métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · foxo forkhead...
TRANSCRIPT
![Page 1: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/1.jpg)
MÉTABOLISME ET SIGNALISATION CELLULAIRE DANS LE QUADRICEPS DES PATIENTS ATTEINTS DE LA
MALADIE PULMONAIRE OBSTRUCTIVE CHRONIQUE
Thèse
Bruno Lemire
Doctorat en médecine expérimentale Philosophiae Doctor (PhD)
Québec, Canada
© Bruno Lemire, 2013
![Page 2: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/2.jpg)
![Page 3: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/3.jpg)
III
Résumé La dysfonction musculaire est une des manifestations importantes de la
maladie pulmonaire obstructive chronique (MPOC). Cette dysfonction musculaire
amène plusieurs anomalies musculaires tant au niveau clinique, structural,
métabolique que biochimique. Ces anomalies contribuent à l’intolérance à l’effort,
la perte de masse maigre et de force musculaire, ainsi qu’à la diminution de la
qualité de vie des patients atteints de la MPOC.
Cette thèse a pour objectif général l’étude de la dysfonction musculaire
périphérique dans la MPOC, plus précisément 1) l’étude des mécanismes
cellulaires impliqués dans l’atrophie musculaire 2) l’étude du métabolisme
musculaire à la suite d’un exercice en endurance et 3) l’étude de la réponse
cellulaire suite à un exercice en résistance.
Tout d’abord, nous avons démontré que la voie de signalisation des MAPK,
plus précisément les protéines p38 MAPK, ERK 1/2 et JNK, pourrait jouer un rôle
important dans le développement de l’atrophie musculaire chez les patients
atteints de la MPOC.
Par la suite, nous avons démontré que le SAA1 pourrait être impliqué dans
la dysfonction des muscles périphériques chez les patients atteints de la MPOC.
Le SAA1 est augmenté de façon significative tant au niveau de l’expression du
gène que le niveau d’ARNm chez les patients présentant une MPOC.
En second lieu, nous avons démontré une plus grande dépendance du
système énergétique à la glycolyse a été observée lors d’un exercice en
endurance chez les patients MPOC, ce qui pourrait contribuer à l’intolérance à
l’exercice chez la MPOC.
Finalement, nous avons déterminé qu’il existe une réponse cellulaire
différente pour les protéines associées au maintien de la masse maigre suite à une
session d’exercice en résistance chez les patients MPOC en comparaison à des
sujets sains appariés pour l’âge.
Cette thèse jette donc la lumière sur la contribution des voies de
signalisation et des facteurs inflammatoires impliqués dans la dysfonction
musculaire chez les patients présentant une MPOC et de la réponse à l’exercice
![Page 4: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/4.jpg)
IV
tant en endurance qu’en résistance dans la MPOC. Ces résultats ajouteront aux
connaissances moléculaires et cellulaires qui contribuent à la dysfonction
musculaire périphérique et à l’intolérance à l’effort chez les patients atteints de la
MPOC.
![Page 5: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/5.jpg)
V
Abstract Peripheral muscle dysfunction is one of the most important systemic
manifestations of Chronic Obstructive Pulmonary Disease (COPD). This
dysfunction brings many muscle abnormalities at the clinical, structural, metabolic
and biochemical levels. These abnormalities contribute to the exercise intolerance,
loss of muscle mass and force as well as diminishing quality of life of patients with
COPD.
This thesis as for general objective the investigation of peripheral muscle
dysfunction in COPD, more precisely 1) the study of signalling pathways involved
in muscle atrophy 2) the study of muscle metabolism in response to endurance
exercise involved in exercise intolerance and 3) the study of muscle cellular
adaptations to resistance exercise involved in the less than optimal response
following resistance training in patients with COPD.
First, we showed the possible contribution of the MAPKs, more precisely
p38 MAPK, ERK1/2 and JNK, to the peripheral muscle dysfunction in COPD. The
phosphorylation levels as well as the mRNA expression of these key proteins are
elevated in patients with COPD compared to age-matched healthy controls.
We also demonstrated that SAA1 could have a possible role in the
peripheral muscle dysfunction in COPD.
Secondly, we observed that patients with COPD have a greater reliance on
the muscle glycolytic metabolism during an endurance exercise done until
exhaustion, therefore possibly contributing to the exercise intolerance seen in
patients with COPD.
Lastly, we demonstrated that the cellular adaptation in response to
resistance exercise training is different for proteins involved in muscle mass
regulation in patients with COPD compared to age-matched healthy controls, thus
possibly contributing to the less-than-optimal response to resistance exercise
training in patients with COPD.
This thesis puts at the forefront the signalling pathways and inflammatory
markers contributing to the inherent peripheral muscle dysfunction in patients with
COPD, as well as the investigation of exercise response in patients with COPD.
![Page 6: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/6.jpg)
VI
These results will add to the scientific knowledge of the metabolic and cellular
aspects of peripheral muscle dysfunction in COPD.
![Page 7: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/7.jpg)
VII
Table des matières
Résumé .................................................................................................................... III Abstract ..................................................................................................................... V Table des matières .................................................................................................. VII Liste des tableaux .................................................................................................... XI Liste des figures ..................................................................................................... XIII Liste des abréviations ............................................................................................ XV Dédicace .............................................................................................................. XVII Remerciements ..................................................................................................... XIX Avant-Propos ........................................................................................................ XXI Liste des publications ........................................................................................... XXV CHAPITRE I .............................................................................................................. 1
INTRODUCTION GÉNÉRALE ............................................................................... 1 1.1 LA MALADIE PULMONAIRE OBSTRUCTIVE CHRONIQUE .......................... 2
1.1.1 Introduction générale ................................................................................ 2 1.1.2 Le diagnostic de la MPOC ........................................................................ 3 1.1.3 Épidémiologie ........................................................................................... 5 1.1.4 Pathologie et physiopathologie ................................................................. 5 1.1.5 Les exacerbations dans la MPOC ............................................................. 7 1.1.6 Traitements ............................................................................................... 8 1.1.7 Les manifestations systémiques de la MPOC ......................................... 10
1.2 LE MUSCLE SQUELETTIQUE ...................................................................... 13 1.2.1 Introduction générale .............................................................................. 13 1.2.2 Le métabolisme énergétique ................................................................... 15 1.2.3 La signalisation intramusculaire associée au maintien de la masse musculaire ........................................................................................................ 22
IGF-1/AKT/mTOR ..................................................................................... 25 Mitogen-Activated Protein Kinases (MAPK) .............................................. 26 Ubiquitine-protéasome (Ub-P’some) ......................................................... 27 Les cytokines inflammatoires .................................................................... 29
1.2.4 La réponse cellulaire à l’exercice en résistance ...................................... 31 1.3 LA DYSFONCTION MUSCULAIRE ASSOCIÉE À LA MPOC ....................... 38
1.3.1 Observations cliniques ............................................................................ 38 1.3.2 Observations structurales ....................................................................... 39 1.3.2 Observations métaboliques ..................................................................... 41 1.3.2 Observations biochimiques ..................................................................... 42 1.3.3 Les causes .............................................................................................. 43 1.3.4 La solution ............................................................................................... 48
CHAPITRE II ........................................................................................................... 50 PROBLÉMATIQUES, OBJECTIFS ET HYPOTHÈSES DES TRAVAUX ............ 50
CHAPITRE III .......................................................................................................... 56 MAPK SIGNALLING IN THE QUADRICEPS OF PATIENTS WITH COPD ............ 56
![Page 8: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/8.jpg)
VIII
3.1 Page titre ........................................................................................................ 57 3.2 Résumé .......................................................................................................... 58 3.2 Abstract .......................................................................................................... 59 3.3 Introduction .................................................................................................... 60 3.4 Methods ......................................................................................................... 61 3.5 Results ........................................................................................................... 67 3.6 Discussion ...................................................................................................... 69 3.7 Conclusion ..................................................................................................... 73 3.8 References ..................................................................................................... 74 3.9 Tables ............................................................................................................ 78 3.10 Figures Legend ............................................................................................ 81 3.11 Figures ......................................................................................................... 82
CHAPITRE IV .......................................................................................................... 88 SAA1 EXPRESSION IN THE QUADRICEPS OF PATIENTS WITH COPD ........ 88 4.1 Page Titre ...................................................................................................... 89 4.2 Résumé .......................................................................................................... 90 4.2 Abstract .......................................................................................................... 91 4.3 Introduction .................................................................................................... 92 4.4 Methods ......................................................................................................... 94 4.5 Results ........................................................................................................... 97 4.6 Discussion ...................................................................................................... 99 4.7 Conclusion ................................................................................................... 101 4.8 References ................................................................................................... 102 4.9 Figure Legend .............................................................................................. 105 4.10 Figure Legend ............................................................................................ 110 4.11 Figures ....................................................................................................... 111 Figure1 ............................................................................................................... 111
CHAPITRE V ......................................................................................................... 116 QUADRICEPS METABOLISM DURING CONSTANT WORKRATE CYCLING EXERCISE IN CHRONIC OBSTRUCTIVE PULMONARY DISEASE ................ 116 5.1 Page titre ...................................................................................................... 117 5.2 Résumé ........................................................................................................ 118 5.2 Abstract ........................................................................................................ 119 5.3 Introduction .................................................................................................. 120 5.4 Methods ....................................................................................................... 122 5.5 Results ......................................................................................................... 127 5.6 Discussion .................................................................................................... 129 5.7 Conclusion ................................................................................................... 132 5.8 References ................................................................................................... 134 5.9 Tables .......................................................................................................... 138 5.10 Figures Legend .......................................................................................... 141 5.11 Figures ....................................................................................................... 142
CHAPITRE VI ........................................................................................................ 145 THE ACTIVATION OF SIGNALLING PATHWAYS INVOLVED IN MUSCLE MASS REGULATION AFTER AN ACUTE BOUT OF RESISTANCE TRAINING EXERCISE IN PATIENTS WITH COPD ............................................................ 145 6.1 Page titre ...................................................................................................... 146
![Page 9: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/9.jpg)
IX
6.2 Résumé ....................................................................................................... 147 6.2 Abstract ....................................................................................................... 148 6.3 Introduction .................................................................................................. 149 6.4 Methods ....................................................................................................... 151 6.5 Results ......................................................................................................... 155 6.6 Discussion ................................................................................................... 157 6.7 Conclusion ................................................................................................... 159 6.8 References .................................................................................................. 161 6.9 Tables .......................................................................................................... 165 6.10 Figures Legends ........................................................................................ 168 6.11 Figures ....................................................................................................... 169
CHAPITRE VII ....................................................................................................... 173 DISCUSSION GÉNÉRALE ................................................................................ 173
CHAPITRE VIII ...................................................................................................... 181 CONCLUSIONS ET PERSPECTIVES .............................................................. 181
RÉFÉRENCES ...................................................................................................... 185 ANNEXES ............................................................................................................. 201
Annexe A ........................................................................................................... 201
![Page 10: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/10.jpg)
X
![Page 11: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/11.jpg)
XI
Liste des tableaux TABLEAU 1. SYMPTÔMES CLINIQUES POUR LE DIAGNOSTIC D’UNE MPOC ...................... 4 TABLEAU 2. LES STADE DE SÉVÉRITÉ DE LA MPOC ...................................................... 5 TABLEAU 3. REVUE DE LA LITTÉRATURE COMPARANT LES RÉPONSES CELLULAIRES
TEMPORELLES À L’EXERCICE EN RÉSISTANCE. ..................................................... 37 TABLEAU 4. REVUE DE LA LITTÉRATURE COMPARANT LES DISTRIBUTIONS DE TYPES DE
FIBRES DU QUADRICEPS CHEZ LES PATIENTS ATTEINTS DE LA MPOC .................... 41
![Page 12: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/12.jpg)
XII
![Page 13: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/13.jpg)
XIII
Liste des figures FIGURE 1. MÉCANISMES D’ACTION DE LA PATHOPHYSIOLOGIE DE LA MPOC. .................. 7 FIGURE 3. LE MUSCLE SQUELETTIQUE.. ..................................................................... 14 FIGURE 4. SCHÉMA RÉCAPITULATIF DES FILIÈRES ÉNERGÉTIQUES MENANT À LA
PRODUCTION D’ATP ......................................................................................... 18 FIGURE 5. SCHÉMA DE LA CONTRIBUTION TEMPORELLE DES DIFFÉRENTES FILIÈRES
ÉNERGÉTIQUES À L’EXERCICE ............................................................................ 20 FIGURE 6. SÉQUENCE DES ÉVÈNEMENTS DE L’ADAPTATION CELLULAIRE À LA SUITE DE
STIMULI ............................................................................................................ 22 FIGURE 10. MÉCANISMES D’ACTION MENANT À LA DYSFONCTION MUSCULAIRE SUITE AU
SÉDENTARISME ET À L’INACTIVITÉ PHYSIQUE. ...................................................... 46 FIGURE 11. MÉCANISMES D’ACTION MENANT À LA DYSFONCTION MUSCULAIRE CHEZ LA
MPOC. ........................................................................................................... 47 FIGURE 12. MÉCANISMES CELLULAIRES PROPOSÉS POUR LA VOIE DES MAPK. .......... 175
![Page 14: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/14.jpg)
XIV
![Page 15: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/15.jpg)
XV
Liste des abréviations
% Pourcentage 4E-BP1 eIF4E binding protein 1 μg Microgramme μM Micromolaire ADN Acide désoxyribonucléique AKT Protéine kinase B ARNm Acide ribonucléique messager ATP Adénosine triphosphate COPD Chronic obstructive pulmonary disease CRP Protéine C-réactive CS Citrate synthase CVF Capacité vitale forcée E1 Ubiquitin-activating enzyme E2 Ubiquitin-carrier protein E3 Ubiquitin-protein ligase ERK Extracellular signal-regulated kinase FoxO Forkhead box of the class O GOLD Global Initiative for Chronic Obstructive Lung Disease g gramme GSK-3β Glycogen synthase kinase 3β HADH 3-hydroxyacyl-CoA deshydrogenase IGF-1 Insulin-like growth factor 1 IGF1R Récepteur de l’insulin-like growth factor 1 IL Interleukine JNK Jun N-terminal kinase kDa Kilodalton LDH Lactate dehydrogenase MAFbx Muscle Atrophy F-box ou Atrogin1 MAPK Mitogen-activated protein kinase mM Millimolaire mmHg Millimètre de mercure ms Millisecondes MPOC Maladie pulmonaire obstructive chronique mTOR Mammalian target of rapamycin MuRF1 Muscle RING Finger 1 NF-κB Nuclear factor kappa B p70S6K Isoforme de 70 kDa de la protéine S6 kinase 1 PaO2 Pression partielle en oxygène Sec Seconde SEM Standard error of the mean TNF-α Tumor necrosis factor alpha
![Page 16: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/16.jpg)
XVI
Ub-P’some Système ubiquitine-protéasome VEMS Volume expiratoire maximal en 1 seconde VEMS/CVF Indice de Tiffeneau
2OV max Consommation maximal d’oxygène
![Page 17: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/17.jpg)
XVII
Dédicace
Quelques pensées qui m’ont influencé et inspiré pendant mon doctorat! ‘Make everything as simple as possible, but not simpler’
Albert Einstein ‘Bad times have a scientific value. These are occasions a good learner would not miss’
Ralph Waldo Emerson ‘If you're not prepared to be wrong, you'll never come up with anything original’
Sir Ken Robinson
![Page 18: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/18.jpg)
XVIII
![Page 19: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/19.jpg)
XIX
Remerciements D’abord et avant tout, j’aimerais remercier mon superviseur et directeur de
thèse François Maltais pour m’avoir donné la chance de faire partie de son équipe de
recherche à l’Institut universitaire de cardiologie et de pneumologie de Québec. François
est dynamique, persévérant et son intérêt envers la recherche est très contagieux. Je me
considère très privilégié de t’avoir rencontré, toi ainsi que toute ton équipe de recherche.
Grâce à toi et à l’équipe, mon doctorat a été une expérience professionnelle et sociale des
plus enrichissantes. J’espère avoir l’occasion der collaborer avec toi sur d’autres projets
dans l’avenir.
Je remercie également mon co-superviseur Richard Debigaré. Richard a un esprit
de synthèse remarquable et une approche pédagogique rigoureuse. Il m’a transmis une
façon « fondamentale » de voir les choses. Merci pour ta simplicité qui m’a permis de ne
pas trop dévier pendant mon doctorat…une chose parfois difficile à faire en science
fondamentale!
Merci à Didier Saey qui a partagé ses données postdoctorales afin de créer notre
collaboration sur le projet des métabolites. Merci pour ton expertise, ton expérience, ta
camaraderie et nos bonnes discussions!
Merci à Claude H. Côté et Yohan Bossé qui ont siégé sur mon comité d’examen
de pré-doctoral. Vous avez su m’aider tout au long de mon doctorat avec mes projets et
mes articles scientifiques.
J’aimerais aussi remercier ma copine Marie-Claude pour sa patience et ses
encouragements tout au long de mon doctorat, surtout dans les derniers mois à Québec.
La complémentarité que nous avons développée pendant nos études à Québec est
exceptionnelle et j’espère collaborer un jour avec toi.
Plusieurs personnes ont contribué de près ou de loin au succès de cette thèse.
Merci à :
Annie Dubé qui m’a « coacher » dans le laboratoire de science fondamentale. En
fait, elle m’a tout montré! C’est à elle que je dois ma découverte des sciences
fondamentales au quotidien. Un grand merci de m’avoir aussi aidé dans ma vie de tous les
jours…En plus d’être une exellente professionnelle de recherche, elle est une personne
très généreuse. Je n’oublierai jamais ton sourire contagieux et nos fous rires à n’en plus
finir!!! Je n’aurais pas pu trouver mieux comme collègue de travail et amie. Merci de ton
amitié.
![Page 20: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/20.jpg)
XX
Marie-Ève Paré, Marie-Eve Thériault, Marc-André Caron et Mathieu Morissette
à qui je dois un gros merci pour votre soutien dans le laboratoire. Ce n’est pas toujours
facile de travailler avec un « clinicien ». Vous avez toute mon admiration pour votre
persévérance et vos connaissances hors pair en science fondamentale. Merci pour vos
conseils de fondamentalistes!
Philippe Gagnon et Vincent Mainguy à qui je dis un très gros merci. Je suis
extrêmement content de vous avoir rencontré pendant mon doctorat. Quel bel adon cette
rencontre! Ce n’est pas à tous les jours que l’on rencontre des individus de votre calibre.
Merci de m’avoir intégré dans votre groupe et j’espère que notre amitié continuera malgré
la distance qui nous séparera. Bonne chance pour la suite!
Un gros merci aux docteurs Steeve Provencher et Julie Milot qui m’ont
grandement aidé avec les nombreuses biopsies musculaires dans le cadre de mes projets
de recherche. Votre collaboration a été primordiale pour la réussite de mes projets.
Merci à toute l’équipe élargie du centre de recherche et surtout aux infirmières
de recherche Marie-Josée Breton, Josée Picard, Brigitte Jean et Marthe Bélanger pour vos efforts pendant mon doctorat. Tout geste, aide, idée et temps donné ne sont pas
passés inaperçu. Vous avez contribué de façon importante à cette thèse et je vous en
remercie sincèrement.
J’aimerais remercier tous les patients qui ont participé à mes études. De
nombreux sacrifices et points de suture ont été faits pendant mes 4 ans de doctorat!
Je voudrais aussi remercier les Instituts de Recherches en Santé du Canada
pour le support financier pendant mes trois premières années au doctorat et aussi le
Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de Québec pour la bourse doctorale lors de ma dernière année d’étude.
Et finalement, merci à mes parents qui mon supporté moralement et monétairement pendant non seulement mon doctorat mais aussi pendant toutes mes années d’études universitaires…ce qui veut dire 9 ans, 3 villes différentes et 6 déménagements!!!
![Page 21: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/21.jpg)
XXI
Avant-Propos Cette thèse comprend 4 articles scientifiques ayant comme thème général la
dysfonction musculaire dans la maladie pulmonaire obstructive chronique (MPOC).
L'introduction abordera les concepts généraux (épidémiologie, pathogénèse et
traitements) de la MPOC ainsi que ses conséquences systémiques. Par la suite, deux
concepts généraux seront discutés, soit le métabolisme énergétique du muscle
squelettique ainsi que la signalisation cellulaire associée au maintien de la masse
musculaire et à la réponse à l’exercice. Les 4 articles scientifiques suivront. À noter que
les références inclues dans les articles scientifiques sont formatées selon le style du
journal dans lequel ils ont été soumis, publiés ou en préparation et que ces références
sont exclues des références finales de la thèse.
Article 1 : MAPK SIGNALLING IN THE QUADRICEPS OF PATIENTS WITH CHRONIC
OBSTRUCTIVE PULMONARY DISEASE
Cette publication met l’emphase sur la contribution possible de la voie de
signalisation des «Mitogen-Activated Protein Kinase», plus précisément les protéines p38
MAPK, ERK 1/2 and JNK à la perte de masse maigre chez les patients atteints de la
MPOC. Étant donné que la voie des ‘MAPK’ est activée par des conditions perturbantes
pour la cellule telles que l’inflammation et le stress oxydant et que ces facteurs se
retrouvent souvent associés à la MPOC, nous voulions étudier la phosphorylation et le
niveau d’ARNm des trois principales protéines de cette voie de signalisation. De plus, les
résultats obtenus avec les expériences cellulaires et animales démontrent que les MAPK
ont un rôle à jouer dans la diminution du diamètre des myotubes en culture et même dans
l’atrophie musculaire chez la souris. Notre objectif était de quantifier l’activation des
MAPK ainsi que les niveaux d’ARNm dans le quadriceps des patients atteints de la MPOC
en faisant le lien avec le maintien de la masse musculaire dans cette population. Cette
étude a été réalisée sous la direction du Dr François Maltais. Le protocole a été écrit par
une professionnelle de recherche du Dr Maltais avant mon arrivée dans l’équipe. J'ai
recruté les patients, amassé les données, analysé tous les résultats et rédigé la version
initiale de l'article. Le Dr Richard Debigaré, mes collègues Dre Annie Dubé et Marie-Eve
Thériault ont collaboré à l'interprétation des résultats ainsi qu’à la réalisation des images
d’immunohistochimie. Le Dr Claude H. Côté a collaboré à la révision de l'article. Ces
résultats ont été présentés au congrès de l’«American Thoracique Society» en mai 2011.
![Page 22: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/22.jpg)
XXII
Ils ont fait l’objet d’une présentation orale et sont publiés dans le «Journal of Applied
Physiology» (110).
Article 2 : QUADRICEPS SERUM AMYLOID A1 EXPRESSION IN COPD
Cette publication aborde une découverte fortuite à la suite d’une analyse de
données génétiques obtenues à partir du quadriceps de patients atteint de la MPOC. En
effet, dans le cadre d’une étude parallèle, nous avions fait une analyse de puces à ADN
avec les échantillons de nos patients ayant une MPOC. Les résultats de ces analyses ont
mis en évidence la surexpression d’un facteur inflammatoire dans le quadriceps des
patients MPOC, soit le Sérum Amyloïde A1 (SAA1). Le SAA1 pourrait jouer un rôle
d’importance dans le maintien de la masse maigre chez les patients MPOC en plus d’être
un biomarqueur potentiel de la dysfonction musculaire périphérique chez la MPOC. Notre
objectif était de mesurer les niveaux de SAA1 au niveau génétique et transcriptionnel chez
des patients atteints de la MPOC en période de stabilité de la maladie ou pendant une
exacerbation de leur maladie. Cette étude a été réalisée sous la direction du Dr François
Maltais. J'ai amassé les données, analysé tous les résultats et rédigé la version initiale de
l'article avec l’aide du Dre Annie Dubé. Le Dr Richard Debigaré et le Dr Yohan Bossé ont
collaboré à l'interprétation des résultats. Ces résultats sont en préparation pour
soumission prochainement.
Article 3 : QUADRICEPS METABOLISM DURING CONSTANT WORKRATE CYCLING
EXERCISE IN CHRONIC OBSTRUCTIVE PULMONARY DISEASE
Cette publication met en évidence la contribution du système glycolytique au
métabolisme musculaire pendant l’effort chez les patients atteints de la MPOC. Étant
donné qu’il existe une diminution de la capacité oxydative du muscle squelettique ainsi
qu’une transition de fibre musculaire de type I à type II, nous voulions mesurer l’impact de
ces anomalies sur le métabolisme musculaire à l’effort dans la MPOC. Notre objectif était
de mesurer les métabolites, enzymes et substrats énergétiques lors d’un effort en
endurance réalisé jusqu’à épuisement chez les patients atteints de la MPOC. Cette étude
a été réalisée sous la direction du Dr François Maltais. Ce travail a été fait dans le cadre
du stage postdoctoral du Dr Didier Saey à l’IUCPQ. Dr Saey a écrit le protocole, recruté
les patients et amassé les données. J’ai analysé les résultats et écrit le manuscrit avec
l’aide du Dr Saey. J’ai également coordonné les efforts d’analyses avec le laboratoire du
Dr Tuppling à l’Université de Waterloo. Ces résultats ont été présentés au congrès du
![Page 23: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/23.jpg)
XXIII
«Regroupement Stratégique en MPOC du FRQ-S» en février 2009 lors d’une présentation
orale et sont publiés dans le «Journal of Applied Physiology» (173).
Article 4 : THE ACTIVATION OF SIGNALLING PATHWAYS INVOLVED IN MUSCLE
MASS REGULATION AFTER AN ACUTE BOUT OF RESISTANCE TRAINING
EXERCISE IN PATIENTS WITH COPD
Ce projet témoigne de l’activation de certaines protéines essentielles ayant une
influence sur le maintien de la masse musculaire à la suite d’une session d’exercice en
résistance chez les patients atteints de la MPOC. Étant donné que les études sur la
réadaptation dans la MPOC démontrent une faible amélioration de la force et de la masse
musculaire en comparaison avec des sujets sains et que certaines voies de signalisation
seraient dysfonctionnelles dans la MPOC, nous voulions étudier la voie de signalisation
IGF-1/AKT/mTOR et la voie des MAPK en réponse à l’exercice en résistance chez les
patients atteints de la MPOC. Cette étude a été réalisée sous la direction du Dr François
Maltais. J'ai écrit le protocole, recruté les patients, amassé les données et analysé tous les
résultats en collaboration avec la Dre Annie Dubé. Le Dr Richard Debigaré, mes collègues
Marie-Eve Thériault et le Dre Annie Dubé ont collaboré à l'interprétation des résultats. Ces
résultats ont été présentés au congrès de l’«American Thoracic Society» en mai 2012. Ils
ont fait l’objet d’une présentation orale et sont en préparation pour une soumission dans le
«Journal of Applied Physiology».
![Page 24: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/24.jpg)
XXIV
![Page 25: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/25.jpg)
XXV
Liste des publications 1- MAPK SIGNALING IN THE QUADRICEPS OF PATIENTS WITH CHRONIC OBSTRUCTIVE PULMONARY DISEASE Bruno B. LEMIRE, Richard DEBIGARÉ, Annie DUBÉ, Marie-Eve THÉRIAULT, Claude H. CÔTÉ, François MALTAIS 2- QUADRICEPS SERUM AMYLOID A1 EXPRESSION IN COPD Bruno B. LEMIRE, Marie-Eve THÉRIAULT, Annie DUBÉ, Yohan BOSSÉ, Richard DEBIGARÉ, François MALTAIS 3- QUADRICEPS METABOLISM DURING CONSTANT WORKRATE CYCLING EXERCISE IN CHRONIC OBSTRUCTIVE PULMONARY DISEASE Didier SAEY*, Bruno B. LEMIRE*, Philippe GAGNON, Éric BOMBARDIER, A. Russel TUPLING, Claude H. CÔTÉ, François MALTAIS 4- THE ACTIVATION OF SIGNALLING PATHWAYS INVOLVED IN MUSCLE MASS REGULATION AFTER AN ACUTE BOUT OF RESISTANCE TRAINING EXERCISE IN PATIENTS WITH COPD Bruno B. LEMIRE, Annie DUBÉ, Marie-Eve THÉRIAULT, Richard DEBIGARÉ, Claude H. CÔTÉ, François MALTAIS
* co-premier auteur Co-auteur :
1. CHARACTERIZATION OF THE QUADRICEPS MUSCLE IN PATIENTS WITH MILD COPD Philippe GAGNON, Bruno B. LEMIRE, Annie DUBÉ, Didier SAEY, Alexandra PORLIER, Steeve PROVENCHER, François MALTAIS
2. ISOLATION AND CHARACTERIZATION OF PERIPHERAL MUSCLE SATELLITE CELLS FROM PATIENTS WITH CHRONIC OBSTRUCTIVE PULMONARY DISEASE Marie-Eve THÉRIAULT, Marie-Ève PARÉ, Bruno B. LEMIRE, François MALTAIS and Richard DEBIGARÉ.
3. GUIDE BPCO : L’EXPLORATION FONCTIONNELLE À L’EFFORT. Maltais F, Provencher S, Lemire BB, Gagnon P, Mainguy V. 2011
![Page 26: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/26.jpg)
![Page 27: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/27.jpg)
CHAPITRE I. Le muscle squelettique
CHAPITRE I
INTRODUCTION GÉNÉRALE
![Page 28: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/28.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
2
1.1 LA MALADIE PULMONAIRE OBSTRUCTIVE CHRONIQUE
1.1.1 Introduction générale
La maladie pulmonaire obstructive chronique (MPOC) est une maladie
chronique caractérisée par l'essoufflement, la toux et une production
d’expectorations. Cette maladie s’installe et progresse pendant des années avant
l’apparition des symptômes et le diagnostic est posé plusieurs années après
l’apparition des symptômes. La MPOC se présente sous deux principales formes,
soit la bronchite chronique et l'emphysème et n’exclut pas une combinaison des
deux.
La bronchite chronique est définie par une toux productive chronique d’une
durée d’au moins trois mois, et ce, pendant deux années consécutives chez un
patient chez qui d'autres causes de toux chronique ont été exclues (32). Cette
définition a été utilisée dans plusieurs études, en dépit de la durée des symptômes
arbitrairement choisis et du manque de justification biologique.
L'emphysème est défini par l'élargissement anormal et permanent des
espaces aériens qui sont en aval des bronchioles terminales. Ceci est
accompagné par la destruction des parois alvéolaires, sans fibrose évidente (165).
Cependant, une augmentation du collagène dans les poumons des patients
présentant une MPOC modérée a déjà été démontrée, ce qui indique qu’un certain
degré de fibrose est probablement présent, bien que ce ne soit pas la lésion
principale (151, 211). L'emphysème peut exister chez des individus qui n'ont pas
d'obstruction bronchique, mais il est le plus souvent accompagné par un
obstruction bronchique modérée ou sévère (66, 135).
La MPOC évolue lentement sur une période qui peut s’étendre sur plusieurs
années. L’évolution de la MPOC est associée à de fréquentes exacerbations de la
maladie et à la perte de capacité respiratoire pouvant mener au décès prématuré
(162). Avec la progression de la maladie, la diminution de la capacité pulmonaire
entraîne de plus en plus d'essoufflement, une réduction importante des niveaux
d'activité physique et une réduction considérable de la qualité de vie des patients.
![Page 29: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/29.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
3
L'American Thoracic Society (ATS), l’European Respiratory Society (ERS)
ainsi que la British Thoracic Society (BTS) ont toutes et chacune définie la MPOC
de façon légèrement différente au cours des 15 dernières années (189).
L'«Initiative Mondiale pour la Maladie Pulmonaire Obstructive Chronique», dans
un rapport produit par le National Heart, Lung, and Blood Institute (NHLBI) et
l'Organisation Mondiale de la Santé (OMS) a définit la MPOC comme suit (66) :
« La maladie pulmonaire obstructive chronique est une maladie
évitable et traitable avec des effets extrapulmonaires significatifs
qui peuvent contribuer à la sévérité de la maladie chez certains
patients. Sa composante pulmonaire est caractérisée par une
limitation du débit aérien qui n'est pas entièrement réversible. La
limitation du débit est habituellement progressive et associée à
une réponse inflammatoire anormale des poumons à des
particules ou des gaz nocifs. »
1.1.2 Le diagnostic de la MPOC
Le diagnostic de la MPOC doit être suspecté chez tous les patients qui
signalent une combinaison d’un ou plusieurs des symptômes suivants: toux
chronique, expectoration chronique, dyspnée au repos ou à l'effort dans un
contexte d’exposition à un irritant respiratoire (fumée de cigarette ou de
biocarburant, produits chimiques reliés au travail) (32). Étant donné que la
dyspnée à l'effort est souvent sous-estimée par les individus, ceux-ci consultent
plus tardivement leur médecin, ce qui retarde considérablement le diagnostic de la
MPOC.
![Page 30: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/30.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
4
Tableau 1. Symptômes cliniques pour le diagnostic d’une MPOC Toux chronique : Présente de façon intermittente ou à tous les
jours, à tout moment de la journée, rarement seulement la nuit
Production chronique d’expectoration :
Toute forme d’apparition de production de sécrétion
De la dyspnée qui est : Progressive (s’aggrave avec le temps)
Persistante (tous les jours) Décrite comme «une augmentation de l’effort à
respirer», «chercher son souffle» Aggravée par l’exercice
Aggravée par les infections respiratoires
Facteurs de risques :
Histoire tabagique élevée Exposition aux poussières ou aux produits
chimiques Exposition à la fumée de combustion
Basé sur L'Initiative Mondiale pour la Maladie Pulmonaire Obstructive Chronique Les patients qui présentent les caractéristiques décrites dans le tableau 1
devraient subir une spirométrie, surtout s'il y a des antécédents d'exposition à des
facteurs de risques de la MPOC (par exemple, la fumée de cigarette) (161). La
spirométrie est utilisée pour diagnostiquer la MPOC, déterminer la gravité et la
réversibilité de l'obstruction bronchique et monitorer la progression de la maladie.
Les valeurs les plus importantes qui sont mesurées sont le volume expiratoire
maximal en une seconde (VEMS) et la capacité vitale forcée (CVF). Lorsque le
ratio VEMS/CVF (l’Indice de Tiffeneau) est inférieur à 0,70, cela indique la
présence d’obstruction des voies respiratoires.
La MPOC est confirmée quand un patient, qui présente des symptômes qui
sont compatibles avec la MPOC, montre également une obstruction bronchique
(rapport VEMS/CVF inférieur à 0,70 et un VEMS moins de 100% de la valeur
prédite) et qu’il n'y a aucune autre explication pour les symptômes et l’obstruction
des voies aériennes. L’importance de la diminution du VEMS par rapport aux
valeurs prédites déterminera le degré de sévérité de la maladie. Le tableau 2
démontre les quatre stades de la MPOC selon «L’Initiative Mondiale pour la
Maladie Pulmonaire Obstructive Chronique» (GOLD).
![Page 31: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/31.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
5
Tableau 2. Les stade de sévérité de la MPOC GOLD I: MPOC légère VEMS/CVF < 0,70
VEMS ≥ 80% de la valeur prédite
GOLD II: MPOC modérée VEMS/CVF < 0,70 50% ≤ VEMS < 80% de la valeur prédite
GOLD III: MPOC sévère VEMS/CVF < 0,70
30% ≤ VEMS < 50% de la valeur prédite
GOLD IV: MPOC très sévère
VEMS/CVF < 0,70 VEMS< 30% de la valeur prédite ou VEMS< 50% de la valeur prédite + insuffisance respiratoire chronique
1.1.3 Épidémiologie
Selon un rapport de l’Organisation Mondiale de la Santé, la MPOC, avec
ses trois millions de décès en 2004 seulement, s’est vue attribuer le quatrième
rang au classement des causes de mortalité pour l’ensemble de la population tout
âge confondu (222). Selon de récentes estimations, il a été évalué que 10% de la
population mondiale âgée de 40 ans et plus est au prise avec une MPOC de stade
II ou plus avancé (26). Au Canada, on estime qu’environ trois millions de
Canadiens souffriraient de cette maladie chronique (5). Dans un sondage du
Canadian Community Health Survey (CCHS) en 2005, 4,4% (329 500) d’hommes
et 4,8% (425 300) de femmes rapportaient avoir reçu un diagnostic de MPOC par
un professionnel de la santé (27). De plus, 84% des Canadiens âgés de plus de 35
ans et qui affirment souffrir de MPOC étaient ou ont déjà été fumeurs.
Les coûts associés au traitement des patients atteints de la MPOC sont
considérables. Au Canada, les coûts directs et indirects associés atteignaient
3200$ par patient en 2003 (34). Ce montant peut même s’élever à 10 000$
annuellement en soins et médicaments pour un patient de stade GOLD IV (83).
1.1.4 Pathologie et physiopathologie
Le tabagisme est la principale cause de la MPOC dans les pays
![Page 32: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/32.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
6
industrialisés. La fumée de cigarette contient plusieurs agents nocifs pour les voies
respiratoires et l'épithélium bronchique, augmentant ainsi l’activation de processus
cellulaires liés au stress oxydant (73, 120, 188) et à l’inflammation (11).
L’inflammation bronchique est associée à une infiltration neutrophilique, qui
est typique à la MPOC (22). Cette augmentation des neutrophiles contribue à la
libération de protéases, perpétuant les déséquilibres en faveur de la destruction du
tissu pulmonaire. De plus, les neutrophiles augmentent les niveaux d'élastase
relâchés dans le tissu pulmonaire. L’élastase augmente le nombre de
macrophages et l'activation des cellules épithéliales (22). Par conséquent,
l’inflammation bronchique cause une hypersécrétion des cellules épithéliales
menant aux signes et symptômes de la bronchite chronique, et à une destruction
du tissu pulmonaire menant aux signes et symptômes de l’emphysème.
De son côté, le stress oxydant au niveau du poumon et de la circulation
sanguine a bien été démontré dans la MPOC (48, 118). Les sources de stress
oxydant proviennent majoritairement des cellules inflammatoires, comme les
macrophages et les neutrophiles, et génèrent les dérivés réactifs de
l'oxygène (DRO) lors de leur activation. Chez les sujets en santé, l’équilibre entre
les agents oxydants et antioxydants est présent et contribue à garder un
environnement stable. Chez la MPOC, les conséquences du stress oxydant
surviennent lorsque ce stress oxydant n’est pas contrebalancé par le système
antioxydant, ce qui contribue au remodelage pulmonaire et à la destruction du tissu
pulmonaire (122).
Ces phénomènes se traduisent ultimement en obstruction des voies
respiratoires. La figure 1 démontre les facteurs de remodelage contribuant à la
limitation du débit ventilatoire chez la MPOC (88).
![Page 33: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/33.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
7
Figure 1. Mécanismes d’action de la pathophysiologie de la MPOC. Adapté de Barnes et al. 2000 (9)
CD8+ : ‘cluster of differentiation’ positif; IL-8 : Interleukin-8.
Chez les individus en santé, une fois les agents nocifs supprimés par les
défenses primaires, les processus de réparation devraient, normalement,
permettre aux voies aériennes un retour à une structure et à une fonction normale.
Un processus de réparation inadéquat est considéré comme étant un joueur clé
dans le développement de la MPOC, malgré l'abandon du tabac (216). Cet échec
de la réparation contribue à la destruction du parenchyme pulmonaire et à
l’hypersécrétion de mucus dans les voies aériennes.
1.1.5 Les exacerbations dans la MPOC
Une exacerbation aiguë de la MPOC est une aggravation soudaine des
symptômes (essoufflement, production d’expectorations) qui dure généralement
plusieurs jours. Elle peut être déclenchée par une infection bactérienne, virale ou
![Page 34: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/34.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
8
par des polluants environnementaux. En général, les infections causent environ
75% ou plus des exacerbations. L’inflammation des voies respiratoires est
augmentée au cours de l’exacerbation entraînant une augmentation de
l'hyperinflation en réduisant le débit d'air expiré et en rendant inefficace les
échanges gazeux (209). Ces périodes d’exacerbations sont caractérisées par des
diminutions importantes des niveaux d’activités physiques et par une plus grande
utilisation de soins de santé, ce qui ultimement contribue à une diminution
importante de la qualité de vie des patients atteints de la MPOC (210). Malgré le
fait que ces épisodes sont caractérisés par une baisse de la fonction respiratoire, il
est estimé que seulement 50% des exacerbations sont rapportées au médecin
traitant (183).
1.1.6 Traitements
La pharmacothérapie associée à la MPOC est utilisée pour prévenir et
diminuer les symptômes (en particulier la dyspnée), réduire la fréquence et la
gravité des exacerbations, améliorer l'état de santé en général et améliorer la
capacité à l’exercice (66). L'«Initiative Mondiale pour la MPOC» suggère une
combinaison de traitements pharmacologiques et non-pharmacologiques pour
contrôler les symptômes, favoriser la diminution des exacerbations et améliorer la
qualité de vie des patients (66).
Les piliers de la pharmacothérapie pour la MPOC sont les
bronchodilatateurs (beta2-agonistes et anticholinergiques) et les anti-
inflammatoires (glucocorticostéroïdes inhalés) administrés seuls ou en
combinaison, en fonction de la gravité de la maladie et de la réponse au
traitement.
L'éducation thérapeutique dont l’objectif est de favoriser la compréhension
de la maladie et de son traitement ainsi que l’apprentissage des techniques
d’inhalation des bronchodilatateurs et des anti-inflammatoires est essentiel. Il est
également essentiel que les patients apprennent à reconnaître les symptômes et
les signes annonciateurs des exacerbations afin de pouvoir amorcer rapidement
un traitement thérapeutique adéquat.
![Page 35: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/35.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
9
L’arrêt tabagique est évidemment essentiel et les thérapies
complémentaires, telles que l'oxygénothérapie au long cours et la réadaptation
pulmonaire doivent être envisagées car elles jouent un rôle important dans la
gestion de la MPOC.
Afin de déterminer si le patient répond de façon adéquate à la thérapie, il est
nécessaire de surveiller les symptômes (par exemple, la dyspnée, la tolérance à
l'effort, la toux, les expectorations), la fonction respiratoire, la fréquence d'utilisation
des bronchodilatateurs de courte action et la fréquence des exacerbations (66).
Dans le cadre de cette thèse, une discussion plus approfondie sur la réadaptation
pulmonaire est de mise.
La réadaptation pulmonaire est un concept thérapeutique large. Elle est
définie par l'American Thoracic Society (ATS) et l’European Respiratory Society
(ERS) comme étant « une intervention fondée sur des preuves, multidisciplinaire et
globale pour les patients qui présentent des symptômes et ont une diminution des
activités de la vie quotidienne» (142). Intégrée dans le traitement individualisé du
patient, la réadaptation pulmonaire est conçue pour réduire les symptômes,
optimiser l’état fonctionnel et réduire les coûts des soins de santé par la
stabilisation et/ou la prévention des manifestations systémiques de la maladie (15,
142, 160, 167). Les patients atteints de la MPOC diminuent plus souvent
qu’autrement leur niveau d’activité physique car cette dernière aggrave la dyspnée.
Le déconditionnement progressif associé à l'inactivité physique initie un cercle
vicieux de détérioration de la maladie. La réadaptation pulmonaire a donc comme
but de briser ce cercle vicieux. Ces points plus spécifiques seront discutés
davantage plus loin dans cette thèse ainsi que dans les articles scientifiques
présentés.
![Page 36: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/36.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
10
1.1.7 Les manifestations systémiques de la MPOC
Même si la MPOC touche principalement les poumons, elle s’accompagne
également d’importantes manifestations systémiques (figure 2). Figure 2. Mécanismes des manifestations systémiques dans la MPOC. Adapté de Barnes et Celli 2009. (10)
IL-6 ; Interleukin 6 : IL-8 : Interleukin 8 : TNF-α ; Tumor necrosis factor alpha.
La MPOC est souvent associée à d’autres maladies chroniques, par
exemple les maladies cardiovasculaires, ou d’autr es non-spécifiques à la MPOC
comme la dépression (47). D'autres conditions sont également considérées
secondaires à la maladie, comme la cachexie et la perte de la masse maigre,
l'ostéoporose et la dysfonction du muscle squelettique, tant au niveau biochimique
que métabolique. Un intérêt particulier est porté sur les muscles respiratoires et
périphériques parce que leur fonctionnement (ou dysfonctionnement) influencent
non seulement les symptômes de la maladie, mais contribuent directement à
l’intolérance à l’effort des patients (71). La faiblesse des muscles squelettiques
![Page 37: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/37.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
11
favorise, indépendamment des paramètres de la fonction pulmonaire, l’état de
santé (187), l’utilisation de soins de santé (42), et la survie (132, 196). Les muscles
représentent donc une cible potentielle pour améliorer le niveau fonctionnel des
patients et la qualité de vie de ces derniers, en dépit de l’atteinte primaire
irréversible aux poumons. Au cours des derniers 25 ans, des études cliniques et
biochimiques ont dressé un portrait des anomalies des muscles squelettiques, en
particulier le quadriceps (190). Par contre, l'étiologie de ces changements demeure
un sujet de recherche d’intérêt dans la communauté scientifique. Pendant cette
même période, les études moléculaires et cellulaires concernant la dysfonction
musculaire se sont multipliées. Malgré ce fait, les mécanismes pertinents à la
MPOC demeurent à ce jour largement inconnus.
L’analyse de la littérature sur les causes des manifestations systémiques de
la MPOC révèle un point primordial : celle-ci est multifactorielle. Les facteurs
considérés comme potentiellement pertinents au dysfonctionnement des muscles
périphériques chez la MPOC comprennent l'hypoxie, l'hypercapnie, la prise de
corticostéroïdes, la nutrition souvent déficiente, le déséquilibre hormonal
anabolique/catabolique, l’inflammation locale et systémique, le stress oxydant, la
susceptibilité génétique et le dernier et non le moindre, l’inactivité physique. Les
plus importants d’entre eux seront discutés plus loin dans cette thèse.
Il existe deux points de vue intéressants à considérer lors de l’étude de
l’étiologie des manifestations systémiques de la MPOC. Plusieurs chercheurs
proposent que ces manifestations soient le résultat d'un «spill-over» systémique
des évènements inflammatoires et réparateurs qui se produisent dans les
poumons des patients atteints de la MPOC, tout en gardant la maladie au centre
du processus. Pour d'autres chercheurs, les manifestations pulmonaires de la
MPOC sont une forme d'expression d'un état d’inflammation systémique générale
avec l’implication de plusieurs organes (55, 185). Il est très clair qu’une direction
scientifique adéquate devra être mise place pour élucider les liens qui existent
entre la MPOC et ces expressions systémiques de la maladie.
![Page 38: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/38.jpg)
CHAPITRE I. La maladie pulmonaire obstructive chronique
12
Étant donné que le muscle squelettique est d’une importance capitale dans
les manifestations systémiques chez la MPOC, la prochaine section introduira ce
sujet qui servira de base pour cette thèse.
![Page 39: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/39.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
13
1.2 LE MUSCLE SQUELETTIQUE
1.2.1 Introduction générale
Le muscle squelettique a pour fonction d’assurer le mouvement, la stabilité
des articulations et la production de chaleur. Le muscle squelettique constitue
environ 40% de notre masse corporelle contribuant à environ 25% de notre
métabolisme de base et est en soi, un réservoir important de protéines (56).
Le muscle est composé de plusieurs types de cellules (Figure 3). Les
myotubes (fibre musculaire), l’endothélium vasculaire, les fibroblastes et les
cellules satellites composent le tissu musculaire. Les fibres musculaires sont
organisées en groupes appelés faisceaux. Les faisceaux sont séparés par une
couche de tissu conjonctif, soit le périmysium. À l’intérieur d’un seul faisceau, nous
pouvons retrouver des dizaines de fibres musculaires. Chaque fibre musculaire est
une cellule individuelle composée principalement de longs cylindres, soit les
myofibrilles. Les myofibrilles comptent pour environ 90% du volume des cellules
musculaires. Chaque myofibrille est un enchaînement de sarcomères et ceux-ci
constituent l’unité de base contractile du système musculaire. Un sarcomère
individuel est un regroupement organisé de myofilaments épais (myosine),
chevauchés de part et d’autre par des myofilaments minces (actine, troponine,
myotroponine). C’est l’interaction entre la myosine et l’actine des filaments minces,
en présence de calcium cytosolique, qui engendre les contractions musculaires.
Finalement, l’organisation extrêmement serrée des myofibrilles fait en sorte que les
mitochondries et les noyaux de la cellule musculaire sont principalement confinés
dans les zones périphériques du sarcoplasme du myocyte.
![Page 40: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/40.jpg)
CHAPITRE I. Le muscle squelettique
14
Figure 3. Le muscle squelettique. Adapté de Farell et al. 2012.
![Page 41: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/41.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
15
Pour répondre aux nombreuses et diversifiées tâches physiques
quotidiennes, le muscle est composé de plusieurs types de fibres musculaires. Les
fibres musculaires sont classées selon le type de myosine qu’elles expriment.
Chez l’humain, trois types de fibres coexistent. Les fibres I, IIa et IIx (56). Les
fibres de type I ou fibres à contraction lente (slow twitch) démontrent
principalement un métabolisme oxydatif pour produire leur énergie et sont
résistantes à la fatigue. Elles sont donc le type de fibres de prédilection des efforts
d’endurance, comme la course de longue durée. Les fibres de type IIx, ou fibres à
contraction rapide (fast twitch), démontrent principalement un métabolisme
glycolytique pour produire leur énergie et sont à prédominance anaérobique. Elles
sont donc le type de fibres impliquées dans les efforts de haute intensité et de
courte durée. Les fibres de type IIa, également à contraction rapide, démontrent un
métabolisme intermédiaire (oxydatif et glycolytique). Elles sont utiles pour des
efforts aussi bien d’endurance que de sprint (56).
1.2.2 Le métabolisme énergétique
La transition de l’état de repos à une contraction tétanique musculaire
impose une demande importante au métabolisme musculaire en comparaison aux
autres tissus. Cette contraction musculaire dépend principalement de l'énergie
obtenue par l'hydrolyse de l'adénosine triphosphate (ATP). L’utilisation de l’ATP
peut augmenter de 0.01 μmol/g/sec au repos jusqu’à 10 μmol/g/sec en 30 ms (56).
C’est seulement en considérant la réponse du système énergétique musculaire
dans son ensemble que nous pouvons apprécier et comprendre ce phénomène
bien orchestré.
Plusieurs filières énergétiques sont connues pour nous permettent de
subvenir à nos besoin en ATP. Il s’agit de la filière de l’adénosine triphosphate-
créatine phosphate (ATP-CP ou phosphagène), de la filière glycolytique et de la
filière aérobie.
![Page 42: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/42.jpg)
CHAPITRE I. Le muscle squelettique
16
La filière de l’adénosine triphosphate-créatine phosphate (ATP-CP ou phosphagène) Une certaine quantité d’ATP est entreposée dans nos muscles, ce qui
permet une contraction rapide au début de l’effort. Par la suite, la formation rapide
de l'ATP peut être accomplie par le transfert d’un lien phosphate riche en énergie
de la phosphocréatine (CP) vers l’adénosine diphosphate (ADP). Cette réaction est
catalysée par l’enzyme créatine kinase (CK). Il y a aussi la réaction de l’adénylate
kinase (ADK) qui transforme 2 molécules d’ADP en ATP (56). Parce que la
quantité de CP et d’ADP dans le muscle est faible, la contribution de cette réaction
est très courte (entre 0 et 10 secondes après le début de l’effort). Lorsque
l'oxygénation et la contribution du système glycolytique du muscle deviennent
suffisantes, les quantités de CP et d’ADP sont reconstituées.
La filière glycolytique Une fois la source énergétique des phosphagènes épuisée, de nouveaux
substrats sont nécessaires pour assurer une resynthèse rapide de l’ATP. C’est le
glycogène emmagasiné dans les muscles et le foie ainsi que le glucose sanguin
qui assurent cette production énergétique. La production d’énergie se déroulant
dans le sarcoplasme musculaire (grâce aux réactions enzymatiques) permet un
effort de haute intensité mais limité en durée (entre 30 secondes et 2 à 3 minutes)
(56). La dégradation du glucose produit de l’ATP et de l’acide pyruvique destinés
au cycle de Krebs pour la phosphorylation oxydative, mais qui se transforme aussi
en lactate lors d’une chute d’oxygène et lorsque que l’effort musculaire élevé
cause une surproduction de pyruvate et une saturation du complexe pyruvate
déshydrogénase (PDC). Le lactate accumulé dans les muscles et déversé dans le
sang est associé à une altération du fonctionnement des filières énergétiques, à la
fatigue musculaire, à la douleur musculaire ainsi qu’à l’apparition d’ions H+ qui
seraient à l’origine de l’acidité musculaire suite à un exercice de haute intensité (3).
Par contre, les mécanismes reliés à ce phénomène ne sont pas encore tous
élucidés.
![Page 43: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/43.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
17
La filière aérobie L’apport d’oxygène dans les fibres musculaire va permettre un énorme
rendement énergétique. Plus de 90% de l’ATP synthétisé au niveau musculaire est
fourni par la filière aérobie. La transformation se produit dans les mitochondries,
centrales énergétiques permettant de transformer l’ATP dans les cellules
musculaires. Cette filière, par l’entremise du cycle de Krebs, permet d’oxyder
l’acide pyruvique issu de la glycolyse (phosphorylation oxydative) et métaboliser
les lipides (beta-oxydation) pour produire de l’énergie. Elle rend aussi possible la
réutilisation du lactate pour resynthétiser du glycogène ou de l’ATP. À ce titre,
nous pouvons considérer l’acide lactique non pas comme un déchet, mais comme
une source d’énergie chimique. Seuls les acides présents dans le sang seront
tamponnés et éliminés dans les urines (3).
![Page 44: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/44.jpg)
CHAPITRE I. Le muscle squelettique
18
En guise de résumé des principaux acteurs qui seront abordés dans le
chapitre 3, la figure suivante récapitule l’ensemble des joueurs capitaux des filières
énergétiques.
Figure 4. Schéma récapitulatif des filières énergétiques menant à la production
d’ATP.
ATP, Adénosine triphosphate : ADP, Adénosine diphosphate : Pi, Phosphate inorganique : CK, Créatine kinase : Cr, Créatine : ADK, Adénylate kinase : HK, Hexokinase : G-1-P, Glucose-1-Phosphate : G-6-P, Glucose-6-Phosphate : F-6-P, Fructose-6-Phosphate: PFK, Phosphofrutokinase : CS, Citrate synthase HADH, 3-Hydroxyacyl CoA-déhydrogénase : LDH, Lactate déhydrogénase.
De façon hiérarchique, le système ATP-CP procure la première source
d’ATP au début de l’exercice. Tout d’abord, l’ATP accumulé dans le muscle sera
utilisé alors que les réactions de la CK et de l’ADK se poursuivront afin de soutenir
le niveau d’ATP pendant les premières secondes de l’exercice. Par la suite, la
![Page 45: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/45.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
19
glycolyse, par l’entremise de la dégradation du glycogène et du glucose, produira
une grande quantité d’ATP, de pyruvate en présence d’oxygène et de lactate en
anaérobie. Plusieurs étapes de la glycolyse sont cruciales, dont la reprise du
Phosphate inorganique (Pi) et des réactions de l’Hexokinase (HK) qui transforme
le glycogène en Glucose-6-Phosphate (G-6-P) et la Phosphofrutokinase (PFK) qui
transforme le Fructose-6-Phosphate (F-6-P) en pyruvate. Une quantité de pyruvate
sera transformée en lactate par la réaction du lactate déhydrogénase (LDH),
surtout en début d’exercice, à très haute intensité et en réduction d’oxygène. Lors
de l’exercice persistant, le pyruvate sera repris par le cycle de Krebs où le glucose
et les lipides formeront une très grande quantité d’ATP avec la réaction de la
phosphorylation oxydative et de la beta-oxydation. Les enzymes comme la citrate
synthase (CS), première étape du cycle de Krebs, et la 3-Hydroxyacyl CoA
dehydrogenase (HADH), troisième étape de la beta-oxydation des lipides, servent
de marqueur de la capacité oxydative. Il est à noter que ces filières énergétiques
travaillent sans cesse pendant un effort physique. Seulement leur contribution en
production d’ATP changera pendant l’exercice (Figure 5).
![Page 46: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/46.jpg)
CHAPITRE I. Le muscle squelettique
20
Figure 5. Schéma de la contribution temporelle des différentes filières énergétiques à l’exercice
Les substrats énergétiques Les principaux types de «carburants» utilisés par le muscle sont le
glycogène, le glucose et les acides gras libres (54, 58, 214). Les sources d'énergie
utilisées par les muscles qui travaillent lors d’un exercice en endurance dépendent
d'un certain nombre de facteurs comme l'intensité, le type et la durée de l'exercice,
le conditionnement physique de l’individu et le régime alimentaire de celui-ci (67).
Au repos, les muscles utilisent principalement les acides gras (56, 58). Au cours
d’un exercice de haute intensité, l'exercice isométrique, la glycolyse anaérobie et
la réaction de la CK sont les principales sources d'énergie (214). Pendant
l'exercice sous-maximal, le type de substrat utilisé par le muscle est fortement
dépendant de l'intensité relative de l'exercice. Lors d’un exercice sous-maximal de
faible intensité, les principales sources d'énergie sont le glucose du sang et les
acides gras libres. Pendant un exercice sous-maximal de haute intensité, la
proportion d'énergie provenant du glycogène et du glucose est augmentée, et par
conséquent, le glycogène devient la principale source. Une des causes de la
![Page 47: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/47.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
21
fatigue musculaire survient lorsque le glucose et les réserves de glycogène sont
épuisées (communément appelé «frapper le mur») (56). Les sources d'énergie
musculaire varient également selon la durée de l'exercice. Au cours de la première
heure d’un exercice à faible intensité (comme le jogging), le glucose, le glycogène,
et acides gras libres sont les principales sources d'énergie. L'absorption des
acides gras libres par le muscle augmente sensiblement après la première heure
d’exercice jusqu’à environ la 4ième heure. Après quatre heures, l'oxydation des
lipides devient la principale source d'énergie (40). La section suivant abordera
comment le muscle maintien sa structure et son volume au niveau cellulaire.
![Page 48: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/48.jpg)
CHAPITRE I. Le muscle squelettique
22
1.2.3 La signalisation intramusculaire associée au maintien de la masse musculaire
Le muscle squelettique est un tissu malléable capable d’altérer son type et
sa quantité de protéines en réponse à des perturbations de l’homéostasie
cellulaire. Le stress oxydant, l’inflammation et la contraction musculaire
représentent de puissants stimuli qui peuvent générer des perturbations
significatives dans le milieu cellulaire musculaire et ainsi provoquer des
modulations importantes et initier une adaptation à l’environnement extracellulaire.
La perturbation de l’homéostasie de façon fréquente et répétée produit une
cascade d’évènements biochimiques qui modifieront dans un premier temps les
mécanismes adaptatifs, suivi par les modifications des caractéristiques
musculaires pour ainsi répondre aux perturbations cellulaires (Figure 6) (217).
Figure 6. Séquence des évènements de l’adaptation cellulaire à la suite de stimuli. Adapté de Williams 2011
Basé sur Williams 2011 (217)
![Page 49: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/49.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
23
Les avancées biotechnologiques ont permis la découverte de mécanismes
spécifiques de la signalisation cellulaire qui initient la réplication de séquences
d’ADN et participent à la traduction du messager génétique pour ainsi créer de
nouvelles protéines. Ultimement, les processus d’adaptation et de plasticité
musculaires sont déterminés par la source, l’intensité et la fréquence des stimuli
ainsi que la demi-vie des protéines influentes.
Le procédé par lequel un signal mécanique est converti en évènement
biochimique dans une cellule musculaire a été nommé la mécanotransduction (84).
Ce procédé inclut l’activation de messagers primaires et secondaires qui initient
une cascade d’évènements cellulaires, résultant en l’activation et/ou la
désactivation de différentes voies de signalisation reliées entre autres à la
synthèse et à la dégradation protéique (217). Plusieurs stimuli peuvent entraîner
une modulation de diverses voies de signalisation, mais il n’en demeure pas moins
que la contraction musculaire est l’un des facteurs les plus puissants pour
influencer les voies de signalisation associées à la synthèse ou à la dégradation
protéique (84).
La majorité des signaux proviennent des facteurs suivants, mais ne sont pas
nécessairement limités à :
Une surcharge musculaire (l’entraînement en résistance);
Une augmentation de l’activation électrique du muscle (EMG);
Une influence autocrine (IGF-1, prostaglandines, etc.);
Une réponse associée aux cytokines inflammatoires (IL-6, TNF, IL-8, etc.);
Une influence des facteurs de croissance;
Une diminution des enzymes associées au profil glycolytique (CK, LDH) ;
Une régulation accrue de la myostatine,
et finalement,
Une traduction de signaux extracellulaires qui activent les signaux
intracellulaires ainsi que des facteurs de transcription.
![Page 50: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/50.jpg)
CHAPITRE I. Le muscle squelettique
24
Une réponse commune aux signaux extracellulaires est l’activation de
protéines kinases et de phosphatases intracellulaires qui modifient le niveau de
phosphorylation de plusieurs molécules intracellulaires et nucléaires. En bout de
ligne, ces modifications affecteront la fonction de protéines cruciales au niveau
musculaire. En plus de la phosphorylation et de la déphosphorylation des
protéines, d’autres modifications post-transcriptionnelles comme l’ubiquitination, la
glycosylation, l’acétylation et d’autres peuvent exercer une influence sur l’activité
des protéines (89). La prochaine section mettra l’emphase sur les principales voies
de signalisation influencées par les cytokines inflammatoires la phosphorylation et
l’ubiquitination, surtout impliquées dans l’hypertrophie du muscle squelettique,
c’est-à-dire une réponse biologique où la surface transversale des fibres d’un
muscle augmente, et l’atrophie du muscle squelettique, c’est-à-dire une diminution
de la taille de la cellule principalement causée par la perte de protéine et la
diminution du volume cytoplasmique.
Les voies de signalisation Après l'initiation de signaux extracellulaires, de nombreuses cascades de
signalisation s’activent dans les cellules musculaires. Il y a plusieurs voies de
signalisation ainsi que de nombreuses possibilités de « cross-talk » entre ces
voies. À ce jour, plusieurs voies de signalisation qui influencent le maintien de la
masse musculaire ont été démontrées (Figure 7) (178).
![Page 51: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/51.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
25
Figure 7. Schéma des principales voies de signalisation jouant un rôle dans le maintien de
IL-6, Interleukin 6 : IL-8, Interleukin 8 : TNF-α, Tumor necrosis factor alpha : NF-κB, Nuclear factor kappa B: MAPK, Mitogen-Activated Protein Kinase: ERK, Extracellular signal-regulated kinase: JNK, c-Jun N-terminal Kinase : p38, p38 MAPK : IGF-1, Insulin-like growth factor 1: mTOR, Mammalian target of rapamycin: p70S6K, Isoforme de 70 kDa de la protéine S6 kinase 1 : 4E-BP1, eIF4E binding protein 1: FoxO, Forkhead box of the class O: GSK-3β, Glycogen synthase kinase 3β: Atrogin1, MAFbx Muscle Atrophy F-box: MuRF1, Muscle RING Finger 1: Translocation Activation Inhibition Un «P» dans un cercle signifie une phosphorylation de la protéine. Un «FT» signifie un facteur de transcription.
IGF-1/AKT/mTOR Une des voies de signalisation ayant un rôle majeur dans la synthèse
protéique est la cascade de signalisation reliée à ‘l'Insuline-like Growth Factor’
(IGF-1) et la protéine kinase B (AKT) (146). Dans cette cascade, l'IGF-1 se lie à
![Page 52: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/52.jpg)
CHAPITRE I. Le muscle squelettique
26
son récepteur, une sérine/thréonine kinase qui phosphoryle et active entre autres
AKT, ce qui ultimement promouvoit la synthèse des protéines par l'activation du
mammalian target of rapamycin (mTOR), une protéine pivot dans la traduction
protéique (117) et de la protein 70 s6 kinase (p70S6K), une kinase nécessaire pour
le maintien de la masse musculaire (144). De plus, la phosphorylation d’AKT
bloque la glycogen synthase kinase-inhiber 3β (GSK-3β), inhibiteur de la synthèse
protéique (146).
En plus de l’activation de la p70S6K, mTOR est aussi connue pour inhiber la
l’Eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1), qui est un
régulateur négatif du facteur d’initiation de la transcription eIF-4E (158). Bien que
la voie de l'IGF-1 active la protéine mTOR en aval de la phosphorylation de 4E-
BP1 et de la p70S6K, les acides aminés provenant du milieu extracellulaire peuvent
aussi influencer directement mTOR, ce qui provoque une stimulation subséquente
de l'activité de la p70S6K (79).
En plus de stimuler la synthèse protéique, AKT inhibe également
l'expression des E3 ligases, soit l’enzyme Muscle-specific RING Finger E3 (MuRF)
et le muscle-specific atrophy gene-1/muscle atrophy F-box (Atrogin1) par
l’entremise de la phosphorylation de la classe de facteurs de transcription forkhead
box O (FoxO) (172), ce qui séquestre celui-ci au cytoplasme et ne peut donc pas
lui permettre de transcrire et d’initier l’expression des gènes des E3 ligases et ainsi
participer à la dégradation protéique par la voie de l’Ubiquitine-protéasome (Ub-
P’some) qui sera discutée dans une section subséquente.
Mitogen-Activated Protein Kinases (MAPK) Les MAPK sont activées en réponse à un stress mécanique comme
l’exercice, un stress oxydant et même l’inflammation (98). Les 3 membres les plus
étudiés de la famille des MAPK, sont l’Extracellular signal-Regulated Kinase 1-2
(ERK 1/2), la p38 MAPK et la c-Jun N-terminal Kinase (JNK). Ils sont connus pour
être impliqués dans le processus d’atrophie musculaire en culture cellulaire et chez
les modèles animaux d'immobilisation (94, 114). Dans des cellules C2C12 exposées
au TNF-α, l’activation de ERK 1/2 donne lieu à une plus grande expression d’une
![Page 53: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/53.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
27
E3 ligase spécifique aux muscles, Atrogin1, qui est impliquée dans la dégradation
des protéines, suggérant que ERK 1/2 pourrait jouer un rôle crucial dans la
pathogenèse de l'atrophie musculaire (150). D’un autre côté, compte tenu de la
réponse très variée de ERK 1/2 à différent stimuli, il est raisonnable de suggérer
que ERK 1/2 est un médiateur de processus cellulaires d’important pour le
maintien de la masse musculaire chez l’humain (98). La p38 MAPK est également
un médiateur important dans la réponse au stress oxydant qui peut induire
l'expression des gènes d’Atrogin1 et MuRF ainsi que l’activité du protéasome dans
le muscle squelettique (90, 114). Enfin, les souris déficientes en JNK sont
protégées contre la perte de force musculaire induite par un stress inflammatoire
(194).
Les joueurs clés ayant une influence sur la modulation et la régulation de la
voie des MAPK sont complexes et proviennent de multiples sources. Il est bien
connu que la voie des MAPK est critique dans la réponse biologique de nombreux
types cellulaires (33, 82).
Ubiquitine-protéasome (Ub-P’some) Le système de l’Ubiquitine-protéasome est une voie régulatrice responsable
de la dégradation de protéines endommagées ou devenues inutiles puisqu’ayant
jouées leur rôles biologiques (221). Une fois marquée par une queue de
polyubiquitines, ces protéines sont dégradées par le protéasome, un complexe
multi-protéique qui catalyse la fragmentation des protéines en polypeptides (221).
Ce marquage constitue un signal cellulaire qui pourra, entre autres, permettre la
migration d’une protéine vers un compartiment cellulaire spécifique. Puisque l’objet
de cette thèse s’intéresse à la dégradation des protéines contractiles, le focus de
cette section se fera sur son rôle en tant que machinerie protéolytique.
Le marquage de protéines avec l'ubiquitine comporte trois étapes cruciales.
La première étape est faite par une enzyme nommée « Ubiquitin-activating
enzyme » (E1) et consiste en une carboxylation de l’ubiquitine. Cette enzyme
ubiquitine possède une quantité importante d’énergie (ATP) qui est nécessaire aux
prochaines étapes d’ubiquitination de la protéine à marquer pour la dégradation.
![Page 54: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/54.jpg)
CHAPITRE I. Le muscle squelettique
28
La deuxième étape de l’ubiquitination est sous la responsabilité des « Ubiquitin-
carrier proteins » (E2). À la suite de son activation par l’enzyme E1, l’ubiquitine est
transférée sur une E2 et est ensuite responsable du transport de l’ubiquitine vers la
protéine à dégrader (107). Ensuite, les E2 préparent la molécule ubiquitine (Ub)
pour la conjugaison avec l‘« Ubiquitin-protein ligases » (E3) et catalysent la liaison
finale de l'ubiquitine aux protéines spécifiques qui seront dégradées par le
protéasome (178). Ces étapes sont répétées à plusieurs reprises et forment une
queue de polyubiquitines sur les protéines ciblées pour être dégradées. Ce sont
les E3 qui sont responsables de la spécificité du système ubiquitine-protéasome
(140) (Figure 8). La voie de l’Ub-P’some est activée dans un certain nombre de
conditions atrophiques, y compris l'inactivité et l'inflammation (106).
Figure 8. Schéma du processus de dégradation protéique par l’ubiquitination
E1, Ubiquitin-activating enzyme : E2, Ubiquitin-carrier proteins : E3 Ubiquitin-protein ligases
En plus d'avoir une spécificité au niveau des protéines cibles (HIF, Notch,
![Page 55: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/55.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
29
etc), les ubiquitines ligases ont une spécificité tissulaire: par exemple, Atrogin1 et
MuRF sont spécifiquement exprimés dans le muscle (68, 106). L’activité et la
pertinence de MuRF et Atrogin1 ont d'abord été identifié par rapport à l’atrophie
induite par l’immobilisation et aux modèles animaux ayant une inhibition de
l’expression de ces ligases qui sont résistants à l'atrophie musculaire causée par
une dénervation (17).
Les cytokines inflammatoires Un domaine de signalisation important est celui associée aux cytokines
inflammatoires, notamment la signalisation associée au Tumor Necrosis Factor-α
(TNF-α). Entre autre, les niveaux sanguins de TNF-α sont augmentés chez les
patients présentant une cachexie cancéreuse (4). La liaison du TNF-α à son
récepteur induit une activation de la famille des facteurs de transcription reliés à
NF-κB (213), qui est essentielle à la dégradation protéique associée à
l’inflammation (102). Cette cytokine est impliquée dans l'atrophie musculaire par
l’entremise de facteurs de transcription comme FoxO (108, 179). Elle augmente la
dégradation protéique par l’entremise de la p38 MAPK (114). Étant donné que les
essais expérimentaux d’anti-TNF-α n’ont pas démontré de prévention significative
de la cachexie cancéreuse, il se pourrait qu’in vivo, TNF-α soit un facilitateur et non
le seul responsable de la dégradation protéique (57). Par conséquent, TNF-α
pourrait agir en synergie avec d’autres facteurs inflammatoires comme
l’Interleukine-6 (IL-6) ou même le Sérum Amyloïde A1 (SAA1) pour promouvoir la
dégradation protéique (voir plus bas). Les cytokines jouent un rôle d’importance
dans le maintien de la masse musculaire ainsi que dans la réponse à l’exercice
chez l’humain (149, 225). Par contre, l’étude de leur action spécifique sur les voies
de signalisation musculaire était au-delà des objectifs de cette thèse. Le chapitre 4 de ma thèse requiert une introduction plus approfondie sur le
Sérum Amyloïde A1 (SAA1). SAA1 est une protéine de phase aiguë de la famille
des apolipoprotéines associées aux lipoprotéines de haute densité (HDL). Elle est
impliquée dans la réponse aux dommages tissulaires, d’infection et surtout
d’inflammation. Il est à noter que le but premier des protéines de phase aiguë est
![Page 56: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/56.jpg)
CHAPITRE I. Le muscle squelettique
30
de restaurer l’homéostasie cellulaire (123). Donc, SAA1 semble être un marqueur
typique de la réponse inflammatoire, et ce, probablement en lien avec un rôle dans
la modulation de plusieurs réponses immunitaires (81, 124, 205). On a proposé
récemment que cette protéine puisse être utile comme marqueur potentiel de
l’exacerbation chez les patients atteints de la MPOC (23). Ses fonctions
biologiques spécifiques sont par contre très peu connues. La source principale de
production de SAA1 semble être le foie, mais plusieurs études démontrent des
niveaux mesurables de SAA1 dans plusieurs autres tissus incluant les reins,
l’estomac, la rate, le cœur, le cerveau et surtout le muscle squelettique (204, 205).
Dans l’inflammation chronique, lors de dérèglement de l’homéostasie, les niveaux
de SAA1 augmentent considérablement et avec d’autres molécules pro-
inflammatoires, contribuant à la boucle de rétroaction positive inflammatoire,
incapable d’être contrôlée par les médiateurs anti-inflammatoires communs. Plus
spécifiquement dans le muscle, la participation de SAA1 dans l’expression de
cytokines pro-inflammatoires et sa contribution dans l’augmentation de la
dégradation protéique musculaire sont déjà démontrées dans un modèle cellulaire
(224). Cependant, les mécanismes biochimiques associés à ce phénomène
demeurent encore méconnus.
![Page 57: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/57.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
31
1.2.4 La réponse cellulaire à l’exercice en résistance
La réponse cellulaire déclenchée par une seule séance d'exercice génère
une augmentation de la transcription nucléaire résultant en une plus grande
quantité d’ARNm spécifiques aux gènes impliqués dans la réponse à l’exercice.
L'expression des gènes, les niveaux d’ARN et des protéines en réponse à
l'exercice est modulée à plusieurs niveaux, mais reflète généralement une
adaptation à un nouveau milieu cellulaire causé par l’exercice (20). La contraction
musculaire répétée génère des augmentations transitoires de la quantité d'ARNm
en provenance des gènes stimulés entre 3 et 12 heures après l'exercice, tandis
que le retour au niveau de base est normalement atteint 24 heures après l’exercice
(16, 152, 159). Par conséquent, des sessions d’exercice successives se traduiront
par une activité transcriptionnelle accrue qui amplifiera la synthèse des protéines
musculaires. Dans ce contexte, l'adaptation musculaire chronique à l’exercice est
due aux effets cumulatifs de chaque session d’exercice, menant ultimement à un
changement de l'état d'équilibre de la synthèse protéique spécifique à l’exercice
qui est fait. Ce phénomène amène un effet d’adaptation à l’exercice se traduisant
en gain de fonctions musculaires (Figure 9) (62, 121).
![Page 58: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/58.jpg)
CHAPITRE I. Le muscle squelettique
32
Figure 9. Schéma de l’adaptation cellulaire post-exercice chez l’humain. Adapté de
Freyssenet 2006
Basé sur Freyssenet (62)
De façon plus spécifique et toujours en gardant en tête les voies de
signalisation discutées auparavant, les prochains paragraphes se veulent un survol
de la réponse individuelle à l’exercice de chaque protéine d’intérêt pour cette
thèse.
AKT à l’exercice La voie IGF-1/AKT/mTOR induit une hypertrophie du muscle squelettique
via l’initiation de la traduction et l'augmentation du contenu protéique (138). Tel
qu’indiqué auparavant, AKT a de nombreuses cibles moléculaires en rapport avec
ses diverses fonctions physiologiques, y compris celles qui sont impliquées dans la
synthèse des protéines (mTOR, GSK-3β, p70s6k, FoxO) (59, 99, 147). Par
exemple, l’activation d’AKT augmenterait la synthèse protéique par l’augmentation
de l’activité du facteur de l’eukariotic initiation factor 2B (elF2B) (95). De plus, AKT
peut phosphoryler mTOR, qui à son tour, peut mener à la phosphorylation de
p70s6k et 4E-BP1 (80). Ceci dit, l’activation répétée d’AKT pour une période de 2 à
![Page 59: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/59.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
33
3 semaines est suffisante pour augmenter de façon significative la masse maigre
(103). Bolster et al. (2003b) ont étudié l'évolution temporelle de la réponse d’AKT à
l'exercice en résistance et ont observé que la phosphorylation d’AKT est à son
maximum entre 5 et 15 minutes à la suite d'une session d’exercice en résistance
(18). De plus, Dreyer et al (2006) ont observé une augmentation de la
phosphorylation d’AKT 60 minutes après une session d’exercice en résistance
(51). Par contre, Masher et al. (2008) n’ont remarqué aucun changement des
niveaux de phosphorylation d’AKT 120 minutes après une session d’exercice en
résistance (134). Les différences entre les sites de phosphorylation, le temps de
prise des biopsies, l’intensité et le type d’exercice peuvent avoir contribué à des
conclusions diverses. Malgré tout, AKT demeure un médiateur d’importance dans
la réponse à l’exercice en résistance chez l’humain.
mTOR à l’exercice Le complexe protéique impliquant la protéine mTOR est capable de détecter
des signaux divers et de produire une multitude de réponses, y compris la
traduction de l’ARNm, la biogenèse des ribosomes et le métabolisme des
nutriments (180). Les cibles primaires en aval de mTOR comprennent p70S6K, 4E-
BP1 et le facteur de l’eukaryotic initiation factor 4B (eIF4B) qui relient mTOR avec
la traduction de l’ARNm, la synthèse protéique et la taille des cellules (17, 144,
171). Cependant, les mécanismes complexes d’activation de mTOR liés à
l'adaptation à l’exercice ne sont pas tous connus (180). Dreyer et al. (2006) ont
montré une augmentation de la phosphorylation de mTOR jusqu'à 2 heures après
une session d’exercice en résistance, procurant du même coup des évidences que
la protéine mTOR est impliquée dans les processus anabolisants après l'exercice
en résistance (51). Masher et al. (2008) ont aussi démontré une augmentation du
niveau de phosphorylation de mTOR 15 à 120 minutes après une session
d’exercice en résistance (134). mTOR semble donc être un joueur notable dans la
synthèse protéique en réponse à l'entraînement en résistance, et ce, même s’il
peut aussi être modulé par la nutrition, l'activité physique et l'âge (117).
p70 S6K à l’exercice
![Page 60: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/60.jpg)
CHAPITRE I. Le muscle squelettique
34
De nombreuses études supporte le rôle fondamental de la p70S6K dans
l'hypertrophie du muscle squelettique (6, 17, 92, 139). Il semble exister un lien
étroit entre l'augmentation de l'activité de la p70S6K et l’hypertrophie musculaire
suite à 6 semaines de stimulation électrique à hautes fréquences (7). De même,
l’augmentation de la phosphorylation de la p70S6K associée à la contraction
excentrique serait nécessaire pour l’hypertrophie musculaire (191). La protéine
p70S6K est reconnue pour initier la traduction de protéines contractiles (36, 44, 50,
134) et sa phosphorylation rapide après une séance unique d’entraînement corrèle
avec le gain de masse maigre à la suite d’un programme d’entraînement de
plusieurs mois (197).
GSK-3β à l’exercice La protéine GSK-3β, de son côté, est un substrat distinct de la voie mTOR,
directement activée par AKT. L’expression de la protéine dominante négative
GSK-3β, inhibiteur de la synthèse protéique (146), a un effet sur l’hypertrophie
musculaire dans des myotubes en culture (168). À la suite d’un exercice en
résistance, les niveaux de phosphorylation de la GSK-3β sont augmentés de
façon significative et ce jusqu’à 3 heures après la fin de la session d’exercice (109,
133, 175).
MAPK à l’exercice La voie des MAPK fait partie des voies de signalisation les plus complexes.
Les MAPK coordonnent l'expression de gènes du cycle cellulaire, du métabolisme,
de la survie et de l'apoptose (169). Parmi les cinq groupes distincts de MAPK,
deux d’entre eux ont été davantage caractérisés à l'égard de la réponse à
l'exercice, soit ERK 1/2 et la p38 MAPK avec ses isoformes α, β, γ et δ (176). La
capacité de l’exercice à induire une activation des MAPK est indéniable. Par
contre, la spécificité de cette réponse et le résultat physiologique demeurent
méconnus et probablement contexte dépendant (143, 199, 219).
ERK 1/2 à l’exercice L’activité et l’expression de ERK 1/2 à la suite d’un exercice augmentent
quels que soient l'intensité, la durée ou le mode d'exercice (43, 219). Fait
![Page 61: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/61.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
35
intéressant, cette réponse peut être atténuée avec l'âge (219). Il a été postulé que
ERK 1/2 est impliqué dans une «réponse générale» à l'exercice qui pourrait inclure
l’expression de gènes spécifiques à l’exercice ou contribuer à la modulation de
voies de signalisation importantes pour la traduction protéique (63, 186, 219).
Compte tenu de la réponse très variée de ERK 1/2 à l’exercice, il est raisonnable
de suggérer que ERK 1/2 est un médiateur de processus cellulaires qui est
important pour le maintien de la masse musculaire (98). La durée du signal de
ERK1/2 influence l'activité fonctionnelle des gènes, et ultimement la réponse
biologique (136).
p38 MAPK à l’exercice L'activation de la p38 MAPK a été observée à la suite d’un exercice en
résistance chez les humains (92, 219). Il semble que la p38 MAPK soit
responsable de multiples régulations de processus cellulaires, y compris
l'expression des gènes myogéniques et mitochondriaux et de l'activité de
l’ubiquitine-protéasome, ce qui rend difficile d’établir un rôle clair et précis pour la
p38 MAPK en réponse à l'exercice (1, 114, 116). Une étude de Deldicque et al.
(2008) a démontré une augmentation de 10 fois les valeurs de base de la
phosphorylation de la p38 MAPK à la suite d’un exercice en résistance (43). Ces
auteurs ont suggéré que la p38 MAPK pourrait agir sur la p70s6k et ainsi être un
joueur majeur dans la réponse à l’exercice en résistance chez l’humain. De plus,
une étude menée par Li et al. (2005) a révélé que la p38 MAPK serait également
impliquée dans l'atrophie musculaire, par l’entremise de la cytokine inflammatoire
TNF-α.
La réponse divergente des MAPK à la suite d’un exercice limite notre
compréhension sur les fonctions physiologiques humaines. En effet, une grande
partie de nos connaissances concernant les réponses des MAPK suite à l'exercice
repose sur des données de corrélation avec peu d'information sur les mécanismes
de régulation.
![Page 62: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/62.jpg)
CHAPITRE I. Le muscle squelettique
36
Les cytokines à l’exercice Les cytokines qui sont produites majoritairement par les muscles actifs, sont
des petits polypeptides libérés au site de l'inflammation en réponse à de nombreux
facteurs, y compris les dommages musculaires causés par l'exercice (28, 86, 148).
Plusieurs cytokines (TNF-α, IL-6, Interleukine-8 (IL-8)) ont été impliquées dans
l'initiation et la suppression de la dégradation et de la synthèse protéique suite à
une blessure musculaire (65, 220).
L’exercice en résistance fournit une réponse autant inflammatoire qu’anti-
inflammatoire dans le muscle squelettique (25, 76). Il semble désormais possible,
sinon très probable, que cette réponse soit due à des changements locaux dans le
muscle plutôt qu’à des changements systémiques (148). Le muscle squelettique
est considéré comme un organe endocrine participant à l’activation de
l’inflammation en raison de sa capacité à produire des cytokines comme l’IL-6 et le
TNF-α (148, 154). Une étude a démontré que les adaptations à l’exercice en
résistance améliorent la force musculaire et réduisent la réponse des niveaux
d'ARNm inflammatoire sans altérer les concentrations plasmatiques de TNF-α ou
d’IL-6 (104). Par contre, la quantité et le rôle précis des médiateurs inflammatoires
sécrétés par le muscle squelettique ne sont pas encore bien définis.
![Page 63: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/63.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
37
Tableau 3. Revue de la littérature comparant les réponses cellulaires temporelles à l’exercice en résistance.
![Page 64: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/64.jpg)
CHAPITRE I. Le muscle squelettique
1.3 LA DYSFONCTION MUSCULAIRE ASSOCIÉE À LA MPOC La MPOC s’accompagne de manifestations extrapulmonaires. Un intérêt
particulier a été porté aux muscles périphériques parce que leur dysfonction
influence non seulement les symptômes qui limitent l'exercice physique, mais
contribue directement à l’intolérance à l’exercice chez les patients atteints de la
MPOC (71). Entre autres, la faiblesse musculaire est reconnue pour contribuer,
indépendamment de la fonction respiratoire, au piètre état de santé des patients
atteints de la MPOC (187) et à l’augmentation de l'utilisation des soins de santé et
à la mortalité (196).
1.3.1 Observations cliniques
Les marqueurs traditionnels de la sévérité de la MPOC, comme le VEMS,
ne prédisent pas bien la mortalité en comparaison avec, par exemple, le
regroupement de facteurs prédictifs comme l’indice de BODE (Body mass index,
airway Obstruction (FEV1), Dyspnea, Exercise tolerance) (31). En effet, la
présence d’obstruction bronchique sévère (VEMS < 50% de la valeur prédite) n’est
pas un très bon indice de survie et de tolérance à l’exercice chez les patients
atteints de MPOC (132, 196). À l’inverse, la normalisation de la fonction
pulmonaire suite à une transplantation pulmonaire ne corrige pas la tolérance à
l'exercice (218). De plus, la réadaptation pulmonaire est efficace pour améliorer de
la qualité de vie et la tolérance à l’exercice des patients, mais n'améliore pas la
fonction pulmonaire (77). Par ailleurs, Schols et al. (1993) ont démontré que
jusqu'à 45% des patients MPOC stables avaient une masse maigre insuffisante ou
avait eu une diminution importante de celle-ci (182). Les techniques d’imageries
médicales récentes ont permis de mettre en lumière des réductions significatives
de la surface de la mi-cuisse et du mollet chez les patients atteints de la MPOC en
comparaison avec des individus sains appariés pour l’âge (13, 132). Bien que
l’essoufflement soit une cause d’arrêt de l’exercice souvent citée chez les patients
MPOC, Killian et al. (1992) ont démontré qu'une proportion étonnante de patients
avaient des symptômes de fatigue musculaire dans les jambes à la suite de l’arrêt
![Page 65: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/65.jpg)
CHAPITRE I. Le muscle squelettique
39
d’un test à l’effort, ce qui implique que le dysfonctionnement des membres
inférieurs peut contribuer à la l’intolérance à l’effort chez ces patients (93). Alors
qu’environ 25% des patients atteints de MPOC citeront la fatigue musculaire des
jambes comme cause d’arrêt de l’exercice lors de la marche, (l’essoufflement étant
la raison la plus commune), environ 70% d’entre eux indiqueront la fatigue
musculaire comme cause d’arrêt lors d’un exercice fait sur vélo stationnaire (130).
La majorité des études ont démontré une réduction de l'endurance et une
augmentation de la fatigabilité du quadriceps (2, 119, 184) en comparaison avec
des sujets sains appariés pour l’âge. Ces anomalies semblent être particulièrement
localisées aux quadriceps. Malgré la présence d'une réduction de 30% de la force
du quadriceps, des études ont déterminé que la force du diaphragme, l'adducteur
du pouce et les muscles abdominaux sont relativement préservés chez les patients
atteints de la MPOC (128, 131). En comparaison avec le quadriceps, le
diaphragme est relativement résistant à la fatigue à l'exercice exhaustif chez les
patients atteints de la MPOC (29). Les fibres du diaphragme d’un patient MPOC
sont métaboliquement plus efficaces que celles des sujets témoins (193). Parmi
les patients présentant une atteinte pulmonaire grave, la force du quadriceps est
un prédicteur de la mortalité (196), comme l’est aussi l’indice de la masse maigre
(132). La faiblesse du quadriceps est également associée à une distance de
marche réduite (71), une réduction de la consommation maximale d'oxygène
( 2OV max) (78) et à l’augmentation de l'utilisation des services de santé (42).
En résumé, les études cliniques démontrent bien que les conséquences de
la MPOC dépassent l’atteinte primaire des poumons et ont d’importantes
répercussions systémiques.
1.3.2 Observations structurales
Les études qui démontrent les anomalies musculaires structurales chez la
MPOC proviennent majoritairement du quadriceps. La plupart des études
démontrent une proportion réduite des fibres de type I des patients atteints d’une
MPOC modérée à sévère en comparaison avec des sujets sains (70). Ce
![Page 66: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/66.jpg)
CHAPITRE I. Le muscle squelettique
40
phénomène est souvent accompagné d’une plus grande proportion de fibres de
type IIx (tableau 4). Ceci a été corroboré par une plus grande proportion de la
chaîne lourde de myosine d’isoforme de type II dans le quadriceps des patients
atteints de la MPOC (127). Ce changement représente un renversement de la
tendance normale du vieillissement qui est caractérisée par une augmentation des
fibres de type I. En plus des changements dans la proportion des fibres
musculaires, une atrophie des fibres de type I, IIa et IIx (70) et une réduction des
capillaires sanguins pour tous les types de fibres musculaires (91) ont été
rapportées. Il est également intéressant de noter que les adaptations structurales
du diaphragme des patients atteints de la MPOC sont à l’opposé de celles
observées dans le quadriceps (28), avec une augmentation de la proportion des
fibres de type I, une réduction des fibres de type II (112, 113) et une augmentation
de la capacité oxydative (111).
![Page 67: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/67.jpg)
CHAPITRE I. Le muscle squelettique
41
Tableau 4. Revue de la littérature comparant les distributions de types de fibres du quadriceps chez les patients atteints de la MPOC MPOC
Études n VEMS1
(% de la prédite)
Type I (% des fibres
totales)
Type IIa (% des fibres
totales)
Type IIx (% des fibres
totales) Whittom, 1998 20 37 32 45 25 Debigaré, 2003 16 39 26 54 20 Couillard, 2003 12 33 27 38 35 Allaire, 2004 16 37 27 43 33 Doucet, 2004 12 65 45 35 20 Russell, 2004 15 46 40 35 25 Koechlin, 2004 18 35 32 39 29 Saey, 2005 32 42 35 42 23 Doucet, 2007 11 31 35 40 25 Gosker, 2007 (Revue) 419 33 (19-44) 41 (18-56) 26 (13-46)
Lemire, 2012 18 34 35 65 SUJETS SAINS
Études n VEMS1
(% de la prédite)
Type I (% des fibres
totales)
Type IIa (% des fibres
totales)
Type IIx (% des fibres
totales) Whittom, 1998 9 --- 60 30 10 Debigaré, 2003 9 --- 39 53 8 Couillard, 2003 10 104 43 2 29 Allaire, 2004 16 110 58 32 7 Doucet, 2004 16 95 55 30 20 Russell, 2004 7 95 62 28 10
Lemire, 2012 9 104 51 49
1.3.2 Observations métaboliques
L’activité enzymatique oxydative est inférieure chez les patients MPOC en
comparaison avec des sujets sains appariés pour l’âge (125). La capacité
d'endurance du quadriceps a été associée de façon significative avec la proportion
de fibres de type I et avec le ratio de l'activité enzymatique oxydative/glycolytique
(195). De plus, la glycolyse est augmentée dans la MPOC tel que démontré par
![Page 68: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/68.jpg)
CHAPITRE I. Le muscle squelettique
42
une élévation de l'activité de la phosphofructokinase (PFK) et de la lactate
déshydrogénase (LDH) dans le quadriceps des patients atteints de la MPOC (87).
De plus, l’augmentation rapide des niveaux de lactate sanguin pendant l'exercice
(126, 177) pourrait être en soit responsable d'une chute du pH musculaire et d’une
acidose systémique (155). Une diminution de la capacité oxydative et une
réorientation vers un métabolisme glycolytique pourraient avoir des implications
négatives sur la tolérance à l’effort (56, 74). Le ratio entre la phosphocréatine (PC)
et le phosphate inorganique (Pi) est étroitement lié à celui de l'ATP/ADP et, par
conséquent, est un marqueur de l'état de l'énergie musculaire. Le rapport PC/Pi
est significativement plus faible (100) lors de l'exercice chez les patients atteints de
la MPOC et la diminution de la PC est plus rapide (198). Gosker et al. (2003) et
Russell et al. (2004) ont également démontré des niveaux significativement réduits
de l’UCP-3 (protéine découplante-3), impliquée dans la régulation du métabolisme
énergétique dans le quadriceps des patients atteints de la MPOC (69, 170).
1.3.2 Observations biochimiques
Les études visant à déterminer si les voies de signalisation cellulaire sont
impliquées dans l'étiologie de la dysfonction musculaire associée à la MPOC en
sont encore à leurs débuts. Doucet et al. (2007) ont démontré des niveaux
d’ARNm de MuRF et d’Atrogin1, ainsi que les des niveaux protéiques de FoxO
significativement augmentés dans le quadriceps des patients atteints de la MPOC,
suggérant une modulation de l’activité des voies atrophiantes chez la MPOC (49).
Contrairement à l’hypothèse de départ, ils ont aussi démontré une augmentation
de la phosphorylation d’AKT, suggérant que la régulation transcriptionelle de
MuRF et d’Atrogin1, par l'intermédiaire FoxO se produit indépendamment d’AKT.
Une augmentation du niveau de phosphorylation de trois protéines associées à
l’hypertrophie musculaire (p70S6K, GSK-3β et 4E-BP1) a aussi été observée chez
les patients atteints de MPOC et ayant une faible masse musculaire par rapport
aux patients ayant une masse musculaire préservée (49). Les auteurs ont proposé
que ceci pourrait être le résultat d'une boucle de rétroaction résultant d’une
![Page 69: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/69.jpg)
CHAPITRE I. Le muscle squelettique
43
tentative non-fonctionnelle de compenser le processus d'atrophie musculaire
présent chez ces patients. Une autre étude a permis de mettre en évidence une
augmentation de d’Atrogin1 et de Nedd4, une E3 ligase impliquée dans le
marquage des protéines à dégrader (153). Au contraire de Doucet et al. (2007),
cette étude n’a pas démontré des niveaux de phosphorylation d’AKT, de p70S6K et
de GSK-3β plus élevés dans le quadriceps des patients MPOC. Un autre groupe a
récemment démontré que la p38 MAPK n’était pas significativement augmentée
dans le quadriceps des patients MPOC, mais que certaines protéines en amont de
la p38 MAPK l’étaient (166). Par contre, une méthodologie contestable pourrait
être à l’origine de ces résultats.
1.3.3 Les causes
Le stress oxydant Le stress oxydant est identifié comme un mécanisme potentiel contribuant à
la dysfonction musculaire chez la MPOC. Les niveaux de stress oxydants sont
augmentés non seulement chez des patients MPOC exacerbés mais aussi chez
les patients stables (164). Le stress oxydant dirige les cellules musculaires dans
un état catabolique et l'exposition chronique à celui-ci mène au dysfonctionnement
du muscle squelettique, notamment en marquant les protéines myofibrillaires pour
la dégradation (24, 96, 115). En contrepartie, il existe des preuves contradictoires
en ce qui concerne la capacité antioxydante chez les patients atteints de la MPOC.
Des études démontrent une diminution de la capacité antioxydante du muscle
squelettique (37, 53), alors qu’une autre étude ne démontre aucune différence
significative entre les patients atteints de la MPOC et des sujets sains (163). La
contribution du stress oxydant à la dysfonction musculaire dans la MPOC demeure
à ce jour spéculative. L’inflammation L'inflammation systémique pourrait être un facteur contribuant à la
dysfonction musculaire dans cette maladie. Comme pour plusieurs autres maladies
chroniques, la MPOC est caractérisée par une inflammation systémique de bas
![Page 70: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/70.jpg)
CHAPITRE I. Le muscle squelettique
44
niveau (181). Certaines cytokines inflammatoires, comme le TNF, d’IL-6, d’IL-8 et
de la protéine C-réactive (CRP) chez les patients atteints de la MPOC (41, 45, 52,
181), suggèrent que les cytokines inflammatoires pourraient jouer un rôle dans la
dysfonction musculaire associée à la MPOC. La littérature suggère que
l'inflammation systémique associée aux exacerbations aiguës peut aussi être
d’une importance capitale dans le développement de la dysfonction musculaire
chez la MPOC. Certains auteurs ont rapporté une relation inverse entre les
niveaux d’IL-8 et la force du quadriceps chez les patients hospitalisés pour une
exacerbation de la MPOC (192). Toutefois, l’implication directe des cytokines
inflammatoires sur la dysfonction musculaire chez la MPOC demeure
controversée. Une étude a démontré que le niveau des cytokines inflammatoires
requis pour induire la perte de masse maigre est beaucoup plus élevé que la
concentration plasmatique observée chez les patients hospitalisés (105). D’autre
part, la préservation relative de la fonction de certains muscles, comme le
diaphragme, est aussi difficile à expliquer si une cause inflammatoire systémique
est retenue comme facteur principal à l’origine de la dysfonction musculaire dans
la MPOC (156). D’autre part, il reste savoir si c’est l'inflammation systémique ou
musculaire qui est la plus importante à étudier dans un contexte de dysfonction
musculaire. Une étude a démontré que le niveau du récepteur TNFRII (récepteur II
du TNF-α) et de la cytokine TNF-α étaient significativement plus bas chez les
patients atteints de la MPOC en comparaison avec des sujets sains appariés pour
l’âge (12). De toute évidence, il semble que les résultats varient selon les études
concernant l’inflammation systémique et musculaire chez la MPOC. Malgré le fait
que l’inflammation semble pouvoir théoriquement contribuer à la dysfonction
musculaire chez la MPOC, aucun résultat ne semble être définitif sur ce sujet. L’inactivité physique
En plus du stress oxydant et de l’inflammation, l’inactivité physique est
possiblement une des causes des anomalies musculaires dans la MPOC. Une
réduction significative de l’activité physique est remarquée dès le début de la
maladie (207). L’inactivité chronique des muscles locomoteurs, fréquente dans la
![Page 71: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/71.jpg)
CHAPITRE I. Le muscle squelettique
45
MPOC (202), s’accompagne de remodelage significatif du muscle soit par la perte
de protéines musculaires (145), des changements de phénotypique de fibres
lentes en fibres rapides (85), une altération des voies métaboliques (85) et par des
adaptations délétères de la jonction neuromusculaire, du cytosquelette et de la
vascularisation intramusculaire (203, 208). Un autre élément en faveur de
l’inactivité comme facteur causal de la dysfonction musculaire dans la MPOC est le
fait que le profil métabolique et morphologique des muscles locomoteurs soit
différent de celui des autres muscles chez les patients MPOC (29). Le diaphragme
par exemple, démontre une capacité oxydative augmentée (29, 113) et une
augmentation des fibres de type I (112), ce qui est à l’opposé du profil observé
chez le quadriceps. Ceci nous porte à croire que les effets de l’inactivité physique
affectent davantage les muscles impliqués dans la locomotion. De plus, la plupart
des anomalies observées dans la MPOC peuvent être aussi rencontrées dans
d’autres maladies chroniques comme l’insuffisance cardiaque et rénale (61), toutes
deux aussi caractérisées par une diminution importante des niveaux d’activité
physique.
En contrepartie, plusieurs observations favorisent l’existence d’une
myopathie non-reliée à l’inactivité physique chez les patients atteints de la MPOC
(38). La fonction et structure musculaire des patients atteints de la MPOC ne sont
pas directement corrélés au niveau d’activité physique (21, 141, 206). De plus, une
disparité de la fonction et la structure musculaire demeure lorsque les patients
atteints de la MPOC sont comparé avec des sujets sains appariés pour le même
niveau d’activité physique (39, 72).
Étant donné que les adaptations associés à l’inactivité physique influencent
les voies de signalisation impliquées dans la synthèse protéique (107), le stress
oxydant (97) et le métabolisme énergétique (46), il est donc normal de s’attarder à
ces phénomènes dans la MPOC (Figure 10).
![Page 72: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/72.jpg)
CHAPITRE I. Le muscle squelettique
46
Figure 10. Mécanismes d’action menant à la dysfonction musculaire suite au sédentarisme et à l’inactivité physique. Adapté de Bajotto et al. 2006 (8)
MAPK, Mitogen-Activated Protein Kinase: ERK, Extracellular signal-regulated kinase: JNK, c-Jun N-terminal Kinase : p38, p38 MAPK : IGF-1, Insulin-like growth factor 1: mTOR, Mammalian target of rapamycin: p70S6K, Isoforme de 70 kDa de la protéine S6 kinase 1 : 4E-BP1, eIF4E binding protein 1: FoxO, Forkhead box of the class O: GSK-3β, Glycogen synthase kinase 3β: Atrogin1, MAFbx Muscle Atrophy F-box: MuRF1, Muscle RING Finger 1: Nedd4, neural precursor cell expressed developmentally down-regulated protein 4.
À la lumière des observations cliniques, structurales, biochimiques et
signalétiques démontrant des anomalies musculaires importantes, on peut
supposer que la présence de l’inflammation systémique et locale, de stress
![Page 73: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/73.jpg)
CHAPITRE I. Le muscle squelettique
47
oxydant et surtout d’inactivité physique sont des facteurs potentiels contribuant à la
dysfonction musculaire chez la MPOC (Figure 11).
Figure 11. Mécanismes d’action menant à la dysfonction musculaire chez la MPOC. Adapté de Couillard et al. 2005.
Basé sur Couillard, 2005 (38)
![Page 74: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/74.jpg)
CHAPITRE I. Le muscle squelettique
48
1.3.4 La solution
La réadaptation pulmonaire chez la MPOC Contrairement à la notion que les patients atteints de la MPOC ne peuvent
atteindre des niveaux d'exercices suffisamment intenses pour produire un effet
d'entraînement physiologique (137), les études des vingt dernières années ont
confirmé que la réadaptation pulmonaire, basée sur le réentraînement
cardiovasculaire et musculaire, est l’intervention non pharmacologique la plus
efficace dans l'amélioration de l'état de santé chez les patients atteints de la
MPOC. Ces améliorations se produisent sans changement de la fonction
pulmonaire de ces patients (101). La réadaptation pulmonaire est devenue la
pierre angulaire de la gestion de la MPOC et pour cause; l'amélioration de la
qualité de vie démontrée dans les études de réadaptation pulmonaire dépasse
largement les effets observés dans les essais cliniques de bronchodilatateurs,
corticoïdes inhalés ou en combinaison (200). Cependant, la réadaptation
pulmonaire ne corrige pas complètement toutes les anomalies observées dans le
quadriceps des patients MPOC (14, 215).
Les patients MPOC démontrent, après avoir complété un programme de
réadaptation de 8 semaines, des gains de force musculaire équivalent à 70% de la
force musculaire de sujets sains appariés pour l’âge non entraînés (60). De plus,
après un entraînement de 10 semaines avec ou sans supplément de testostérone,
les patients MPOC participant au régime d’entraînement en résistance ayant reçu
le placebo ont seulement gagné 0.1 kg de masse maigre, alors que les patients
recevant seulement de la testostérone ont montré des gains de 2.3 kg de masse
maigre en 10 semaines (30). Plusieurs facteurs peuvent limiter les gains de force
et de masse musculaire chez les patients MPOC participant à un programme
d’exercice en résistance. Le réentraînement musculaire visant à augmenter la
masse musculaire induit des évènements moléculaires et cellulaires impliqués
dans la synthèse des protéines. En effet, l'augmentation de la masse maigre
concorde avec l'augmentation de l’activité de la voie de signalisation d’IGF-1/AKT
![Page 75: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/75.jpg)
CHAPITRE I. Le muscle squelettique
49
et l'activation de la machinerie de la synthèse protéique. Une étude a investigué la
réponse cellulaire suite à un programme d’exercice en résistance chez les patients
MPOC cachexiques. Les résultats démontrent une réponse atténuée de la voie de
l’IGF1/AKT chez ces patients cachexiques par rapport aux patients non
cachexiques (212). Étant donné que les bénéfices physiologiques et
psychologiques de la réadaptation pulmonaire chez la MPOC sont bien
documentés (201), mais n’améliorent que partiellement les fonctions musculaires,
des études portant sur la réponse moléculaire et cellulaire à l’exercice méritent de
voir le jour pour tenter de bonifier l’intervention de réadaptation pulmonaire chez la
MPOC.
![Page 76: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/76.jpg)
CHAPITRE II
PROBLÉMATIQUES, OBJECTIFS ET HYPOTHÈSES DES TRAVAUX
![Page 77: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/77.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
51
Cette thèse a pour objectif général l’étude de la dysfonction musculaire
périphérique dans la MPOC, plus précisément 1) l’étude des mécanismes
cellulaires impliqués dans l’atrophie musculaire (Chapitres 3 et 4) 2) l’étude du
métabolisme musculaire à la suite d’un exercice en endurance (Chapitre 5) et 3)
l’étude de la réponse cellulaire suite à un exercice en résistance (Chapitre 6).
Voici une brève description de la problématique de chaque projet de
recherche ainsi que les principaux objectifs et hypothèses de recherche.
La première problématique traitée sera présentée dans le chapitre 3. Cette
étude établira le fait que des voies de signalisation autre que l’IGF-1/AKT
pourraient être impliquées dans le processus d’atrophie musculaire chez la MPOC.
Étant donné que la voie de signalisation d’IGF-1/AKT fait l’objet d’un paradoxe dû
au fait que la phosphorylation de protéines pro-synthèses est augmentée chez des
patients MPOC ayant une masse maigre considérablement réduite, d’autres voies
de signalisation comme les MAPK sont certainement impliquées dans le processus
atrophique associé à la MPOC. Puisqu’aucune donnée n’était disponible
concernant l’activation de cette voie de signalisation dans le quadriceps de
patients MPOC, nos objectifs étaient de :
1) Mesurer les niveaux de phosphorylation de p38 MAPK, ERK 1/2 et JNK
2) Mesurer les niveaux d’ARNm de p38 MAPK, ERK 1/2 et JNK
3) Mesurer les niveaux protéiques et d’ARNm des E3 ligases, Atrogin1 et
MuRF
Notre hypothèse générale pour cette étude:
Les niveaux de phosphorylation et d’ARNm des joueurs majeurs de la voie
des MAPK (p38 MAPK, ERK 1/2 et JNK) sont plus élevés dans le quadriceps des
patients atteints de la MPOC en comparaison avec des sujets sains appariés pour
l’âge.
La deuxième problématique fera l’objet du chapitre 4. Cette étude
démontrera qu’un facteur inflammatoire, le SAA1, pourrait avoir un impact dans
![Page 78: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/78.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
52
l’atrophie musculaire des patients. Étant donné que 1) les résultats publiés à date
concernant les facteurs inflammatoires communément mesurés dans les études
sur la MPOC sont discordants et qu’il n’existe aucun consensus sur le fait que
l’inflammation est présente ou pas dans les muscles périphériques des patients
atteints de MPOC et que 2) il a été montré que SAA1 est augmenté dans le
quadriceps de patients MPOC sans pour autant faire l’objet d’une investigation
plus approfondie; nous produirons des évidences qui supportent l’idée que cette
apolipoprotéine est présente de façon importante dans la MPOC et qu’elle pourrait
jouer un rôle dans le développement de l’atrophie musculaire dans cette maladie.
Cette étude avait donc comme objectif de :
1) Mesurer les niveaux d’expression du gène de SAA1 dans le quadriceps dans
une cohorte de patients MPOC modérés à sévères.
2) Mesurer les niveaux d’ARNm de SAA1 dans le quadriceps chez une autre
cohorte de validation de patients MPOC modérés à sévères.
3) Mesurer les niveaux d’ARNm de SAA1 dans le quadriceps chez une cohorte de
patients MPOC ayant une exacerbation
Notre hypothèse générale pour cette étude :
Les niveaux d’expression du gène et les niveaux d’ARNm sont plus élevés
dans le quadriceps des patients atteints de la MPOC en comparaison avec des
sujets sains appariés pour l’âge et les patients présentant une exacerbation de la
MPOC démontrent des niveaux plus élevés de SAA1 que les patients MPOC
stables et les sujets sains appariés pour l’âge.
La troisième problématique sera présentée dans le chapitre 5. Cette étude
démontrera une plus grande dépendance à la glycolyse comme voie métabolique
de prédilection pendant un exercice en endurance chez les patients atteints de la
MPOC modérée à sévère. Étant donné que plusieurs études démontrent que la
capacité oxydative est réduite dans le quadriceps des patients MPOC, ce projet
tentera d’illustrer un effet compensatoire du système glycolytique dans le muscle
![Page 79: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/79.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
53
de ces patients, tout en suggérant que ceci pourrait contribuer à l’intolérance à
l’exercice dans la MPOC. Cette étude avait donc comme objectif de :
1) Mesurer les métabolites (ATP, ADP, CP, Pi) dans le quadriceps à la
suite d’un exercice en endurance chez des patients MPOC
2) Mesurer les facteurs intermédiaires de la glycolyse (F-6-P, G-1-P et G-6-
P) dans le quadriceps à la suite d’un exercice en endurance chez des
patients MPOC
3) Mesurer l’activité enzymatique reliée à la capacité oxydative (HADH, CS)
et à la capacité glycolytique (PFK, LDH) dans le quadriceps chez des
patients MPOC
4) Mesurer les taux d’utilisation de glucose/glycogène ainsi que de lactate
dans le quadriceps à la suite d’un exercice en endurance chez des
patients MPOC
Notre hypothèse générale pour cette étude:
Les patients MPOC montrent une plus grande dépendance au système
glycolytique pendant un exercice en endurance, ce qui contribue en partie à
l’intolérance à l’exercice dans la MPOC.
La quatrième problématique de cette thèse sera élaborée dans le chapitre 5.
Cette étude consistera à quantifier la réponse cellulaire des voies de signalisation
impliquées dans le maintien de la masse musculaire à la suite d’un exercice en
résistance chez les patients atteints de MPOC modérée à sévère. Même si la
littérature démontre que l’exercice en résistance est bien toléré et aide les patients
MPOC à retrouver une meilleure qualité de vie, il semble qu’ils ne répondent pas
tous aussi bien à l’exercice en résistance en comparaison avec des sujets sains
appariés pour l’âge. Par conséquent, ce projet de recherche mesurera la réponse
cellulaire à l’exercice en résistance chez les patients atteints de la MPOC modérée
à sévère.
![Page 80: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/80.jpg)
CHAPITRE II. Problématique, hypothèses et objectifs de recherche
54
Cette étude avait donc comme objectif de :
1) Mesurer dans les quadriceps les niveaux de phosphorylation de
protéines clés impliquées dans le maintien de la masse musculaire
(AKT, mTOR, p70s6k, p38 MAPK, ERK 1/2) à la suite d’un exercice en
résistance chez des patients MPOC;
2) Mesurer dans le quadriceps les niveaux de protéines et d’ARNm des E3
ligases (Atrogin1 et MuRF) impliquées dans la dégradation protéique à la
suite d’un exercice en résistance chez des patients MPOC;
3) Mesurer dans le quadriceps les niveaux d’ARNm de cytokines (TNF-α,
IL-6, IL-8), impliquées dans la réponse inflammatoire à la suite d’un
exercice en résistance chez des patients MPOC.
Notre hypothèse générale pour cette étude était :
La réponse cellulaire des patients atteints de la MPOC à la suite d’un
exercice en résistance est différente de celle des sujets sains appariés pour l’âge.
Les patients MPOC montrent une réponse pro-synthèse atténuée en comparaison
aux sujets sains, ce qui contribue à la moins bonne réponse à l’exercice en
résistance dans la MPOC.
![Page 81: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/81.jpg)
![Page 82: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/82.jpg)
CHAPITRE III
MAPK SIGNALLING IN THE QUADRICEPS OF PATIENTS WITH COPD
Article publié dans the Journal of Applied Physiology
Lemire BB, Debigaré R, Dubé A, Thériault ME, Côté CH, and Maltais F. MAPK signaling in the quadriceps of patients with chronic obstructive pulmonary disease. J Appl Physiol 113: 159-166, 2012 Journal of Apply Physiology 113: 159-166, 2012.
![Page 83: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/83.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
57
3.1 Page titre
MAPK SIGNALLING IN THE QUADRICEPS OF PATIENTS WITH CHRONIC
OBSTRUCTIVE PULMONARY DISEASE
Authors:
Bruno B. LEMIRE1, Richard DEBIGARÉ1, Annie DUBÉ1, Marie-Eve THÉRIAULT1,
Claude H. CÔTÉ2 and François MALTAIS1
Affiliation :
1Centre de recherche, Institut Universitaire de cardiologie et de pneumologie de Québec, Université Laval, Québec, Canada. 2Centre de recherche, Centre Hospitalier Universitaire de Québec, Pavillon CHUL, Université Laval, Québec, Canada
B B. Lemire is the recipient of a PhD training award from the Canadian Institutes of Health Research (CIHR). R. Debigaré is a Research Scholar of the Fonds de la Recherche en Santé du Québec. F. Maltais holds a GSK/CIHR Research Chair on COPD at Université Laval. This work has been supported by CIHR grant MOP-115136. Running head: Intramuscular signalling in the quadriceps of patients with COPD Word count: 2221 Address of correspondence: Dr François Maltais
Institut Universitaire de cardiologie et de pneumologie de Québec
2725 Chemin Ste-Foy Québec, Québec G1V 4G5 CANADA Tel: 418-656-4747 Fax: 418-656-4762
E-mail: [email protected]
![Page 84: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/84.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
58
3.2 Résumé
L'atrophie musculaire dans la MPOC est associée à une réduction de la tolérance à
l'effort, de la force musculaire et de la survie. Les mécanismes moléculaires conduisant à
l'atrophie musculaire dans la MPOC sont encore méconnus. Les « Mitogen-Activated
Protein Kinases » (MAPK), tels que la p38 MAPK et ERK 1/2, peuvent augmenter les
niveaux de MAFbx/Atrogin1 et MuRF1 qui sont spécifiquement impliqués dans la
dégradation des protéines musculaires. L’objectif de l’étude était de déterminer les niveaux
de phosphorylation de la p38 MAPK, ERK 1/2 et JNK dans le quadriceps des patients
atteints de la MPOC. Une biopsie du quadriceps a été obtenue chez 18 patients atteints de la
MPOC ainsi que chez 9 sujets sains appariés pour l’âge. Nous avons évalué les niveaux de
phosphorylation ainsi que les niveaux de protéines totales de la p38 MAPK, ERK 1/2 et
JNK ainsi que de MAFbx/Atrogin1 et MuRF1 chez tous les participants de l’étude. Les
niveaux d'ARNm des protéines auparavant mentionnées ont été évalués par PCR en temps
réel. Les ratios phosphorylation/protéine totale de la p38 MAPK (p = 0,02) et ERK 1/2 (p =
0,01) étaient significativement plus élevés chez les patients atteints de la MPOC par rapport
aux sujets sains. De plus, le niveau de protéines de MAFbx/Atrogin1 avait tendance à être
plus élevé chez les patients atteints de la MPOC (p = 0,08). Les niveaux d’ARNm de la p38
MAPK (p = 0,03), ERK 1/2 (p = 0,02) et MAFbx/Atrogin1 (p = 0,04) étaient
significativement plus élevés chez les patients atteints de la MPOC. De plus, les ratios
phosphorylation/protéine totale de la p38 MAPK (Pearson’s = -0,45, p <0,05) et de ERK
1/2 (Pearson’s = -0,47, p <0,05) étaient négativement associés à la surface transversale du
quadriceps des participants. Finalement, ces données soutiennent l'hypothèse que les
MAPK pourraient jouer un rôle dans le développement de l'atrophie musculaire associée à
la MPOC.
Mots-clés: MPOC, MAPK, signalisation intramusculaire, biopsie musculaire
![Page 85: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/85.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
59
3.2 Abstract
Muscle atrophy in COPD is associated with reduced exercise tolerance, muscle
strength and survival. The molecular mechanisms leading to muscle atrophy in COPD
remain elusive. The Mitogen-Activated Protein Kinases (MAPKs) such as p38 MAPK and
ERK 1/2 can increase levels of MAFbx/Atrogin and MuRF1, which are specifically
involved in muscle protein degradation and atrophy. Our aim was to investigate the level of
activation of p38 MAPK, ERK 1/2 and JNK in the quadriceps of patients with COPD. A
biopsy of the quadriceps was obtained in 18 patients with COPD as well as in 9 healthy
controls. We evaluated the phosphorylated as well as total protein levels of p38 MAPK,
ERK 1/2 and JNK as well as MAFbx/Atrogin and MuRF1 in these muscle samples. The
corresponding mRNA expression was also assessed by qPCR. Ratios of phosphorylated to
total level of p38 MAPK (p=0.02) and ERK 1/2 (p=0.01) were significantly elevated in
patients with COPD compared to controls. Moreover, protein levels of MAFbx/Atrogin
showed a tendency to be greater in patients with COPD (p=0.08). mRNA expression of p38
MAPK (p=0.03), ERK 1/2 (p=0.02) and MAFbx/Atrogin (p=0.04) were significantly
elevated in patients with COPD. In addition, phosphorylated to total p38 MAPK ratio
(Pearson’s r=-0.45; p < 0.05) and phosphorylated to total ERK 1/2 ratio (Pearson’s r=-0.47;
p < 0.05) were negatively associated with the mid-thigh muscle cross-sectional area. These
data support the hypothesis that the MAPKs might play a role in the development of muscle
atrophy in COPD.
Word count: 245
Keywords: COPD, MAPK, intramuscular signalling, muscle biopsy
![Page 86: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/86.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
60
3.3 Introduction
Peripheral muscle dysfunction in chronic obstructive pulmonary disease (COPD) is
characterized by fiber-type shifting, metabolic alterations and atrophy. Among these,
muscle atrophy is associated with reduction in exercise tolerance, strength, quality of life
and even survival (33). Although a role for the ubiquitin/proteasome pathway in the
development of muscle atrophy in COPD has been proposed (12, 29), other biochemical
pathways may also be involved in this process.
In this regard, several observations suggest a possible involvement of the Mitogen-
Activated Protein Kinases (MAPKs) pathway in the COPD-related atrophying process.
MAPKs can be activated in response to inflammatory and oxidative stress (20), two
common findings in peripheral muscles of patients with COPD (33). The MAPKs,
including extracellular signal-regulated kinase 1-2 (ERK 1/2), p38 MAPK and c-Jun N-
terminal kinase (JNK) are involved in the muscle atrophy process in cell culture and animal
models of immobilization-induced atrophy (19, 21, 37). In C2C12 cells exposed to TNF,
ERK activation led to a greater expression of muscle atrophy F-box protein
(MAFbx/Atrogin) that is involved in protein degradation suggesting that ERK could play a
crucial role in the pathogenesis of muscle atrophy (27). p38 MAPK also mediates oxidative
stress-induced MAFbx/Atrogin gene expression and ubiquitin-conjugating activity in
skeletal muscle (18, 21). Lastly, JNK has been shown to potentiate the caspase activity
during inflammation, which in itself can lead to loss of muscle proteins, while JNK-
deficient mice are protected against the inflammation-induced loss of muscle force (40).
Because the ubiquitination of proteins and the levels of E3 ligases such as MuRF1
and MAFbx/Atrogin have been associated with skeletal muscle atrophy and since the active
forms of ERK 1/2, p38 MAPK and JNK could modulate their expression, we hypothesized
that the level of MAPKs protein phosphorylation would be increased and the corresponding
mRNA overexpressed in the quadriceps of patients with COPD. We also speculate that the
quadriceps level of ubiquitinated and polyubiquitinated proteins and of MAFbx/Atrogin
and MuRF1 would be upregulated in this context. Lastly, we hypothesized that these
![Page 87: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/87.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
61
biochemical abnormalities would be associated with evidence of inflammation and
oxidative stress at the muscle level.
To test these hypotheses, we investigated the phosphorylation levels of ERK 1/2,
p38 MAPK and JNK and of ubiquitinated proteins, MAFbx/Atrogin and MuRF1 in the
quadriceps of patients with COPD in comparison to aged-matched healthy controls. The
presence of several key markers of inflammation (tumor necrosis factor α [TNF-α],
interleukin-6 [IL-6], interleukin-8 [IL-8], serum amyloid A1 [SAA11], cluster of
differentiation 45 receptor [CD45R]) and of oxidative stress (lipid peroxidation, protein
carbonylation and advance oxidative protein products) was also evaluated in the quadriceps
of these individuals.
3.4 Methods
Subjects
Eighteen patients with moderate to severe COPD and nine healthy aged-matched
controls subjects participated in this study. The diagnosis of COPD was based on
spirometry showing moderate to severe irreversible airflow obstruction (forced expiratory
volume in 1 second [FEV1] < 80% predicted value, and FEV1/ forced vital capacity [FVC]
< 70%). All patients with COPD were in a stable condition at the time of the study without
any acute exacerbation of their disease or exposure to systemic corticosteroids within 2
months of their participation in the study. None of the patients was receiving long-term
oxygen therapy. Patients with COPD and healthy controls were excluded if they presented
any medical condition, other than COPD (in the case of patients with COPD), likely to
influence muscle and biochemical testing (i.e. cardiovascular, neurological,
musculoskeletal, locomotor or other respiratory diseases). In both groups, only sedentary
male ex-smokers who had stopped for at least 6 months were included in the present study
in order to minimize heterogeneity in the measurements. The institutional ethics committee
approved the research protocol and a signed informed consent was obtained from each
subject.
![Page 88: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/88.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
62
Study design
After reviewing medical history and familiarization with the study procedures,
subjects filled out a physical activity questionnaire (41). Anthropometric measurements,
pulmonary function testing, mid-thigh muscle cross-sectional area measures and a body
composition assessment were performed. Subjects were also given a physical activity
monitor for a period of 7 days. Subjects then returned to the laboratory for a quadriceps
biopsy at rest.
Pulmonary function testing
Standard pulmonary function tests including spirometry, lung volumes, and carbon
monoxide diffusion capacity were obtained in all subjects during the initial evaluation
according to previously described guidelines (3). Results were related to previously publish
normal values (31).
Physical activity measurement and score
The level of physical activity was assessed with a multisensor wearable device worn
on the right arm designed to collect and analyze a broad range of data from the body and its
movements (SenseWear Armband, Pittsburg, PA) for at least 7 days. The level of physical
activity in daily living was also assessed with the Voorrips physical activity questionnaire
described by Baecke et al. adapted for elderly individuals and used in patients with COPD
(4, 36, 41). This questionnaire attributes a score for household, sport, and other leisure-time
physical activities, together resulting in a global physical activity score. A score of 9-16
indicates a moderate level of daily physical activity, whereas a score < 9 depicts low levels
of daily physical activity and is associated with a sedentary lifestyle.
Anthropometric measurements and body composition.
Height and weight were measured according to standardized methods (16). Dual
energy X-ray Absorptiometry (DEXA) provided regional assessment of fat, fat-free mass
and total thigh muscle mass (sum of both legs) (General Electric Healthcare, Chicago, IL).
Measurement of mid-thigh muscle cross-sectional area
A computed tomography (CT) of the right thigh halfway between the pubic
symphysis and the inferior condyle of the femur was performed using a fourth-generation
Toshiba Scanner 900S (Toshiba). Computed tomography was used to quantify muscle
![Page 89: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/89.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
63
cross-sectional area mass in a more specific manner than anthropometric measurements
(39).
Muscle biopsy and muscle specimen analyses
After 30 minutes of rest in the supine position, a needle biopsy of the quadriceps
was performed as described by Bergström and routinely done in our laboratory (6, 23).
Muscle specimens were frozen in liquid nitrogen and stored at -80°C for future analysis.
Protein extraction and Western blotting
Cytoplasmic protein extraction was performed with ≈ 30 mg of muscle. Muscle
samples were then homogenised using a Polytron PowerGen 125 (Omni International,
Marietta, GA, USA). Protein content was determined by a DC protein essay (BioRad,
Mississauga, ON, Canada) based on a modified Lowry method. Electrophoresis was
performed using 10-15 % SDS PAGE gels. After a 3-hour protein transfer in cold (4°C)
buffer, nitrocellulose membranes were blocked for 1 hour with 5% non-fat dry milk in
TBS. The membranes were then incubated overnight at 4°C using the primary antibody
phosphorylated-p38 MAPK (monoclonal rabbit anti-human [Thr180/Tyr182] Cell
Signaling technology, Danvers, MA, USA cat. no. 4511), p38 (polyclonal rabbit anti-
human, Cell Signaling technology, Danvers, MA, USA cat. no. 9212), phosphorylated-
ERK 1/2 (monoclonal rabbit anti-human [Thr202/Tyr 204], Cell Signaling technology,
Danvers, MA, USA cat. no. 4376), ERK (monoclonal rabbit anti-human, Cell Signaling
technology, Danvers, MA, USA cat. no. 4695), phosphorylated-JNK (monoclonal rabbit
anti-human [Thr183/Tyr185], Cell Signaling technology, Danvers, MA, USA cat. no.
4668), JNK (monoclonal rabbit anti-human, Cell Signaling technology, Danvers, MA, USA
cat. no. 9258). For p38, ERK 1/2 and JNK the antibodies that were used detected all protein
isoforms (p38α, -β and -γ, Erk1/Erk2 and SAPK/JNK). MuRF1 (polyclonal rabbit anti-
human, GeneTex Inc., Irvine CA, USA cat. no. GTX110475), ubiquitin (mouse
monoclonal anti-human, Cell Signaling technology, Danvers, MA, USA cat. no. 3936),
polyubiquitin (polyclonal rabbit anti-human Lysine 48-linkage, Cell Signaling technology,
Danvers, MA, USA cat. no. 4289) and 4-HNE (polyclonal rabbit anti-HNE-Michael [4-
Hydroxynonenal] Adducts, Reduced, Calbiochem, San Diego, CA, USA cat. no. 393207).
The antibody against MAFbx/Atrogin was developed in our centre as previously reported
![Page 90: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/90.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
64
(11, 12). The membranes were then washed 3 x 20 minutes with TBS and incubated for
1 hour at room temperature with the secondary antibody and again washed as above.
Secondary antibodies used were goat anti-rabbit IgG and horse anti-mouse IgG (Cell
Signaling technology, Danvers, MA, USA). Finally, the membranes were treated for 5
minutes with ECL Plus (GE Healthcare, Baie D’Urfé, QC, Canada) to detect
chemiluminescence substrates on X-ray exposed over a nitrocellulose membrane. For
protein oxidation measurements, the OxyBlot® kit was used to detect carbonyl groups
according to the manufacturer’s protocol (Millipore, Billeria, MA, USA). All protein
contents were normalized to α-tubulin (Sigma, Oakville, ON, Canada) except for
polyubiquitin, which was normalized according to the intensity of Amido black staining
(2). All proteins were referenced to an optical density quantity dependant curve at the end
of each SDS PAGE gels. Phosphorylated to total protein level ratios were individually
calculated and averaged per group for comparison.
Real-Time PCR
Total RNA extraction was performed from ≈ 15 mg of muscle using a commercially
available preparation (TRIzol® Reagent) (Invitrogen, Burlington, ON, Canada). One μg of
RNA was reverse transcribed to cDNA using QuantitectTM Reverse Transcription Kit
(Qiagen, Mississauga, ON, Canada). Real time PCR were performed in a Rotor-GeneTM
6000 (Corbett Life Science, San Francisco, CA, USA) using QuantitectTM SYBR® Green
PCR Kit (Qiagen, Mississauga, ON, Canada). At the end of the PCR amplifications, the
samples were subjected to a melting curve analysis. The comparative threshold cycles
(∆CT) values for p38, ERK 1/2, JNK, MAFbx/Atrogin and MuRF1 were normalized for
RPLPO, 18s reference genes and analyzed using the 2-∆Ct method (22). All qPCR runs were
performed in duplicate to ensure quantitative accuracy. Specific primers are given in Table
1. The p38 primer detects p38α, ERK detects ERK2 and JNK detects JNK1.
Fiber typing
Five (5) μm cryosections were prepared from frozen muscle samples. Sections were
fixed for 10 minutes with acetone/methanol (60/40) at –20oC, washed 10 minutes in PBS
(Na2HPO4 58 mM, NaH2PO4 17 mM, NaCl 68 mM), blocked for 5 minutes with hydrogen
peroxyde 3%, washed for another 10 minutes in PBS, and then blocked in horse serum for
![Page 91: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/91.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
65
1 hour. Muscle was immunohistochemically stained using monoclonal anti-skeletal myosin
fast (Sigma, Oakville, ON, Canada) incubated overnight at 4oC with 1:200 dilution.
Cryosections were washed 10 minutes in PBS just before adding 1:50 dilution of
biotinylated antibody IgG from VECTASTAIN Elite ABC system (Vector Laboratories,
Burlington, ON, Canada). The immunoreactivity was visualized by AEC chromogen
substrate (Dako, Burlington, ON, Canada) that detects peroxydase activity. Cryosections
were then counterstained with Mayer’s Hematoxylin. Muscle fibers were classified
according to the staining intensity: type I (non-stained) and type II (stained). All muscle
sections were magnified and transferred to an image analysing system (Image Pro Plus 4.5
for Windows, MediaCybernetics, Silver Spring, MD, USA). All fibers were counted and
classified to obtain the fiber-type composition for each subject.
Immunohistochemical assays
Muscle tissue was cut in 5 µm consecutive sections on a cryostat and prepared like the
cryosections for fiber typing. Sections were then incubated overnight at 4°C with
monoclonal mouse anti-human SAA11 diluted 1:10 (Calbiochem, San Diego, CA, USA
cat. no. ST1506), polyclonal rabbit anti-human Il-6 diluted 1:10 000 (Genetex, Irvine, CA,
USA cat. no. GTX26672), polyclonal rabbit anti-human Il-8 diluted 1:1000 (Bender Med
System, San Diego, CA, USA cat. no. BMS136), monoclonal rabbit anti-human TNF-α
diluted 1:40 (Millipore, Billerica, MA, USA cat. no. 04-1114), monoclonal rabbit anti-
human CD45R diluted 1:10 (Pharmingen, Mississauga, ON, Canada cat. no. 555904).
Cryosections were then treated exactly like fiber typing immunohistochemistry with
VECTASTAIN Elite ABC system (described above) and AEC chromogen substrate.
Positive and negative assays were used to ensure specific staining stated in the
manufacturer’s protocol. A blinded evaluator randomly selected 50 muscle fibers to be
analysed for each specific antibody described above. Two evaluators then counted all
specific stains to get the total stain count which was then averaged between the two
evaluators and divided by the number of fibers to obtain the stains/fiber ratio.
Representative examples of the inflammatory immunohistochemical stains are provided in
Figure 1.
![Page 92: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/92.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
66
STATISTICAL ANALYSIS
Results are expressed as mean (± SEM). Between-group comparisons were done
using unpaired Student’s t tests, while normality for all data was assessed with a Shapiro-
Wilk test. Possible relationships were evaluated using Pearson’s correlations. Results were
considered significant if p values were less than 0.05.
![Page 93: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/93.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
67
3.5 Results
Subjects’ characteristics
Anthropometric characteristics and pulmonary function data are provided in Table
2. On average, patients with COPD had moderate to severe airflow obstruction, reduced
diffusion capacity and mild hypoxemia. Total fat-free mass and fat-free mass index were
significantly lower in patients with COPD compared to healthy controls.
Muscle characteristics
Mid-thigh muscle cross sectional area was smaller in COPD compared to controls.
In COPD, mid-thigh muscle cross-sectional areas ranged from severe atrophy (47 cm2) to
normal value (102 cm2). Six patients exhibited a mid-thigh muscle cross-sectional area < 70
cm2, a value that is associated with poor survival (24). Patients with COPD also exhibited a
smaller proportion of type I fibers with a reciprocal increase in type II fiber proportion
(table 2).
MAPK pathway: Phosphorylated and total protein levels and mRNA levels
Phosphorylated to total protein ratios for p38 MAPK, ERK1/2 and JNK within the
quadriceps are illustrated in Figures 2 (panels A to C). Increases in muscle phosphorylated
to total p38 MAPK ratio (215%; p = 0.02) and phosphorylated to total ERK 1/2 ratio
(385%; p = 0.01) were observed in COPD in comparison to controls. However, no
statistically significant difference between groups was seen for phosphorylated to total JNK
ratio (153%; p = 0.23). The mRNA expression of p38 MAPK α (253%; p = 0.04) and
ERK2 (384%; p = 0.02) were significantly elevated in patients with COPD compared to
controls, while JNK1 (171 %; p = 0.52) mRNA levels did not show any differences
between groups (figure 3 A, B and C).
Total protein content of MAFbx/Atrogin tended to be elevated in patients with
COPD (170%; p = 0.08) (figure 4A) while MuRF total protein levels was similar between
groups (figure 4B). MAFbx/Atrogin mRNA level was significantly elevated in patients
with COPD (364%; p = 0.04, Figure 4C). A similar tendency was observed for MuRF1, but
this did not reach statistical significance (201%; p = 0.28, figure 4D). Total ubiquitinated
proteins were similar between groups (figures 4E) while poly-ubiquitinated proteins levels
![Page 94: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/94.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
68
were significantly elevated in patients with COPD (155%; p = 0.02, figure 4F). In all
subjects, there was a negative correlation between the phosphorylated to total p38 MAPK
ratio (Pearson’s r=-0.45; p < 0.05) and the phosphorylated to total ERK1/2 ratio (Pearson’s
r=-0.47; p < 0.05) and mid-thigh muscle cross sectional area (figure 5A and B). In addition,
there were significant correlations between the phosphorylated to total p38 MAPK ratio
(Pearson’s r=0.44; p < 0.05) and the phosphorylated to total ERK1/2 ratio (Pearson’s
r=0.57; p < 0.05) with MAFbx/Atrogin (figure 5C and D). Finally, a correlation was
observed between the phosphorylated to total ERK1/2 ratio (Pearson’s r=0.55; p < 0.05)
and the polyubiquitinated proteins levels (figure 5E).
Muscle oxidative stress and inflammatory markers
Immunohistochemical assays revealed similar muscle levels for IL-6, IL-8, TNF-α,
SAA11 and CD45R in both groups (Table 3). Also depicted in table 3, lipid peroxidation
(4-HNE) and protein carbonylation levels (OxyBlot®) measured in muscle samples were
similar between groups.
![Page 95: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/95.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
69
3.6 Discussion
In this study, the extent of activation of several MAPKs was assessed in the context of their
possible contribution to the development of muscle atrophy in patients with COPD. The
main finding was the greater proportion of phosphorylated proteins levels of p38 MAPK
and ERK 1/2 in the quadriceps of patients with moderate to severe COPD compared to
healthy controls. The presence of an elevated proteolytic activity in the muscles of these
patients was supported by the mRNA overexpression of MAFbx1/Atrogin and increased
muscle protein polyubiquitination in COPD patients. Moreover, significant correlations
were found between quadriceps phosphorylated protein levels of p38 MAPK and ERK 1/2
with mid-thigh muscle cross sectional area, MAFbx1/Atrogin and polyubiquitin. Although
the origin of this activation of p38 MAPK and ERK 1/2 in these patients could not be
confirmed in the absence of evidence for muscle inflammation and oxidative stress, our
results nevertheless highlight the abnormal regulation of key signalling proteins that could
be involved in the regulation of muscle mass in patients with stable COPD.
MAPKs signalling
While the activity of the MAPKs responds to several distinct stresses, convincing
evidence shows that p38 MAPK and ERK are contributors to the development of skeletal
muscle atrophy through activation of proteolysis (18, 30, 40). Specifically, MAFbx/Atrogin
expression is upregulated by inflammatory stresses in a p38 MAPK-dependent manner in
culture myotubes (21). Recent findings indicate that the blockade of MAFbx/Atrogin gene
induction can be achieved with the inhibition of p38 MAPK (18). In addition, ERK
activation increases the expression of the MAFbx/Atrogin in C2C12 cells, suggesting an
upregulation of the proteasome activity and a downregulation of the myogenic process (27).
Although the MAPKs (p38 MAPK, ERK and JNK) induce transcriptional factors such as
AP-1, p53, and c-Myc and many other nontranscriptional factors involved in muscle cell
degradation, the specific activation of these factors remain elusive (30). Thus our findings
of increased levels of activation of p38 MAPK and ERK 1/2, muscle protein
polyubiquitination levels and of MAFbx1/Atrogin mRNA overexpression in patients with
![Page 96: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/96.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
70
COPD are consistent with cell and animal experiments in suggesting a potential
contribution of this pathway in the regulation of skeletal mass in this disease. This
statement is further supported by the correlations between p38 MAPK and ERK 1/2 with
MAFbx1/Atrogin, polyubiquitin and mid-thigh muscle cross-sectional area.
Apart from its involvement in the regulation of muscle mass, the activation of the
various MAPKs signalling pathway may contribute to other muscle phenotypic
manifestations commonly seen in COPD. Increased levels of ERK1/2 have been associated
with type II fiber predominant muscle phenotype that is commonly seen in COPD (14, 38).
For instance, p38 MAPK overexpression can decrease GLUT4 expression and contraction-
stimulated glucose transport (17). This is of interest because a reduction in GLUT4
transporters and glucose transport/utilization in COPD have been previously reported (15,
35).
One recent study measuring the phosphorylated levels of p38 MAPK and other
downstream targets of the MAPKs signalling pathway in the quadriceps of patients with
COPD showed no significant difference in phosphorylated p38 MAPK levels compared to
healthy controls (34). Discrepancies between these and our results are likely to be related to
different methodologies used to explore the effectors of the MAPK signalling pathway and
to differences in study populations.
Mechanisms of MAPKs signalling pathway upregulation
On the basis that several studies have shown that pro-inflammatory cytokines like
TNF-α can stimulate muscle proteolysis and lead to atrophy, we investigated whether the
activation of p38 MAPK and ERK 1/2 was driven by muscle inflammation or oxidative
stress. A low level of systemic and/or muscle inflammation has been proposed as a
potential trigger of muscle atrophy in COPD (10, 13). For example, patients with COPD
who fail to gain weight in response to nutritional support present high circulating levels of
TNF-α, which can activate all three major MAPKs signalling pathways in skeletal muscle,
thus possibly contributing to the muscle protein catabolic state (8).
Oxidative stress is also associated with loss of muscle mass in COPD (5). Oxidative
stress within skeletal muscle fibers activates redox-sensitive transcription factors and
![Page 97: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/97.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
71
protein kinases, including p38 MAPK, ERK1/2, and JNK (30). In the current study, we
found that p38 MAPK and ERK 1/2 activation as well as MAFbx/Atrogin levels were
elevated in patients with COPD but no apparent evidence of muscle inflammation and
oxidative stress could be observed.
There are inconsistencies regarding the presence of muscle inflammation and
oxidative stress in patients with COPD across studies (1, 26, 28, 32), including ours. A
definitive conclusion about the significance of inflammation and/or oxidative stress to the
COPD-related atrophying process cannot be currently reached. Our view is that this process
is likely to be multifactorial and that the relative contribution of each individual factor is
likely to vary in time and from one patient to the other. One possibility is that intermittent
inflammatory or oxidative bursts occurring during an acute COPD exacerbation or during
acute immobilization and that cannot be detected during a stable phase of the disease, could
be detrimental to skeletal muscle maintenance in patients with COPD, although one report
does not support this contention (9).
Even if not all mRNAs translate into proteins, our results of the greater expression
of p38 MAPK and ERK 1/2 mRNA show that the cellular environment is prepared to
produce a larger amount of those proteins, if necessary. This could be relevant for
situations requiring rapid inflammatory or oxidative responses.
Limitations
This study has the merit of reporting on molecular mechanisms that have been
convincingly associated with the development of muscle atrophy in cells and hindlimb
immobilized animals (7, 21, 25). However, a number of methodological considerations and
potential limitations need to be taken into account regarding its interpretation. First,
although patients with COPD clearly exhibited a loss of muscle mass, we cannot ascertain
whether they were actively loosing muscle mass at the time of experimentation. Another
limitation that is intrinsic to this type of human experimentation is the descriptive nature of
the study. As such, our results do not confirm a causal relationship between the activation
of the p38 MAPK and ERK 1/2 and the reduction of muscle mass, although this was
suggested from correlational analyses. Future mechanistic experiments or pharmacological
![Page 98: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/98.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
72
manipulations of these MAPKs pathways are necessary to address a possible causality
between these observations. Furthermore, several isoforms and expression patterns of the
MAPKs exist; however, dissecting of the specific role of each subunit in the COPD-related
atrophying process appeared premature and was beyond the scope of this investigation (25,
30). As such, antibodies detecting all protein isoforms were used in the western blot
analyses. Lastly, we acknowledge that some discrepancies exist between our protein and
mRNA results. Apart from biological explanations for this phenomenon (see previous
paragraph), some methodological issues could contribute to these discrepancies; while the
primers that were used for PCR analyses were specific for certain mRNAs, the antibodies
that were used for the Western Blot analyses covered all the different isoforms of the
proteins of interest.
![Page 99: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/99.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
73
3.7 Conclusion
This study demonstrates elevated phosphorylation levels of p38 MAPK and ERK1/2
in the quadriceps of patients with COPD compared to healthy aged-matched controls.
These intracellular signalling events were associated with increased levels of
MAFbx/Atrogin and protein polyubiquitination. As such, the present results support the
hypothesis that p38 MAPK and ERK1/2 could be potentially involved in the regulation of
muscle mass in COPD.
ACKNOWLEDGEMENTS
The authors acknowledge the help of Alexandra Porlier, Vera Askerov, Marthe
Bélanger, Marie-Josée Breton, Brigitte Jean and Josée Picard in accomplishing this study.
![Page 100: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/100.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
74
3.8 References
1. Agusti A. NF- B activation and iNOS upregulation in skeletal muscle of patients with COPD and low body weight. Thorax 59: 483-487, 2004. 2. Aldridge GM, Podrebarac DM, Greenough WT, and Weiler IJ. The use of total protein stains as loading controls: an alternative to high-abundance single-protein controls in semi-quantitative immunoblotting. J Neurosci Methods 172: 250-254, 2008. 3. ATS. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. Am J Respir Crit Care Med 152: S77-121, 1995. 4. Baecke JA, Burema J, and Frijters JE. A short questionnaire for the measurement of habitual physical activity in epidemiological studies. Am J Clin Nutr 36: 936-942, 1982. 5. Barreiro E, Rabinovich R, Marin-Corral J, Barbera JA, Gea J, and Roca J. Chronic endurance exercise induces quadriceps nitrosative stress in patients with severe COPD. Thorax 64: 13-19, 2009. 6. Bergström J. Muscle electrolytes in man determined by neutron activation analysis on needle biopsy specimens. Scand J Clin Lab Inv 14: 1962. 7. Childs TE, Spangenburg EE, Vyas DR, and Booth FW. Temporal alterations in protein signaling cascades during recovery from muscle atrophy. Am J Physiol Cell Physiol 285: C391-398, 2003. 8. Creutzberg EC, Schols AM, Weling-Scheepers CA, Buurman WA, and Wouters EF. Characterization of nonresponse to high caloric oral nutritional therapy in depleted patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 161: 745-752, 2000. 9. Crul T, Spruit MA, Gayan-Ramirez G, Quarck R, Gosselink R, Troosters T, Pitta F, and Decramer M. Markers of inflammation and disuse in vastus lateralis of chronic obstructive pulmonary disease patients. Eur J Clin Invest 37: 897-904, 2007. 10. Debigaré R, Marquis K, Côté CH, Tremblay RR, Michaud A, LeBlanc P, and Maltais F. Catabolic/anabolic balance and muscle wasting in patients with COPD. Chest 124: 83-89, 2003. 11. Doucet M, Dubé A, Joanisse DR, Debigaré R, Michaud A, Paré ME, Vaillancourt R, Fréchette E, and Maltais F. Atrophy and hypertrophy signalling of the quadriceps and diaphragm in COPD. Thorax 65: 963-970, 2010. 12. Doucet M, Russell AP, Léger B, Debigaré R, Joanisse DR, Caron MA, LeBlanc P, and Maltais F. Muscle atrophy and hypertrophy signaling in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 176: 261-269, 2007. 13. Eid AA, Ionescu AA, Nixon LS, Lewis-Jenkins V, Matthews SB, Griffiths TL, and Shale DJ. Inflammatory response and body composition in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 164: 1414-1418, 2001.
![Page 101: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/101.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
75
14. Gosker HR, Zeegers MP, Wouters EF, and Schols AM. Muscle fibre type shifting in the vastus lateralis of patients with COPD is associated with disease severity: a systematic review and meta-analysis. Thorax 62: 944-949, 2007. 15. Green HJ, Bombardier E, Burnett M, Iqbal S, D'Arsigny CL, O'Donnell DE, Ouyang J, and Webb KA. Organization of metabolic pathways in vastus lateralis of patients with chronic obstructive pulmonary disease. Am J Physiol Regul Integr Comp Physiol 295: R935-941, 2008. 16. Heymsfield SB WP. Nutritional assessment by clinical and biochemical methods. In: Modern nutrition in health and disease. Philadelphia: Lea & Febiger, 1994, p. pp. 812-841. 17. Ho RC, Alcazar O, Fujii N, Hirshman MF, and Goodyear LJ. p38gamma MAPK regulation of glucose transporter expression and glucose uptake in L6 myotubes and mouse skeletal muscle. Am J Physiol Regul Integr Comp Physiol 286: R342-349, 2004. 18. Jin B, and Li YP. Curcumin prevents lipopolysaccharide-induced atrogin-1/MAFbx upregulation and muscle mass loss. J Cell Biochem 100: 960-969, 2007. 19. Kim J, Won KJ, Lee HM, Hwang BY, Bae YM, Choi WS, Song H, Lim KW, Lee CK, and Kim B. p38 MAPK Participates in Muscle-Specific RING Finger 1-Mediated Atrophy in Cast-Immobilized Rat Gastrocnemius Muscle. Korean J Physiol Pharmacol 13: 491-496, 2009. 20. Kramer HF, and Goodyear LJ. Exercise, MAPK, and NF-kappaB signaling in skeletal muscle. J Appl Physiol 103: 388-395, 2007. 21. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, and Reid MB. TNF-alpha acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle. Faseb J 19: 362-370, 2005. 22. Livak KJ, and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408, 2001. 23. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Bélanger M, Breton MJ, and Jobin J. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 55: 848-853, 2000. 24. Marquis K, Debigaré R, Lacasse Y, LeBlanc P, Jobin J, Carrier G, and Maltais F. Midthigh muscle cross-sectional area is a better predictor of mortality than body mass index in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 166: 809-813, 2002. 25. McClung JM, Judge AR, Powers SK, and Yan Z. p38 MAPK links oxidative stress to autophagy-related gene expression in cachectic muscle wasting. Am J Physiol Cell Physiol 298: C542-549, 2010.
![Page 102: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/102.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
76
26. Montes de Oca M, Torres SH, De Sanctis J, Mata A, Hernandez N, and Talamo C. Skeletal muscle inflammation and nitric oxide in patients with COPD. Eur Respir J 26: 390-397, 2005. 27. Penna F, Costamagna D, Fanzani A, Bonelli G, Baccino FM, and Costelli P. Muscle wasting and impaired myogenesis in tumor bearing mice are prevented by ERK inhibition. PLoS One 5: e13604, 2010. 28. Piehl-Aulin K, Jones I, Lindvall B, Magnuson A, and Abdel-Halim SM. Increased serum inflammatory markers in the absence of clinical and skeletal muscle inflammation in patients with chronic obstructive pulmonary disease. Respiration 78: 191-196, 2009. 29. Plant PJ, Brooks D, Faughnan M, Bayley T, Bain J, Singer L, Correa J, Pearce D, Binnie M, and Batt J. Cellular markers of muscle atrophy in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 42: 461-471, 2009. 30. Powers SK, Kavazis AN, and McClung JM. Oxidative stress and disuse muscle atrophy. J Appl Physiol 102: 2389-2397, 2007. 31. Quanjer PH, Tammeling GJ, Cotes JE, Pedersen OF, Peslin R, and Yernault JC. Lung volumes and forced ventilatory flows. Report Working Party Standardization of Lung Function Tests, European Community for Steel and Coal. Official Statement of the European Respiratory Society. Eur Respir J Suppl 16: 5-40, 1993. 32. Rabinovich RA, Figueras M, Ardite E, Carbo N, Troosters T, Filella X, Barbera JA, Fernandez-Checa JC, Argiles JM, and Roca J. Increased tumour necrosis factor-alpha plasma levels during moderate-intensity exercise in COPD patients. Eur Respir J 21: 789-794, 2003. 33. Rabinovich RA, and Vilaro J. Structural and functional changes of peripheral muscles in chronic obstructive pulmonary disease patients. Curr Opin Pulm Med 16: 123-133, 2010. 34. Riddoch-Contreras J, George T, Natanek SA, Marsh GS, Hopkinson NS, Tal-Singer R, Kemp P, and Polkey MI. p38 Mitogen-activated Protein Kinase is Not Activated in the Quadriceps of Patients with Stable Chronic Obstructive Pulmonary Disease. Copd epub: 2012. 35. Saey D, Lemire BB, Gagnon P, Bombardier E, Tupling AR, Debigaré R, Côté CH, and Maltais F. Quadriceps metabolism during constant workrate cycling exercise in chronic obstructive pulmonary disease. J Appl Physiol 110: 116-124, 2011. 36. Serres I, Gautier V, Varray A, and Prefaut C. Impaired skeletal muscle endurance related to physical inactivity and altered lung function in COPD patients. Chest 113: 900-905, 1998. 37. Shen HM, and Liu ZG. JNK signaling pathway is a key modulator in cell death mediated by reactive oxygen and nitrogen species. Free Radic Biol Med 40: 928-939, 2006.
![Page 103: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/103.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
77
38. Shi H, Scheffler JM, Pleitner JM, Zeng C, Park S, Hannon KM, Grant AL, and Gerrard DE. Modulation of skeletal muscle fiber type by mitogen-activated protein kinase signaling. Faseb J 22: 2990-3000, 2008. 39. Sipila S, and Suominen H. Muscle ultrasonography and computed tomography in elderly trained and untrained women. Muscle Nerve 16: 294-300, 1993. 40. Supinski GS, Ji X, and Callahan LA. The JNK MAP kinase pathway contributes to the development of endotoxin-induced diaphragm caspase activation. Am J Physiol Regul Integr Comp Physiol 297: R825-834, 2009. 41. Voorrips LE, Ravelli AC, Dongelmans PC, Deurenberg P, and Van Staveren WA. A physical activity questionnaire for the elderly. Med Sci Sports Exerc 23: 974-979, 1991.
![Page 104: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/104.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
78
3.9 Tables
Table 1. Primer sequences used for qPCR analyses
Target
mRNA
PCR primer sequence 5’→ 3’
p38 MAPK Forward Reverse
CAGGGCCACCTTCTTGCCCG CTGTGTGCCGAGCCAGTCCA
ERK 1/2 Forward Reverse
GCCTGGCCCGTGTTGCAGAT TGGGTGGGCCAGAGCCTGTT
JNK Forward Reverse
GCACCCGAGGTCATCCTTGGC GGAGAGGGCTGCCCCCGTAT
MAFbx/Atrogin1 Forward Reverse
GCAGCTGAACAACATTCAGATCAC CAGCCTCTGCATGATGTTCAGT
MuRF1 Forward Reverse
CCTGAGAGCCATTGACTTTGG CTTCCCTTCTGTGGACTCTTCCT
18s Forward Reverse
ACCGGCGCAAGACGAACCAG GCCGGGTGAGGTTTCCCGTG
RPLPO Forward Reverse
TCTACAACCCTGAAGTGCTTGATATC GCAGACAGACACTGGCAACATT
![Page 105: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/105.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
79
Table 2. Characteristics of study subjects
Values are mean ± SEM BMI, body mass index; FEV1, forced expiratory volume in 1 sec; FEV1/FVC, FEV1 to
forced vital capacity (FVC) ratio; DLco, diffusing capacity of carbon monoxyde; MTCSA, mid-thigh muscle cross-sectional area. * Versus Controls, p ≤ 0.05
CONTROLS
(n = 9)
COPD
(n = 18)
Age (years) 66 ± 3 65 ± 1 Height (cm) 172 ± 2 170 ± 1 BMI (kg/m
2) 28.7 ± 1.8 25.8 ± 0.7
Fat-free mass (kg) 58.7 ± 1.7 50.1 ± 0.7* Fat-free mass index (kg/m2) 19.8 ± 0.5 17.5 ± 0.5* Fat mass (kg) 21.4 ± 1.1 23.3 ± 1.4 Pulmonary function FEV1 (L) 3.13 ± 0.09 1.04 ± 0.05* FEV1 (% predicted) 104 ± 2 34 ± 2* FEV1/FVC (%) 74 ± 1 34 ± 1* DLCO (% predicted) 93 ± 2 49 ± 2* PaCO2 (mm Hg) - 42 ± 1 PaO2 (mm Hg) - 74 ± 1 Physical activity monitoring Voorrips (score) 5.8 ± 0.5 3.1 ± 0.2* Steps (steps/day) 5836 ± 413 3456 ± 764 Muscle characteristics MTCSA (cm2) 114.7 ± 4.1 79.9 ± 3.9* Total thigh muscle mass (kg) 19.9 ± 1.2 16.5 ± 0.5* Type I muscle fibers (% of total fibers) 51 ± 17 35 ± 15* Type II muscle fibers (% of total fibers) 49 ± 17 65 ± 15*
![Page 106: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/106.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
80
Table 3. Muscle oxidative stress and inflammatory markers Values are mean ± SEM TNF-α, tumor necrosis factor alpha, IL-6, interleukin 6; IL-8, interleukin 8; SAA11, serum amyloid A1; CD45R, cluster of differentiation 45 antigen receptor; Oxyblot, protein carbonylation; 4-HNE, trans-4-hydroxy-2-nonenal.
CONTROLS (n = 9)
COPD (n = 18)
Inflammatory markers TNF-α (stains/fiber) 41.0 ± 4.7 40.6 ± 2.1 IL-6 (stains/fiber) 7.0 ± 2.3 6.0 ± 1.8 IL-8 (stains/fiber) 9.8 ± 2.8 8.2 ± 1.5 SAA11 (stains/fiber) 55.8 ± 7.3 46.1 ± 5.1 CD45R (stains/fiber) 3.5 ± 0.8 3.6 ± 0.4 Oxidative stress markers Oxyblot® (fold increase from CTRL) 1.00 ± 0.03 1.03 ± 0.03 4-HNE (fold increase from CTRL) 1.00 ± 0.09 1.02 ± 0.04
![Page 107: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/107.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
81
3.10 Figures Legend FIGURE 1. Examples of immunohistochemical staining. Isotypical control (panel A), positive staining for SAA11 (panel B) and positive staining for TNF-α (panel C) on muscle cryosections are provided. Arrows point to area of positive staining. FIGURE 2. Group mean values for phosphorylated to total p38 MAPK ratio (panel A), phosphorylated to total ERK 1/2 ratio (panel B), phosphorylated to total JNK ratio (panel C) in the quadriceps of healthy controls and patients with COPD. Bands were normalized according to their correspondent α-tubulin for the cytoplasmic protein content. FIGURE 3. p38 MAPK α (panel A), ERK2 (panel B) and JNK1 (panel C) mRNA expression in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). Data are presented in arbitrary units (A.U.) FIGURE 4. Representative Western blots and group mean values for MAFbx/Atrogin (panel A) and MuRF (panel B) total protein content in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). MAFbx/Atrogin (panel C) and MuRF (panel D) mRNA expression in the quadriceps of healthy controls and patients with COPD. Total ubiquitinated (panel E) and polyubiquitinated (panel F) protein content in the quadriceps of healthy controls and patients with COPD. A.U. = arbitrary units.
FIGURE 5. Correlation between phosphorylated to total ERK ratio and mid-thigh muscle cross-sectional area (panel A), phospho-p38/total p38 and mid-thigh muscle cross-sectional area (panel B), phosphorylated to total ERK ratio and MAFbx/Atrogin (panel C), phosphorylated to total p38 MAPK ratio and MAFbx/Atrogin (panel D) and phosphorylated to total ERK ratio and polyubiquitinated protein levels (panel E) in healthy controls and patients with COPD. A.U. = arbitrary units.
![Page 108: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/108.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
82
3.11 Figures
Figure 1
![Page 109: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/109.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
83
Figure 2
![Page 110: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/110.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
84
Figure 3
![Page 111: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/111.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
85
Figure 4
![Page 112: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/112.jpg)
CHAPITRE III. MAPK Signalling In The Quadriceps Of Patients With COPD
86
Figure 5
![Page 113: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/113.jpg)
![Page 114: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/114.jpg)
CHAPITRE IV
SAA1 EXPRESSION IN THE QUADRICEPS OF PATIENTS WITH COPD
Article en préparation pour The American Journal of Respiratory and Critical Care Medicine
![Page 115: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/115.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
89
4.1 Page Titre
SAA1 EXPRESSION IN THE QUADRICEPS OF PATIENTS WITH CHRONIC OBSTRUCTIVE PULMONAIRY DISEASE
Authors: Bruno B. LEMIRE1, Annie DUBÉ1, Marie-Eve THÉRIAULT1, Yohan BOSSÉ1,2, Richard DEBIGARÉ1 and François MALTAIS1
Affiliation :
1) Centre de recherche, Institut Universitaire de cardiologie et de pneumologie de Québec, Université Laval, Québec, Canada. 2) Department of Molecular Medicine, Laval University, Québec, Canada.
B B. Lemire is the recipient of a PhD training award from the Canadian Institutes of Health Research (CIHR). Y. Bossé is a research scholar from the Heart and Stroke Foundation of Canada. R. Debigaré is a Research Scholar of the Fonds de la Recherche en Santé du Québec. F. Maltais holds a GSK/CIHR Research Chair on COPD at Université Laval. This work has been supported by CIHR grant MOP-84091. Word count: Address of correspondence: Dr François Maltais
Institut Universitaire de Cardiologie et de Pneumologie de Québec
2725 Chemin Ste-Foy Québec, Québec G1V 4G5 CANADA Tel: 418-656-4747 Fax: 418-656-4762
E-mail: [email protected]
![Page 116: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/116.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
90
4.2 Résumé
Plusieurs études ont établi un lien entre l'inflammation systémique et les
changements physiologiques et histologiques observés dans les muscles squelettiques des
patients atteints de la MPOC. Bien que certains résultats énoncés dans la littérature soient
contradictoires quant à l’absence ou la présence d'inflammation, il n’en demeure pas moins
que l'inflammation pourrait être une des causes principales de la dysfonction musculaire
périphérique dans la MPOC. Le Sérum Amyloïde A1 (SAA1) est connu pour être impliqué
dans la dégradation des protéines musculaires. Il a récemment été suggéré comme étant un
nouveau biomarqueur de l'inflammation lors des exacerbations aiguës de la MPOC. Nous
voulions étudier de manière plus approfondie les niveaux d'expression musculaire de SAA1
chez les patients atteints de MPOC modérée à sévère ainsi que pendant une exacerbation de
la maladie. Pour y arriver, des biopsies du quadriceps chez 16 patients atteints de la MPOC
et 7 sujets sains appariés pour l’âge ont été obtenues. Des analyses génétiques et
transcriptionnelles avec des puces à ADN et du PCR en temps réel ont été effectuées. Les
résultats démontrent une augmentation de l'expression du gène SAA1 de 2,5 fois et une
augmentation des niveaux d’ARNm de 66 fois dans le quadriceps des patients atteints de la
MPOC en comparaison avec les sujets sains. De plus, un groupe de validation de 11
patients atteints de la MPOC et de 10 sujets sains appariés pour l’âge a aussi été analysé
pour connaître les niveaux d'ARNm de SAA1 par PCR en temps réel ainsi que de TNF-α,
IL-6 et IL-8 à des fins de comparaison. Les résultats démontrent une augmentation de
l’ARNm de 19 fois dans le quadriceps des patients atteints de la MPOC en comparaison
avec les sujets sains. Aucune différence n’a été détectée pour le TNF-α, IL-6 et IL-8. Enfin,
les résultats de 7 patients hospitalisés pour une exacerbation de leur MPOC démontrent une
impressionnante augmentation de l'ARNm de SAA1 de 36 542 fois en comparaison avec
les sujets sains. Cette étude met en évidence un rôle possible de SAA1 comme marqueur de
l’inflammation musculaire chez la MPOC et suggère qu’il pourrait être un facteur
important dans la dysfonction musculaire chez la MPOC.
![Page 117: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/117.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
91
4.2 Abstract
Several reports have linked systemic inflammation with the physiological and histological
changes observed in the skeletal muscles of patients with COPD. Although results have
been inconsistent with the presence or not of inflammation, the possibility remains that
inflammation may be a key mediator of limb muscle dysfunction in COPD. Serum amyloid
A1 (SAA1), an acute phase protein, has been suggested to be a novel biomarker of
inflammation during acute exacerbations in COPD and has been known to be elevated
during cachexia as well as being involved in protein degradation. We investigated SAA1
muscle expression levels in patients with moderate to severe COPD under stable condition
and during an exacerbation of the disease. Sixteen (16) patients with COPD and 7 age-
matched healthy controls had a biopsy of the quadriceps. Tissue was analyzed by gene Chip
analysis and qPCR. Results indicate a 2.5-fold increase in SAA1 gene expression and a 66-
fold increase in SAA1 mRNA expression in the quadriceps of patients with COPD. A
validation group of 11 COPD and 10 age-matched healthy controls were also analyzed for
SAA1, TNF-α, IL-6 and IL-8 mRNA expression. Results showed a 19-fold increase in
quadriceps SAA1 mRNA expression in patients with COPD compared to controls while no
differences were seen in TNF-α, IL-6 and IL-8. Finally, a 36 542-fold increase in
quadriceps SAA1 mRNA expression was seen in 7 exacerbated patients compared to
healthy controls. This study highlights a possible role of SAA1 expression as a marker
and/or a contributor to limb muscle dysfunction in COPD.
Keywords: muscle dysfunction, COPD, SAA1, muscle wasting
![Page 118: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/118.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
92
4.3 Introduction
Chronic obstructive pulmonary disease COPD) is associated with an array of
systemic manifestations among which limb muscle atrophy has been the subject of detailed
researches (11, 13, 19, 34). Inflammation has been proposed to be a key mechanism in the
initiation and perpetuation of muscle loss in several animal and human models of cachexia
(15, 30). However in COPD, neither convincing nor consistent evidence of muscle
inflammation has emerged (3, 27) and the search for an inflammatory mediator that could
orchestrate the signalling cascades involved in limb muscle protein degradation in COPD
has lead to disappointing results.
Serum amyloid A1 (SAA1), an acute phase protein, is a multifunctional
apolipoprotein involved in cholesterol transport and metabolism. It is one of the typical
inflammatory markers because of its role in the modulation of numerous immunological
responses and its ubiquitous presence in inflammatory diseases (29, 32, 35), such as in
COPD (7, 21). Recently, SAA1 has been proposed as a novel biomarker of inflammation
during acute exacerbations in COPD (7). The biological functions of SAA1 have not been
fully defined, although recent reports indicate that SAA1 induces pro-inflammatory
cytokine expression (17), can modify receptors of pro-resolving signals of inflammation
thus preventing tissue healing in lungs (6) and contributes to muscle protein degradation in
L6 myotubes (36). While the most abundant production of SAA1 comes from the liver,
extra hepatic sources of SAA1 involve a wide range of tissues including kidney, stomach,
spleen, heart, brain and skeletal muscle (10, 32). SAA1 muscle gene expression is elevated
during cancer cachexia and in this model the muscles could provide a large fraction of the
serum acute phase proteins such as SAA1(5). SAA1 could mediate the inflammatory
response through Signal Transducer and Activator of Transcription 3 (STAT3) and the
Mitogen-Activated Protein Kinases (MAPKs) activation (5).
In 2008, we reported the mRNA expression profile of the quadriceps in a small
sample of patients with COPD (13). An intriguing finding was the 21.2 fold increase in the
SAA1 mRNA expression level in the quadriceps of patients with stable COPD compared to
age-matched healthy controls. This was, by far, the most upregulated gene found in this
exploratory experiment. This finding was corroborated by a subsequent muscle gene
![Page 119: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/119.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
93
expression study involving reporting a 1.9 fold increase in SAA1 in 6 patients with COPD
in comparison with 5 healthy controls (26).
Since SAA1 is a marker of inflammation that is increased during cellular stress and
might precede a cascade of metabolic events detrimental to skeletal muscle, this
investigation aimed at; 1) evaluating quadriceps gene and mRNA SAA1 expression in a
discovery study of patients with COPD in comparison to healthy age-matched subjects; 2)
validating the mRNA expression of SAA1 in a validation study and comparing these results
with other intramuscular cytokines (TNF-α, IL-6 and IL-8) and finally; 3) obtaining
preliminary data on the mRNA expression of SAA1 in patients with COPD suffering from
an acute exacerbation.
![Page 120: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/120.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
94
4.4 Methods
Subjects
Patients with moderate to severe COPD and healthy age-matched controls were
recruited; 16 and 7, respectively for the discovery study (COPD DIS) and 11 and 10,
respectively for the validation study (COPD VAL). The diagnosis of COPD was based on
spirometry showing moderate to severe irreversible airflow obstruction (forced expiratory
volume in 1 second [FEV1] < 80% predicted value, and FEV1/ forced vital capacity [FVC]
< 70%). All patients with COPD were in a stable condition at the time of the study without
any acute exacerbation of their disease or exposure to systemic corticosteroids within 2
months of their participation in the study. None of the patients was receiving long-term
oxygen therapy. Patients with COPD and healthy controls were excluded if they presented
any medical condition, other than COPD (in the case of patients with COPD), likely to
influence muscle and biochemical testing (i.e. cardiovascular, neurological,
musculoskeletal, locomotor or other respiratory diseases). In both groups, only ex-smoker
sedentary males who had stopped for at least 6 months were included. In the exacerbation
study, seven patients (COPD EXA) were recruited within a range of 48 hours of the
exacerbation onset and before systemic corticosteroids and antibiotics were initiated. The
institutional ethics committee approved the research protocol and a signed informed
consent was obtained from each subject.
Study design
After reviewing medical history and familiarization with the study procedures,
participants filled out a physical activity questionnaire (33). Anthropometric measurements,
bioelectrical impedance, pulmonary function testing, computed tomographies of the thigh
were performed in all participants with the exception of the 7 exacerbated patients. A
needle biopsy of the quadriceps was then performed after 30 minutes of rest in the supine
position.
![Page 121: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/121.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
95
Anthropometric measurements and body composition.
Height and weight were measured according to standardized methods (14). Dual
energy X-ray Absorptiometry (DEXA) provided regional assessment of fat, fat-free mass
and total thigh muscle mass (General Electric Healthcare, Chicago, IL).
Pulmonary function testing
Standard pulmonary function tests including spirometry, lung volumes, and carbon
monoxide diffusion capacity were obtained according to previously described guidelines (2).
Results were related to previously publish normal values (24).
Measurement of mid-thigh muscle cross-sectional area
A computed tomography (CT) of the right thigh halfway between the pubic
symphysis and the inferior condyle of the femur was performed using a fourth-generation
Toshiba Scanner 900S (Toshiba). Computed tomography was used to quantify muscle
cross-sectional area mass in a more specific manner than anthropometric measurements
(28).
Systemic inflammation markers The antecubital venous blood was centrifuged for 10-min, plasma was aliquoted,
and stored at -80°C until further analysis. Commercial ELISA kits (R&D Systems Inc,
Minneapolis, MN, USA and Invitrogen, Ontario, Canada) were used to measure the plasma
levels of systemic inflammatory markers (TNF-α, IL-6, IL-8, CRP, SAA1).
Muscle biopsy and muscle specimen analyses
Needle biopsies of the quadriceps were performed as described by Bergström and
routinely done in our laboratory (4, 18). Muscle specimens were frozen in liquid nitrogen
and stored at -80°C for future analysis.
Quantitative Real-Time PCR
![Page 122: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/122.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
96
Total RNA extraction was performed from ≈ 15 mg of muscle using a commercially
available preparation (TRIzol® Reagent) (Invitrogen, Burlington, ON, Canada). One μg of
RNA was reverse transcribed to cDNA using QuantitectTM Reverse Transcription Kit
(Qiagen, Mississauga, ON, Canada). qPCR were performed in a Rotor-GeneTM 6000
(Corbett Life Science, San Francisco, CA, USA) using QuantitectTM SYBR® Green PCR
Kit (Qiagen, Mississauga, ON, Canada). At the end of the qPCR amplifications, the
samples were subjected to a melting curve analysis. The comparative threshold cycles
(∆CT) values for SAA1, TNF-α, IL-6 and IL-8 were normalized with RPLPO or 18s
reference genes and analyzed using the 2-∆Ct method (22). All qPCR runs were performed
in duplicate to ensure quantitative accuracy. Specific primers are given in Table 1. All
qPCR runs were performed in duplicate to ensure quantitative accuracy.
Microarray analysis
We performed microarray analysis using the HumanWG-6 v3.0 expression
BeadChips (Illumina, San Diego, California) with the total muscle RNA that was extracted
from muscle specimens. The false discovery rate (FDR) and the fold change threshold were
set at 5% and 2.0, respectively.
Statistical analysis
Data are expressed as the mean ± standard error of the mean and were analyzed
using a statistical package program SAS version 9.01. Between-group comparisons were
done using a Mann-Whitney test, while normality for all data was assessed with a Shapiro-
Wilk test. Pearson’s correlation analysis was done for any relevant associations. Results
were considered significant if p values were less than 0.05.
![Page 123: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/123.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
97
4.5 Results
Subjects’ characteristics
Anthropometric characteristics and pulmonary function data are provided in Table
2, 3 and 4 for all study groups. On average, patients with COPD had moderate to severe
airflow obstruction, reduced diffusion capacity and mild hypoxemia. Physically, they were
also significantly lighter than the age-matched healthy controls, explained mostly by the
decrease in lean muscle mass (table 2).
Muscle characteristics
Mid-thigh muscle cross sectional area was smaller in COPD compared to controls
for both the discovery and validation studies. In the discovery study, patients’ mid-thigh
muscle cross-sectional areas ranged from severe atrophy (47 cm2) to normal value (104
cm2). Three patients exhibited a mid-thigh muscle cross-sectional area < 70 cm2, a value
that is associated with poor survival (23). In the validation study, patients’ mid-thigh
muscle cross-sectional areas ranged from severe atrophy (59 cm2) to normal value (118
cm2) while two patients exhibited a mid-thigh muscle cross-sectional area < 70 cm2.
Systemic inflammation markers IL-6, IL-8, TNF-α, CRP (C-reactive protein) and SAA1 proteins assays were
performed in the validation and for exacerbation group of patient. IL-8 (p = 0.01) and CRP
(p = 0.03) were significantly elevated in the COPD EXA group compared to healthy
controls. In addition, SAA1 was significantly elevated in the COPD EXA group compared
to healthy controls (p = 0.02) (Figure 4).
Gene and mRNA analysis
In the discovery study, the muscle microarray analysis showed a 2.5 fold elevation
in SAA1 (q value = 0, false discovery rate of 0%) in patients with COPD DIS compared to
healthy controls. These results were verified by qPCR, where the expression of SAA1 was
65.8-fold (p = 0.004) greater in COPD DIS compared to healthy controls (table 5).
![Page 124: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/124.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
98
In the validation study, the SAA1 mRNA expression was 19.3 fold (p = 0.0006)
greater in the COPD VAL group compared to controls (table 5, figure 1). In addition, TNF-
α (p = 0.88), IL-6 (p = 0.87) and IL-8 (p = 0.88) did not show any difference in mRNA
expression between groups (figure 2).
During exacerbation, the SAA1 mRNA expression averaged 36 542-fold (p =
0.0002) increase in COPD EXA patients compared to controls in this study (figure 1).
However, TNF-α (p = 0.60), IL-6 (p = 0.77) and IL-8 (p = 0.32) mRNA expression was
similar between groups (figure 2).
Finally, Pearson’s analysis between the quadriceps mRNA expression (fold from
CTRL) and the mid-thigh cross-sectional area (MTCSA) in all study participants showed a
significant negative correlation of r = -0.35 (p ≤ 0.05) (figure 3).
![Page 125: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/125.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
99
4.6 Discussion
This investigation quantified SAA1 at the gene and the mRNA levels in the
quadriceps of patients with COPD compared to age-matched healthy controls. We validated
findings of the discovery study in a validation study and provided preliminary data about
SAA1 levels during an acute COPD exacerbation. Our results confirm that the gene
expression and mRNA levels of SAA1 are increased in the muscle tissue of patients with
stable COPD (13, 26). The results also show an impressive SAA1 quadriceps mRNA
expression during an exacerbation while other muscle cytokine expression such as TNF-α,
IL-6 and IL-8 were not significantly modified. A similar pattern was seen in systemic
inflammation in these patients.
Increased muscle SAA1 mRNA levels following an acute exercise bout has been
reported without seeing any increases in plasma SAA1 levels (9), confirming the intrinsic
capacity of the muscle to produce this protein. Although not all available mRNA
synthesized in a given cell is necessarily translated into protein (16), the abundance in
SAA1 mRNA could act as a reservoir for an acute response when the organism is being
stressed or may be produced under conditions that do not evoke the systemic acute-phase
response and could play a role related to the site of expression (32).
In the case where systemic inflammation is known to be present, albeit during a
COPD exacerbation, SAA1 systemic levels are rapidly increased in patients with COPD
and could be involved in the inflammation imbalance that ‘opposes anti-inflammatory and
pro-resolution pathways’ during these events (7, 8). This study again demonstrates that
systemic levels of SAA1 are elevated in exacerbated patients while IL-6 and TNF-α were
not (figure 4).
Specifically to the peripheral muscles, only scant and unconvincing data supporting
the presence of quadriceps inflammation in COPD have been reported (1, 20, 25). Our own
findings (13) are corroborated by others (3) who did not find evidence of quadriceps
inflammation in COPD, even in the presence of muscle wasting or during periods of acute
exacerbation when inflammatory bursts should be expected (12). In this context, the present
investigation is relevant because it provides a robust observation of the presence of an acute
![Page 126: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/126.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
100
phase inflammatory marker within a limb muscle in patients with COPD. The lack of
significant changes in other pro-inflammatory cytokines in the face of an elevated SAA1
also raises the hypothesis of specificity in the nature of muscle inflammation occurring in
COPD.
Bozinovski et al. eloquently demonstrated that SAA1 could in fact be a potential
biomarker for acute exacerbations in COPD, but its presence in peripheral muscles had, to
the best of our knowledge, never been investigated. Therefore, these and our results merit
further investigation on the possible contribution to the development of muscle dysfunction
in COPD. However, our Pearson’s analysis showed a significant negative correlation
between the SAA1 quadriceps expression and the MTCSA of our study subjects, raising a
possibility that SAA1 could play a role in muscle atrophy in COPD, as it is already known
to be a candidate pathogenic mediator in the mechanism for defective resolution in lung
tissue in COPD (8).
Although not investigated in the present study, cellular and animal data support a
possible mechanistic role of SAA1 in the development of muscle atrophy. In L6 myotubes,
SAA1 in combination with IL-6 has been associated with a decreased IGF-1 signalling and
an increased protein degradation (36). SAA1 accumulates in the quadriceps and
gastrocnemius of cachectic mice in association with up-regulation in the proteasome, IL-6
and MAPKs signalling pathways (5), suggesting the possible involvement of SAA1 on
protein regulation cellular signalling in muscle.
The SAA1 mRNA upregulation may be even more relevant during the course of an
exacerbation, a period during which patients with COPD are vulnerable to the deterioration
of muscle function (31). In this context, the dramatic elevation of SAA1 suggests that this
protein is not a mere bystander but could be involved in the regulation of the inflammatory
process. We acknowledge the preliminary nature of our study but the consistencies across
the discovery and validation studies as well as the findings in the exacerbated patients
provide a plausible target for the investigation of inflammation as a mechanism of limb
muscle atrophy in COPD.
![Page 127: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/127.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
101
4.7 Conclusion
This study provides solid evidence that inflammation is increased within the
quadriceps of patients with COPD. The possibility exists that SAA1 expression may exert a
pathogenic role in the development of limb muscle dysfunction in COPD. SAA1 may also
become a valuable biomarker of the muscle inflammation in this disease. Further
mechanistic studies are needed to elucidate the role of SAA1 in muscle inflammation and
atrophy in COPD.
ACKNOWLEDGEMENTS
The authors acknowledge the help of Dr Steeve Provencher, Dr Julie Milot, Sana
Chambah, Fernanda Ribeiro, Marthe Bélanger, Marie-Josée Breton, Brigitte Jean and Josée
Picard in accomplishing this study.
![Page 128: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/128.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
102
4.8 References
1. Agusti A. NF- B activation and iNOS upregulation in skeletal muscle of patients with COPD and low body weight. Thorax 59: 483-487, 2004. 2. ATS. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. American Journal of Respiratory and Critical Care Medicine 152: S77-121, 1995. 3. Barreiro E, Schols AM, Polkey MI, Galdiz JB, Gosker HR, Swallow EB, Coronell C, and Gea J. Cytokine profile in quadriceps muscles of patients with severe COPD. Thorax 63: 100-107, 2008. 4. Bergstrom J. Muscle electrolytes in man determined by neutron activation analysis on needle biopsy specimens. Scandinavian Journal of Clinical and Laboratory Investigation 14: 1962. 5. Bonetto A, Aydogdu T, Kunzevitzky N, Guttridge DC, Khuri S, Koniaris LG, and Zimmers TA. STAT3 activation in skeletal muscle links muscle wasting and the acute phase response in cancer cachexia. PLoS One 6: e22538, 2011. 6. Bozinovski S, Anthony D, Anderson GP, Irving LB, Levy BD, and Vlahos R. Treating neutrophilic inflammation in COPD by targeting ALX/FPR2 resolution pathways. Pharmacol Ther 2013. 7. Bozinovski S, Hutchinson A, Thompson M, Macgregor L, Black J, Giannakis E, Karlsson AS, Silvestrini R, Smallwood D, Vlahos R, Irving LB, and Anderson GP. Serum amyloid a is a biomarker of acute exacerbations of chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 177: 269-278, 2008. 8. Bozinovski S, Uddin M, Vlahos R, Thompson M, McQualter JL, Merritt AS, Wark PA, Hutchinson A, Irving LB, Levy BD, and Anderson GP. Serum amyloid A opposes lipoxin A(4) to mediate glucocorticoid refractory lung inflammation in chronic obstructive pulmonary disease. Proc Natl Acad Sci U S A 109: 935-940, 2012. 9. Buford TW, Cooke MB, and Willoughby DS. Resistance exercise-induced changes of inflammatory gene expression within human skeletal muscle. Eur J Appl Physiol 107: 463-471, 2009. 10. Cheval L, Pierrat F, Dossat C, Genete M, Imbert-Teboul M, Duong Van Huyen JP, Poulain J, Wincker P, Weissenbach J, Piquemal D, and Doucet A. Atlas of gene expression in the mouse kidney: new features of glomerular parietal cells. Physiol Genomics 43: 161-173, 2011. 11. Couillard A, and Préfaut C. From muscle disuse to myopathy in COPD: potential contribution of oxidative stress. Eur Respir J 26: 703-719, 2005. 12. Crul T, Spruit MA, Gayan-Ramirez G, Quarck R, Gosselink R, Troosters T, Pitta F, and Decramer M. Markers of inflammation and disuse in vastus lateralis of chronic obstructive pulmonary disease patients. Eur J Clin Invest 37: 897-904, 2007.
![Page 129: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/129.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
103
13. Debigaré R, Maltais F, Côté CH, Michaud A, Caron MA, Mofarrahi M, Leblanc P, and Hussain SN. Profiling of mRNA expression in quadriceps of patients with COPD and muscle wasting. Copd 5: 75-84, 2008. 14. Heymsfield SB WP. Nutritional assessment by clinical and biochemical methods. In: Modern nutrition in health and disease. Philadelphia: Lea & Febiger, 1994, p. pp. 812-841. 15. Lenk K, Schuler G, and Adams V. Skeletal muscle wasting in cachexia and sarcopenia: molecular pathophysiology and impact of exercise training. J Cachexia Sarcopenia Muscle 1: 9-21, 2010. 16. Maier T, Guell M, and Serrano L. Correlation of mRNA and protein in complex biological samples. FEBS Lett 583: 3966-3973, 2009. 17. Malle E, Sodin-Semrl S, and Kovacevic A. Serum amyloid A: an acute-phase protein involved in tumour pathogenesis. Cell Mol Life Sci 66: 9-26, 2009. 18. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Bélanger M, Breton MJ, and Jobin J. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 55: 848-853, 2000. 19. Montes de Oca M, Loeb E, Torres SH, De Sanctis J, Hernandez N, and Talamo C. Peripheral muscle alterations in non-COPD smokers. Chest 133: 13-18, 2008. 20. Montes de Oca M, Torres SH, De Sanctis J, Mata A, Hernandez N, and Talamo C. Skeletal muscle inflammation and nitric oxide in patients with COPD. Eur Respir J 26: 390-397, 2005. 21. Nussbaumer-Ochsner Y, and Rabe KF. Systemic manifestations of COPD. Chest 139: 165-173, 2011. 22. Quanjer PH, and Furberg CD. GOLD COPD stage I is not associated with increased risk of death. Respiratory Medicine 106: 153, 2012. 23. Quanjer PH, Schouten JP, Miller MR, and Ruppel G. Avoiding bias in the annualized rate of change of FEV1. American Journal of Respiratory and Critical Care Medicine 175: 291-292; author reply 292, 2007. 24. Quanjer PH, Tammeling GJ, Cotes JE, Pedersen OF, Peslin R, and Yernault JC. Lung volumes and forced ventilatory flows. Report Working Party Standardization of Lung Function Tests, European Community for Steel and Coal. Official Statement of the European Respiratory Society. Eur Respir J Suppl 16: 5-40, 1993. 25. Rabinovich RA, Figueras M, Ardite E, Carbo N, Troosters T, Filella X, Barbera JA, Fernandez-Checa JC, Argiles JM, and Roca J. Increased tumour necrosis factor-alpha plasma levels during moderate-intensity exercise in COPD patients. Eur Respir J 21: 789-794, 2003. 26. Radom-Aizik S, Kaminski N, Hayek S, Halkin H, Cooper DM, and Ben-Dov I. Effects of exercise training on quadriceps muscle gene expression in chronic obstructive pulmonary disease. J Appl Physiol 102: 1976-1984, 2007.
![Page 130: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/130.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
104
27. Sin DD, and Reid WD. Is inflammation good, bad or irrelevant for skeletal muscles in COPD? Thorax 63: 95-96, 2008. 28. Sipila S, and Suominen H. Muscle ultrasonography and computed tomography in elderly trained and untrained women. Muscle Nerve 16: 294-300, 1993. 29. Sun Y, Zhang P, Li X, Zhang H, Li J, Liu G, and Guo J. A novel nonsense mutation Y652X in the S6/pore region of human ether-go-go gene found in a long QT syndrome family. Scand Cardiovasc J 43: 181-186, 2009. 30. Tisdale MJ. Biomedicine. Protein loss in cancer cachexia. Science 289: 2293-2294, 2000. 31. Troosters T, Probst VS, Crul T, Pitta F, Gayan-Ramirez G, Decramer M, and Gosselink R. Resistance training prevents deterioration in quadriceps muscle function during acute exacerbations of chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 181: 1072-1077, 2010. 32. Urieli-Shoval S, Linke RP, and Matzner Y. Expression and function of serum amyloid A, a major acute-phase protein, in normal and disease states. Curr Opin Hematol 7: 64-69, 2000. 33. Voorrips LE, Ravelli AC, Dongelmans PC, Deurenberg P, and Van Staveren WA. A physical activity questionnaire for the elderly. Med Sci Sports Exerc 23: 974-979, 1991. 34. Wagner PD. Possible mechanisms underlying the development of cachexia in COPD. Eur Respir J 31: 492-501, 2008. 35. Wang W, Wang J, Li J, Mao L, Guo F, and Zhang B. New mutation of the patched homologue 1 gene in a Chinese family with naevoid basal cell carcinoma syndrome. Br J Oral Maxillofac Surg 47: 366-369, 2009. 36. Zhang L, Du J, Hu Z, Han G, Delafontaine P, Garcia G, and Mitch WE. IL-6 and serum amyloid A synergy mediates angiotensin II-induced muscle wasting. J Am Soc Nephrol 20: 604-612, 2009.
![Page 131: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/131.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
105
4.9 Figure Legend
Table 1. Primer sequences used for qPCR analyses Target mRNA
PCR primer sequence 5’→ 3’
SAA1 Forward Reverse
CTC CTT GGT CCT GGG TGT C TTG TCT GAG CCG ATG TAA TTG G
TNF-α Forward Reverse
ACCACGCTCTTCTGCCTGCTG TCTGGTAGGAGACGGCGATGC
IL-8 Forward Reverse
ATGACTTCCAAGCTGGCCGTGGCT TCTCAGCCCTCTTCAAAAACTTCT
IL-6 Forward Reverse
CTGGGGCTGCTCCTGGTGTTG AGGCTGGCATTTGTGGTTGGG
18s Forward TTGACGGAAGGGCACCACCAG Reverse GCACCACCACCCACGGAATCG PPIA Forward ACGTGGTATAAAAGGGGCGGGAGG Reverse ACACGGTTTTCCTCGGCGGTG RPLPO Forward
Reverse TCTACAACCCTGAAGTGCTTGATATC GCAGACAGACACTGGCAACATT
![Page 132: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/132.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
106
Table 2. Characteristics of study subjects in the discovery study Values are mean ± SEM BMI, body mass index; FEV1, forced expiratory volume in 1 sec; FEV1/FVC, FEV1 to forced vital capacity (FVC) ratio; DLco, diffusing capacity of carbon monoxyde; MTCSA, mid-thigh muscle cross-sectional area. * Versus Controls, p ≤ 0.05 † Versus Controls, p ≤ 0.10
CONTROLS (n = 7)
COPD (n = 16)
Age (years) 68 ± 2 64 ± 1 Weight (kg) 88.8 ± 3.8 73.5 ± 3.9* BMI (kg/m
2) 30 ± 1 26 ± 2†
Fat-free mass (kg) 60.7 ± 2.8 49.1 ± 1.4* Fat-free mass index (kg/m2) 20 ± 1 17 ± 0.4* Fat mass (kg) 24.8 ± 2.3 20.8 ± 2.5 MTCSA (cm2) 118.5 ± 3.9 84.4 ± 4.2* Pulmonary function FEV1 (L) 3.1 ± 0.2 1.1 ± 0.2* FEV1 (% predicted) 104 ± 4 35.6 ± 3.6* FEV1/FVC (%) 75 ± 2 35 ± 2* DLCO (% predicted) 95 ± 4 49 ± 4* PaCO2 (mm Hg) N/A - 43.1 ± 1.8 PaO2 (mm Hg) N/A - 72.8 ± 2.1
![Page 133: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/133.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
107
Table 3. Characteristics of study subjects in the validation study
Values are mean ± SEM BMI, body mass index; FEV
1, forced expiratory volume in 1 sec; FEV1/FVC, FEV1 to forced vital capacity (FVC) ratio; DLco, diffusing capacity of carbon monoxyde; MTCSA, mid-thigh muscle cross-sectional area. * Versus Controls, p ≤ 0.05
CONTROLS (n = 10)
COPD (n = 11)
Age (years) 64 ± 3 68 ± 2 Weight (kg) 75.3 ± 3.8 80.4 ± 5.7 BMI (kg/m
2) 27 ± 1 27 ± 2
Fat-free mass (kg) 54.6 ± 2.4 50.6 ± 1.8 Fat-free mass index (kg/m2) 19 ± 0.5 17 ± 1* Fat mass (kg) 18.5 ± 1.8 24.5 ± 4.1 MTCSA (cm2) 108.5 ± 6.3 84.3 ± 5.2* Pulmonary function FEV1 (L) 3.4 ± 0.2 1.3 ± 0.1* FEV1 (% predicted) 117 ± 6 45 ± 3* FEV1/FVC (%) 79 ± 1 38 ± 3* DLCO (% predicted) 99 ± 5 61 ± 6* PaCO2 (mm Hg) N/A - 39.5 ± 1.7 PaO2 (mm Hg) N/A - 73.7 ± 2.8
![Page 134: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/134.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
108
Table 4. Characteristics of the exacerbated patients with COPD Values are mean ± SEM BMI, body mass index; FEV1, forced expiratory volume in 1 sec; FEV1/FVC, FEV1 to forced vital capacity (FVC) ratio. * Versus all study Controls, p ≤ 0.05
COPD (n = 7)
Age (years) 66 ± 2 Weight (kg) 65.0 ± 6.0 BMI (kg/m
2) 26 ± 3
Pulmonary function FEV1 (L) 1.4 ± 0.2* FEV1 (% predicted) 44 ± 8* FEV1/FVC (%) 54 ± 3*
![Page 135: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/135.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
109
Table 5. mRNA expression of SAA1 by microarrays in all study subjects
Values are fold from controls All values are presented as fold
from their respective age-matched controls, except for exacerbated COPD as they are presented as fold from all controls. * p ≤ 0.05 from CTRL
q-value p-value Fold from CTRL COPD discovery group (n=16)
mRNA expression by microarrays 0 2.5 mRNA levels 0.004 65.8*
COPD validation group (n=11)
mRNA levels 0.0006 19.3* COPD exacerbated group (n=7)
mRNA levels 0.0002 36 542*
![Page 136: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/136.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
110
4.10 Figure Legend
FIGURE 1. Quadriceps mRNA expression (fold from CTRL) of SAA1 in clinically stable COPD for the discovery group (COPD DIS), in clinically stable COPD for the validation group (COPD VAL) and exacerbated COPD (COPD EXA). Doted line represent CTRL values set at 1. COPD DIS vs. respective CTRL, p = 0.004; COPD VAL vs. respective CTRL, p = 0.0006; COPD EXA vs. all study CTRL, p = 0.0002. FIGURE 2. Quadriceps mRNA expression (fold from CTRL) (A) IL-6 (B) IL-8 and (C) TNF-α in clinically stable COPD for the validation group (COPD VAL) and exacerbated COPD (COPD EXA). Doted line represent CTRL values set at 1. FIGURE 3. Pearson’s correlation between the quadriceps mRNA expression (fold from CTRL) and the Mid-thigh cross-sectional area (MTCSA) for all study participants. Black circles = COPD, grey circle = healthy controls. Pearson’s correlation of -0.35, p ≤ 0.05 FIGURE 4. Proteins blood levels (ng/ml) for (A) IL-6 (B) IL-8 and (C) TNF-α (D) CRP (C-reactive proteins) and (E) SAA1 in healthy controls (CTRL), clinically stable COPD for the validation group (COPD VAL) and exacerbated COPD (COPD EXA).
![Page 137: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/137.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
111
4.11 Figures Figure1
![Page 138: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/138.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
112
Figure 2.
A
B
C
![Page 139: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/139.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
113
Figure 3.
![Page 140: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/140.jpg)
CHAPITRE IV. SAA1 Expression in the Quadriceps of Patients with COPD
114
Figure 4.
![Page 141: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/141.jpg)
115
![Page 142: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/142.jpg)
116
CHAPITRE V
QUADRICEPS METABOLISM DURING CONSTANT WORKRATE CYCLING EXERCISE IN CHRONIC OBSTRUCTIVE PULMONARY
DISEASE
Article publié dans the Journal of Applied Physiology
Saey D*, Lemire BB*, Gagnon P, Bombardier E, Tupling AR, Debigaré R, Côté CH, and Maltais F. Quadriceps metabolism during constant workrate cycling exercise in chronic obstructive pulmonary disease. J Appl Physiol 110: 116-124, 2011
![Page 143: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/143.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
117
5.1 Page titre
QUADRICEPS METABOLISM DURING CONSTANT WORKRATE CYCLING EXERCISE IN CHRONIC OBSTRUCTIVE PULMONARY DISEASE
Authors: Didier SAEY1, Bruno B. LEMIRE1, Philippe GAGNON1, Éric BOMBARDIER2, A. Russell TUPLING2, Richard DEBIGARÉ1, Claude H. CÔTÉ3, and François MALTAIS1
Affiliation :
1Centre de recherche, Institut Universitaire de cardiologie et de pneumologie de Québec, Université Laval, Québec, Canada. 2Department of Kinesiology, University of Waterloo, Waterloo, Ontario, Canada 3Centre de recherche du CHUQ, Pavillon CHUL, Université Laval, Québec, Canada DS and BBL contributed equally to this work. B B. Lemire is the recipient of a Ph.D. training award from the Canadian Institutes of Health Research (CIHR). F. Maltais holds a GSK/CIHR Research Chair on COPD at Université Laval. This work has been supported by CIHR grant MOP-84091. Running head: Quadriceps metabolism during exercise in COPD Word count: 4292 Address of correspondence: Dr François Maltais Institut Universitaire de cardiologie et de pneumologie de Québec 2725 Chemin Ste-Foy Québec, Québec G1V 4G5 CANADA Tel: 418-656-4747 Fax: 418-656-4762 E-mail: [email protected]
![Page 144: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/144.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
118
5.2 Résumé La modification du métabolisme dans les muscles périphériques des patients atteints de la
MPOC contribue potentiellement à l'intolérance à l’effort dans cette maladie. Cette étude a examiné
le métabolisme énergétique du quadriceps, de la dégradation du glycogène à l'accumulation de
lactate, pendant un exercice fait jusqu’à épuisement chez des patients atteints de la MPOC. Nous
avons mesuré, chez 12 patients atteints de la MPOC et 10 sujets sains appariés pour l’âge, 1) les
niveaux de substrats énergétiques et les produits de la glycolyse (glycogène, glucose, pyruvate,
lactate) et les marqueurs intermédiaires de la glycolyse (glucose-6-phophate, glucose-1-phophate,
fructose-6-phosphate) et 2) l'activité des enzymes impliquées dans la régulation de la glycolyse
(phosphofructokinase, lactate déshydrogénase) avant et après un exercice de charge constante sur
ergocycle à 80% du maximum fait jusqu’à épuisement. L’intensité de l'exercice (p < 0,01), la durée
(p = 0,049) et le travail total (p < 0,01) étaient significativement abaissés chez les patients atteints
de la MPOC. Les variations de substrats énergétiques et les produits finaux de la glycolyse après
l’exercice sur ergocycle étaient similaires chez les patients atteints de la MPOC et les sujets sains.
Le niveau de glucose-6-phophate (p = 0,036) et de fructose-6-phosphate (p = 0,042) étaient
significativement plus élevés chez les patients atteints de la MPOC après l'exercice. Les enzymes de
la glycolyse, le phosphofructokinase (p < 0,01) et le lactate déshydrogénase (p = 0,02), étaient aussi
plus élevés chez les patients atteints de la MPOC. L'utilisation du glycogène musculaire (p = 0,022)
et l'accumulation du lactate musculaire (p = 0,025) par unité de travail étaient plus élevés chez les
patients MPOC. En conclusion, l'exercice fait jusqu’à épuisement induit des changements
métaboliques d’ampleur similaire dans le quadriceps des patients atteints de MPOC et des sujets
sains appariés pour l’âge. Par contre, ces évènements intramusculaires surviennent à une charge de
travail beaucoup plus faible et plus rapidement chez les patients atteints de la MPOC. Nos données
suggèrent une plus grande dépendance à la glycolyse au cours de l'exercice chez la MPOC, ce qui
pourrait contribuer à l'intolérance à l’effort dans cette maladie.
![Page 145: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/145.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
119
5.2 Abstract Impaired resting metabolism in peripheral muscles potentially contributes to exercise intolerance in
COPD. This study investigated the cytosolic energy metabolism of the quadriceps, from glycogen
degradation to lactate accumulation, in exercising patients with COPD, in comparison to healthy
controls. We measured, in 12 patients with COPD and 10 control subjects, resting and post-cycling
exercise quadriceps levels of 1) energy substrates and end-products of glycolysis (glycogen,
glucose, pyruvate, lactate) and intermediate markers of glycolysis (glucose-6-phophate, glucose-1-
phophate, fructose-6-phosphate) and 2) the activity of key enzymes involved in the regulation of
glycolysis (phosphofructokinase, lactate dehydrogenase). Exercise intensity (p < 0.01), duration (p
= 0.049) and total work (p < 0.01) were reduced in patients with COPD. The variations in energy
substrates and end-products of glycolysis after cycling exercise were of similar magnitude in
patients with COPD and controls. Glucose-6-phophate (p = 0.036) and fructose-6-phosphate (p =
0.042) were significantly elevated in patients with COPD after exercise. Phosphofructokinase (p <
0.01) and lactate dehydrogenase (p = 0.02) activities were greater in COPD. Muscle glycogen
utilization (p = 0.022) and lactate accumulation (p = 0.025) per unit of work were greater in COPD.
We conclude that cycling exercise induced changes in quadriceps metabolism in patients with
COPD that were of similar magnitude to those of healthy controls. These intramuscular events
required a much lower exercise workload and time to occur in COPD. Our data suggests a greater
reliance on glycolysis during exercise in COPD which may contribute to exercise intolerance in
COPD.
Word count: 247
Keywords: COPD, exercise, cycle ergometer, muscle metabolism, muscle biopsy
![Page 146: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/146.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
120
5.3 Introduction
Exercise limitation is a hallmark feature of chronic obstructive pulmonary disease (COPD).
The contribution of peripheral muscle dysfunction to exercise intolerance in COPD is still debated
(11). While appreciating the complex nature of exercise intolerance in COPD (34), our group has
reported that peripheral muscle fatigue reduces exercise capacity in this disease (13, 39). We
showed that the occurrence of quadriceps fatigue prevents bronchodilation to translate into
improved exercise capacity (39) and that the pre-induction of quadriceps fatigue reduces the
endurance during constant workrate exercise (13). Susceptibility to muscle fatigue in COPD is
assumed to be related to the reduction in the proportion of fatigue-resistant slow-twitch muscle
fibers and in oxidative enzyme activity (16, 48). These phenotypic and enzymatic muscle changes
modify muscle energy metabolism during exercise resulting in premature muscle acidosis, lactate
accumulation and fatigue (9, 29, 49).
Under resting conditions, the peripheral muscle metabolic profile of patients with COPD
shows low concentration of high-energy phosphates such as ATP and creatine phosphate as well as
lower aerobic enzyme activity such as citrate synthase (CS) compared with aged-matched healthy
controls (12, 19, 23). In addition, intermediate markers of glycolysis, namely glucose-6-phosphate,
glucose-1-phosphate, and fructose-6-phosphate as well as phosphofructokinase (PFK) and lactate
dehydrogenase (LDH) activities were shown to be elevated in resting COPD muscle (19, 23).
Together, these findings suggest an impaired muscle oxidative capacity with a reduction in
phosphorylation potential and a greater reliance on glycolysis at rest that may well contribute to the
exercise intolerance in COPD.
In healthy humans, a greater reliance on glycolysis during exercise is associated with
premature lactate accumulation (47), muscle acidosis (41) ultimately translating into early exercise
cessation. In this regard, little is known about muscle metabolism in response to exercise in patients
with COPD. Studies using nuclear magnetic resonance spectroscopy on the forearm and calf
muscles reported greater decline in muscle intracellular pH and in the creatine phosphate/inorganic
phosphate ratio, suggesting an impaired aerobic capacity during exercise in patients with COPD
(26, 45, 49). Steiner et al. observed that adenine nucleotides, as well as lactate and creatine
phosphate were modulated in a similar fashion in patients with COPD compared to aged-matched
healthy controls during constant workrate cycling exercise of similar duration but of lower intensity
(44). Although this study provided good insight into the local muscle metabolic stress experienced
![Page 147: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/147.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
121
by patients with COPD during cycling exercise, the metabolic abnormalities that might contribute to
exercise limitation in COPD were not explored. In fact, no data is yet available on the extent of the
metabolic perturbations occurring in the quadriceps of patients with COPD during exercise done
until exhaustion.
The aim of the present study was to investigate, in a comprehensive fashion, the behavior
of the quadriceps cytosolic energy metabolism, from glycogen degradation to lactate accumulation,
in exercising patients with COPD, in comparison to healthy controls of similar age. To reach this
objective, we measured in the quadriceps 1) several energy substrates and end-products of
glycolysis (glycogen, glucose, pyruvate, lactate) and intermediate markers of glycolysis (glucose-6-
phosphate, glucose-1-phosphate, and fructose-6-phosphate) and 2) the activity of key enzymes
involved in the regulation of glycolysis (LDH, PFK, HK) and of the citric acid cycle (CS, 3-
hydroxyacyl CoA dehydrogenase [HADH]) at rest and immediately following cycling exercise in
patients with COPD and healthy controls. Because impaired energy metabolism could compromise
ATP resynthesis, we also evaluated the changes in intramuscular high energy phosphate compounds
(ATP, creatine phosphate, creatine, inorganic phosphate) during exercise. To provide a clinically
meaningful interpretation of these intramuscular processes, we also obtained detailed physiological
responses during exercise in these individuals.
We reasoned that if muscle metabolic abnormalities were important contributors to exercise
tolerance in COPD, the exercise-induced production of glycolytic end-products such as lactate and
pyruvate and intermediate markers of glycolysis such as glucose-6-phosphate, glucose-1-phosphate
and fructose-6-phosphate as well as glycogen utilization should be equal or greater in patients with
COPD despite lower exercise intensity, duration and total work in comparison with healthy
controls. Conversely, if exercise was primarily limited by ventilation and dyspnea, the degree of
metabolic stress occurring during exercise should be less in patients with COPD.
![Page 148: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/148.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
122
5.4 Methods
Subjects
Twelve patients with moderate to severe COPD and ten healthy aged-matched controls participated
in this study. The diagnosis of COPD was based on spirometry showing moderate to severe
irreversible airflow obstruction (post-bronchodilator forced expiratory volume in 1 second (FEV1) <
80% predicted value, and FEV1/ forced vital capacity < 70%) (36) and current or past smoking
history of at least 20 pack years. In both groups, subjects were excluded if they presented any
medical condition, other than COPD, likely to influence muscle and exercise testing (i.e.
cardiovascular, neurological, musculoskeletal, locomotor or other respiratory diseases). Only males
were included in the present study in order to minimize measurement variability. The research
protocol was approved by the institutional ethics committee and a signed informed consent was
obtained from each subject.
Study design
After reviewing medical history and familiarization with the study procedures, subjects filled out a
physical activity questionnaire (46). Anthropometric measurements, pulmonary function testing,
mid-thigh cross-sectional area by computed tomography and a symptom-limited incremental cycle
exercise test were performed. Within 1 week, subjects returned to the laboratory for a constant
workrate cycle exercise bout performed at 80% of their peak work rate until they reached the point
of exhaustion. Vastus lateralis biopsies were obtained before and exactly 1 minute after constant
workrate cycle exercise. After the post-exercise biopsy, patients sat down to recuperate. Quadriceps
force was then measured 15 minutes post exercise to quantify the degree of muscle fatigue
occurring with exercise.
Pulmonary function testing
Standard pulmonary function tests including spirometry, lung volumes, and carbon monoxide
diffusion capacity were obtained in all subjects during the initial evaluation according to previously
described guidelines (4). Results were related to previously publish normal values (15, 25). Maximum
voluntary ventilation (MVV) was estimated by multiplying FEV1 by 35 (14).
Physical activity score
The level of physical activity in daily living was assessed with the activity questionnaire described
by Baecke et al. (5) adapted for elderly individuals (46) and used in patients with COPD (43) called
![Page 149: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/149.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
123
Vorrips score. The questionnaire attributes a score for household, sport, and other leisure-time
physical activities, together resulting in a global physical activity score (Table 1). A score of 9-16
indicates a moderate level of daily physical activity, whereas a score < 9 depicts low levels of daily
physical activity and is associated with a sedentary lifestyle.
Incremental exercise testing
Patients were seated on an electrically braked ergocycle (Quinton Corival 400; A.H. Robins,
Seattle, WA) and connected to the respiratory circuit through a mouthpiece. During exercise, a 12-
lead electrocardiogram was recorded continuously and arterial pressure was monitored using an
automatic arm blood pressure monitor (Quinton Automated BP model 410; A.H. Robins, Seattle,
WA). Heart rate was computed from standard ECG leads (42). The respiratory circuit consisted of a
pneumotachograph, O2 and CO2 analyzers, and mixing chamber (Sensor Medics, Vmax Legacy,
Yorba Linda, CA). After 5 minutes of rest, a progressive stepwise exercise test was performed up to
the individual maximal capacity. Each exercise step lasted 1 minute and increments of 10 watts
were used. Minute ventilation ( EV ), oxygen uptake ( 2OV ), and carbon dioxide production
( 2COV ) were measured at rest and during exercise, on a breath-by-breath basis.
Constant workrate cycle exercise
After 5 minutes of rest and 1 minute of warm-up with unloaded pedaling, a constant workrate cycle
exercise bout was performed until exhaustion at an intensity corresponding to 80% of the peak
workrate achieved during the incremental exercise test. Patients were asked to pedal at 60 RPM and
standardized encouragement was provided during exercise. Similarly to the incremental test,
subjects were connected to the respiratory circuit through a mouthpiece and wore a nose clip during
the test. EV , 2OV and 2COV were measured at rest and during exercise on a breath-by-breath
basis. Heart rate was monitored by an electrocardiograph (Cardiosoft program-Corina, USA) and
blood pressure by an automated blood pressure monitor (Quinton 410, Quinton, Botmhell, WA).
Oxygen pulse saturation (SpO2) was measured by a pulse oximeter (OSM2 Hexoximeter;
Radiometer, Copenhagen, Denmark). The perception of dyspnea and leg fatigue were assessed at
end-exercise using the modified 10-point Borg scale (8).
Quadriceps strength measurements
Muscle strength was measured during maximal voluntary contraction of the quadriceps and
potentiated quadriceps twitch force as previously reported by our group (13). Subjects were seated
![Page 150: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/150.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
124
in a recumbent chair (N-K 330 Exercise Table, N-K Products, Elsinore, CA) with 90° knee flexion
and right ankle attached to a strain gauge (Hewlett-Packard). The strain gauge was systematically
adjusted perpendicularly to the leg. The strain gauge signal was amplified (Model 8811A
amplifiers; Hewlett-Packward), transformed by an analog transducer (Biopac), and linked to a
computer for data analysis. Maximal voluntary contraction was recorded during a 3-second
isometric maximal contraction. Maximal voluntary contraction maneuvers were separated by 60
seconds and reported values correspond to the mean of the three strongest contractions. Verbal
encouragement was provided during each maneuver. Potentiated quadriceps twitch force was
systematically measured three seconds after the end of the maximal voluntary contraction
maneuver. The femoral nerve was stimulated through a 70 mm figure-of-eight coil powered by a
double Magstim stimulator (Magstim Co Ltd., Whitland, Dyed,Wales, UK). For analysis, the mean
of the two highest values was calculated. In order to ensure that the magnetic stimulation was
supramaximal, a quadriceps twitch force/power output relationship was obtained as previously
published ensuring that a plateau in quadriceps twitch force was obtained in each subject (39).
Measurement of mid-thigh muscle area
A computed tomography (2) of the right thigh halfway between the pubic symphysis and the
inferior condyle of the femur was performed using a fourth-generation Toshiba Scanner 900S
(Toshiba) as routinely done in our laboratory (38). Each image was 5-mm thick and was taken at
120 kV and 200 mA with a scanning time of 1 s while the subject was lying in the supine position.
The mid-thigh muscle cross-sectional area (MTCSA) was obtained by measuring the surface area of
the tissue with a density of 40 to 100 Hounsfield units (HU). This range of density was chosen
because it corresponds to the density of muscle tissue (24). Computed tomography was used to
estimate muscle mass because it is more specific than anthropometric measurements. For instance,
the age-related fat infiltration of the muscles, which cannot be detected with anthropometric
measurements, can be identified by computed tomography because of the fat specific density.
Muscle biopsy
Needle biopsies of the vastus lateralis were performed as described by Bergström (6) and routinely
done in our laboratory (30). The post-exercise biopsy was performed through the same incision as
the pre-exercise biopsy allowing a fast access to the muscle. Immediately following exercise, the
leg of the subject was quickly stabilized on a footstool and the post-exercise biopsy was then taken
while the patient was still seating on the cycle ergometer. This method allowed the post-exercise
biopsy to be obtained at one-minute post-exercise in each subject. Muscle specimens were frozen in
![Page 151: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/151.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
125
liquid nitrogen exactly one minute after the end of exercise and stored at - 80°C for future analysis.
Quadriceps fiber typing and enzymatic activities associated with oxidative capacity and glycolysis
were analyzed from pre-exercise biopsies only.
Fiber Typing and surface areas: Muscle sections were stained to detect myofibrillar adenosine
triphosphatase activity according to the single step ethanol modified technique (28). The medium
contained 20 mM Na barbital, 10 mM CaCl2, 5 mM MgCI2, 5 mM NaN3, 1.0 mM ATP at 21°C,
17%-18% ethanol and pH 9.4. At 37°C, ethanol concentrations were reduced to 7.5%-8.5%. The
incubation time was 40 to 60 min at room temperature. The proportion of types I (non-stained), IIa
(lightly stained), and IIx (darkly stained) fibers was assessed and calculated as the number of fibers
of each type divided by the total number of muscle fibers. The mean cross-sectional area for each
subject was measured by averaging the cross-sectional areas of 120 randomly selected fibres (7).
Enzymatic Activity: Quadriceps muscle activity of LDH, PFK, hexokinase (HK), CS and HADH
were assessed using spectrophotometric techniques as previously described (30, 50). The reaction
media used to measure enzymatic activities were tris-HCl 15 mM (pH 8.0) containing DTNB 0.016
mM, acetyl-CoA 0.1 M, and sodium oxaloacetate 0.038 mM for citrate synthase and
triethanolamine 100 mM (pH 7.0) containing EDTA 5 mM, NADH 0.17 mM, KCN 1 mM, and
acetyl-CoA 0.1 mM for 3-hydroxyacyl CoA dehydrogenase. Each assay was done in duplicate and
the average of the two values is reported. The coefficient of variation between duplicate
measurements of enzymatic activities varied from 1.6% to 13.1%.
Metabolite and substrate measurements From pre and post-exercise biopsies, following subsequent
freeze drying, powdering and extraction (20, 21), samples were analyzed for glycogen, glucose,
pyruvate and lactate as well as intermediate markers of glycolysis such as glucose-6-phosphate,
glucose-1-phosphate and fructose-6-phosphate. We also analyzed tissue samples for adenosine
triphosphate, creatine phosphate, creatine and inorganic phosphate. For the HPLC ATP assay,
approximately 5 mg of freezedried tissue were extracted in perchloric acid (PCA, 0.5M) and
neutralized by the addition of 2.3 M K2HPO4. The neutralized sample was centrifuged, and an
aliquot was used for HPLC analysis. A Waters Alliance system was used consisting of a Waters
2690 Separations Module for solvent delivery and auto sampling and a Waters 996 Photo Diode
Array Detector. The detector wavelength for monitoring the eluate was 254 nm. All measurements
were conducted at room temperature by means of a reverse-phase column (Supelcosil LC-18-T 2
cm x 4.6 mm). The solvent system consisted of two buffers: Buffer A (150 mM potassium
dihydrogen orthophosphate, 150 mM potassium chloride, pH 6.0, was filtered through a .45 m
![Page 152: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/152.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
126
filter) and Buffer B (80% Buffer A, 15% methanol, 5% Acetonitrile). During the total 20min run
time, a gradient was applied at a constant flow of 1ml/min starting with 100% Buffer A and
increasing Buffer B to a max of 40% over the first 6 min and returning to 0% by 12 min. All
standards were obtained from Sigma Chemical and dissolved in ultra pure water. Nucleotide
concentrations were detected from the peak height of the chromatogram. All nucleotide values were
expressed in millimoles per kilogram of dry weight. All other measurements were accomplished
using fluorometric procedures (27) as described in detail previously (22). The coefficient of
variation between duplicate measurements for the energy substrates and end-products of glycolysis
(glycogen, glucose, pyruvate and lactate) and intermediate markers of glycolysis (glucose-6-
phosphate, glucose-1-phosphate and fructose-6-phosphate) varied from 2 % to 12%. The coefficient
of variation between duplicate measurements for the high-energy phosphate compounds (adenosine
triphosphate, creatine phosphate, creatine and inorganic phosphate) varied from 1% to 3%.
Statistical analysis
Data are expressed as the mean ± standard error of the mean and were analyzed using a
statistical package program SAS version 9.01. A p value of < 0.05 was considered statistically
significant, while a p value between 0.05 and 0.10 was considered to show a statistical trend.
Glycogen, glucose, pyruvate, lactate, glucose-6-phophate, glucose-1-phosphate and fructose-6-
phosphate values were log transformed to obtain normal distribution for analysis. Student’s
unpaired t-test was performed to compare patient characteristics as well as resting intramuscular
data. The effect of exercise on energy substrates, intermediate markers of glycolysis and high-
energy phosphate compounds were compared using a mixed-model analysis of variance on the
percentage changes with adjustment for baseline levels. To allow comparison of the glycolytic
substrates variation in response to exercise between groups cycling for different duration and at
different absolute intensities, the changes in glycogen, glucose and lactate were corrected for the
total cycle work that was performed during constant workrate cycle exercise (44). Pearson
correlation coefficients were used to evaluate relationships between MTCSA and the mean fiber
cross-sectional area.
![Page 153: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/153.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
127
5.5 Results
Subjects’ characteristics Anthropometric characteristics and pulmonary function are provided in table 1. Patients
with COPD had moderate-to-severe airflow obstruction. Both groups were well matched for body
mass index and levels of physical activity in daily living as assessed by the Voorrips scores.
Exercise capacity
End-exercise values for the incremental and constant workrate cycling exercises are
presented in table 2. Exercise intensity, duration and total cycle work were significantly lower in
COPD. The perception of dyspnea and leg fatigue at the end of incremental and constant workrate
exercises were similar between both groups. The physiological measurements during constant
workrate exercise are depicted in figure 1. As a result of a greater mean exercise
intensity, , , respiratory exchange ratio and lactate were greater (p < 0.05) in controls from
the 25% duration of exercise until the end of exercise. When expressed as a % of maximum
voluntary ventilation, was larger in patients with COPD who also exhibit a lower inspiratory
capacity throughout exercise than controls. In addition, despite a greater fall in SpO2 induced by
exercise in COPD compared to healthy subjects (-3 ± 3 % vs -1 ± 3 % p < 0.05), no difference was
observed between the two groups for the decrease in PaO2 (-7.41 ± 11.78 vs -5.29 ± 23.32 mmHg).
Quadriceps fatigue
The fall in muscle voluntary contraction and potentiated quadriceps twitch force during
exercise, expressed as % of baseline values, were significant and of similar magnitude between both
groups (Figure 2).
Muscle characteristics and metabolism
Muscle characteristics and resting energy substrates data are provided in table 3. Patients
with COPD displayed a smaller midthigh muscle cross sectional area and proportion of type I
fibers. The mean fiber cross-sectional areas averaged 4489 ± 239 µm2 in patients with COPD and
5281 ± 344 µm2 in healthy controls. Although this difference did not reach statistical significance (p
= 0.13), the 15% reduction in mean fiber size in COPD is consistent with the 20% reduction in
![Page 154: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/154.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
128
MTCSA. Also, the mean fiber size significantly correlated with MTCSA (r = 0.73, p < 0.01). PFK
and LDH enzyme activities were greater in COPD, while oxidative enzyme activities were similar
between COPD and controls. Resting levels of glycogen and lactate were significantly greater in
COPD, while glucose and creatine phosphate showed a trend to be greater in COPD.
Quadriceps metabolism at the end of constant workrate cycle exercise
The influence of exercise on energy substrates and end-products of glycolysis in the
quadriceps expressed in percent difference from baseline values were of similar magnitude between
both groups (figure 3A). However, the exercise-induced increase in glucose-6-phophate and
fructose-6-phosphate, two intermediate markers of glycolysis, was significantly greater in COPD
(figure 3B). Exercise-induced changes in high-energy phosphate compounds were also of similar
magnitude between both groups (figure 3 C). These conclusions remained essentially unchanged
when the absolute changes in the different variables were used in the analyses instead of the relative
changes except for the absolute differences in glucose-6-phophate and fructose-6-phosphate
between COPD and healthy controls that were of borderline statistical significance (p = 0.09 and p
= 0.12, for G-6-P and F-6-P, respectively). In order to account for the difference in total cycle work
between COPD patients and controls, the exercise-induced changes in glycogen, glucose and lactate
were adjusted by dividing them by total cycle work performed (figure 3D). A greater utilization in
muscle glycogen and greater accumulation of lactate were found in COPD compared to controls
while glucose did not differ statistically between groups (p = 0.224).
![Page 155: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/155.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
129
5.6 Discussion
The main findings of this study are that the extent of changes in quadriceps metabolism and
falls in quadriceps force generating capacity after a constant workrate cycle exercise done until
exhaustion were similar in patients with COPD and age-matched controls despite a much lower
total work performed by the former group. These intramuscular events were reached an average of
2.27 minutes faster and for 468 Watts*min lesser total work in COPD compared to controls. Taking
into account the amount of work performed, our data shows an increased utilization of glycogen and
accumulation of lactate in COPD patients. Moreover, key intermediate markers of glycolysis in the
quadriceps of patients with COPD show significant increases after exercise. These results support
the greater reliance on glycolysis during exercise in patients with COPD. The fact that patients with
COPD reached similar metabolic perturbations and exhibited similar levels of quadriceps fatigue
compared to controls suggests that the metabolic events taking place within the contracting muscles
are tightly regulated during exercise.
The present study permitted investigation of whether cycle exercise done until exhaustion
would be sufficient to stress the contractile limb muscles of patients with COPD. In the presence of
classical evidence of ventilatory limitation such as high dyspnea scores, a /MVV > 1 and
dynamic hyperinflation, it is remarkable that patients with COPD experienced similar decreases in
quadriceps force post-exercise concurrently with similar intramuscular accumulation of inorganic
phosphate and lactate compared with healthy controls. These observations are consistent with the
notion that the degree of peripheral muscle fatigue and metabolic perturbations occurring during
exercise are tightly regulated (1) and may contribute to exercise limitation in health and chronic
diseases such as COPD (13). According to this theory, feedback signals originating in the fatigued
muscles inhibit motor cortical output, thus preventing subsequent locomotor recruitment and the
development of dangerous and potentially irreversible fatigue (1). We previously reported that
patients with COPD developing contractile fatigue of the quadriceps during cycling exercise
stopped exercising at the same level of quadriceps fatigue (within 5%), regardless of whether they
received a placebo or a bronchodilator before exercise (39). Although this was not tested, our
findings are consistent with the concept that the central nervous system integrates information
originating from the peripheral muscles to determine the duration of exercise and the degree of
muscle fatigue (2, 33).
![Page 156: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/156.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
130
One objective of the present study was to investigate the quadriceps glycolytic metabolism
response to a constant workrate cycle exercise done until exhaustion in patients with COPD. When
reported per total cycle work, glycogen utilization and lactate accumulation were greater in COPD
compared to controls. These results support the fact that a greater amount of glycogen had to be
used for a lesser intense and shorter duration exercise in COPD compared to controls although the
source of this greater muscle glycogen utilization could not be ascribed specifically to the glycolytic
or aerobic (citric acid cycle) metabolism. On the other hand, muscle lactate accumulation is specific
to cytosolic glycolysis. The greater accumulation of lactate per workload in COPD therefore reflects
either or both; 1) a decreased utilization of lactate/pyruvate as a substrate by the aerobic
metabolism; 2) a greater utilization of cytosolic glycolysis during exercise. There were also larger
increases in glucose-6-phosphate and fructose-6-phosphate during exercise along with increased
phosphofructokinase activity in patients with COPD. Taking into account the mitochondrial
abnormalities reported in COPD (37), our overall interpretation is that there is a greater reliance on
glycolysis during exercise in COPD, acting as a compensatory mechanism to sustain energy
demands.
In contrast with our initial hypothesis, glucose accumulation per workload was not
increased in patients with COPD (fig. 3D). Two non mutually exclusive avenues could explain this
observation: 1) the reported lower concentration of muscle GLUT4 transporters in COPD (19)
could lessen the amount of blood glucose entering the exercising muscle and thus explain the
similar accumulation of muscle glucose per workload between COPD patients and controls; 2) the
utilization of muscle glucose could possibly be greater in COPD given the higher glycolytic activity
in patients with COPD.
In contrast to previous studies (12, 19, 23, 35) there were no major differences in resting
metabolites between patients with COPD and controls. The non significant difference in resting
ATP between the two groups is in accordance with Wuyam et al. (49). In contrast to previous
studies showing that resting phosphagen energy content was slightly decreased in COPD (12, 19,
23), we, and previous investigators (44), found no differences in high energy phosphate between
COPD and controls, suggesting that the greater resting muscle glycogen, glucose and some
intermediate markers of glycolysis in COPD could serve to preserve resting ATP levels in patients
with COPD.
The investigation of the mechanisms responsible for the current muscle metabolic findings
was beyond the scope of this study. Although physical inactivity is often quoted as an important
![Page 157: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/157.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
131
mechanism for the peripheral muscle abnormalities in COPD, the level of daily life activities as
assessed by a physical activity questionnaire was similar between patients and healthy controls. The
greater reliance on glycolysis in COPD could, in part, be explained by the increase type IIa fibre
proportion in these individuals. These fibres are characterized by a greater potential for high-energy
phosphate and glycolysis than type I muscle fibers (18). Moreover, this glycolytic reliance could
possibly involve the lactate and glucose transporters whose activity can be altered in COPD (19).
Since these transporters are crucial for lactate removal and glucose entry in skeletal muscle, they
could influence the relative contribution of the glycolytic pathway to the total energy expenditure
during exercise. Targeting these transporters may be of great interest in future rehabilitation studies.
Apart from these intrinsic muscle changes, we cannot exclude that impairment in muscle
perfusion and oxygenation could have influenced muscle metabolism during exercise in COPD
(31). In one study, a 25% increase in quadriceps work capacity was observed while breathing 100%
oxygen in comparison to room air breathing during localized knee extensor exercise in patients with
COPD and modest exercise-induced oxygen desaturation (38). More recently, the effects of
respiratory muscle unloading and of supplemental oxygen on the degree of quadriceps fatigue
during cycling exercise were evaluated in patients with COPD whose end-exercise SaO2 averaged
87% (3). By reducing the work of breathing and improving oxygenation with respiratory muscle
unloading or supplemental oxygen during exercise, a 30% reduction in the amount of quadriceps
fatigue occurring during exercise was reported in comparison to the same exercise without
respiratory assistance. Although limb blood flow was not measured in this study, this attenuation of
muscle fatigue with ventilatory support and improved oxygenation could be due to a redistribution
of blood flow and oxygen from the respiratory muscles to the limb muscles. The authors concluded
that quadriceps fatigue in exercising patients with COPD is in part related to insufficient O2
transport to the limb muscles but that the bulk of fatigue is related to intrinsic muscles changes. Our
data does not allow making inference about the proportion of the metabolic changes occurring
during exercise within the COPD quadriceps that could be ascribed to possible impairments in
muscle perfusion and oxygenation. Additional experiments involving manipulations in oxygen
delivery to muscles would be required to address this issue.
Methodological considerations
Constant workrate cycle exercise was performed at 80% of peak incremental workload in
order to reach exhaustion within 8-10 minutes in most subjects. The end-exercise results showed
![Page 158: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/158.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
132
similar Borg scale rating for leg fatigue and dyspnea in both groups. Moreover, similar heart rate,
2OV and EV values at the end of the constant workrate cycle exercise and incremental exercise
indicate that the effort was maximal/near maximal in both groups.
The reductions in MTCSA and in the proportion of type I fibers found in patients with
COPD were consistent with the results of larger studies (17, 32) suggesting that this small patient
population was representative of the expected degree of muscle atrophy and morphometric changes
for a moderate to severe COPD population. The observation of a similar CS and HADH activity
between COPD and healthy controls was somewhat unexpected given the bulk of data showing that
the quadriceps oxidative capacity is reduced in patients with COPD (23, 30). Since these enzyme
activities are markedly influenced by the level of physical activity, one possible explanation for this
finding is the fact that both groups were well matched for daily physical activity levels.
Potential clinical implications
Greater reliance on glycolytic metabolism during submaximal exercise leads to
accumulation of lactate (47) and decrease in plasma pH levels (41), which ultimately translates into
early cessation of exercise (40). Although the relative exercise intensity at which this study was
performed was relatively high, patients with COPD frequently engage in daily life activities as
stairs climbing or fast walking, whose absolute intensities are similar to those used in this study
(~85 watts). Thus, the observation that the quadriceps undergoes important metabolic perturbations
reported in COPD may be clinically relevant because they may occur in daily life, potentially
contributing to exercise limitation in this disease.
Our data also supports the relevance for the implementation of therapeutic strategies such as
aerobic-based activities, to reduce early variations in muscle metabolites and reliance on glycolysis
while improving the muscle oxidative capacities (i.e. β-oxidation and oxidative phosphorylation)
during submaximal exercise, ultimately resulting in improvements in functional capacities of COPD
patients.
5.7 Conclusion
We conclude that constant work cycle exercise performed until exhaustion induced
significant changes in quadriceps metabolites and energy substrates in patients with COPD. These
intramuscular events were of similar magnitude to those occurring in age and activity level matched
healthy controls but they required a much lower exercise workload and time to take place in patients
![Page 159: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/159.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
133
with COPD. Taking into account the greater glycogen utilization and lactate accumulation per unit
of work, the increases of intermediate markers of glycolysis and the increased glycolytic enzyme
activity, our data suggest a greater reliance on glycolysis during exercise in COPD which may
contribute to exercise intolerance and impair the activity of daily living in COPD.
ACKNOWLEDGEMENTS
The authors acknowledge the help of Marthe Bélanger, Marie-Josée Breton, Brigitte
Jean and Josée Picard in accomplishing this study and are grateful to Eric Nadreau (M.Sc.)
for his technical support during the exercise testing. The authors also thank Serge Simard
for statistical assistance and Dre Annie Dubé for her helpful suggestions on the manuscript.
![Page 160: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/160.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
134
5.8 References 1. Amann M, Dempsey JA. Locomotor muscle fatigue modifies central motor drive in healthy humans and imposes a limitation to exercise performance. J Physiol 586: 161-173, 2008. 2. Amann M, Proctor LT, Sebranek JJ, Pegelow DF, Dempsey JA. Opioid-mediated muscle afferents inhibit central motor drive and limit peripheral muscle fatigue development in humans. J Physiol 587: 271-283, 2009. 3. Amann M, Regan MS, Kobitary M, Eldridge MW, Boutellier U, Pegelow DF, Dempsey JA. Impact of pulmonary system limitations on locomotor muscle fatigue in patients with COPD. Am J Physiol Regul Integr Comp Physiol 299: R314-324, 2010. 4. ATS. Standardization of spirometry--1987 update. Official statement of American Thoracic Society. Respir Care 32: 1039-1060, 1987. 5. Baecke JA, Burema J, Frijters JE. A short questionnaire for the measurement of habitual physical activity in epidemiological studies. Am J Clin Nutr 36: 936-942, 1982. 6. Bergstrom J. Muscle electrolytes in man determined by neutron activation analysis on needle biopsy specimens. Scandinavian Journal of Clinical and Laboratory Investigation 14: 1962. 7. Blomstrand E, Celsing F, Friden J, Ekblom B. How to calculate human muscle fibre areas in biopsy samples--methodological considerations. Acta Physiol Scand 122: 545-551, 1984. 8. Borg GA. Psychophysical bases of perceived exertion. Med Sci Sports Exerc 14: 377-381, 1982. 9. Casaburi R, Patessio A, Ioli F, Zanaboni S, Donner CF, Wasserman K. Reductions in exercise lactic acidosis and ventilation as a result of exercise training in patients with obstructive lung disease. Am Rev Respir Dis 143: 9-18, 1991. 10. CSEP. Canadian Society for Exercise Physiology: Certified Fitness Appraiser Resource Manual. CSEP, Ottawa: 1986. 11. Debigare R, Maltais F. The major limitation to exercise performance in COPD is lower limb muscle dysfunction. J Appl Physiol 105: 751-753; discussion 755-757, 2008. 12. Fiaccadori E, Del Canale S, Vitali P, Coffrini E, Ronda N, Guariglia A. Skeletal muscle energetics, acid-base equilibrium and lactate metabolism in patients with severe hypercapnia and hypoxemia. Chest 92: 883-887, 1987. 13. Gagnon P, Saey D, Vivodtzev I, Laviolette L, Mainguy V, Milot J, Provencher S, Maltais F. Impact of preinduced quadriceps fatigue on exercise response in chronic obstructive pulmonary disease and healthy subjects. J Appl Physiol 107: 832-840, 2009. 14. Gandevia B, Hugh-Jones P. Terminology for measurements of ventilatory capacity; a report to the thoracic society. Thorax 12: 290-293, 1957. 15. Goldman HI, Becklake MR. Respiratory function tests; normal values at median altitudes and the prediction of normal results. Am Rev Tuberc 79: 457-467, 1959. 16. Gosker HR, van Mameren H, van Dijk PJ, Engelen MP, van der Vusse GJ, Wouters EF, Schols AM. Skeletal muscle fibre-type shifting and metabolic profile in patients with chronic obstructive pulmonary disease. Eur Respir J 19: 617-625, 2002.
![Page 161: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/161.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
135
17. Gosker HR, Zeegers MP, Wouters EF, Schols AM. Muscle fibre type shifting in the vastus lateralis of patients with COPD is associated with disease severity: a systematic review and meta-analysis. Thorax 62: 944-949, 2007. 18. Green HJ. Mechanisms of muscle fatigue in intense exercise. J Sports Sci 15: 247-256, 1997. 19. Green HJ, Burnett ME, D'Arsigny CL, O'Donnell DE, Ouyang J, Webb KA. Altered metabolic and transporter characteristics of vastus lateralis in chronic obstructive pulmonary disease. J Appl Physiol 105: 879-886, 2008. 20. Green HJ, Sutton J, Young P, Cymerman A, Houston CS. Operation Everest II: muscle energetics during maximal exhaustive exercise. J Appl Physiol 66: 142-150, 1989. 21. Harris RC, Hultman E, Nordesjo LO. Glycogen, glycolytic intermediates and high-energy phosphates determined in biopsy samples of musculus quadriceps femoris of man at rest. Methods and variance of values. Scand J Clin Lab Invest 33: 109-120, 1974. 22. Hintz CS, Chi MM, Fell RD, Ivy JL, Kaiser KK, Lowry CV, Lowry OH. Metabolite changes in individual rat muscle fibers during stimulation. Am J Physiol 242: C218-228, 1982. 23. Jakobsson P, Jorfeldt L, Henriksson J. Metabolic enzyme activity in the quadriceps femoris muscle in patients with severe chronic obstructive pulmonary disease. Am J Respir Crit Care Med 151: 374-377, 1995. 24. Kelley DE, Slasky BS, Janosky J. Skeletal muscle density: effects of obesity and non-insulin-dependent diabetes mellitus. Am J Clin Nutr 54: 509-515, 1991. 25. Knudson RJ, Slatin RC, Lebowitz MD, Burrows B. The maximal expiratory flow-volume curve. Normal standards, variability, and effects of age. Am Rev Respir Dis 113: 587-600, 1976. 26. Kutsuzawa T, Shioya S, Kurita D, Haida M, Ohta Y, Yamabayashi H. 31P-NMR study of skeletal muscle metabolism in patients with chronic respiratory impairment. Am Rev Respir Dis 146: 1019-1024, 1992. 27. Lowry O, Passonneau J. A flexible system of enzymatic analysis. New York: Academic Press 1972. 28. Mabuchi K, Sreter FA. Actomyosin ATPase. II. Fiber typing by histochemical ATPase reaction. Muscle Nerve 3: 233-239, 1980. 29. Maltais F, LeBlanc P, Simard C, Jobin J, Bérubé C, Bruneau J, Carrier L, Belleau R. Skeletal muscle adaptation to endurance training in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 154: 442-447, 1996. 30. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Bélanger M, Breton MJ, Jobin J. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 55: 848-853, 2000. 31. Maltais F, Simon M, Jobin J, Desmeules M, Sullivan MJ, Bélanger M, Leblanc P. Effects of oxygen on lower limb blood flow and O2 uptake during exercise in COPD. Med Sci Sports Exerc 33: 916-922, 2001. 32. Marquis K, Debigaré R, Lacasse Y, LeBlanc P, Jobin J, Carrier G, Maltais F. Midthigh muscle cross-sectional area is a better predictor of mortality than body mass index in
![Page 162: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/162.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
136
patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 166: 809-813, 2002. 33. Noakes TD, St Clair Gibson A, Lambert EV. From catastrophe to complexity: a novel model of integrative central neural regulation of effort and fatigue during exercise in humans: summary and conclusions. Br J Sports Med 39: 120-124, 2005. 34. Pépin V, Saey D, Laviolette L, Maltais F. Exercise capacity in chronic obstructive pulmonary disease: mechanisms of limitation. Copd 4: 195-204, 2007. 35. Pouw EM, Schols AM, van der Vusse GJ, Wouters EF. Elevated inosine monophosphate levels in resting muscle of patients with stable chronic obstructive pulmonary disease. Am J Respir Crit Care Med 157: 453-457, 1998. 36. Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y, Jenkins C, Rodriguez-Roisin R, van Weel C, Zielinski J. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary. Am J Respir Crit Care Med 176: 532-555, 2007. 37. Rabinovich RA, Vilaro J. Structural and functional changes of peripheral muscles in chronic obstructive pulmonary disease patients. Curr Opin Pulm Med 16: 123-133, 2010. 38. Richardson RS, Sheldon J, Poole DC, Hopkins SR, Ries AL, Wagner PD. Evidence of skeletal muscle metabolic reserve during whole body exercise in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 159: 881-885, 1999. 39. Saey D, Debigaré R, LeBlanc P, Mador MJ, Côté CH, Jobin J, Maltais F. Contractile leg fatigue after cycle exercise: a factor limiting exercise in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 168: 425-430, 2003. 40. Saey D, Michaud A, Couillard A, Côté CH, Mador MJ, LeBlanc P, Jobin J, Maltais F. Contractile fatigue, muscle morphometry, and blood lactate in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 171: 1109-1115, 2005. 41. Sahlin K. Metabolic factors in fatigue. Sports Med 13: 99-107, 1992. 42. Schreijer AJ, Cannegieter SC, Meijers JC, Middeldorp S, Buller HR, Rosendaal FR. Activation of coagulation system during air travel: a crossover study. Lancet 367: 832-838, 2006. 43. Serres I, Gautier V, Varray A, Préfaut C. Impaired skeletal muscle endurance related to physical inactivity and altered lung function in COPD patients. Chest 113: 900-905, 1998. 44. Steiner MC, Evans R, Deacon SJ, Singh SJ, Patel P, Fox J, Greenhaff PL, Morgan MD. Adenine nucleotide loss in the skeletal muscles during exercise in chronic obstructive pulmonary disease. Thorax 60: 932-936, 2005. 45. Thompson CH, Davies RJ, Kemp GJ, Taylor DJ, Radda GK, Rajagopalan B. Skeletal muscle metabolism during exercise and recovery in patients with respiratory failure. Thorax 48: 486-490, 1993. 46. Voorrips LE, Ravelli AC, Dongelmans PC, Deurenberg P, Van Staveren WA. A physical activity questionnaire for the elderly. Med Sci Sports Exerc 23: 974-979, 1991. 47. Westerblad H, Allen DG. Recent advances in the understanding of skeletal muscle fatigue. Curr Opin Rheumatol 14: 648-652, 2002.
![Page 163: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/163.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
137
48. Whittom F, Jobin J, Simard PM, Leblanc P, Simard C, Bernard S, Belleau R, Maltais F. Histochemical and morphological characteristics of the vastus lateralis muscle in patients with chronic obstructive pulmonary disease. Med Sci Sports Exerc 30: 1467-1474, 1998. 49. Wuyam B, Payen JF, Levy P, Bensaidane H, Reutenauer H, Le Bas JF, Benabid AL. Metabolism and aerobic capacity of skeletal muscle in chronic respiratory failure related to chronic obstructive pulmonary disease. Eur Respir J 5: 157-162, 1992. 50. Zammit VA, Newsholme EA. The maximum activities of hexokinase, phosphorylase, phosphofructokinase, glycerol phosphate dehydrogenases, lactate dehydrogenase, octopine dehydrogenase, phosphoenolpyruvate carboxykinase, nucleoside diphosphatekinase, glutamate-oxaloacetate transaminase and arginine kinase in relation to carbohydrate utilization in muscles from marine invertebrates. Biochem J 160: 447-462, 1976.
![Page 164: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/164.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
138
5.9 Tables Table 1. Participant characteristics
COPD (n=12) Controls (n=10) Age (yrs) 65 ± 2 69 ± 2
Weight (kg) 74 ± 4 77 ± 4
Height (cm) 168 ± 1 170 ± 2
Body mass index (kg/m2) 26 ± 2 27 ± 1
Smoking history (pack years) 45 ± 1* 18 ± 7
Voorrips score 8.7 ± 1.2 9.0 ± 1.4
FEV1 (L) 1.3 ± 0.1* 2.9 ± 0.5
FEV1 (% predicted) 45 ± 3* 103 ± 4
FVC (L) 2.9 ± 0.2* 3.9 ± 0.2
FVC (% predicted) 79 ± 5* 107 ± 5
FEV1/FVC (%) 46 ± 3* 74 ± 2
TLC (% predicted) 105 ± 4 99 ± 6
RV (% predicted) 127 ± 15* 93 ± 8
DLCO (% predicted) 65.5 ± 4.1* 85.7 ± 6.6
Values are mean ± SE FEV1, forced expiratory volume in 1sec; FVC, forced vital capacity; RV, residual volume; TLC, total lung capacity; FRC, functional residual volume; DLco, diffusing capacity for carbon monoxyde * p < 0.05, versus controls
![Page 165: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/165.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
139
Table 2. End-exercise values for the incremental and constant work cycle exercises
Values are mean ± SEM SpO2, oxygen pulse saturation; PaO2, partial pressure of oxygen in arterial blood * p < 0.05 versus controls
![Page 166: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/166.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
140
Table 3. Mid-thigh cross sectional area, enzymatic activity, fiber type distribution, energy substrates, end-products of glycolysis and high-energy phosphate compounds. COPD (n=12) Controls (n=10)
MTCSA (cm2) 79 ± 3* 99 ± 7 Glycolytic activity LDH (µmol/min/g muscle) 74.4 ± 2.5* 43.7 ± 4.2 PFK (µmol/min/g muscle) 48.9 ± 1.1* 23.1 ± 1.0 HK (µmol/min/g muscle) 0.7 ± 0.1* 0.9 ± 0.1 Oxidative activity CS (µmol/min/g muscle) 12.6 ± 0.3 13.3 ± 0.6 HADH (µmol/min/g muscle) 4.8 ± 0.2 4.7 ± 0.3 Fiber type distribution Type I fibers (% total fibers) 39 ± 2* 56 ± 5 Type IIa fibers (% total fibers) 38 ± 3* 25 ± 5 Type IIx fibers (% total fibers) 23 ± 3 19 ± 4 Energy substrates, end-products of glycolysis and high-energy phosphate compounds
Gly (mmol/ kg of dry weight) 254.6 ± 20.8* 178.7 ± 11.7 Glu (mmol/ kg of dry weight) 3.1 ± 0.4‡ 1.9 ± 1.3 PY (mmol/ kg of dry weight) 0.2 ± 0.02 0.3 ± 0.03 La (mmol/ kg of dry weight) 10.2 ± 1.3* 6.2 ± 5.6 ATP (mmol/ kg of dry weight) 19.9 ± 0.6 18.9 ± 1.2 CP (mmol/ kg of dry weight) 75.8 ± 5.9† 60.3 ± 7.7 CR (mmol/ kg of dry weight) 49.7 ± 3.5 54.7 ± 5.8 Pi (mmol/ kg of dry weight) 32.1 ± 1.6 33.7 ± 4.7
Values are mean ± SE MTCSA; midthigh muscle cross-sectional area; LDH, lactate dehydrogenase; PFK, phosphofructokinase; HK, hexokinase; CS, citrate synthase; HADH, hydroxyacyl-C enzyme-A dehydrogenase; Gly, glycogen; Glu, glucose; PY, pyruvate; La, lactate; A adenosine triphosphate; CP, creatine phosphate; CR, creatine; Pi, inorganic phosphat
* p < 0.05 versus controls
† p = 0.06 versus controls ‡ p = 0.05 versus controls
![Page 167: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/167.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
141
5.10 Figures Legend FIGURE 1. Physiological measurements during constant workrate exercise in COPD and controls. Values are means ± SE. Ventilation ( ), ventilation/maximal voluntary ventilation ( /MVV), oxygen consumption ( ), respiratory exchange ratio (RER), respiratory rate (RR), inspiratory capacity (IC), blood lactate, heart rate (HR). Values are mean ± SE. * p < 0.05 versus controls FIGURE 2. The fall in maximal voluntary contraction (MVC) and in twitch force (TwQ) of the quadriceps in COPD and controls 15 minutes post constant workrate cycle exercise. Values are mean ± SE. * p < 0.05 versus baseline FIGURE 3. Percent change from baseline in quadriceps glycogen (Gly), glucose (Glu), pyruvate (Py) and lactate (La) after constant workrate cycle exercise in COPD and controls (panel A). Percent change from baseline in quadriceps glucose-6-phosphate (G-6-P), gluocose-1-phosphate (G-1-P) and fructose-6-phosphate (F-6-P) after constant workrate cycle exercise in COPD and controls (panel B). Percent change from baseline in quadriceps adenosine triphosphate (ATP), creatine phosphate (CP) creatine (CR) and inorganic phosphate (Pi) after constant workrate cycle exercise in COPD and controls (panel C). Quadriceps glycogen utilization, glucose and lactate accumulation per unit of total cycle work during constant workrate cycle exercise in COPD and controls (panel D). Values are mean ± SE. * p < 0.05 versus baseline
![Page 168: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/168.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
142
5.11 Figures Figure 1
![Page 169: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/169.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
143
Figure 2
![Page 170: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/170.jpg)
CHAPITRE V. Quadriceps Metabolism during Constant Workrate Cycling Exercise in COPD
144
Figure 3
![Page 171: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/171.jpg)
145
CHAPITRE VI
THE ACTIVATION OF SIGNALLING PATHWAYS INVOLVED IN MUSCLE MASS REGULATION AFTER AN ACUTE BOUT OF
RESISTANCE TRAINING EXERCISE IN PATIENTS WITH COPD
Article en préparation pour The Journal of Applied Physiology
![Page 172: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/172.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
146
6.1 Page titre THE ACTIVATION OF SIGNALLING PATHWAYS INVOLVED IN MUSCLE MASS REGULATION AFTER AN ACUTE BOUT OF RESISTANCE TRAINING EXERCISE IN PATIENTS WITH COPD Authors: Bruno B. LEMIRE, Annie DUBÉ, Marie-Eve THÉRIAULT, Richard DEBIGARÉ, Claude H. CÔTÉ, and François MALTAIS
Affiliation :
Centre de recherche, Institut Universitaire de Cardiologie et de Pneumologie de Québec, Université Laval, Québec, Canada.
B B. Lemire is the recipient of a PhD training award from the Canadian Institutes of Health Research (CIHR). F. Maltais holds a GSK/CIHR Research Chair on COPD at Université Laval. This work has been supported by CIHR grant MOP-115136. Running head: Intramuscular signaling in the quadriceps of patients with COPD Word count: Address of correspondence: Dr François Maltais
Institut Universitaire de Cardiologie et de Pneumologie de Québec
2725 Chemin Ste-Foy Québec, Québec G1V 4G5 CANADA Tel: 418-656-4747 Fax: 418-656-4762
E-mail: [email protected]
![Page 173: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/173.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
147
6.2 Résumé
La faiblesse et l’atrophie musculaire sont des conséquences importantes de la MPOC. Bien
que l’exercice en résistance semble augmenter la force musculaire chez les patients atteints de la
MPOC, la réponse à l’exercice semble être sous-optimale dans cette population. Un dérèglement
des voies de signalisation impliquées dans la régulation de la masse musculaire pourrait jouer un
rôle important dans ce phénomène. Nous avons étudié l'impact d’une séance d'entraînement en
résistance sur les principales voies de signalisation impliquées dans la régulation de la masse
musculaire chez une population atteinte de la MPOC. Les niveaux de phosphorylation de protéines
clés (AKT, p70S6K, mTOR, GSK-3β, p38 MAPK, ERK 1/2) ainsi que des E3 ligases impliquées
dans la dégradation des protéines (Atrogin1 et MuRF), en plus des niveaux d’ARNm des cytokines
(TNF- α, IL-8, IL-6) ont été mesurés avant et après une séance d’entraînement aiguë chez 11
patients atteints de la MPOC (VEMS 45 ± 2% de la valeur prédite) et 10 sujets sains appariés pour
l’âge (CTRL). Tous les exercices ont été effectués à 80% du maximum pour 2 séries de 12
répétitions de « squat », « leg press » et « leg extension ». Des biopsies du quadriceps ont été
obtenues avant et 2 heures après la session d’exercice. Les niveaux de phosphorylation et de
protéines totales ont été mesurés par immunobuvardage alors que les variations en ARNm des
cytokines ont été analysées par PCR en temps réel. Après l’exercice, le ratio
phosphorylation/protéine totale d’AKT était augmenté de 208 ± 23% chez les CTRL, alors qu'une
réponse de 83 ± 15% a été mesurée chez les MPOC (p = 0,02). De plus, ce ratio p70S6K était
augmenté de 308 ± 119% chez les CTRL et seulement de 119 ± 32% chez les MPOC (p = 0,01). Le
ratio phosphorylation/protéine totale de la p38 MAPK était quant à lui significativement différent
entre les groupes (p = 0,01), alors qu’il était de 43 ± 12% pour les MPOC et de 130 ± 32 % pour les
CTRL. Dans l'ensemble, nos données montrent que le ratio phosphorylation/protéine totale des
protéines associées à l’hypertrophie (p70S6K, AKT) était moins augmenté chez la MPOC, tandis que
ce ratio chez la p38 MAPK était significativement diminué chez la MPOC par rapport aux sujets
sains après la session d’exercice en résistance.
![Page 174: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/174.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
148
6.2 Abstract
Muscle weakness and atrophy are important consequences of chronic obstructive
pulmonary disease (COPD). Although resistance training increases strength in patients with COPD,
the response to training appears to be suboptimal in this population. A dysregulation in the
signalling pathways involved in the regulation of muscle mass could play an important role in this
phenomenon. Thus, we investigated the impact of an acute bout of resistance training on key
signalling proteins involved in the regulation of muscle mass in a COPD population. We measured
the phosphorylation status of key quadriceps signalling proteins (AKT, p70s6k, mTOR, GSK-3β, p38
MAPK, ERK 1/2) as well as E3 ligases involved in protein degradation (Atrogin1 and MuRF) and
cytokines mRNA expression (TNF-α, IL-8, IL-6) before and after an acute bout of resistance
training session in 11 patients with COPD (FEV1: 45 ± 2% of predicted) and 10 age-matched
healthy controls. All exercises were done at 80% of max for 2 sets of 12 repetitions of squats, leg
press and leg extension and was chosen to mimic a normal resistance training session of a normal
rehabilitation session for COPD patients. Biopsies of the quadriceps were obtained before and 2
hours after exercise. The phosphorylated and total protein levels were analyzed by western blotting
while cytokines were analyzed qPCR by. After exercise, the phosphorylated to total AKT ratio were
increased by 208 ± 23% in CTRL, while a response of 83 ± 15% was measured in COPD (p=0.02),
In addition, the phosphorylated to total p70s6k ratio were increased by 308 ± 119% in CTRL and by
only 119 ± 32% in COPD (p=0.01). Moreover, the exercise response for the phosphorylated to total
p38 MAPK ratio was significantly different between groups (p=0.01) as this ratio was reduced by
43 ± 12% in COPD (p<0.01), while CTRL showed an increase of 130 ± 32%. Overall, our data
shows that the ratios of kinases associated with hypertrophy (p70s6k, AKT) were less
phosphorylated in COPD, while p38 MAPK was significantly decreased in COPD compared to
controls after an acute bout of resistance exercise.
![Page 175: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/175.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
149
6.3 Introduction Muscle dysfunction is one of the systemic manifestations of Chronic Obstructive
Pulmonary Disease (COPD). Among the muscle abnormalities associated with this dysfunction,
skeletal muscle atrophy is often present in patients with COPD (26). Although the origin of this
muscle atrophy is not well defined, it greatly contributes to exercise intolerance, muscle weakness
and poor quality of life of those patients (38).
Resistance training exercise is known to reverse the above-mentioned consequences, at least
in healthy subjects. In comparison, the improvements in muscle strength in patients in COPD
patients participating in an 8-week rehabilitation program shows minor gains that reached 70% of
healthy controls baseline values (13). In a 10-week study of resistance training with and without the
use of testosterone, exercising patients with COPD on placebo only gained 0.1 kg of lean mass
compared with 2.3 kg in non-exercising COPD patients using steroids and 3.3 kg in exercising
COPD patients using steroids (5). In all transparency, other studies have shown similar increases in
thigh lean mass as well as in quadriceps strength between COPD and healthy controls after 8 weeks
of highly controlled resistance training (32), albeit showing an exercise-induced inflammatory
muscle infiltration in patients with COPD at lower exercise intensities suggesting that this response
may occur during daily activities and may contribute to the low-grade inflammation involved in
skeletal muscle wasting and dysfunction in COPD.
Numerous factors can limit the gains in muscle and strength in patients with COPD. Our
group and others has shown that a signalling pathways (AKT, p70s6k, MAPK) involved in muscle
mass maintenance were irregular and/or chronically overexpressed in COPD (11, 24, 37, 41). Thus,
this abnormal intramuscular signalling could contribute to the suboptimal response in rehabilitation
training in COPD, at least for resistance training outcomes such as muscle mass gains.
Key signalling pathways involved in the regulation of protein translation in skeletal muscle
are activated immediately following a single bout of resistance exercise (16). Thus, resistance
exercise induce acute increases in the phosphorylation of protein kinase B (AKT) and the
mammalian target of rapamycin (mTOR) and its downstream targets p70S6 kinase (p70S6k) and
glycogen synthase kinase 3β (GSK-3β), which are known to regulate the initiation of skeletal
muscle protein translation (6, 9, 13, 17, 30, 45). Moreover, the acute increase in the phosphorylation
of p70S6k following an initial bout of resistance training is closely correlated with the increase in
human skeletal muscle mass after a few months of continuous resistance training (45). While in
![Page 176: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/176.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
150
vitro, the acute phosphorylation of ERK1/2 and p38 MAPK appears to be linked to the
phosphorylation of p70S6k (8), evidences show that the MAPKs could also be linked to protein
muscle degradation in certain condition of cellular stress (25, 32).
The ATP-dependent ubiquitin-proteasome system predominates under conditions of muscle
wasting (33). Two of the muscle-specific ubiquitin ligase genes, muscle atrophy F-box (MAFbx,
aka Atrogin1) and muscle ring finger 1 (MuRF), are known to regulate this proteasome system and
are markedly induced in diverse models of muscle atrophy (20). Atrogin1 and MuRF are regulated
by the PI3-kinase/AKT pathway. AKT phosphorylates the forkhead box class O (FoxO)
transcription factors and inhibits their nuclear transport. Under condition of muscle atrophy, the
deactivation of AKT results in the nuclear accumulation of FoxO factors, which in turn induce the
transcription of Atrogin1 and MuRF leading to an increase in protein degradation (43). In addition,
inflammation-induced ERK 1/2 activation has been shown to increase the expression of muscle
Atrogin1, suggesting that ERK 1/2 could play a crucial role in the pathogenesis of muscle atrophy
(36). Moreover, p38 MAPK is also to mediate oxidative stress-induced Atrogin1 gene expression
and ubiquitin-conjugating activity in skeletal muscle (25).
Overall, these events collectively lead to the formation of the translation initiation complex
and activate protein synthesis as well as protein degradation, which makes up the delicate balance
of muscle mass maintenance in human skeletal muscle.
Thus, we investigated the acute intramuscular cellular response to an acute resistance
training exercise session in patients with COPD to gain data regarding the kinase and transcriptional
responses of a number of important mediators within the skeletal muscle of patients with COPD.
![Page 177: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/177.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
151
6.4 Methods Subjects
Eleven (11) patients with moderate to severe COPD and 10 healthy aged-matched
controls participated in this study. The diagnosis of COPD was based on spirometry
showing moderate to severe irreversible airflow obstruction (forced expiratory volume in 1
second (FEV1) < 80% predicted value, and FEV1/ forced vital capacity (FVC) < 70%) (37,
38). All patients with COPD were in a stable condition at the time of the study without any
acute exacerbation of their disease or exposure to systemic corticosteroids within 2 months
of their participation in the study. No patients were receiving long-term oxygen therapy. In
both groups, subjects were excluded if they presented any medical condition, other than
COPD, likely to influence muscle and biochemical testing (i.e. cardiovascular,
neurological, musculoskeletal, locomotor or other respiratory diseases). Only male ex-
smokers for at least 6 months were included in the present study in order to minimize
measurement variability. The research protocol was approved by the institutional ethics
committee and a signed informed consent was obtained from each subject.
Study design After reviewing medical history and familiarization with the study procedures, subjects
filled out a physical activity questionnaire (45). Anthropometric measurements, pulmonary function
testing, mid-thigh cross-sectional area by computed tomography (CT scan) and a body composition
assessment by dual energy X-ray Absorptiometry (DEXA) and exercise familiarization and testing
were performed. Subjects were also given a pedometer for a period of 7 days in order to measure
physical activity in daily living. Subjects then returned to the laboratory for a vastus lateralis
biopsies at rest. Three days later (72 hours), the participants came back to the laboratory for the
acute resistance exercise bout and the post-exercise muscle biopsy.
Pulmonary function testing
Standard pulmonary function tests including spirometry, lung volumes, and carbon
monoxide diffusion capacity were obtained in all subjects during the initial evaluation
according to previously described guidelines (1). Results were related to previously publish
normal values (18, 22).
![Page 178: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/178.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
152
Physical activity measurement and score The level of physical activity was assessed with a multisensor wearable device worn on the
right arm designed to collect and analyze a broad range of data from the body and its movement
(SenseWear Armband) for at least 7 days. The level of physical activity in daily living was also
assessed with the Voorrips physical activity questionnaire described by Baecke et al. (2) adapted for
elderly individuals (45) and used in patients with COPD (43). The questionnaire attributes a score
for household, sport, and other leisure-time physical activities, together resulting in a global
physical activity score. A score of 9-16 indicates a moderate level of daily physical activity,
whereas a score < 9 depicts low levels of daily physical activity and is associated with a sedentary
lifestyle.
Exercise testing
Each participant was given instruction on the three resistance training exercises. A qualified
kinesiologist evaluated the 1 repetition maximum in all participants and determined the proper
weight that should be used for 12 repetitions. This was calculated to be around 80% of max for all
participants.
Muscle biopsy
A needle biopsies of the vastus lateralis were performed as described by Bergström (3) and
routinely done in our laboratory (27). Muscle specimens were frozen in liquid nitrogen exactly one
minute after the end of exercise and stored at - 80°C for future analysis. In resting condition the pre-
exercise muscle biopsy was done three days prior the exercise session in order for the quadriceps to
heal properly and not compromise the exercise session and to avoid the unnecessary measurements
of the inflammatory surge post-biopsy in the muscle tissue.
Exercise session
The exercise session consisted of 3-resistance exercise that primarily focused on leg
exercises. Two sets of 12 repetitions of standing dumbbell squats, leg press and leg extension were
performed in a controlled manner to resemble a typical training program session in a rehabilitation
center. Participants were allowed a 1-minute break between sets.
Anthropometric measurements and body composition
Height and weight were measured according to standardized methods (19). Dual energy X-
ray Absorptiometry (DEXA) provided regional assessment of fat and fat-free mass (General
Electric Healthcare, Chicago, IL).
Measurement of mid-thigh muscle cross-sectional area
![Page 179: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/179.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
153
A computed tomography (CT) of the right thigh halfway between the pubic symphysis and
the inferior condyle of the femur was performed using a fourth-generation Toshiba Scanner 900S
(Toshiba). Each image was 5-mm thick and was taken at 120 kV and 200 mA with a scanning time
of 1 s while the subject was lying in the supine position. The mid-thigh muscle cross-sectional area
(MTCSA) was obtained by measuring the surface area of the tissue with a density of 40 to 100
Hounsfield units (HU). This range of density was chosen because it corresponds to the density of
muscle tissue (21). Computed tomography was used to estimate muscle mass because it is more
specific than anthropometric measurements. For instance, the age-related fat infiltration of the
muscles, which cannot be detected with anthropometric measurements, can be identified by
computed tomography because of the fat specific density.
Blood sampling and analysis
Arterial blood was drawn from a radial artery and PaO2 was then analyzed with a blood gas
analyser (AVL995; AVL Scientific, Roswell, GA) only in patients with COPD. The antecubital
venous blood was centrifuged for 15 minutes, plasma was aliquoted, and stored at -80°C until
further analysis. Commercial ELISA kits (R&D Systems Inc, Minneapolis, MN, USA) for TNF-α,
IL-6 AND IL-8 were used to measure the plasma levels of systemic inflammatory markers (TNF-α,
IL-6, IL-8).
Skeletal Muscle and Data Analysis
Protein extraction and Western blotting
Cytoplasmic protein extraction was performed with ≈ 30 mg of muscle. Muscle samples
were washed for 1 minute in PBS 1X to remove all excess blood. Muscle samples were then
homogenised using a Polytron PowerGen 125 (Omni International, Marietta, GA, USA). Protease
inhibitor cocktails for mammalian cell and tissue extracts (Sigma, Oakville, Ontario, Canada) and
phosphatase inhibitor cocktails I and II (Sigma, Oakville, ON, Canada) was added to the extraction
buffer containing 5 mM Tris pH 8, 1 % glycerol, 1 mM EDTA, 1 mM EGTA 1 mM β-
mercaptoethanol. Protein content was determined by a DC protein essay (BioRad, Mississauga,
Ontario, Canada) based on a modified Lowry method. Electrophoresis was performed using 12 %
SDS PAGE gels. After a 3-hour protein transfer in cold (4°C) buffer, nitrocellulose membranes
were blocked for 1 hour with BSA 5% in TBS-T (Tris 10 mM pH 8, NaCl 150 mM containing 0,1%
Tween-20). The membranes were then incubated overnight at 4°C using the primary antibodies
(phosphorylated-p38, p38, phosphorylated-ERK 1/2, ERK 1/2, MuRF, phosphorylated-AKT, AKT,
![Page 180: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/180.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
154
phosphorylated-mTOR, mTOR, phosphorylated-p70s6k and p70s6k, phosphorylated-GSK-3β and
GSK-3β (Cell Signaling technology , Danvers, MA, USA) diluted 1:5000 in BSA 5%. The
antibodies against Atrogin1, was developed in our centre as previously reported (10, 11, 24). The
membranes were then washed 3 x 20 minutes with TBS-T and incubated for 1 hour at room
temperature with the secondary antibody IRDye 800CW goat anti-rabbit IgG (H+L) (Mandel,
Guelph, ON, Canada cat. no. LIC-926-32211) diluted 1:10 000 in BSA 5% and again washed as
above. Finally, all protein contents were normalized to α-tubulin (Sigma, Oakville, ON, Canada cat.
no. T5168) with secondary antibody IRDye 800CW goat anti-mouse IgG (H+L) (Mandel, Guelph,
ON, Canada cat. no. LIC-926-32220). Quantification was performed using infrared imaging system
(Odyssey, LI-COR : Mandel, Guelp, ON Canada).
Real-Time PCR
Total RNA extraction was performed from ≈ 15 mg of muscle using a commercially
available preparation (TRIzol® Reagent, Invitrogen, Burlington, Ontario, Canada). One μg
of RNA was reverse transcribed to cDNA using QuantitectTM Reverse Transcription Kit
(Qiagen, Mississauga, Ontario, Canada). Real time PCR were performed in a Rotor-GeneTM
6000 (Corbett Life Science, San Francisco, CA, USA) using QuantitectTM SYBR® Green
PCR Kit (Qiagen, Mississauga, Ontario, Canada). All protocols consisted of one denaturing
cycle at 90°C for 10 minutes, followed by 40 cycles of denaturing at 90°C for 30 seconds,
annealing at 60°C for 60 seconds and elongation at 72°C for 60 seconds followed by final
elongation at 72°C for 5 minutes. At the end of the PCR amplifications the samples were
subjected to a melting curve analysis. The comparative threshold cycles (∆CT) values for
TNF-α, IL-6, IL-8 were normalized for RPLPO and 18s human reference genes and
analyzed using the 2-∆Ct method (26). All qPCR runs were performed in duplicate to ensure
quantitative accuracy. PCR primer sequences are provided in table 1.
STATISTICAL ANALYSIS
Results are expressed as mean (± SEM). Baseline value and between-group comparisons of
% changes from baseline were done using unpaired Student’s t tests, while normality for all data
was assessed with a Shapiro-Wilk test. Possible relationships were evaluated using Pearson’s
correlations. Results were considered significant if p values were less than 0.05.
![Page 181: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/181.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
155
6.5 Results Subjects’ characteristics
Anthropometric characteristics and pulmonary function data are provided in Table 2. On
average, patients with COPD had moderate to severe airflow obstruction, reduced diffusion capacity
and mild hypoxemia. Total fat-free mass and fat-free mass index were lesser in patients with COPD
compared to healthy controls.
Muscle characteristics
Mid-thigh muscle cross sectional area was smaller in COPD compared to controls. In
COPD, mid-thigh muscle cross-sectional areas ranged from severe atrophy (60 cm2) to normal
value (117 cm2). Only two patients exhibited a mid-thigh muscle cross-sectional area < 70 cm2, a
value that is associated with poor survival (29).
Phosphorylated to total protein ratio levels
Baseline values for AKT (figure 1, panel C) and p38 MAPK (figure 2, panel A) were
significantly greater in COPD compared to controls. In addiction, ERK ½ (figure 2, panel B),
Atrogin1 (figure 3, panel A) and MuRF (figure 3, panel C) showed a trend to elevated in our COPD
patients.
Percent (%) changes from baseline values were significantly elevated in controls for AKT
(p=0.02, figure 1, panel D), p70s6k (p=0.01, figure 1, panel F), and Atrogin1 (p=0.03, figure 3, panel
B). In addition, % change from baseline values for mTOR showed a trend to be elevated in controls
(p=0.10, figure 1, panel B). In COPD, % changes from baseline values showed a significant
decrease in p38 MAPK (p<0.01, figure 2, panel B), while a trend for an increase GSK-3β (p=0.06,
figure 1, panel H) was observed post-exercise.
Between groups comparison of the % changes from baseline values revealed significant
differences for the exercise response of AKT (p=0.02, figure 1, panel B), p70s6k (p=0.03, figure 1,
panel F), p38 MAPK (p=0.01, figure 2, panel B) and Atrogin1 (p=0.01, figure 3, panel B), while
ERK 1/2 showed a similar response than p38 MAPK but was not significant (p=0.11, figure 2,
panel D).
![Page 182: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/182.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
156
Systemic inflammatory markers
As depicted in table 3, no baseline systemic inflammatory markers were different between
groups. Only IL-6 was significantly elevated from baseline values after exercise in the control
group.
Local inflammatory markers
As depicted in figure 4, no difference for baseline value of local inflammatory markers
were seen. All % change from baseline for inflammatory markers were influence with exercise and
this, in a similar fashion for both groups, except for IL-8 (p=0.03, figure 4, panel D), which was
significantly elevated in controls.
![Page 183: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/183.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
157
6.6 Discussion The main finding of this study is that the cellular response of key signalling proteins
involved in muscle mass regulation are differently activated in patients with COPD compared to
age-matched healthy controls. The phosphorylation levels of 3 pro-synthesis proteins were elevated
in healthy controls while at the opposite, GSK-3β, a dominant negative pro-synthesis protein, was
significantly elevated in our COPD patients. In addition, the fact that the exercise response of the
E3 ligase Atrogin1 was significantly elevated by exercise in our controls, while the p38 MAPK was
significantly reduced in our COPD group, adds to the evidence that the cellular response of patients
with COPD to resistance training might be different than their age-matched healthy controls
counterparts. Taken into account that the mRNA expression of inflammatory markers known to be
elevated with resistance training exercise were similarly increased with exercise in both groups, this
shows that a similar cellular stress caused by resistance exercise can elicits a different cellular
response in COPD compared to healthy controls.
Our goal was to evaluate the cellular response of patients with COPD to a ‘typical’ training
regiment at our rehabilitation center. The exercises were chosen because they are included in the
rehabilitation program for patients with COPD. Since we measured the quadriceps response, we
only focused on exercises for the lower body with a ‘typical’ intensity of around 80% of max.
The typical response to resistance training involves the phosphorylation of key signalling
proteins involved in muscle mass regulation from 1 to 24 hours post-exercise (33). Of course, this
varies across studies depending on intensities, duration and population studied (6, 9, 15, 28, 43).
However, a ‘typical’ general response to resistance training can be established from the literature in
order to compare the response to exercise in COPD to healthy controls.
Masher et al. (2008) showed increased phosphorylation of mTOR and p70s6k from 15
minutes to 2 hours post-exercise in young healthy controls, while no change in Atrogin1 and a
decrease in MuRF mRNA expression was recorded. Since the exercise intensity and volume of this
study was very high (4 series, 10 reps, 80% of max) and done by young healthy controls, the direct
comparison with our results is difficult. Our results show that our healthy controls increased p70s6k
about 3 fold, while Mascher et al. (2008) show increases of between 6 to 15 fold from baseline
depending on the phosphorylation site. Our results are more in the range of Dreyer et al. that
showed significant increases in AKT, mTOR and p70s6k in a mixed population of healthy controls in
![Page 184: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/184.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
158
the range of 1.5 to 3 fold increases (12). Although the volume of the exercise session was greater
than ours (8 series, 10 reps), the intensity was lesser at 70% of max, which brings the question that
maybe it is the intensity that drives the cellular response to resistance training exercise as the
volume as already shown to be important at least for p70s6k and the ribosomal protein S6 (43).
It is known that the cellular response to exercise is different between E3 ligases Atrogin1
and MuRF (29). Mascher et al. (2008) show decreases in the mRNA expression of Atrogin1 48
hours post-exercise while showing an increase in MuRF mRNA expression 2 hours post-exercise.
Another study by Coffee et al. (2007) showed increases in Atrogin1 mRNA expression at 24 hours
post-exercise while no significant changes were recorded for MuRF (7). However, we show
increases in Atrogin1 in our healthy controls while our COPD do not show any changes with
exercise. As well, no change for MuRF was recorded in both groups. Since our results our protein
measurements and not mRNA, this could be a source of discrepancy. However, this is still an
indication of the difference in cellular response to exercise in COPD patients.
Another interesting point of comparison is the studies investigating the exercise response of
older versus younger individuals. A study comparing the MAPK response to resistance training
exercise showed that resting levels of p38 MAPK and ERK 1/2 were elevated in the quadriceps of
older individuals compared to younger males (45). After exercise, the phosphorylation levels were
increased in younger males and were decreased in the older individuals, similarly to our data,
except our groups were matched for age. This could be an indication that the resting COPD muscle
is under ‘cellular stress’ and this is reflected in the response to exercise in patients with COPD. It is
known that the myofribrillar protein synthesis (measured by the fractional synthetic rate) is lesser in
older individual 1 to 2 hours after exercise and this seems to be related to the phosphorylation levels
of p70s6k (21). We did not measure the protein synthesis rate in our study, but the p70s6k values seem
to indicate that our COPD patients would have a tapered down response of this protein synthesis
rate post-exercise. However, more muscles post-exercise muscle biopsies and a direct measurement
would be needed to confirm this statement.
Although we chose to exercise our groups at similar % of maximum capacity, results might
be influenced by the total amount of work done during exercise. Volume and intensity of resistance
training exercise has been shown to influence the molecular response to exercise (4, 43), especially
in COPD where post-exercise inflammatory cells infiltration is associated with the intensity of work
performed (32). Are results showing similar increases in inflammatory cytokines (TNF-α, IL-6, IL-
8) in both groups are in line with Menon et al. showing similar increases in inflammatory cell
![Page 185: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/185.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
159
response after an acute bout of resistance training exercise in COPD. We acknowledge that this is
part of the normal muscle inflammatory response to resistance training exercise, however this seems
to happen at much lower total workload in COPD, albeit at the same % of maximum capacity. This
could simply be a reflection of an untrained, deconditioned muscle response to exercise as often
seen in COPD response to exercise.
Limitations
This study has the merit of reporting on molecular mechanisms that have been convincingly
associated with the muscle mass maintenance in response to resistance training exercise (6, 40).
However, a number of methodological considerations and potential limitations need to be taken into
account regarding its interpretation. First, only one muscle biopsy was taken in the post-exercise
phase. This was chosen because of the fragility of our COPD population and the burden associated
with multiple muscle biopsies in a short amount of time. Another limitation that is intrinsic to this
type of human experimentation is the descriptive nature of the study. As such, our results show that
baseline values are different between COPD and controls, but no mechanisms is able (for now) to
pinpoint the cause of this resting signalling abnormalities in the quadriceps of patients with COPD.
Future mechanistic experiments or pharmacological manipulations of these signalling pathways are
necessary to address a possible causality between these observations. Furthermore, several isoforms
and expression patterns of the key proteins measured in this study exist; however, dissecting of the
specific role of each subunit in the COPD response to resistance training exercise appeared
premature and was beyond the scope of this investigation. As such, antibodies detecting all protein
isoforms were used in the western blot analyses.
6.7 Conclusion This study shows that the cellular response of key proteins involved in muscle mass
maintenance is different in COPD compared to age-matched healthy controls following a single
bout of resistance training exercise and could be involved in the COPD-related exercise intolerance.
Although the information gained from acute exercise is typically less clinically relevant than that
obtained from training studies; these investigations can provide a wide range of valuable
information concerning biological targets in training studies.
We acknowledge that pulmonary rehabilitation is the best tool to treat our patients with
COPD and the benefits outweigh the less than optimal response to exercise, however, our study
![Page 186: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/186.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
160
shows that care should be taken to make sure that appropriate and specific resistance training
exercises should be put in place to ensure better cellular response to exercise thus hopefully
translating into better quality of life outcomes for patients with COPD.
ACKNOWLEDGEMENTS
The authors acknowledge the help of Marthe Bélanger, Marie-Josée Breton, Brigitte
Jean, Josée Picard, Philippe Gagnon and Vincent Mainguy in accomplishing this study.
![Page 187: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/187.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
161
6.8 References 1. ATS. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. American Journal of Respiratory and Critical Care Medicine 152: S77-121, 1995. 2. Baecke JA, Burema J, and Frijters JE. A short questionnaire for the measurement of habitual physical activity in epidemiological studies. The American journal of clinical nutrition 36: 936-942, 1982. 3. Bergstrom J. Muscle electrolytes in man determined by neutron activation analysis on needle biopsy specimens. Scandinavian Journal of Clinical and Laboratory Investigation 14: 1962. 4. Bickel CS, Cross JM, and Bamman MM. Exercise dosing to retain resistance training adaptations in young and older adults. Med Sci Sports Exerc 43: 1177-1187, 2011. 5. Casaburi R, Bhasin S, Cosentino L, Porszasz J, Somfay A, Lewis MI, Fournier M, and Storer TW. Effects of testosterone and resistance training in men with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 170: 870-878, 2004. 6. Coffey VG, and Hawley JA. The molecular bases of training adaptation. Sports Med 37: 737-763, 2007. 7. Coffey VG, Reeder DW, Lancaster GI, Yeo WK, Febbraio MA, Yaspelkis BB, 3rd, and Hawley JA. Effect of high-frequency resistance exercise on adaptive responses in skeletal muscle. Med Sci Sports Exerc 39: 2135-2144, 2007. 8. Deldicque L, Atherton P, Patel R, Theisen D, Nielens H, Rennie MJ, and Francaux M. Decrease in Akt/PKB signalling in human skeletal muscle by resistance exercise. Eur J Appl Physiol 104: 57-65, 2008. 9. Deldicque L, Theisen D, and Francaux M. Regulation of mTOR by amino acids and resistance exercise in skeletal muscle. Eur J Appl Physiol 94: 1-10, 2005. 10. Doucet M, Dubé A, Joanisse DR, Debigaré R, Michaud A, Paré ME, Vaillancourt R, Frechette E, and Maltais F. Atrophy and hypertrophy signalling of the quadriceps and diaphragm in COPD. Thorax 65: 963-970, 2010. 11. Doucet M, Russell AP, Leger B, Debigaré R, Joanisse DR, Caron MA, LeBlanc P, and Maltais F. Muscle atrophy and hypertrophy signaling in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 176: 261-269, 2007. 12. Doucet M, Russell AP, Leger B, Debigaré R, Joanisse DR, Caron MA, LeBlanc P, and Maltais F. Muscle atrophy and hypertrophy signaling in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 176: 261-269, 2007. 13. Dreyer HC, Fujita S, Cadenas JG, Chinkes DL, Volpi E, and Rasmussen BB. Resistance exercise increases AMPK activity and reduces 4E-BP1 phosphorylation and protein synthesis in human skeletal muscle. J Physiol 576: 613-624, 2006.
![Page 188: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/188.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
162
14. Dreyer HC, Fujita S, Cadenas JG, Chinkes DL, Volpi E, and Rasmussen BB. Resistance exercise increases AMPK activity and reduces 4E-BP1 phosphorylation and protein synthesis in human skeletal muscle. J Physiol 576: 613-624, 2006. 15. Franssen FM, Broekhuizen R, Janssen PP, Wouters EF, and Schols AM. Effects of whole-body exercise training on body composition and functional capacity in normal-weight patients with COPD. Chest 125: 2021-2028, 2004. 16. Freyssenet D. Cellular and molecular mechanisms regulating skeletal muscle mass during strength training. Science & Sports 21: 74-79, 2006. 17. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 37: 1974-1984, 2005. 18. Goldman HI, and Becklake MR. Respiratory function tests; normal values at median altitudes and the prediction of normal results. Am Rev Tuberc 79: 457-467, 1959. 19. Heymsfield SB WP. Nutritional assessment by clinical and biochemical methods. In: Modern nutrition in health and disease. Philadelphia: Lea & Febiger, 1994, p. pp. 812-841. 20. Kandarian SC, and Jackman RW. Intracellular signaling during skeletal muscle atrophy. Muscle Nerve 33: 155-165, 2006. 21. Kelley DE, Slasky BS, and Janosky J. Skeletal muscle density: effects of obesity and non-insulin-dependent diabetes mellitus. The American journal of clinical nutrition 54: 509-515, 1991. 22. Knudson RJ, Burrows B, and Lebowitz MD. The maximal expiratory flow-volume curve: its use in the detection of ventilatory abnormalities in a population study. Am Rev Respir Dis 114: 871-879, 1976. 23. Kumar V, Selby A, Rankin D, Patel R, Atherton P, Hildebrandt W, Williams J, Smith K, Seynnes O, Hiscock N, and Rennie MJ. Age-related differences in the dose-response relationship of muscle protein synthesis to resistance exercise in young and old men. J Physiol 587: 211-217, 2009. 24. Lemire BB, Debigare R, Dube A, Theriault ME, Cote CH, and Maltais F. MAPK signaling in the quadriceps of patients with chronic obstructive pulmonary disease. J Appl Physiol 113: 159-166, 2012. 25. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, and Reid MB. TNF-alpha acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle. Faseb J 19: 362-370, 2005. 26. Livak KJ, and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif 25: 402-408, 2001. 27. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Bélanger M, Breton MJ, and Jobin J. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 55: 848-853, 2000. 28. Man WD, Kemp P, Moxham J, and Polkey MI. Skeletal muscle dysfunction in COPD: clinical and laboratory observations. Clin Sci (Lond) 117: 251-264, 2009. 29. Marquis K, Debigaré R, Lacasse Y, LeBlanc P, Jobin J, Carrier G, and Maltais F. Midthigh muscle cross-sectional area is a better predictor of mortality than body mass index in
![Page 189: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/189.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
163
patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 166: 809-813, 2002 30. Mascher H, Andersson H, Nilsson PA, Ekblom B, and Blomstrand E. Changes in signalling pathways regulating protein synthesis in human muscle in the recovery period after endurance exercise. Acta Physiol (Oxf) 191: 67-75, 2007. 31. Mascher H, Tannerstedt J, Brink-Elfegoun T, Ekblom B, Gustafsson T, and Blomstrand E. Repeated resistance exercise training induces different changes in mRNA expression of MAFbx and MuRF-1 in human skeletal muscle. Am J Physiol Endocrinol Metab 294: E43-51, 2008. 32. McClung JM, Judge AR, Powers SK, and Yan Z. p38 MAPK links oxidative stress to autophagy-related gene expression in cachectic muscle wasting. Am J Physiol Cell Physiol 298: C542-549, 2010. 33. Melstrom LG, Melstrom KA, Jr., Ding XZ, and Adrian TE. Mechanisms of skeletal muscle degradation and its therapy in cancer cachexia. Histol Histopathol 22: 805-814, 2007. 34. Menon MK, Houchen L, Singh SJ, Morgan MD, Bradding P, and Steiner MC. Inflammatory and Satellite Cells in the Quadriceps of Patients with COPD and the Response to Resistance Training. Chest 2012. 35. Miller BF, Olesen JL, Hansen M, Dossing S, Crameri RM, Welling RJ, Langberg H, Flyvbjerg A, Kjaer M, Babraj JA, Smith K, and Rennie MJ. Coordinated collagen and muscle protein synthesis in human patella tendon and quadriceps muscle after exercise. J Physiol 567: 1021-1033, 2005. 36. Penna F, Costamagna D, Fanzani A, Bonelli G, Baccino FM, and Costelli P. Muscle wasting and impaired myogenesis in tumor bearing mice are prevented by ERK inhibition. PLoS One 5: e13604, 2010. 37. Plant PJ, Brooks D, Faughnan M, Bayley T, Bain J, Singer L, Correa J, Pearce D, Binnie M, and Batt J. Cellular markers of muscle atrophy in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 42: 461-471, 2009. 38. Quanjer PH, Schouten JP, Miller MR, and Ruppel G. Avoiding bias in the annualized rate of change of FEV1. American Journal of Respiratory and Critical Care Medicine 175: 291-292; author reply 292, 2007. 39. Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y, Jenkins C, Rodriguez-Roisin R, van Weel C, and Zielinski J. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary. American Journal of Respiratory and Critical Care Medicine 176: 532-555, 2007. 40. Rabinovich RA, and Vilaro J. Structural and functional changes of peripheral muscles in chronic obstructive pulmonary disease patients. Curr Opin Pulm Med 16: 123-133, 2010. 41. Riddoch-Contreras J, George T, Natanek SA, Marsh GS, Hopkinson NS, Tal-Singer R, Kemp P, and Polkey MI. p38 mitogen-activated protein kinase is not activated in the quadriceps of patients with stable chronic obstructive pulmonary disease. Copd 9: 142-150, 2012. 42. Sandri M. Signaling in muscle atrophy and hypertrophy. Physiology (Bethesda) 23: 160-170, 2008.
![Page 190: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/190.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
164
43. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, and Goldberg AL. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117: 399-412, 2004. 44. Serres I, Gautier V, Varray A, and Prefaut C. Impaired skeletal muscle endurance related to physical inactivity and altered lung function in COPD patients. Chest 113: 900-905, 1998. 45. Terzis G, Spengos K, Mascher H, Georgiadis G, Manta P, and Blomstrand E. The degree of p70 S6k and S6 phosphorylation in human skeletal muscle in response to resistance exercise depends on the training volume. Eur J Appl Physiol 110: 835-843, 2010. 46. Voorrips LE, Ravelli AC, Dongelmans PC, Deurenberg P, and Van Staveren WA. A physical activity questionnaire for the elderly. Med Sci Sports Exerc 23: 974-979, 1991. 47. Williamson D, Gallagher P, Harber M, Hollon C, and Trappe S. Mitogen-activated protein kinase (MAPK) pathway activation: effects of age and acute exercise on human skeletal muscle. J Physiol 547: 977-987, 2003.
![Page 191: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/191.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
165
6.9 Tables Table 1. Primer sequences used for qPCR analyses
T
NF-α, tumor necrosis factor alpha; IL-6, Interleukine 6; IL-8, Interleukine 8; RPLPO, acidic ribosomal phosphoprotein PO.
Target mRNA
PCR primer sequence 5’→ 3’
TNF Forward Reverse
ACCACGCTCTTCTGCCTGCTG TCTGGTAGGAGACGGCGATGC
IL-8 Forward Reverse
ATGACTTCCAAGCTGGCCGTGGCT TCTCAGCCCTCTTCAAAAACTTCT
IL-6 Forward Reverse
CTGGGGCTGCTCCTGGTGTTG AGGCTGGCATTTGTGGTTGGG
18s Forward Reverse
CGCACGGCCGGTACAGTGAA GGGAGAGGAGCGAGCGACCA
RPLPO Forward Reverse
TCTACAACCCTGAAGTGCTTGATATC GCAGACAGACACTGGCAACATT
![Page 192: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/192.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
166
Table 2. Characteristics of study subjects
Values are mean ± SEM BMI, body mass index; FEV1, forced expiratory volume in 1 sec; DLco, diffusing capacity of carbon monoxyde; FEV1/FVC, ratio of forced expiratory volume in 1 sec on forced vital capacity; PaCO2, arteriole partial pressure of carbon dioxide; PaO2, arteriole partial pressure of oxygen; MTSCA, mid-thigh cross-sectional area * Versus Controls, p ≤ 0.05 † p = 0.07
CTRL (n = 10)
COPD (n = 11)
Age (years) 65 ± 2 67 ± 1 Weight (kg) 78.5 ± 2.3 78.2 ± 3.7 BMI (kg/m
2) 28 ± 1 27 ± 1
Fat-free mass (kg) 55.6 ± 1.2 49.8 ± 1.1† Fat-free mass index (kg/m2) 19.5 ± 0.3 17.0 ± 0.3* Fat mass (kg) 19.9 ± 1.2 23.2 ± 2.3 Pulmonary function FEV1 (L) 3.38 ± 0.09 1.32 ± 0.06* FEV1 (% of predicted) 118 ± 3 45 ± 2* FEV1/FVC (%) 79 ± 1 38 ± 1* DLCO (% of predicted) 103 ± 2 60 ± 3* PaCO2 (mmHg) - 39.5 ± 0.9 PaO2 (mmHg) - 73.8 ± 1.5 Physical activity monitoring Voorrips (score) 6.9 ± 0.6 4.2 ± 0.6† Steps (steps/day) 8268 ± 842 3807 ± 386* Muscle characteristics MTCSA (cm2) 113.8 ± 3.8 86.2 ± 2.6*
![Page 193: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/193.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
167
Table 3. Systemic markers of inflammation and % change from baseline after exercise
Values are mean ± SEM TNF-α, tumor necrosis factor alpha; IL-6, interleukin 6; IL-8, interleukin 8; * Versus baseline values, p ≤ 0.05
CTRL (n = 10) COPD
(n = 11) Baseline Change from
baseline (%) Baseline
Change from baseline (%)
TNF-α (pg/ml) 1.88 ± 0.34 99 ± 5 1.71 ± 0.12 99 ± 3 IL-6 (pg/ml) 2.03 ± 0.36 145 ± 18* 3.32 ± 0.53 118 ± 17
IL-8 (pg/ml) 4.35 ± 0.61 123 ± 77 6.37 ± 0.76 88 ± 9
![Page 194: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/194.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
168
6.10 Figures Legends FIGURE 1. Phosphorylated to total protein ratios at baseline and after exercise for mTOR (panel A and B), AKT (panel C and D), p70s6k (panel E and F) and GSK-3β (panel G and H) in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). Data are presented in arbitrary units (A.U.) and percent change from baseline. †, 0.05 < p < 0.10 versus baseline value. *, p < 0.05 versus baseline value. FIGURE 2. Phosphorylated to total protein ratios at baseline and after exercise for p38 MAPK (panel A and B) and ERK 1/2 (panel C and D) in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). Data are presented in arbitrary units (A.U.) and percent change from baseline. *, p < 0.05 versus baseline value. FIGURE 3. Total protein content levels at baseline and after exercise for Atrogin1 (panel A and B) and MuRF (panel C and D) in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). Data are presented in arbitrary units (A.U.) and percent change from baseline. *, p < 0.05 versus baseline value. FIGURE 4. mRNA expressions at baseline and after exercise for TNF-α (panel A and B), IL-8 (panel C and D) and IL-6 (panel E and F) in the quadriceps of healthy controls and patients with chronic obstructive pulmonary disease (COPD). Data are presented in arbitrary units (A.U.) and percent change from baseline. †, 0.05 < p < 0.10 versus baseline value. *, p < 0.05 versus baseline value
![Page 195: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/195.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
169
6.11 Figures Figure 1.
![Page 196: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/196.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
170
Figure 2.
![Page 197: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/197.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
171
Figure 3
![Page 198: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/198.jpg)
CHAPITRE VI. The Activation of Signalling Pathways Involved in Muscle Mass Regulation after an Acute Bout of Resistance Training Exercise in Patients with COPD
172
Figure 4
![Page 199: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/199.jpg)
CHAPITRE VII
DISCUSSION GÉNÉRALE
![Page 200: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/200.jpg)
CHAPITRE VII. Discussion générale
174
Cette thèse a pour but d’ajouter aux connaissances de la dysfonction
musculaire périphérique dans la MPOC, en démontrant dans un premier temps,
des mécanismes cellulaires possiblement impliqués dans l’atrophie musculaire
dans cette maladie (chapitre 3 et 4). Dans un deuxième temps, cette thèse s’est
penchée sur l’étude du métabolisme musculaire à la suite d’un exercice en
endurance puisque des altérations métaboliques sont possiblement impliquées
dans l’intolérance à l’exercice dans la MPOC (chapitre 5). Troisièmement, l’étude
de la réponse cellulaire suite à un exercice en résistance pourrait nous aider à
comprendre pourquoi la réponse à l’entraînement en résistance est sous-optimale
chez les patients atteints de la MPOC (chapitre 6). Les résultats de chaque étude ont fait l’objet de discussions spécifiques
dans chacun des articles scientifiques. Par contre, certaines discussions
concernant les principales conclusions de ces études sont de mises dans cette
discussion générale. Étant donné qu’en science, les questions sont presqu’aussi
importantes que les réponses, voici quelques points de discussion qui méritent une
attention spéciale.
Étude 1 (chapitre 3)
Étant donné que la dysfonction des muscles périphériques associée à la
MPOC est liée au stress inflammatoire et au stress oxydant et que la voie de
signalisation des MAPK (p38 MAPK, ERK 1/2 et JNK) est activée lors de ces
stress, nous avions posé l’hypothèse que l’activation des MAPK serait augmentée
dans le quadriceps des patients atteints de MPOC. Nos résultats, tant pour la
phosphorylation que pour les niveaux d’ARNm, ont démontré que les principales
kinases de cette voie de signalisation étaient augmentées dans le quadriceps des
patients atteints de la MPOC. Cette affirmation est appuyée par l’augmentation
d’une E3 ligase, Atrogin1, impliquée dans la dégradation protéique ainsi que par
une augmentation du ratio phosphorylation/protéine totale de la p38 MAPK. À la
lumière de ces résultats, nous pouvons poser la question suivante :
Est-ce que les MAPK jouent un rôle important dans la dysfonction des muscles
périphériques dans la MPOC?
![Page 201: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/201.jpg)
CHAPITRE VII. Discussion générale
175
La littérature abonde concernant l’activation des MAPK dans le muscle
squelettique suite à un stress cellulaire provenant de stress mécanique, oxydant,
et inflammatoire et de même que lors de l’immobilisation (35, 94, 98, 157). Il est
clair que l’activation des MAPK est d’une importance capitale pour la réponse
musculaire aux stress externes. Par contre, les nombreuses influences sur de
multiples facteurs de transcription rendent très compliquée la compréhension de
cette voie de signalisation. Cela étant, l’activation chronique de la voie des MAPK
pourrait être dommageable à long terme dans le cadre d’une pathologie comme la
MPOC (Figure 12).
Figure 12. Mécanismes cellulaires proposés pour la voie des MAPK. Adapté de Kramer et al. 2007 et de Gehart et al. 2010.
Adapté de Kramer et al. 2007 et de Gehart et al. 2010 (64, 98)
Dans le cadre de notre étude où aucun stimulus externe n’a été appliqué à
nos patients, nous pourrions conclure que l’augmentation de la phosphorylation et
des niveaux d’ARNm des MAPK dans le quadriceps des patients MPOC pourraient
![Page 202: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/202.jpg)
CHAPITRE VII. Discussion générale
176
être causées par une exposition chronique à un stress cellulaire non défini jusqu’à
présent. Cependant, la littérature ne cesse de produire des données incriminant
les MAPK dans le processus atrophique (voir chapitre 3). Par exemple, la p38
MAPK est un médiateur important dans la réponse au stress oxydant qui induit
l'expression des gènes d’Atrogin1 et MuRF ainsi que l’activité du protéasome, ce
qui favorise une dégradation des cellules musculaires (90, 114). Notre étude ne
permet pas de cibler spécifiquement l’implication des MAPK dans le
développement de la dysfonction musculaire chez la MPOC mais servira
certainement à stimuler la recherche sur cette voie de signalisation et sur ses
impacts dans le muscle squelettique. Des études futures comparant la réponse
des MAPK aux effets aigus versus chroniques seront de mise pour élucider la
contribution exacte des MAPK.
Étude 2 (chapitre 4)
Étant donné qu’il n’existe pas de consensus sur le fait que l’inflammation
soit présente ou pas dans les muscles périphériques des patients atteints de
MPOC et qu’il n’existe pas de biomarqueur de la dysfonction musculaire pour cette
maladie, nous avions posé l’hypothèse que le SAA1 pourrait être augmenté dans
le quadriceps des patients atteints de la MPOC. Celui-ci pourrait être une des
causes de la dysfonction des muscles périphériques chez ces patients. Nos
résultats tant au niveau de l’expression des gènes que des niveaux d’ARNm
démontrent une augmentation de SAA1 dans le quadriceps des patients atteints de
la MPOC. Tant nos groupes expérimentaux (analyse génétique et
transcriptionnelle) que nos groupes de validation ont démontré que l’expression du
SAA1 était élevée de façon significative dans le muscle des patients atteints de la
MPOC. De plus, nous avons présenté les données préliminaires de sept (7)
patients MPOC présentant une exacerbation qui font état d’une fulgurante
expression du SAA1. Le SAA1 est aussi plus spécifique et sensible que la CRP
pendant les épisodes d’exacerbations et le lien avec l’apparition du SAA1 dans le
sang et la sévérité de l’exacerbation chez la MPOC a déjà été établi (23). De plus,
SAA1 a été associé à plusieurs maladies inflammatoires et aux infections virales,
![Page 203: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/203.jpg)
CHAPITRE VII. Discussion générale
177
incluant les infections respiratoires (124, 205, 223). Comme l’étude du chapitre 4
l’a clairement établi, il est d’une importance capitale de déterminer son influence
spécifique sur les voies de signalisation et ainsi déterminer son action sur la
physiologie humaine, plus spécifiquement dans le cadre de cette thèse, le muscle
squelettique. SAA1 a récemment été rapporté comme jouant un rôle dans la
dégradation protéique (224) pouvant contribuer à la cachexie (19). Des études
mécanistiques sont présentement en cours dans notre laboratoire pour déterminer
son influence sur des voies de signalisation spécifiques.
Est-ce que le SAA1 joue un rôle important dans la dysfonction des muscles
périphériques dans la MPOC?
SAA1 est encore très peu connu, mais les données préliminaires
accumulées par plusieurs groupes de recherche sur différentes cohortes de
patients sont très convaincantes. Des données préliminaires (non présentées dans
cette thèse, voir figure en Annexe A) démontrent que l’expression d’Atrogin1 et
MuRF impliqués dans la dégradation protéique sont induits par le SAA1 en culture
cellulaire chez des myotubes C2C12. À date, aucune cytokine inflammatoire n’a
démontré d’élévation plus convaincante que SAA1 dans le quadriceps des patients
atteints de la MPOC. Le futur nous dira si SAA1 est simplement un marqueur
inflammatoire ou un joueur important dans la pathogène de la dysfonction
périphérique dans la MPOC.
Étude 3 (chapitre 5)
Étant donné que l’intolérance à l’exercice est un problème majeur dans la
MPOC et que celle-ci est reliée à un désordre métabolique des muscles
périphériques, nous avons posé l’hypothèse que lors d’un exercice fait jusqu’à
épuisement, les produits de la glycolyse seraient égaux ou plus élevés chez des
patients MPOC en comparaison avec des sujets sains appariés pour l’âge et ce
malgré une intensité et une durée d’exercice plus courtes. Nos résultats
démontrent qu’un exercice fait sur ergocycle jusqu’à épuisement induit des
changements métaboliques et de substrats énergétiques d’importance dans le
![Page 204: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/204.jpg)
CHAPITRE VII. Discussion générale
178
quadriceps des patients atteints de la MPOC. Ces changements étaient similaires
en comparaison avec les sujets sains, mais sont survenus plus rapidement, et ce,
pour une intensité considérablement plus faible. En tenant compte du ratio
d’utilisation du glycogène et de production du lactate par unité de travail, il semble
que les patients atteints de la MPOC aient une plus grande dépendance à la
glycolyse pendant l’exercice, ce qui pourrait contribuer à l’intolérance à l’exercice
chez cette population. Une revue de la littérature sur la dysfonction des muscles
périphériques chez la MPOC en 2009 démontrait que la plupart des anomalies
musculaires tant au niveau clinique (réduction de l’endurance, augmentation de la
fatigue), structural (réduction des capillaires sanguins) que métabolique (diminution
des enzymes oxydatifs) étaient associées à une réduction de la capacité oxydative
du muscle squelettique dans la MPOC. Par contre, jusqu’ici le métabolisme
glycolytique a peu été étudié dans la MPOC (129).
Est-ce que le métabolisme glycolytique joue un rôle important dans l’intolérance à
l’exercice en endurance dans la MPOC?
Nos résultats démontrent une tendance de compensation énergétique vers
la glycolyse, du moins pour un effort fait jusqu’à épuisement, dans le muscle des
patients atteints de la MPOC. Nous proposons donc que ceci pourrait contribuer à
l’intolérance à l’exercice dans la MPOC puisque pour un exercice sous-maximal,
une plus grande dépendance au système glycolytique est associée à une plus
grande accumulation de lactate sanguin et à la formation d’acidose musculaire
(174) se traduisant par une cessation précoce de l’exercice. Ce phénomène
pourrait être causé par le changement de fibres musculaires de type I (oxydatives)
vers des fibres de type II (glycolytiques) et/ou par un mécanisme compensatoire dû
au fait que la capacité oxydative musculaire est réduite dans la MPOC.
Étude 4 (chapitre 6)
Étant donné que la faiblesse et la perte de masse maigre sont des
conséquences majeures de la MPOC influençant grandement la survie et la qualité
de vie des patients et que l’exercice en résistance, connu pour améliorer la force et
la masse musculaire, ne semble pas produire d’aussi bons résultats chez les
![Page 205: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/205.jpg)
CHAPITRE VII. Discussion générale
179
patients atteints de la MPOC par rapport à des individus sains, nous avons posé
l’hypothèse que la réponse moléculaire et cellulaire à l’exercice en résistance
serait différente chez les patients MPOC en comparaison avec des sujets sains
appariés pour l’âge. Nos résultats démontrent que les protéines associées à la
synthèse protéique (p70s6k, AKT) sont augmentées de façon significative par un
exercice musculaire chez les sujets sains alors qu’elles ne le sont pas chez les
patients MPOC. De plus, les MAPK, connues pour être modulées avec l’exercice,
semblent être diminuées chez des patients MPOC après l’exercice en
comparaison avec les sujets sains. De plus, les facteurs inflammatoires
normalement augmentés avec l’exercice en résistance l’étaient dans les deux
groupes, démontrant que le stress inflammatoire est présent après l’exercice chez
les patients MPOC, mais que la réponse des protéines clés ne semble pas être
semblable à celle des sujets sains.
Est-ce que la signalisation intramusculaire joue un rôle important dans la réponse
inadéquate des patients MPOC à l’exercice en résistance ?
Les anomalies de la signalisation musculaire dans les muscles
périphériques des patients atteints de la MPOC sont de plus en plus rapportées et
répertoriées. Que ce soit au niveau métabolique ou structural, la biochimie
musculaire est certainement affectée par la maladie. Les E3 ligases sont
augmentées (49, 110, 153), les MAPK sont modulées (110, 166), les transporteurs
glycogéniques (75) sont diminués et la signalisation IGF-1/AKT semble être
défectueuse (49). La signalisation intramusculaire dans la MPOC est certainement
influencée par une ou des sources de stress cellulaire encore méconnues. Une
des plus frappantes comparaisons en ce qui a trait à la réponse moléculaire et
cellulaire peut être faite avec l’étude de Williamson et al. 2003 (219). Ces auteurs
démontrent que la p38 MAPK, ERK1/2 et JNK sont légèrement augmentés dans le
muscle au repos de personnes plus âgées en comparaison avec des sujets plus
jeunes. Après une session d’exercice en résistance, la phosphorylation des MAPK
est légèrement augmentée dans le muscle des jeunes mais est diminuée dans le
![Page 206: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/206.jpg)
CHAPITRE VII. Discussion générale
180
muscle des sujets plus âgés. Cette réponse est similaire à ce que nous avons
démontré dans notre étude (chapitre 6). Étant donné que nos participants à l’étude
étaient tous appariés pour l’âge, nous émettons l’hypothèse que le muscle MPOC
se comporte comme s’il était victime d’un vieillissement prématuré en comparaison
avec les sujets sains. D’autre part, il semble que nos sujets sains répondent de
façon classique à l’exercice en résistance avec une augmentation de la
phosphorylation des protéines pro-synthèse alors qu’aucun changement n’a pu
être observé dans notre groupe de MPOC. Il sera important de poursuivre ce type
d’investigation, mais à plus long terme, pour mettre en relation les gains de masse
maigre et de force avec les changements biochimiques obtenus avec l’exercice en
résistance dans la MPOC. La poursuite de telles études permettra de mieux
comprendre la réponse à l’exercice dans la MPOC mais aussi d’établir de
nouvelles façons de s’entraîner en réhabilitation musculaire afin d’améliorer la
survie et la qualité de vie de nos patients.
![Page 207: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/207.jpg)
CHAPITRE VIII
CONCLUSIONS ET PERSPECTIVES
![Page 208: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/208.jpg)
CHAPITRE VIII. Conclusions et perspectives
182
Ma contribution, aussi petite soit-elle, au monde de la science se résume
simplement aux travaux présentés dans cette thèse, mais ont permis d’illustrer
que:
Les kinases p38 MAPK, ERK 1/2 et JNK, membres de la grande famille des
MAPK, semblent être activées de façon chronique dans le quadriceps des patients
atteints de la MPOC;
Les niveaux d’ARNm de l’apolipoprotéine SAA1, une protéine de phase
aiguë, est augmentée de façon importante dans le quadriceps des patients atteints
de la MPOC;
Les patients présentant une MPOC démontrent une perturbation
métabolique lors d’exercice en endurance fait jusqu’à épuisement et ce, en
démontrant une plus grande dépendance au système glycolytique;
Les patients présentant une MPOC possèdent une réponse cellulaire
différente à l’exercice en résistance en comparaison aux sujets sains. Les patients
ont une moins bonne réponse des protéines qui sont impliquées dans la
modulation de la masse musculaire.
Ces découvertes amènent plus de questions que de réponses, mais n’est-
ce pas le but d’un doctorat! Plusieurs perspectives découlent de ces travaux. En
particulier, un lien intéressant peut être fait entre les études 1 et 2. L’étude 1
(chapitre 3) fait la démonstration que les MAPK sont élevées dans le quadriceps
de patients MPOC, témoignant ainsi d’une signalisation musculaire anormale au
repos chez les patients MPOC. Le stress oxydant, l’inflammation, le traitement
pharmacologique, l’inactivité musculaire et même le stress mécanique sont parmi
les causes possibles pour expliquer ce dérangement de la signalisation musculaire
dans la MPOC.
Alors voilà que l’étude 2 (chapitre 4) nous fait découvrir un facteur qui
pourrait être important dans le développement de la dysfonction des muscles
périphériques dans la MPOC. Les niveaux de SAA1 qui est augmentée dans le
quadriceps de plusieurs groupes de patients MPOC pourrait avoir des influences
sur les voies de signalisation cellulaire impliquées dans la dysfonction des muscles
![Page 209: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/209.jpg)
CHAPITRE VIII. Conclusions et perspectives
183
périphériques chez cette population. Étant donné que les études 1 et 2 sont
principalement descriptives, ces découvertes fortuites mèneront à plusieurs études
mécanistiques en culture cellulaire servant à démontrer l’implication du SAA1 dans
la dégradation protéique et son influence dans le développement de la
myogenèse. Entre autres, nous voulons évaluer l’influence qu’aurait SAA1 sur la
voie de signalisation des MAPK, IGF-1/AKT, JAK/STAT et la myostatine, tous
ayant un rôle d’important dans la biochimie du muscle squelettique.
Les études 3 et 4 (chapitre 5 et 6) démontrent bien une différence de la
réponse cellulaire et moléculaire à l’exercice en endurance et en résistance chez
les patients MPOC. Cela dit, une perspective intéressante sera d’évaluer les
changements métaboliques et signalétiques après un entraînement à long terme
pour ainsi apprécier l’impact des différentes réponses biochimiques sur les
résultats cliniques des patients atteints de la MPOC. Est-ce qu’une signalisation
pro-synthèse réduite après l’exercice chez les patients MPOC pourrait expliquer
une moins bonne prise de masse maigre ou de force musculaire? Est-ce qu’un
entraînement en endurance à long terme pourrait faire en sorte que le système
glycolytique serait moins utilisé et donc permette une meilleure tolérance à
l’exercice?
Évidemment, plusieurs autres questions pourraient être posées. Cependant,
il y a un point important qui constamment est revenu tout au long de mes études
doctorales. C’est l’inactivité physique et la sédentarité des patients MPOC. Après
mes 4 ans de doctorat, je me rends à l’évidence que l’inactivité physique est peut-
être le point le plus important à considérer non seulement dans la MPOC mais
dans toutes autres maladies chroniques. La littérature abonde de données qui
s’apparentent aux données dans la MPOC, tant au niveau systémique, musculaire
que cardiovasculaire, incriminant l’inactivité physique comme cause première des
dysfonctionnements métaboliques et signalétiques chez l’humain. Cela dit, des
efforts ont été déployés dans tous mes travaux afin d’apparier les patients MPOC à
des sujets témoins pour le niveau d’activité physique. Les patients atteints de
![Page 210: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/210.jpg)
CHAPITRE VIII. Conclusions et perspectives
184
MPOC sont grandement sédentaires et je spéculerai qu’au-delà de l’atteinte
primaire aux poumons, de l’inflammation systémique, du traitement
pharmacologique et du stress oxydant, c’est le bas niveau d’activité physique qui
amène, à mon avis, les plus grandes détériorations physiologiques dans la MPOC.
Cette question perdure depuis longtemps, elle ne cessera jamais d’être présente et
elle devrait servir, comme elle l’est présentement, de base primordiale non
seulement de prévention mais aussi de traitement global de la MPOC.
Le défi demeurera toujours de changer les habitudes de vie sédentaire des
patients atteints de la MPOC.
![Page 211: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/211.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
185
RÉFÉRENCES 1. Akimoto T, Pohnert SC, Li P, Zhang M, Gumbs C, Rosenberg PB, Williams RS, and Yan Z. Exercise stimulates Pgc-1alpha transcription in skeletal muscle through activation of the p38 MAPK pathway. J Biol Chem 280: 19587-19593, 2005. 2. Allaire J, Maltais F, Doyon JF, Noel M, LeBlanc P, Carrier G, Simard C, and Jobin J. Peripheral muscle endurance and the oxidative profile of the quadriceps in patients with COPD. Thorax 59: 673-678, 2004. 3. Allen DG, Lamb GD, and Westerblad H. Skeletal muscle fatigue: cellular mechanisms. Physiol Rev 88: 287-332, 2008. 4. Argiles JM, and Lopez-Soriano FJ. The role of cytokines in cancer cachexia. Med Res Rev 19: 223-248, 1999. 5. Association TCL. COPD and smoking survey results. 2007. 6. Baar K. Training for endurance and strength: lessons from cell signaling. Med Sci Sports Exerc 38: 1939-1944, 2006. 7. Baar K, Blough E, Dineen B, and Esser K. Transcriptional regulation in response to exercise. Exerc Sport Sci Rev 27: 333-379, 1999. 8. Bajotto G, and Shimomura Y. Determinants of disuse-induced skeletal muscle atrophy: exercise and nutrition countermeasures to prevent protein loss. J Nutr Sci Vitaminol (Tokyo) 52: 233-247, 2006. 9. Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 343: 269-280, 2000. 10. Barnes PJ, and Celli BR. Systemic manifestations and comorbidities of COPD. Eur Respir J 33: 1165-1185, 2009. 11. Barnes PJ, Shapiro SD, and Pauwels RA. Chronic obstructive pulmonary disease: molecular and cellularmechanisms. European Respiratory Journal 22: 672-688, 2003. 12. Barreiro E, Schols AM, Polkey MI, Galdiz JB, Gosker HR, Swallow EB, Coronell C, and Gea J. Cytokine profile in quadriceps muscles of patients with severe COPD. Thorax 63: 100-107, 2008. 13. Bernard S, LeBlanc P, Whittom F, Carrier G, Jobin J, Belleau R, and Maltais F. Peripheral muscle weakness in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 158: 629-634, 1998. 14. Bernard S, Whittom F, Leblanc P, Jobin J, Belleau R, Berube C, Carrier G, and Maltais F. Aerobic and strength training in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 159: 896-901, 1999. 15. Bianchi R, Gigliotti F, Romagnoli I, Lanini B, Castellani C, Binazzi B, Stendardi L, Bruni GI, and Scano G. Impact of a rehabilitation program on dyspnea intensity and quality in patients with chronic obstructive pulmonary disease. Respiration 81: 186-195, 2011. 16. Bickel CS, Slade J, Mahoney E, Haddad F, Dudley GA, and Adams GR. Time course of molecular responses of human skeletal muscle to acute bouts of resistance exercise. J Appl Physiol 98: 482-488, 2005.
![Page 212: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/212.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
186
17. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, and Glass DJ. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294: 1704-1708, 2001. 18. Bolster DR, Kubica N, Crozier SJ, Williamson DL, Farrell PA, Kimball SR, and Jefferson LS. Immediate response of mammalian target of rapamycin (mTOR)-mediated signalling following acute resistance exercise in rat skeletal muscle. J Physiol 553: 213-220, 2003. 19. Bonetto A, Aydogdu T, Kunzevitzky N, Guttridge DC, Khuri S, Koniaris LG, and Zimmers TA. STAT3 activation in skeletal muscle links muscle wasting and the acute phase response in cancer cachexia. PLoS One 6: e22538, 2011. 20. Booth FW, Chakravarthy MV, and Spangenburg EE. Exercise and gene expression: physiological regulation of the human genome through physical activity. J Physiol 543: 399-411, 2002. 21. Bossenbroek L, de Greef MH, Wempe JB, Krijnen WP, and Ten Hacken NH. Daily physical activity in patients with chronic obstructive pulmonary disease: a systematic review. COPD 8: 306-319, 2011. 22. Bourdin A, Burgel PR, Chanez P, Garcia G, Perez T, and Roche N. Recent advances in COPD: pathophysiology, respiratory physiology and clinical aspects, including comorbidities. Eur Respir Rev 18: 198-212, 2009. 23. Bozinovski S, Hutchinson A, Thompson M, Macgregor L, Black J, Giannakis E, Karlsson AS, Silvestrini R, Smallwood D, Vlahos R, Irving LB, and Anderson GP. Serum amyloid a is a biomarker of acute exacerbations of chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 177: 269-278, 2008. 24. Buck M, and Chojkier M. Muscle wasting and dedifferentiation induced by oxidative stress in a murine model of cachexia is prevented by inhibitors of nitric oxide synthesis and antioxidants. Embo J 15: 1753-1765, 1996. 25. Buford TW, Cooke MB, and Willoughby DS. Resistance exercise-induced changes of inflammatory gene expression within human skeletal muscle. Eur J Appl Physiol 107: 463-471, 2009. 26. Buist AS, McBurnie MA, Vollmer WM, Gillespie S, Burney P, Mannino DM, Menezes AM, Sullivan SD, Lee TA, Weiss KB, Jensen RL, Marks GB, Gulsvik A, and Nizankowska-Mogilnicka E. International variation in the prevalence of COPD (the BOLD Study): a population-based prevalence study. Lancet 370: 741-750, 2007. 27. Canada PHAo. Public Health Agency of Canada. Life and Breath: Respiratory Diseases in Canada. edited by Canada PHAo. Ottawa: 2007. 28. Cannon JG, and St Pierre BA. Cytokines in exertion-induced skeletal muscle injury. Mol Cell Biochem 179: 159-167, 1998. 29. Caron MA, Debigare R, Dekhuijzen PN, and Maltais F. Comparative assessment of the quadriceps and the diaphragm in patients with COPD. J Appl Physiol 107: 952-961, 2009.
![Page 213: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/213.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
187
30. Casaburi R, Bhasin S, Cosentino L, Porszasz J, Somfay A, Lewis MI, Fournier M, and Storer TW. Effects of testosterone and resistance training in men with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 170: 870-878, 2004. 31. Celli BR, Cote CG, Marin JM, Casanova C, Montes de Oca M, Mendez RA, Pinto Plata V, and Cabral HJ. The body-mass index, airflow obstruction, dyspnea, and exercise capacity index in chronic obstructive pulmonary disease. N Engl J Med 350: 1005-1012, 2004. 32. Celli BR, and MacNee W. Standards for the diagnosis and treatment of patients with COPD: a summary of the ATS/ERS position paper. Eur Respir J 23: 932-946, 2004. 33. Chang L, and Karin M. Mammalian MAP kinase signalling cascades. Nature 410: 37-40, 2001. 34. Chapman KR, Bourbeau J, and Rance L. The burden of COPD in Canada: results from the Confronting COPD survey. Respiratory Medicine 97 Suppl C: S23-31, 2003. 35. Childs TE, Spangenburg EE, Vyas DR, and Booth FW. Temporal alterations in protein signaling cascades during recovery from muscle atrophy. Am J Physiol Cell Physiol 285: C391-398, 2003. 36. Coffey VG, and Hawley JA. The molecular bases of training adaptation. Sports Med 37: 737-763, 2007. 37. Couillard A, Maltais F, Saey D, Debigare R, Michaud A, Koechlin C, LeBlanc P, and Prefaut C. Exercise-induced quadriceps oxidative stress and peripheral muscle dysfunction in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 167: 1664-1669, 2003. 38. Couillard A, and Prefaut C. From muscle disuse to myopathy in COPD: potential contribution of oxidative stress. Eur Respir J 26: 703-719, 2005. 39. Couillard A, and Préfaut C. From muscle disuse to myopathy in COPD: potential contribution of oxidative stress. EurRespirJ 26: 703-719, 2005. 40. Das AM, Steuerwald U, and Illsinger S. Inborn errors of energy metabolism associated with myopathies. J Biomed Biotechnol 2010: 340849, 2010. 41. Debigare R, Marquis K, Cote CH, Tremblay RR, Michaud A, LeBlanc P, and Maltais F. Catabolic/anabolic balance and muscle wasting in patients with COPD. Chest 124: 83-89, 2003. 42. Decramer M, Gosselink R, Troosters T, Verschueren M, and Evers G. Muscle weakness is related to utilization of health care resources in COPD patients. Eur Respir J 10: 417-423, 1997. 43. Deldicque L, Atherton P, Patel R, Theisen D, Nielens H, Rennie MJ, and Francaux M. Decrease in Akt/PKB signalling in human skeletal muscle by resistance exercise. Eur J Appl Physiol 104: 57-65, 2008. 44. Deldicque L, Theisen D, and Francaux M. Regulation of mTOR by amino acids and resistance exercise in skeletal muscle. Eur J Appl Physiol 94: 1-10, 2005.
![Page 214: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/214.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
188
45. Di Francia M, Barbier D, Mege JL, and Orehek J. Tumor necrosis factor-alpha levels and weight loss in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 150: 1453-1455, 1994. 46. Di Giovanni S, Molon A, Broccolini A, Melcon G, Mirabella M, Hoffman EP, and Servidei S. Constitutive activation of MAPK cascade in acute quadriplegic myopathy. Ann Neurol 55: 195-206, 2004. 47. Divo M, Cote C, de Torres JP, Casanova C, Marin JM, Pinto-Plata V, Zulueta J, Cabrera C, Zagaceta J, Hunninghake G, and Celli B. Comorbidities and Risk of Mortality in Patients with COPD. American Journal of Respiratory and Critical Care Medicine 2012. 48. Domej W, Foldes-Papp Z, Flogel E, and Haditsch B. Chronic obstructive pulmonary disease and oxidative stress. Curr Pharm Biotechnol 7: 117-123, 2006. 49. Doucet M, Russell AP, Leger B, Debigare R, Joanisse DR, Caron MA, LeBlanc P, and Maltais F. Muscle atrophy and hypertrophy signaling in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 176: 261-269, 2007. 50. Dreyer HC, Blanco CE, Sattler FR, Schroeder ET, and Wiswell RA. Satellite cell numbers in young and older men 24 hours after eccentric exercise. Muscle Nerve 33: 242-253, 2006. 51. Dreyer HC, Fujita S, Cadenas JG, Chinkes DL, Volpi E, and Rasmussen BB. Resistance exercise increases AMPK activity and reduces 4E-BP1 phosphorylation and protein synthesis in human skeletal muscle. J Physiol 576: 613-624, 2006. 52. Eid AA, Ionescu AA, Nixon LS, Lewis-Jenkins V, Matthews SB, Griffiths TL, and Shale DJ. Inflammatory response and body composition in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 164: 1414-1418, 2001. 53. Engelen MP, Schols AM, Does JD, Deutz NE, and Wouters EF. Altered glutamate metabolism is associated with reduced muscle glutathione levels in patients with emphysema. American Journal of Respiratory and Critical Care Medicine 161: 98-103, 2000. 54. Essen B. Intramuscular substrate utilization during prolonged exercise. Ann N Y Acad Sci 301: 30-44, 1977. 55. Fabbri LM, and Rabe KF. From COPD to chronic systemic inflammatory syndrome? Lancet 370: 797-799, 2007. 56. Farrell PA JM, Caiozzo VJ. Advanced Exercise Physiology. Baltimore, MD: Wolters Kluwer, 2012. 57. Fearon KC, Glass DJ, and Guttridge DC. Cancer Cachexia: Mediators, Signaling, and Metabolic Pathways. Cell Metab 2012. 58. Felig P, and Wahren J. Fuel homeostasis in exercise. N Engl J Med 293: 1078-1084, 1975. 59. Fingar DC, and Blenis J. Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 23: 3151-3171, 2004.
![Page 215: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/215.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
189
60. Franssen FM, Broekhuizen R, Janssen PP, Wouters EF, and Schols AM. Limb muscle dysfunction in COPD: effects of muscle wasting and exercise training. Med Sci Sports Exerc 37: 2-9, 2005. 61. Franssen FM, Wouters EF, and Schols AM. The contribution of starvation, deconditioning and ageing to the observed alterations in peripheral skeletal muscle in chronic organ diseases. Clin Nutr 21: 1-14, 2002. 62. Freyssenet D. Mécanismes cellulaires et moléculaires du contrôle de la masse musculaire lors d'un entraînement en force. Science & Sports 21: 74-79, 2006. 63. Galetic I, Maira SM, Andjelkovic M, and Hemmings BA. Negative regulation of ERK and Elk by protein kinase B modulates c-Fos transcription. J Biol Chem 278: 4416-4423, 2003. 64. Gehart H, Kumpf S, Ittner A, and Ricci R. MAPK signalling in cellular metabolism: stress or wellness? EMBO Rep 11: 834-840, 2010. 65. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 37: 1974-1984, 2005. 66. Global-Initiative-for-Chronic-Obstructive-Lung-Disease. Global strategy for the diagnosis_management and prevention of chronic obstructive pulmonary disease. 2006. 67. Gollnick PD, Piehl K, and Saltin B. Selective glycogen depletion pattern in human muscle fibres after exercise of varying intensity and at varying pedalling rates. J Physiol 241: 45-57, 1974. 68. Gomes MD, Lecker SH, Jagoe RT, Navon A, and Goldberg AL. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci U S A 98: 14440-14445, 2001. 69. Gosker HR, Schrauwen P, Hesselink MK, Schaart G, van der Vusse GJ, Wouters EF, and Schols AM. Uncoupling protein-3 content is decreased in peripheral skeletal muscle of patients with COPD. Eur Respir J 22: 88-93, 2003. 70. Gosker HR, van Mameren H, van Dijk PJ, Engelen MPKJ, van der Vusse GJ, Wouters EFM, and Schols AMWJ. Skeletal muscle fibre-type shifting and metabolic profile in patients with chronic obstructive pulmonary disease. European Respiratory Journal 19: 617-625, 2002. 71. Gosselink R, Troosters T, and Decramer M. Peripheral muscle weakness contributes to exercise limitation in COPD. American Journal of Respiratory and Critical Care Medicine 153: 976-980, 1996. 72. Gouzi F, Préfaut C, Abdellaoui A, Vuillemin A, Molinari N, Ninot G, Caris G, and Hayot M. Evidence of an early physical activity reduction in chronic obstructive pulmonary disease patients. ArchPhysMedRehabil 92: 1611-1617, 2011. 73. Goven D, Boutten A, Lecon-Malas V, Marchal-Somme J, Amara N, Crestani B, Fournier M, Leseche G, Soler P, Boczkowski J, and Bonay M. Altered Nrf2/Keap1-Bach1 equilibrium in pulmonary emphysema. Thorax 63: 916-924, 2008. 74. Green HJ. Mechanisms of muscle fatigue in intense exercise. Journal of Sports Sciences 15: 247-256, 1997.
![Page 216: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/216.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
190
75. Green HJ, Burnett ME, D'Arsigny CL, O'Donnell DE, Ouyang J, and Webb KA. Altered metabolic and transporter characteristics of vastus lateralis in chronic obstructive pulmonary disease. J Appl Physiol 105: 879-886, 2008. 76. Greiwe JS, Cheng B, Rubin DC, Yarasheski KE, and Semenkovich CF. Resistance exercise decreases skeletal muscle tumor necrosis factor alpha in frail elderly humans. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15: 475-482, 2001. 77. Griffiths TL, Burr ML, Campbell IA, Lewis-Jenkins V, Mullins J, Shiels K, Turner-Lawlor PJ, Payne N, Newcombe RG, Ionescu AA, Thomas J, and Tunbridge J. Results at 1 year of outpatient multidisciplinary pulmonary rehabilitation: a randomised controlled trial. Lancet 355: 362-368, 2000. 78. Hamilton AL, Killian KJ, Summers E, and Jones NL. Muscle strength, symptom intensity, and exercise capacity in patients with cardiorespiratory disorders. Am J Respir Crit Care Med 152: 2021-2031, 1995. 79. Hara K, Yonezawa K, Weng QP, Kozlowski MT, Belham C, and Avruch J. Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4E BP1 through a common effector mechanism. J Biol Chem 273: 14484-14494, 1998. 80. Harris TE, Chi A, Shabanowitz J, Hunt DF, Rhoads RE, and Lawrence JC, Jr. mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin. Embo J 25: 1659-1668, 2006. 81. Hayat S, and Raynes JG. Acute phase serum amyloid A protein increases high density lipoprotein binding to human peripheral blood mononuclear cells and an endothelial cell line. Scand J Immunol 51: 141-146, 2000. 82. Hazzalin CA, and Mahadevan LC. MAPK-regulated transcription: a continuously variable gene switch? Nat Rev Mol Cell Biol 3: 30-40, 2002. 83. Hilleman DE, Dewan N, Malesker M, and Friedman M. Pharmacoeconomic evaluation of COPD. Chest 118: 1278-1285, 2000. 84. Hornberger TA, and Esser KA. Mechanotransduction and the regulation of protein synthesis in skeletal muscle. Proc Nutr Soc 63: 331-335, 2004. 85. Ishihara A, Roy RR, Ohira Y, and Edgerton VR. Motoneuron and sensory neuron plasticity to varying neuromuscular activity levels. Exerc Sport Sci Rev 30: 152-158, 2002. 86. Jackman RW, and Kandarian SC. The molecular basis of skeletal muscle atrophy. Am J Physiol Cell Physiol 287: C834-843, 2004. 87. Jakobsson P, Jorfeldt L, and Henriksson J. Metabolic enzyme activity in the quadriceps femoris muscle in patients with severe chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 151: 374-377, 1995. 88. James AL, and Wenzel S. Clinical relevance of airway remodelling in airway diseases. Eur Respir J 30: 134-155, 2007. 89. Jensen ON. Interpreting the protein language using proteomics. Nat Rev Mol Cell Biol 7: 391-403, 2006. 90. Jin B, and Li YP. Curcumin prevents lipopolysaccharide-induced atrogin-1/MAFbx upregulation and muscle mass loss. J Cell Biochem 100: 960-969, 2007.
![Page 217: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/217.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
191
91. Jobin J, Maltais F, Doyon JF, LeBlanc P, Simard PM, Simard AA, and Simard C. Chronic obstructive pulmonary disease: capillarity and fiber-type characteristics of skeletal muscle. J Cardiopulm Rehabil 18: 432-437, 1998. 92. Karlsson HK, Nilsson PA, Nilsson J, Chibalin AV, Zierath JR, and Blomstrand E. Branched-chain amino acids increase p70S6k phosphorylation in human skeletal muscle after resistance exercise. Am J Physiol Endocrinol Metab 287: E1-7, 2004. 93. Killian KJ, Leblanc P, Martin DH, Summers E, Jones NL, and Campbell EJ. Exercise capacity and ventilatory, circulatory, and symptom limitation in patients with chronic airflow limitation. Am Rev Respir Dis 146: 935-940, 1992. 94. Kim J, Won KJ, Lee HM, Hwang BY, Bae YM, Choi WS, Song H, Lim KW, Lee CK, and Kim B. p38 MAPK Participates in Muscle-Specific RING Finger 1-Mediated Atrophy in Cast-Immobilized Rat Gastrocnemius Muscle. Korean J Physiol Pharmacol 13: 491-496, 2009. 95. Kimball SR, Farrell PA, and Jefferson LS. Invited Review: Role of insulin in translational control of protein synthesis in skeletal muscle by amino acids or exercise. J Appl Physiol 93: 1168-1180, 2002. 96. Kondo H, Miura M, and Itokawa Y. Antioxidant enzyme systems in skeletal muscle atrophied by immobilization. Pflugers Arch 422: 404-406, 1993. 97. Kondo H, Nakagaki I, Sasaki S, Hori S, and Itokawa Y. Mechanism of oxidative stress in skeletal muscle atrophied by immobilization. Am J Physiol 265: E839-844, 1993. 98. Kramer HF, and Goodyear LJ. Exercise, MAPK, and NF-kappaB signaling in skeletal muscle. J Appl Physiol 103: 388-395, 2007. 99. Kubica N, Kimball SR, Jefferson LS, and Farrell PA. Alterations in the expression of mRNAs and proteins that code for species relevant to eIF2B activity after an acute bout of resistance exercise. J Appl Physiol 96: 679-687, 2004. 100. Kutsuzawa T, Shioya S, Kurita D, Haida M, Ohta Y, and Yamabayashi H. Muscle energy metabolism and nutritional status in patients with chronic obstructive pulmonary disease. A 31P magnetic resonance study. American Journal of Respiratory and Critical Care Medicine 152: 647-652, 1995. 101. Lacasse Y, Goldstein R, Lasserson TJ, and Martin S. Pulmonary rehabilitation for chronic obstructive pulmonary disease. Cochrane Database Syst Rev CD003793, 2006. 102. Ladner KJ, Caligiuri MA, and Guttridge DC. Tumor necrosis factor-regulated biphasic activation of NF-kappa B is required for cytokine-induced loss of skeletal muscle gene products. J Biol Chem 278: 2294-2303, 2003. 103. Lai KM, Gonzalez M, Poueymirou WT, Kline WO, Na E, Zlotchenko E, Stitt TN, Economides AN, Yancopoulos GD, and Glass DJ. Conditional activation of akt in adult skeletal muscle induces rapid hypertrophy. Mol Cell Biol 24: 9295-9304, 2004. 104. Lambert CP, Wright NR, Finck BN, and Villareal DT. Exercise but not diet-induced weight loss decreases skeletal muscle inflammatory gene expression in frail obese elderly persons. J Appl Physiol 105: 473-478, 2008.
![Page 218: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/218.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
192
105. Langen RC, Schols AM, Kelders MC, Wouters EF, and Janssen-Heininger YM. Inflammatory cytokines inhibit myogenic differentiation through activation of nuclear factor-kappaB. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15: 1169-1180, 2001. 106. Lecker SH. Ubiquitin-protein ligases in muscle wasting: multiple parallel pathways? Current Opinion in Clinical Nutrition and Metabolic Care 6: 271-275, 2003. 107. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, and Goldberg AL. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. Faseb J 18: 39-51, 2004. 108. Lee SJ. Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20: 61-86, 2004. 109. Leger B, Cartoni R, Praz M, Lamon S, Deriaz O, Crettenand A, Gobelet C, Rohmer P, Konzelmann M, Luthi F, and Russell AP. Akt signalling through GSK-3beta, mTOR and Foxo1 is involved in human skeletal muscle hypertrophy and atrophy. J Physiol 576: 923-933, 2006. 110. Lemire BB, Debigare R, Dube A, Theriault ME, Cote CH, and Maltais F. MAPK signaling in the quadriceps of patients with chronic obstructive pulmonary disease. J Appl Physiol 113: 159-166, 2012. 111. Levine S, Gregory C, Nguyen T, Shrager J, Kaiser L, Rubinstein N, and Dudley G. Bioenergetic adaptation of individual human diaphragmatic myofibers to severe COPD. J Appl Physiol 92: 1205-1213, 2002. 112. Levine S, Kaiser L, Leferovich J, and Tikunov B. Cellular adaptations in the diaphragm in chronic obstructive pulmonary disease. N Engl J Med 337: 1799-1806, 1997. 113. Levine S, Nguyen T, Kaiser LR, Rubinstein NA, Maislin G, Gregory C, Rome LC, Dudley GA, Sieck GC, and Shrager JB. Human diaphragm remodeling associated with chronic obstructive pulmonary disease: clinical implications. American Journal of Respiratory and Critical Care Medicine 168: 706-713, 2003. 114. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, and Reid MB. TNF-alpha acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle. Faseb J 19: 362-370, 2005. 115. Li YP, Schwartz RJ, Waddell ID, Holloway BR, and Reid MB. Skeletal muscle myocytes undergo protein loss and reactive oxygen-mediated NF-kappaB activation in response to tumor necrosis factor alpha. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 12: 871-880, 1998. 116. Lluis F, Perdiguero E, Nebreda AR, and Munoz-Canoves P. Regulation of skeletal muscle gene expression by p38 MAP kinases. Trends Cell Biol 16: 36-44, 2006. 117. Ma XM, and Blenis J. Molecular mechanisms of mTOR-mediated translational control. Nat Rev Mol Cell Biol 10: 307-318, 2009.
![Page 219: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/219.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
193
118. MacNee W. Pulmonary and systemic oxidant/antioxidant imbalance in chronic obstructive pulmonary disease. Proc Am Thorac Soc 2: 50-60, 2005. 119. Mador MJ, Deniz O, Aggarwal A, and Kufel TJ. Quadriceps fatigability after single muscle exercise in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 168: 102-108, 2003. 120. Maestrelli P, Paska C, Saetta M, Turato G, Nowicki Y, Monti S, Formichi B, Miniati M, and Fabbri LM. Decreased haem oxygenase-1 and increased inducible nitric oxide synthase in the lung of severe COPD patients. Eur Respir J 21: 971-976, 2003. 121. Mahoney DJ, Parise G, Melov S, Safdar A, and Tarnopolsky MA. Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 19: 1498-1500, 2005. 122. Mak JC. Pathogenesis of COPD. Part II. Oxidative-antioxidative imbalance. Int J Tuberc Lung Dis 12: 368-374, 2008. 123. Malle E, Sodin-Semrl S, and Kovacevic A. Serum amyloid A: an acute-phase protein involved in tumour pathogenesis. Cell Mol Life Sci 66: 9-26, 2009. 124. Malle E, Sodin-Semrl S, and Kovacevic A. Serum amyloid A: an acute-phase protein involved in tumour pathogenesis. Cell Mol Life Sci 66: 9-26, 2009. 125. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Belanger M, Breton MJ, and Jobin J. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 55: 848-853, 2000. 126. Maltais F, Simard AA, Simard C, Jobin J, Desgagnes P, and LeBlanc P. Oxidative capacity of the skeletal muscle and lactic acid kinetics during exercise in normal subjects and in patients with COPD. Am J Respir Crit Care Med 153: 288-293, 1996. 127. Maltais F, Sullivan MJ, LeBlanc P, Duscha BD, Schachat FH, Simard C, Blank JM, and Jobin J. Altered expression of myosin heavy chain in the vastus lateralis muscle in patients with COPD. Eur Respir J 13: 850-854, 1999. 128. Man WD, Hopkinson NS, Harraf F, Nikoletou D, Polkey MI, and Moxham J. Abdominal muscle and quadriceps strength in chronic obstructive pulmonary disease. Thorax 60: 718-722, 2005. 129. Man WD, Kemp P, Moxham J, and Polkey MI. Skeletal muscle dysfunction in COPD: clinical and laboratory observations. Clin Sci (Lond) 117: 251-264, 2009. 130. Man WD, Soliman MG, Gearing J, Radford SG, Rafferty GF, Gray BJ, Polkey MI, and Moxham J. Symptoms and quadriceps fatigability after walking and cycling in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 168: 562-567, 2003. 131. Man WD, Soliman MG, Nikoletou D, Harris ML, Rafferty GF, Mustfa N, Polkey MI, and Moxham J. Non-volitional assessment of skeletal muscle strength in patients with chronic obstructive pulmonary disease. Thorax 58: 665-669, 2003. 132. Marquis K, Debigare R, Lacasse Y, LeBlanc P, Jobin J, Carrier G, and Maltais F. Midthigh muscle cross-sectional area is a better predictor of mortality than body mass index in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 166: 809-813, 2002.
![Page 220: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/220.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
194
133. Mascher H, Andersson H, Nilsson PA, Ekblom B, and Blomstrand E. Changes in signalling pathways regulating protein synthesis in human muscle in the recovery period after endurance exercise. Acta Physiol (Oxf) 191: 67-75, 2007. 134. Mascher H, Tannerstedt J, Brink-Elfegoun T, Ekblom B, Gustafsson T, and Blomstrand E. Repeated resistance exercise training induces different changes in mRNA expression of MAFbx and MuRF-1 in human skeletal muscle. Am J Physiol Endocrinol Metab 294: E43-51, 2008. 135. McDonough JE, Yuan R, Suzuki M, Seyednejad N, Elliott WM, Sanchez PG, Wright AC, Gefter WB, Litzky L, Coxson HO, Pare PD, Sin DD, Pierce RA, Woods JC, McWilliams AM, Mayo JR, Lam SC, Cooper JD, and Hogg JC. Small-airway obstruction and emphysema in chronic obstructive pulmonary disease. N Engl J Med 365: 1567-1575, 2011. 136. Murphy LO, Smith S, Chen RH, Fingar DC, and Blenis J. Molecular interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol 4: 556-564, 2002. 137. Murray CJ, and Lopez AD. Evidence-based health policy--lessons from the Global Burden of Disease Study. Science 274: 740-743, 1996. 138. Nader GA. Molecular determinants of skeletal muscle mass: getting the "AKT" together. Int J Biochem Cell Biol 37: 1985-1996, 2005. 139. Nader GA, and Esser KA. Intracellular signaling specificity in skeletal muscle in response to different modes of exercise. J Appl Physiol 90: 1936-1942, 2001. 140. Nandi D, Tahiliani P, Kumar A, and Chandu D. The ubiquitin-proteasome system. J Biosci 31: 137-155, 2006. 141. Natanek SA, Gosker HR, Slot IG, Marsh GS, Hopkinson NS, Man WD, Tal-Singer R, Moxham J, Kemp PR, Schols NM, and Polkey MI. Heterogeneity of quadriceps muscle phenotype in chronic obstructive pulmonary disease (COPD); implications for stratified medicine? Muscle Nerve 2013. 142. Nici L, Donner C, Wouters E, Zuwallack R, Ambrosino N, Bourbeau J, Carone M, Celli B, Engelen M, Fahy B, Garvey C, Goldstein R, Gosselink R, Lareau S, MacIntyre N, Maltais F, Morgan M, O'Donnell D, Prefault C, Reardon J, Rochester C, Schols A, Singh S, and Troosters T. American Thoracic Society/European Respiratory Society statement on pulmonary rehabilitation. American Journal of Respiratory and Critical Care Medicine 173: 1390-1413, 2006. 143. Nielsen JN, Frosig C, Sajan MP, Miura A, Standaert ML, Graham DA, Wojtaszewski JF, Farese RV, and Richter EA. Increased atypical PKC activity in endurance-trained human skeletal muscle. Biochem Biophys Res Commun 312: 1147-1153, 2003. 144. Ohanna M, Sobering AK, Lapointe T, Lorenzo L, Praud C, Petroulakis E, Sonenberg N, Kelly PA, Sotiropoulos A, and Pende M. Atrophy of S6K1(-/-) skeletal muscle cells reveals distinct mTOR effectors for cell cycle and size control. Nat Cell Biol 7: 286-294, 2005. 145. Ohira Y, Yoshinaga T, Nomura T, Kawano F, Ishihara A, Nonaka I, Roy RR, and Edgerton VR. Gravitational unloading effects on muscle fiber size, phenotype and myonuclear number. Adv Space Res 30: 777-781, 2002.
![Page 221: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/221.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
195
146. Otto A, and Patel K. Signalling and the control of skeletal muscle size. Exp Cell Res 316: 3059-3066, 2010. 147. Parkington JD, LeBrasseur NK, Siebert AP, and Fielding RA. Contraction-mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J Appl Physiol 97: 243-248, 2004. 148. Pedersen BK. Muscles and their myokines. J Exp Biol 214: 337-346, 2011. 149. Pedersen BK, Akerstrom TC, Nielsen AR, and Fischer CP. Role of myokines in exercise and metabolism. J Appl Physiol 103: 1093-1098, 2007. 150. Penna F, Costamagna D, Fanzani A, Bonelli G, Baccino FM, and Costelli P. Muscle wasting and impaired myogenesis in tumor bearing mice are prevented by ERK inhibition. PLoS One 5: e13604, 2010. 151. Pierce JA, Hocott JB, and Ebert RV. The collagen and elastin content of the lung in emphysema. Ann Intern Med 55: 210-222, 1961. 152. Pilegaard H, Ordway GA, Saltin B, and Neufer PD. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol Metab 279: E806-814, 2000. 153. Plant PJ, Brooks D, Faughnan M, Bayley T, Bain J, Singer L, Correa J, Pearce D, Binnie M, and Batt J. Cellular markers of muscle atrophy in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 42: 461-471, 2010. 154. Plomgaard P, Penkowa M, and Pedersen BK. Fiber type specific expression of TNF-alpha, IL-6 and IL-18 in human skeletal muscles. Exerc Immunol Rev 11: 53-63, 2005. 155. Polkey MI, Hawkins P, Kyroussis D, Ellum SG, Sherwood R, and Moxham J. Inspiratory pressure support prolongs exercise induced lactataemia in severe COPD. Thorax 55: 547-549, 2000. 156. Polkey MI, Kyroussis D, Hamnegard CH, Mills GH, Green M, and Moxham J. Diaphragm strength in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 154: 1310-1317, 1996. 157. Powers SK, Kavazis AN, and McClung JM. Oxidative stress and disuse muscle atrophy. J Appl Physiol 102: 2389-2397, 2007. 158. Proud CG. Ras, PI3-kinase and mTOR signaling in cardiac hypertrophy. Cardiovasc Res 63: 403-413, 2004. 159. Psilander N, Damsgaard R, and Pilegaard H. Resistance exercise alters MRF and IGF-I mRNA content in human skeletal muscle. J Appl Physiol 95: 1038-1044, 2003. 160. Puhan MA, Gimeno-Santos E, Scharplatz M, Troosters T, Walters EH, and Steurer J. Pulmonary rehabilitation following exacerbations of chronic obstructive pulmonary disease. Cochrane Database Syst Rev CD005305, 2011. 161. Qaseem A, Wilt TJ, Weinberger SE, Hanania NA, Criner G, van der Molen T, Marciniuk DD, Denberg T, Schunemann H, Wedzicha W, MacDonald R, and Shekelle P. Diagnosis and management of stable chronic obstructive pulmonary disease: a clinical practice guideline update from the American College of Physicians, American College of Chest Physicians, American Thoracic Society, and European Respiratory Society. Ann Intern Med 155: 179-191, 2011.
![Page 222: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/222.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
196
162. Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y, Jenkins C, Rodriguez-Roisin R, van Weel C, and Zielinski J. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary. American Journal of Respiratory and Critical Care Medicine 176: 532-555, 2007. 163. Rabinovich RA, Ardite E, Troosters T, Carbo N, Alonso J, Gonzalez de Suso JM, Vilaro J, Barbera JA, Polo MF, Argiles JM, Fernandez-Checa JC, and Roca J. Reduced muscle redox capacity after endurance training in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 164: 1114-1118, 2001. 164. Rahman I, Skwarska E, and MacNee W. Attenuation of oxidant/antioxidant imbalance during treatment of exacerbations of chronic obstructive pulmonary disease. Thorax 52: 565-568, 1997. 165. Rennard SI. COPD: overview of definitions, epidemiology, and factors influencing its development. Chest 113: 235S-241S, 1998. 166. Riddoch-Contreras J, George T, Natanek SA, Marsh GS, Hopkinson NS, Tal-Singer R, Kemp P, and Polkey MI. p38 mitogen-activated protein kinase is not activated in the quadriceps of patients with stable chronic obstructive pulmonary disease. Copd 9: 142-150, 2012. 167. Ries AL, Bauldoff GS, Carlin BW, Casaburi R, Emery CF, Mahler DA, Make B, Rochester CL, Zuwallack R, and Herrerias C. Pulmonary Rehabilitation: Joint ACCP/AACVPR Evidence-Based Clinical Practice Guidelines. Chest 131: 4S-42S, 2007. 168. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, and Glass DJ. Mediation of IGF-1-induced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat Cell Biol 3: 1009-1013, 2001. 169. Roux PP, and Blenis J. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68: 320-344, 2004. 170. Russell AP, Somm E, Debigare R, Hartley O, Richard D, Gastaldi G, Melotti A, Michaud A, Giacobino JP, Muzzin P, LeBlanc P, and Maltais F. COPD results in a reduction in UCP3 long mRNA and UCP3 protein content in types I and IIa skeletal muscle fibers. J Cardiopulm Rehabil 24: 332-339, 2004. 171. Ruvinsky I, and Meyuhas O. Ribosomal protein S6 phosphorylation: from protein synthesis to cell size. Trends Biochem Sci 31: 342-348, 2006. 172. Sacheck JM, Ohtsuka A, McLary SC, and Goldberg AL. IGF-I stimulates muscle growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. Am J Physiol Endocrinol Metab 287: E591-601, 2004. 173. Saey D, Lemire BB, Gagnon P, Bombardier E, Tupling AR, Debigare R, Cote CH, and Maltais F. Quadriceps metabolism during constant workrate cycling exercise in chronic obstructive pulmonary disease. J Appl Physiol 110: 116-124, 2011. 174. Sahlin K. Metabolic factors in fatigue. Sports Med 13: 99-107, 1992.
![Page 223: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/223.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
197
175. Sakamoto K, Arnolds DE, Ekberg I, Thorell A, and Goodyear LJ. Exercise regulates Akt and glycogen synthase kinase-3 activities in human skeletal muscle. Biochem Biophys Res Commun 319: 419-425, 2004. 176. Sakamoto K, and Goodyear LJ. Invited review: intracellular signaling in contracting skeletal muscle. J Appl Physiol 93: 369-383, 2002. 177. Sala E, Roca J, Marrades RM, Alonso J, Gonzalez De Suso JM, Moreno A, Barbera JA, Nadal J, de Jover L, Rodriguez-Roisin R, and Wagner PD. Effects of endurance training on skeletal muscle bioenergetics in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 159: 1726-1734, 1999. 178. Sandri M. Signaling in muscle atrophy and hypertrophy. Physiology (Bethesda) 23: 160-170, 2008. 179. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, and Goldberg AL. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117: 399-412, 2004. 180. Sarbassov DD, Ali SM, and Sabatini DM. Growing roles for the mTOR pathway. Curr Opin Cell Biol 17: 596-603, 2005. 181. Schols AM, Buurman WA, Staal van den Brekel AJ, Dentener MA, and Wouters EF. Evidence for a relation between metabolic derangements and increased levels of inflammatory mediators in a subgroup of patients with chronic obstructive pulmonary disease. Thorax 51: 819-824, 1996. 182. Schols AM, Soeters PB, Dingemans AM, Mostert R, Frantzen PJ, and Wouters EF. Prevalence and characteristics of nutritional depletion in patients with stable COPD eligible for pulmonary rehabilitation. Am Rev Respir Dis 147: 1151-1156, 1993. 183. Seemungal TA, Donaldson GC, Paul EA, Bestall JC, Jeffries DJ, and Wedzicha JA. Effect of exacerbation on quality of life in patients with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 157: 1418-1422, 1998. 184. Serres I, Gautier V, Varray A, and Prefaut C. Impaired skeletal muscle endurance related to physical inactivity and altered lung function in COPD patients. Chest 113: 900-905, 1998. 185. Sevenoaks MJ, and Stockley RA. Chronic Obstructive Pulmonary Disease, inflammation and co-morbidity--a common inflammatory phenotype? Respir Res 7: 70, 2006. 186. Shahbazian D, Roux PP, Mieulet V, Cohen MS, Raught B, Taunton J, Hershey JW, Blenis J, Pende M, and Sonenberg N. The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. Embo J 25: 2781-2791, 2006. 187. Simpson K, Killian K, McCartney N, Stubbing DG, and Jones NL. Randomised controlled trial of weightlifting exercise in patients with chronic airflow limitation. Thorax 47: 70-75, 1992. 188. Slebos DJ, Kerstjens HA, Rutgers SR, Kauffman HF, Choi AM, and Postma DS. Haem oxygenase-1 expression is diminished in alveolar
![Page 224: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/224.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
198
macrophages of patients with COPD. Eur Respir J 23: 652-653; author reply 653, 2004. 189. Snider GL. Nosology for our day: its application to chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 167: 678-683, 2003. 190. Society ATSaER. Skeletal muscle dysfunction in chronic obstructive pulmonary disease. A statement of the American Thoracic Society and European Respiratory Society. American Journal of Respiratory and Critical Care Medicine 159: S1-40, 1999. 191. Spangenburg EE, and McBride TA. Inhibition of stretch-activated channels during eccentric muscle contraction attenuates p70S6K activation. J Appl Physiol 100: 129-135, 2006. 192. Spruit MA, Gosselink R, Troosters T, Kasran A, Gayan-Ramirez G, Bogaerts P, Bouillon R, and Decramer M. Muscle force during an acute exacerbation in hospitalised patients with COPD and its relationship with CXCL8 and IGF-I. Thorax 58: 752-756, 2003. 193. Stubbings AK, Moore AJ, Dusmet M, Goldstraw P, West TG, Polkey MI, and Ferenczi MA. Physiological properties of human diaphragm muscle fibres and the effect of chronic obstructive pulmonary disease. J Physiol 586: 2637-2650, 2008. 194. Supinski GS, Ji X, and Callahan LA. The JNK MAP kinase pathway contributes to the development of endotoxin-induced diaphragm caspase activation. Am J Physiol Regul Integr Comp Physiol 297: R825-834, 2009. 195. Swallow EB, Gosker HR, Ward KA, Moore AJ, Dayer MJ, Hopkinson NS, Schols AM, Moxham J, and Polkey MI. A novel technique for nonvolitional assessment of quadriceps muscle endurance in humans. J Appl Physiol 103: 739-746, 2007. 196. Swallow EB, Reyes D, Hopkinson NS, Man WD, Porcher R, Cetti EJ, Moore AJ, Moxham J, and Polkey MI. Quadriceps strength predicts mortality in patients with moderate to severe chronic obstructive pulmonary disease. Thorax 62: 115-120, 2007. 197. Terzis G, Georgiadis G, Stratakos G, Vogiatzis I, Kavouras S, Manta P, Mascher H, and Blomstrand E. Resistance exercise-induced increase in muscle mass correlates with p70S6 kinase phosphorylation in human subjects. Eur J Appl Physiol 102: 145-152, 2008. 198. Thompson CH, Davies RJ, Kemp GJ, Taylor DJ, Radda GK, and Rajagopalan B. Skeletal muscle metabolism during exercise and recovery in patients with respiratory failure. Thorax 48: 486-490, 1993. 199. Thong FS, Derave W, Urso B, Kiens B, and Richter EA. Prior exercise increases basal and insulin-induced p38 mitogen-activated protein kinase phosphorylation in human skeletal muscle. J Appl Physiol 94: 2337-2341, 2003. 200. Troosters T, Casaburi R, Gosselink R, and Decramer M. Pulmonary rehabilitation in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 172: 19-38, 2005.
![Page 225: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/225.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
199
201. Troosters T, Gosselink R, and Decramer M. Short- and long-term effects of outpatient rehabilitation in patients with chronic obstructive pulmonary disease: a randomized trial. Am J Med 109: 207-212, 2000. 202. Troosters T, Sciurba F, Battaglia S, Langer D, Valluri SR, Martino L, Benzo R, Andre D, Weisman I, and Decramer M. Physical inactivity in patients with COPD, a controlled multi-center pilot-study. Respiratory Medicine 104: 1005-1011, 2010. 203. Tyml K, and Mathieu-Costello O. Structural and functional changes in the microvasculature of disused skeletal muscle. Front Biosci 6: D45-52, 2001. 204. Uhlar CM, and Whitehead AS. Serum amyloid A, the major vertebrate acute-phase reactant. Eur J Biochem 265: 501-523, 1999. 205. Urieli-Shoval S, Linke RP, and Matzner Y. Expression and function of serum amyloid A, a major acute-phase protein, in normal and disease states. Curr Opin Hematol 7: 64-69, 2000. 206. van den Borst B, Slot IG, Hellwig VA, Vosse BA, Kelders MC, Barreiro E, Schols AM, and Gosker HR. Loss of quadriceps muscle oxidative phenotype and decreased endurance in patients with mild-to-moderate COPD. J Appl Physiol 2012. 207. Van Remoortel H, Hornikx M, Demeyer H, Langer D, Burtin C, Decramer M, Gosselink R, Janssens W, and Troosters T. Daily physical activity in subjects with newly diagnosed COPD. Thorax 2013. 208. Vattemi G, Tonin P, Filosto M, Savio C, Rizzuto N, and Tomelleri G. Reversible upper limb muscle weakness with selective loss of thick filaments. Neurology 61: 863-864, 2003. 209. Vestbo J, Hurd SS, Agusti AG, Jones PW, Vogelmeier C, Anzueto A, Barnes PJ, Fabbri LM, Martinez FJ, Nishimura M, Stockley RA, Sin DD, and Rodriguez-Roisin R. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary. American Journal of Respiratory and Critical Care Medicine 187: 347-365, 2013. 210. Vestbo J, Hurd SS, and Rodriguez-Roisin R. The 2011 revision of the global strategy for the diagnosis, management and prevention of COPD (GOLD)--why and what? Clin Respir J 6: 208-214, 2012. 211. Vlahovic G, Russell ML, Mercer RR, and Crapo JD. Cellular and connective tissue changes in alveolar septal walls in emphysema. American Journal of Respiratory and Critical Care Medicine 160: 2086-2092, 1999. 212. Vogiatzis I, Simoes DC, Stratakos G, Kourepini E, Terzis G, Manta P, Athanasopoulos D, Roussos C, Wagner PD, and Zakynthinos S. Effect of pulmonary rehabilitation on muscle remodelling in cachectic patients with COPD. Eur Respir J 36: 301-310, 2010. 213. von Haehling S, Genth-Zotz S, Anker SD, and Volk HD. Cachexia: a therapeutic approach beyond cytokine antagonism. Int J Cardiol 85: 173-183, 2002. 214. Wahren J. Glucose turnover during exercise in man. Ann N Y Acad Sci 301: 45-55, 1977.
![Page 226: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/226.jpg)
Bibliographie (Chapitres I, II, VII et VIII)
200
215. Whittom F, Jobin J, Simard PM, Leblanc P, Simard C, Bernard S, Belleau R, and Maltais F. Histochemical and morphological characteristics of the vastus lateralis muscle in patients with chronic obstructive pulmonary disease. Med Sci Sports Exerc 30: 1467-1474, 1998. 216. Willemse BW, ten Hacken NH, Rutgers B, Lesman-Leegte IG, Postma DS, and Timens W. Effect of 1-year smoking cessation on airway inflammation in COPD and asymptomatic smokers. Eur Respir J 26: 835-845, 2005. 217. Williams RSaN, P. D. Regulation of Gene Expression in Skeletal Muscle by Contractile Activity. Comprehensive Physiology 1124–1150, 2011. 218. Williams TJ, Patterson GA, McClean PA, Zamel N, and Maurer JR. Maximal exercise testing in single and double lung transplant recipients. Am Rev Respir Dis 145: 101-105, 1992. 219. Williamson D, Gallagher P, Harber M, Hollon C, and Trappe S. Mitogen-activated protein kinase (MAPK) pathway activation: effects of age and acute exercise on human skeletal muscle. J Physiol 547: 977-987, 2003. 220. Williamson DL, Kimball SR, and Jefferson LS. Acute treatment with TNF-alpha attenuates insulin-stimulated protein synthesis in cultures of C2C12 myotubes through a MEK1-sensitive mechanism. Am J Physiol Endocrinol Metab 289: E95-104, 2005. 221. Wing SS. Control of ubiquitination in skeletal muscle wasting. Int J Biochem Cell Biol 37: 2075-2087, 2005. 222. World-Health-Organization. The global burden of disease: 2004 update. Switzerland: 2008. 223. Yip TT, Chan JW, Cho WC, Wang Z, Kwan TL, Law SC, Tsang DN, Chan JK, Lee KC, Cheng WW, Ma VW, Yip C, Lim CK, Ngan RK, Au JS, Chan A, and Lim WW. Protein chip array profiling analysis in patients with severe acute respiratory syndrome identified serum amyloid a protein as a biomarker potentially useful in monitoring the extent of pneumonia. Clin Chem 51: 47-55, 2005. 224. Zhang L, Du J, Hu Z, Han G, Delafontaine P, Garcia G, and Mitch WE. IL-6 and serum amyloid A synergy mediates angiotensin II-induced muscle wasting. J Am Soc Nephrol 20: 604-612, 2009. 225. Zoico E, and Roubenoff R. The role of cytokines in regulating protein metabolism and muscle function. Nutr Rev 60: 39-51, 2002.
![Page 227: Métabolisme et signalisation cellulaire dans le quadriceps des … · 2018-04-20 · FoxO Forkhead box of the class O . GOLD Global Initiative for Chronic Obstructive Lung Disease](https://reader035.vdocuments.pub/reader035/viewer/2022063003/5f4fe94d503cf3427c5321cd/html5/thumbnails/227.jpg)
201
ANNEXES
Annexe A
Niveaux d’ARNm d’Atrogin1 et de MuRF dans des myotubes C2C12 à la suite d’une stimulation avec 2 μg de Sérum Amyloïde A (SAA1) recombinant ainsi qu’un contrôle positif soit une stimulation avec 50 ug de lipopolysaccharide (LPS) (n=2). Thériault M-E et al. 2012, résultats non-publiés