with the same MHCisotypes. These data provide evi-dence of isotype-specific preservation of MHC3'-UT regionsduring evolution. It may have interesting implications for boshMHCgene regulation and evolution, as postulated by Saez etal. (34).

It is well documented that the ratio of the different ventric-ular MHCisozymes is developmentally regulated in small an-imals. In rat and mouse, fl-MHC is the most abundant myosinin late fetal life. After birth, a-MHC increases and becomes thepredominant form throughout perinatal and adult life (8). Incomparison, in larger mammals, including humans, previous

was seen. (C) Cryostat section of right atrium stained with CMA19.Only a small number of fibers are labeled. (D) As in C, except thatthe myofibers are stained with HMC14. Note that almost all myo-fibers are strongly labeled.

investigations failed to detect any physical difference betweenfetal and adult ventricular MHC(35, 36). The results of ourNorthern blot strongly suggest that the same f3-MHC gene isexpressed in both fetal and adult ventricles, which supports theidea that fetal and adult fl-MHCs are indistinguishable inhuman, as is the case with other mammals. The interspeciesvariation in the relative amount of cardiac myosin isozymes inadulthood may be due to species-dependent regulatory mecha-nisms in the expression of a- and ,B-MHC genes. The inductionof ,-MHC gene expression in pressure-overloaded atria sug-gests that adaptation of the adult human atria to mechanicalstress is mediated by the expression of the same #l-MHC genethat is predominantly expressed in both fetal and adult ventri-cles. However, it is possible for distinct genes to have nearlyidentical coding and noncoding sequences. Furthermore, it isalso possible that the same gene is differently transcribed, ei-ther by alternative splicing or by different promoter use.

Recently, analysis of the mRNAsequences in atrial muscleof rat (8) and rabbit (37) hearts by S1 nuclease mapping hasshown that atrial a-MHC mRNAis indistinguishable fromventricular a-MHCmRNAin the 3'-UT regions and in a num-ber of coding regions. It thus has been strongly suggested thatatrial and ventricular a-MHC mRNAsare encoded by thesame gene. However, the relationship between the structure ofthe f3-MHC present in the atrium and ventricle of large ani-mals that contain a relatively large amount of ,B-MHC in the


atrium has not been established. The results of the Northernblot in this experiment indicate that the same fl-MHC gene isexpressed in both atrium and ventricle. In our previous work,f3-MHC in the atrium is indistinguishable from that in theventricle in peptide composition and enzymatic activities incanine heart (38). The results presented here provide consis-tent evidence with that of our previous work.

Although much evidence has been accumulated about thechanges in the MHCisozyme composition in the ventricle,isomyosin redistribution in the atrium has not been demon.strated in sufficient detail. Previous studies indicate that eachmember of the MHCmultigene family can be regulated bythyroid hormone in highly different modes, depending on themuscle in which it is expressed (39). For example, expressionof the a-MHCgene is apparently independent of thyroid hor-mone in the atrium but highly dependent on thyroid hormonein the ventricle. Studies described by Izumo et al. (22) demon-strated that the MHCisozyme transition during hemodynamicoverload in the rat ventricle is produced by changes in the levelof a- and ,3-MHC gene expression. One of the important im-plications in our study centers on whether a- and 13-MHCgenes in the human atrium also respond to hemodynamic loadin the same fashion as that seen in the hypertrophied rat ven-tricle. The result of comparative examination by Northern blotand immunofluorescence staining, changes in the a- and13-MHC mRNAlevel, are in a large part reflected by thechanges in their respective proteins. Although immunofluores-cence staining is not quantitative, translational and posttrans-lational mechanisms, if present, do not appear to play a majorrole in the production of the MHCisozyme switches in re-sponse to hemodynamic overload.

From the data presented here, the following importantquestion remains to be answered. What is the biochemicalsignal that regulates the a- and ,3-MHC gene expression in thepressure-overloaded condition? It has been shown that there isan induction of expression of the ventricular type myosin al-kali light chain isoform in hypertrophied human atria (40).Significant evidence has been accumulated to suggest that se-quences in the 5' flanking regions are important for the regula-tion of transcription. Gustafson et al. (41) have identified the 5'flanking sequences responsible for the induction by thyroidhormone in the rat a-MHCgene. Furthermore, Saez et al. (25)have shown that the 5' flanking sequences of rat and humana-MHCgenes are highly homologous. To define the gene regu-lation in cardiac hypertrophy, studies of a number of muscle-specific genes whose expressions are altered by pressure over-load may provide some information that will help to identifythe sequences in the 5' flanking regions that are important forthe regulation of transcription in the pressure overloaded con-dition.

In conclusion, the data presented here define the mRNAsequences coding for a- and Wl-MHCs in fetal human heart.This investigation has shown that fetal and adult ventricular,B-MHCs are products of the same gene and this is true fora-MHCs present in both stages. The f3-MHC gene is also ex-pressed in the adult atrium and skeletal muscle. Finally, wehave demonstrated that MHCisozyme transition seen in pres-sure overloaded atrium is produced by the increase in f3-MHCmRNAand corresponding decrease in a-MHCmRNA.

AcknowledgmentsWeare grateful to Dr. M. E. Buckingham and Dr. A. Weydert for thegenerous gift of the mouse a-MHC cDNA clone and also to Drs. Y.

Shibasaki and H. Hirai for their help during the course of our experi-ment.

This investigation was supported in part by a grant-in-aid for Scien-tific Research from the Ministry of Education, Science, and Culture ofJapan, grants from the Ministry of Welfare, and from a research work-shop on cell calcium signals in the cardiovascular system.

References

1. Hoh, J. F. Y., P. A. McGrath, and H. T. Hale. 1978. Electropho-retic analysis of multiple forms of rat cardiac myosin. Effect of hypo-physectomy and thyroxine replacement. J. Mol. Cell. Cardiol.10:1053-1076.

2. Yazaki, Y., and M. S. Raben. 1974. Cardiac myosin adenosine-triphosphatase of rat and mouse: distinctive enzymatic propertiescompared with rabbit and dog cardiac myosin. Circ. Res. 35:15-23.

3. Yazaki, Y., S. Ueda, R. Nagai, and K. Shimada. 1979. Cardiacatrial myosin adenosine triphosphatase of animals and humans: dis-tinctive enzymatic properties compared with cardiac ventricular myo-sin. Circ. Res. 45:522-527.

4. Lompre, A.-M., J. J. Mercadier, C. Wisnewsky, P. Bouveret, C.Pantaloni, A. D'Albis, and K. Schwartz. 1981. Species and age-depen-dent changes in the relative amounts of cardiac myosin isoenzymes inmammals. Dev. Bio. 84:286-290.

5. Clark, W. A., Jr., R. A. Chizzonite, A. W. Everett, M. Rabino-witz, and R. Zak. 1982. Species correlations between cardiac isomyo-sins. A comparison of electrophoretic and immunological properties.J. Biol. Chem. 257:5449-5454.

6. Schwartz, K., Y. Lecarpentier, J. L. Martin, A.-M. Lompre, J.-J.Mercadier, and B. Swynghedaw. 1981. Myosin isoenzymic distribu-tion correlates with speed of myocardial contraction. J. Mol. Cell.Cardiol. 77:220-234.

7. Yazaki, Y., and M. S. Raben. 1975. Effect of thyroid state on theenzymatic characteristic of cardiac myosin: a difference in behavior ofrat and rabbit cardiac myosin. Circ. Res. 36:208-215.

8. Lompre, A.-M., B. Nadal-Ginard, and V. Mahdavi. 1984. Ex-pression of the cardiac ventricular a- and ,-myosin heavy chain genesis developmentally and hormonally regulated. J. Biol. Chem.259:6437-6446.

9. Hoh, J. F. Y., and L. J. Egerton. 1979. Action of triiodothyro-nine on the synthesis of rat ventricular myosin isoenzymes. FEBS(Fed. Eur. Biochem. Soc.) Lett. 101:143-148.

10. Chizzonite, R. A., A. W. Everett, W. A. Clark, S. Jakovcic, M.Rabinowitz, and R. Zak. 1982. Isolation and characterization of twomolecular variants of myosin heavy chains from rabbit ventricle:changes in their content during normal growth and after treatmentwith thyroid hormone. J. Biol. Chem. 257:2056-2065.

11. Litten, R. Z., B. J. Martin, R. B. Low, and N. R. Alpert. 1982.Altered myosin isozyme patterns from pressure-overloaded and thyro-toxic hypertrophied rabbit hearts. Circ. Res. 50:856-864.

12. Everett, A. W., W. A. Clark, R. A. Chizzonite, and R. Zak.1983. Change in synthesis rates of a- and (3-myosin heavy chains inrabbit heart after treatment with thyroid hormone. J. Biol. Chem.258:2421-2425.

13. Flink, I. L., J. H. Rader, and E. Morkin. 1979. Thyroid hor-mone stimulates synthesis of a cardiac isozyme. J. Biol. Chem.254:3105-3110.

14. Dillman, W. H. 1982. Influence of thyroid hormone adminis-tration on myosin ATPase activity and myosin isoenzyme distributionin the hearts of diabetic rats. Metab. Clin. Exp. 31:199-204.

15. Lompre, A.-M., K. Schwarz, A. D'Albis, G. Lacombe, N. VanTheim, and B. Swynghedaw. 1979. Myosin isoenzymca redistributionin chronic heart overload. Nature (Lond.). 282:105-107.

16. Mercadier, J.-J., A.-M. Lompre, C. Wisnewsky, J. L. Samuel, J.Bercovici, B. Swynghedaw, and K. Schwartz. 1981. Myosin isoenzy-mic changes in several models of rat cardiac hypertrophy. Circ. Res.49:525-532.


17. Gorza, L., J. J. Mercadier, K. Schwartz, L. E. Thornell, S.Sartore, and S. Schiaffino. 1984. Myosin types in the human heart: animmunofluorescence study of normal and hypertrophied atrial andventricular myocardium. Circ. Res. 54:694-702.

18. Mahdavi, V., M. Periasamy, and B. Nadal-Ginard. 1982. Mo-lecular characterization of two myosin heavy chain genes expressed inthe adult heart. Nature (Lond.). 297:659-665.

19. Mahdavi, V., A. P. Chambers, and B. Nadal-Ginard. 1984.Cardiac a- and ,3-myosin heavy chain genes are organized in tandem.Proc. Natl. Acad. Sci. USA. 81:2626-2630.

20. Sinha, A. M., P. K. Umeda, C. J. Kavinsky, C. Rajamanickam,H.-J. Hsu, S. Jakovcic, and M. Rabinowitz. 1982. Molecular cloning ofmRNAsequences for cardiac a and , myosin heavy chains: expressionin ventricles of normal, hypothyroid and thyrotoxic rabbits. Proc. Natl.Acad. Sci. USA. 79:5847-5851.

21. Friedman, D. J., P. K. Umeda, A. M. Sinha, H.-J. Hsu, S.Jakovcic, and M. Rabinowitz. 1984. Characterization of genomicclones specifying rabbit a- and f3-ventricular myosin heavy chains.Proc. Natl. Acad. Sci. USA. 81:3044-3048.

22. Izumo, S., A.-M. Lompre, R. Matsuoka, G. Koren, K.Schwartz, B. Nadal-Ginard, and V. Mahdavi. 1987. Myosin heavychain messenger RNAand protein isoform transition during cardiachypertrophy: interaction between hemodynamic and thyroid hor-mone-induced signals. J. Clin. Invest. 79:970-977.

23. Mercadier, J. J., P. Bouveret, L. Gorza, S. Schaffino, W. A.Clark, R. Zak, B. Swynghedaw, and K. Schwartz. 1983. Myosin isoen-zymes in normal and hyprertrophied human ventricular myocardium.Circ. Res. 53:52-62.

24. Tsuchimochi, H., M. Sugi, M. Kuro-o, S. Ueda, F. Takaku, S.Furuta, T. Shirai, and Y. Yazaki. 1984. Isozymic changes in myosin ofhuman atrial myocardium induced by overload: immunohistochemi-cal study using monoclonal antibodies. J. Clin. Invest. 74:662-665.

25. Saez, L. J., K. M. Gianola, E. M. McNally, R. Feghali, R. Eddy,T. B. Shows, and L. A. Leinwand. 1987. Humancardiac myosin heavychain genes and their linkage in the genome. Nucleic Acids Res.15:5443-5459.

26. Clemens, M. J. 1984. Purification of eukariotic mRNA. InTranscription and Translation. B. D. Hamesand S. J. Higgins, editors.IRL Press, Washington, DC. 211-220.

27. Maniatis, T., E. P. Fritsch, and J. Sambrook. 1982. MolecularCloning: A Laboratory Manual. Cold Spring Harbor Laboratory, ColdSpring Harbor, NY.

28. Gubler, U., and B. J. Hoffman. 1983. A simple and very effi-cient method for generating cDNA libraries. Gene (Amst.). 25:263-269.

29. Weydert, A., P. Daubas, I. Lazaridis, P. Barton, I. Garner, D. P.Leader, F. Bonhomme, J. Catalan, D. Simon, J. L. Guenet, F. Gros,

and M. E. Buckingham. 1985. Genes for skeletal muscle myosin heavychains are clustered and are not located on the same mouse chromo-some as a cardiac myosin heavy chain gene. Proc. Natl. Acad. Sci.USA. 82:7183-7187.

30. Gupta, K. C., and D. W. Kingsbury. 1984. Complete sequencesof the intergenic and mRNAstart signals in the Sendai virus genome,homologies with the genome of vesicular stomatitis virus. NucleicAcids Res. 12:3829-3841.

31. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNAse-quencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA. 74:5463-5467.

32. Lehrach, H., D. Diamond, J. M. Wozney, and H. Boedtker.1977. RNAmolecular weight determination by the gel electrophoresisunder denaturing conditions, a critical examination. Biochemistry,16:4743-4751.

33. Jandreski, M. A., and C.-C. Liew. 1987. Construction of ahuman ventricular cDNA library and characterization of a beta myo-sin heavy chain cDNAclone. Hum. Genet. 76:47-53.

34. Saez, L., and L. A. Leinwand. 1986. Characterization of diverseforms of myosin heavy chain expressed in adult human skeletal mus-cle. Nucleic Acids Res. 14:2951-2969.

35. Schier, J. J., and R. S. Adelstein. 1982. Structural and enzy-matic comparison of human cardiac muscle myosin isolated frominfants, adult, and patients with hypertrophic cardiomyopathy. J. Clin.Invest. 69:816-825.

36. Tobacman, L. S., and R. S. Adelstein. 1984. Enzymatic com-parisons between light chain isozymes of human cardiac myosin sub-fragment-1. J. Biol. Chem. 259:11226-11230.

37. Sinha, A. M., D. J. Friedman, J. M. Nigro, S. Jakovcic, M.Rabinowitz, and P. K. Umeda. 1984. Expression of rabbit ventricular,-myosin heavy chain messenger RNAsequences in atrial muscle. J.Biol. Chem. 259:6674-6680.

38. Komuro, I., H. Tsuchimochi, S. Ueda, M. Kurabayashi, Y.Seko, F. Takaku, and Y. Yazaki. 1986. Isolation and characterizationof two isozymes of myosin heavy chain from canine atrium. J. Biol.Chem. 261:4504-4509.

39. Izumo, S., B. Nadal-Ginard, and V. Mahdavi. 1986. Allmembers of the MHCmultigene family respond to thyroid hormonein a highly tissue-specific manner. Science (Wash. DC). 231:597-600.

40. Cummins, P. 1982. Transition in human atrial and ventricularmyosin light-chain isoenzymes in response to cardiac-pressure-over-load-induced hypertrophy. Biochem. J. 205:195-204.

41. Gustafson, T. A., B. E. Markham, J. J. Bahl, and E. Morkin.1987. Thyroid hormone regulates expression of a transfected a-myosinheavy-chain fusion gene in fetal heart cells. Proc. Natl. Acad. Sci. USA.84:3122-3126.


molecular cloning characterization human cardiac...

Documents