NF-jB p65 transactivation domain is involvedin the NF-jB-inducing kinase pathwayq,qq

Xu Jiang,a,b Naoko Takahashi,a Kiichiro Ando,a,b Takanobu Otsuka,b

Toshifumi Tetsuka,a and Takashi Okamotoa,*

a Department of Molecular Genetics, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japanb Department of Orthopedic Surgery, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan

Received 13 December 2002

Abstract

NF-jB-inducing kinase (NIK) is involved in the signal transduction pathway leading to the NF-jB activation. In this report,

we demonstrate that the NIK-mediated NF-jB activation involves the transactivation (TA) domain of p65 subunit of NF-jBand the nuclear translocation of IKKa. By using luciferase assay, we found that both IKKa and IKKb could activate NF-jB in

synergy with NIK. Interestingly, although IKKb stimulated the NIK-mediated IjB degradation, IKKa stimulated the action of

NF-jB without enhancing the IjB degradation. By using heterologous transactivation system with Gal4 DNA-binding domain

in fusion with various portions of p65 TA domain, we found that the transactivation domain 1 (TA1) of p65 serves as the direct

target for the NIK–IKKa cascade and that the serine residue at 536 within p65 TA1 is indispensable for this action. Fur-

thermore, we found that this action of NIK depends on the energy-dependent action of Ras-related protein (Ran) since the

dominant negative mutant of Ran (RanQ69L) inhibited the transcriptional activity of p65 by preventing the nuclear import of

IKKa.� 2003 Elsevier Science (USA). All rights reserved.

Keywords: NF-jB; p65 subunit; Transactivation; NIK; IKK; Signal transduction; Kinase cascade; Nuclear translocation; Gene expression

NF-jB represents a family of eukaryotic transcrip-

tion factors participating in the regulation of immune

response, cell growth, and survival [1,2]. There are five

members of the NF-jB/Rel family in mammalian cells.

In most cells, NF-jB/Rel family members form hetero-and homodimers with distinct specificities in various

combinations, and the heterodimer of p65 (RelA) and

p50 is the predominant form of NF-jB. Since p65 is

responsible for the transcriptional activity of NF-jB, it

has been most extensively studied [3–6]. p65 contains

at least two independent transactivation domains (TA1

and TA2) within its C-terminal 120 amino acids and is

responsible for transcriptional activation of the target

genes. TA1 is confined to the C-terminal 30 aminoacids and is likely to adopt an amphipathic a-helicalstructure that clusters serine residues on the hydro-

philic surface [4]. Interestingly, the TNF-mediated

signaling was shown to involve phosphorylation of Ser

529 within TA1 by casein kinase II [7,8]. Similarly,

overexpression of IjB kinase b (IKKb) is reported to

induce phosphorylation of p65 at Ser536 [9]. In addi-

tion, Ras-induced NF-jB activation is mediated byPI3K/Akt kinase which phosphorylates serine residues

at 529 and 536 within TA1 [10]. These signal-induced

p65 phosphorylations appear to induce NF-jB-dependent gene expression by augmenting the tran-

scriptional activity of NF-jB (p65) rather than by

promoting its nuclear translocation through IjBaphosphorylation.

Biochemical and Biophysical Research Communications 301 (2003) 583–590

www.elsevier.com/locate/ybbrc

BBRC

qThis work was supported in part by grants-in-aid from the

Ministry of Health, Labour and Welfare, the Ministry of Education,

Culture, Sports, Science and Technology of Japan and the Japanese

Health Sciences Foundation.qqAbbreviations: NF-jB, nuclear factor kappa B; TA1, transac-

tivation domains 1; NIK, NF-jB-inducing kinase; RHD, Rel homol-

ogy domain; NLS, nuclear localization signal; Ran, Ras-related

protein; TNF, tumor necrosis factor; IL-1b, interleukin-1b; IKK,

IjB kinase; GFP, green fluorescent protein; luc, luciferase; NTF2,

nuclear transport factor 2.* Corresponding author. Fax: +81-52-859-1235.

E-mail address: tokamoto@med.nagoya-cu.ac.jp (T. Okamoto).

0006-291X/03/$ - see front matter � 2003 Elsevier Science (USA). All rights reserved.

doi:10.1016/S0006-291X(03)00011-1

In most cells, NF-jB complexes are located largely inthe cytoplasm. However, in response to proinflamma-

tory cytokines such as TNF and IL-1b, the inhibitory

proteins, IjB, become phosphorylated by IjB kinase

(IKK) complex on two serine residues located in the N-

terminal region [11], which results in rapid ubiquitina-

tion and proteolysis by the 26S proteasome, allowing

the liberated NF-jB to translocate to the nucleus [1,2].

The IKK complex consists of two catalytic subunits,IKKa and IKKb, and a regulatory subunit IKKc[12–15]. The kinase activity of both IKKa and IKKbis induced by a wide variety of NF-jB inducers such as

TNF or IL-1b, and mediated by the upstream kinases

including the NIK and the extracellular signal-regulated

kinase kinase kinase 1, 3 [16–19]. Recent studies have

demonstrated that in contrast to IKKb, although IKKadoes not participate in IjB phosphorylation, it is in-dispensable for generation of NF-jB transcriptional

activity [20]. NIK was originally identified as a protein

interacting with the TNF receptor associated factor 2

component of the TNF receptor complex [21]. NIK

physically interacts via its C-terminal region with IKKaand IKKb, and stimulates their catalytic activity

[17,22,23]. Moreover, recent studies in NIK-deficient

mice demonstrated that NIK plays an essential role inthe LTbR signaling pathway but not in TNF signaling

pathway [24,25].

In this report, we studied the effect of NIK on the

NF-jB activation. Our findings clearly indicate that the

NIK–IKKa pathway is involved in the induction of

transcriptional activation of p65 and that the nuclear

translocation of IKKa through the energy-dependent

action of Ras-related protein (Ran) is crucial.

Materials and methods

Plasmid constructs. Construction of mammalian expression vectors,

pM-p65, pM-p65 (286–551), pM-p65 (521–551), and pcDNA3.1-p65,

was previously described [26]. pM-p65 (1–286) was generated by

amplifying the corresponding p65 fragment by PCR using the oligo-

nucleotide primers 50-CGGGATCCCGATGGACGAACTGTTCC

CCCTCAT-30 and 50-GCTCTAGAGCGAATTCCATGGGCTCA

CTGAGCT-30 containing BamHI and XbaI sites. pM-p65 (521–

551:S529A) was generated by PCR using the oligo-nucleotides 50-

GGAATTCCCGGGGCTCCCCAATGGCCTCCTTGCAGGAGAT

GA-30 and 50-CGCGGATCCGCGCGTTAGGAGCTGATCTGACT

CAGCAGGGCT-30 containing EcoRI and BamHI sites. In order to

construct pM-p65 (521–551:S536A), the p65 (521–551:S536A) frag-

ment was generated by PCR using pM-p65 as a template with the

oligonucleotide primers 50-GCTCTAGAGCCCACCATGGACTACA

AAGACGATGACGACAAGATGGACGAACTGTTCCCCCTCAT

CTTCCCGGCAGAGCCAGCCC-30 and 50-CGCGGATCCGCGT

TAGGAGCTGATCTGACTCAGCAGGGCTGAGAAGTCCATG

TCCGCAATGGCGGAGAAGTCTTCATCTCCTGAAAGGAGGC

C-30 and this PCR product was cut with SmaI and BamHI. These PCR

fragments were inserted into pM vector at respective restriction sites.

pCR2FL-IKKa and pCR2FL-IKKb expression vectors encoding wild

type of IKKa and IKKb, respectively, were provided by Dr. Hiroyasu

Nakano (Juntendo University) [16]. pcDNA3-NIK and pcDNA3-

NIK(KM) encoding wild-type NIK and mutant NIK (KK429–430AA)

were gifts from Dr. David Wallach (The Weizmann Institute, Israel).

The plasmid expressing the Myc-tagged IjB, pcDNA-Myc-IjBa, wasprovided by Dr. S. Hatakeyama [27]. The plasmid expressing p65 TA1

in fusion with green fluorescent protein (GFP), pEGFP-TA1, was

generated from pM-p65 (521–551) by cutting with SmaI–BamHI and

ligated into pEGFP-C1 vector (Clontech). pEGFP-p65 was con-

structed by PCR using the oligo-nucleotides 50-CCCAAGCTTGGG

CCATGGACGAACTGTTCCCC-30 and 50-CGCGGATCCGCGTT

AGGAGCTGATCTGACTC-30 containing BamHI and HindIII sites,

and the PCR product was cloned into pEGFP-C1. All PCR amplifi-

cation reactions used Expand high fidelity system (Roche Molecular

Biochemicals). All the constructs were confirmed by dideoxynucleotide

sequencing using ABI PRISM Dye Terminator Cycle Sequencing

Ready Kit (Perkin–Elmer) on an Applied Biosystems 313 automated

DNA sequencer.

The construction of luciferase (luc) reporter plasmids of 4jBw-luc

containing four tandem copies of the HIV jB sequence and 4jBm-luc

harboring four mutated inactive jB sites has been described previously

[28]. Another luciferase reporter plasmid, pFR-luc, containing five

tandem copies of Gal4 binding site upstream of TATA box was pur-

chased from Stratagene.

The Ran expression plasmid pHARan1.1.1 and its mutant pHA-

RanQ69L1.1.1 were gifts from Dr. T. Kimura (Kansai Medical Uni-

versity, Osaka, Japan). pHARan1.1.1 expresses the wild-type Ran,

whereas pHARanQ69L expresses a mutant which dominantly inhibits

the Ran-mediated import of macromolecules [29].

Cell culture and transfection. Cells (293) were grown at 37 �C in

Dulbecco�s modified Eagle�s medium (Sigma) with 10% heat-inacti-

vated fetal bovine serum (IBL, Maebashi, Japan). Cells were

transfected using FuGene 6 transfection reagent (Roche Molecular

Biochemicals) according to the manufacturer�s recommendations. At

48 h post-transfection, the cells were harvested and the cell extracts

were prepared for the luciferase assay. Luciferase activity was

measured using the luciferase assay system (Promega) as described

previously [28]. Transfection efficiency was monitored by Renilla

luciferase activity using the pRL-TK plasmid (Promega) as an in-

ternal control and the luciferase activity was normalized by the

Renilla luciferase activity. For each transfection, 50 ng of the luc

reporter plasmid and 25 ng of internal control plasmid pRL-TK

were used. pUC19 was used to adjust the total amount of DNA

(500 ng) transfected. Cells without the stimulation of TNF were

lysed 48 h after transfection and the luciferase activity was mea-

sured. Other cells, as indicated, were stimulated with 10 ng/ml TNF

after 24 h of transfection and lysed after an additional incubation

for 24 h. The data are presented as the fold increase in luciferase

activities (means� SD) relative to the control of three independent

transfections.

Western blotting. The detection of Myc-IjB in the transfected

cells was performed as previously described [26,28]. Briefly, whole cell

extracts were lysed in 350ll of ice-cold lysis buffer (50mM Tris [pH

7.4], 150mM NaCl, 2mM EDTA, 1mM phenylmethylsulfonyl

fluoride, 1mM dithiothreitol, 0.2% Nonidet P-40, 10mM sodium

fluoride, 10 lg/ml aprotinin, 10 lg/ml leupeptin, and 1 lg/ml pepstatin

A). The proteins were resolved by 10% SDS–PAGE and transferred

onto PVDF membrane (Millipore). The membrane was incubated

with anti-Myc epitope antibody (Santa Cruz) and immunoreactive

proteins were visualized by enhanced chemilluminescence (ECL)

(Amersham).

Microscopic examination. The intracellular localizations of p65 and

its TA1 domain were examined by fluorescence microscopy by trans-

fecting pEGFP-C1-p65 and pEGFP-C1-TA1, respectively. Cells (293)

were cultured in 2-well chamber slides and transfected with plasmids

expressing these GFP fusion proteins using FuGene 6 transfection

reagent (Roche Molecular Biochemicals). After 24 h, cells were fixed in

4% paraformaldehyde at room temperature for 15min followed by

washing with PBS and subjected to microscopic examinations.

584 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590

The intracellular localization of NIK and IKKa in 293 cells was

examined by immunostaining. Cells (293) were cultured in 2-well

chamber slides and after transfected with NIK or IKKa alone, or

contransfected with Ran and its mutants (RanQ69L), 24 h after

transfection cells were fixed in 4% (w/v) paraformaldehyde/PBS at

room temperature for 20min and then permeabilized by 0.5% Triton

X-100/PBS for 20min at room temperature. They were then incu-

bated with rabbit polyclonal antibody against NIK (Santa Cruz) or

IKKa (Santa Cruz) for 1 h at 37 �C, rinsed three times with 0.05%

Triton X-100/PBS, and incubated with secondary antibody, fluo-

rescein-conjugated goat anti-rabbit IgG (CAPPEL; ICN Pharma-

ceuticals), for 1 h at 37 �C. The slides were rinsed three times with

PBS and mounted with buffered glycerol for fluorescent microscopic

examination. Primary and secondary antibodies were diluted at

1:100 and 1:200 in PBS containing 3% of bovine serum albumin,

respectively.

Results

Synergism between NIK and IKKa or IKKb in the NF-jB

activation cascade

We first examined the effects of overexpression of

NIK, IKKa, and IKKb in the NF-jB activation path-

way, either alone or in combination, using the transient

luciferase assay with an NF-jB-dependent reporterplasmid (4jBw-luc). As shown in Fig. 1A, TNF alone

stimulated NF-jB-dependent gene expression by 21-fold

and overexpression of NIK activated the gene expres-

sion by 23-fold. Overexpression of IKKa alone did not

Fig. 1. Synergism between NIK and IKKa or IKKb. The effects of TNF-signaling, NIK, IKKa, and IKKb, either alone or in combination, on the

NF-jB-dependent luciferase (luc) gene expression and IjBa degradation were examined. (A) Effects of TNF, NIK, IKKa, or IKKb on the luc

reporter gene expression. Cells (293) were transfected with 50 ng of 4� jBw-luc (containing wild-type NF-jB binding sites) or 4� jBm-luc

(mutant NF-jB sites) reporter plasmid (pGL3-4jBwt-luc or pGL3-4jBm-luc) together with either 20 ng of pcDNA3-NIK, 50 ng of pCR2FL-

IKKa or pCR2FL-IKKb expression plasmids. TNF (10 ng/ml) was added as a physiological stimulator of the NF-jB signaling. (B) Synergistic

effect on TNF-mediated jB-dependent gene expression by the overexpression of NIK and IKKb but not IKKa. (C) Synergism between NIK and

IKKa or IKKb. (D) Roles of NIK, IKKa, and IKKb in IjBa degradation. Cells (293) were transfected with NIK, IKKa, or IKKb together with

Myc-tagged IjBa. After stimulated with low concentration of TNF (2 ng/ml) for 4min, the cells were lysed, the lysate was resolved by SDS–

PAGE, and the protein level of IjB was detected by Western blotting with anti-Myc epitope antibody. Antibody to b-tubulin was used as an

internal control.

X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 585

significantly activate NF-jB-dependent gene expressionwhereas IKKb stimulated the gene expression by 3.5-

fold. These data suggested that upstream signal is re-

quired for the optimal activity of IKKs as previously

reported [12,14]. When a luciferase reporter construct

harboring mutant jB sites (4jBm-luc) was used, no

significant effect of these kinases was observed.

We then examined the effect of IKKa and IKKb on

the NF-jB-dependent gene expression when combinedwith TNF or NIK. As shown in Fig. 1B, when NIK,

IKKa, or IKKb was expressed in 293 cells and stimu-

lated with TNF, synergistic effect was observed with

NIK or IKKb, but not with IKKa. These results were

consistent with the fact that the TNF-induced NF-jBactivation is abolished in the IKKb- but not in the

IKKa-gene knockout mice [30–32]. However, when

NIK was overexpressed, either IKKa or IKKb syner-gized with NIK in stimulating the jB-dependent gene

expression (Fig. 1C). These findings suggest that

whereas the NIK–IKKb cascade is involved in the TNF

signaling, the NIK–IKKa cascade is not involved in the

TNF signaling.

We then examined the role of NIK, IKKa, and IKKbin IjB degradation. In Fig. 1D, Myc-IjBa is overex-

pressed in 293 cells and the synergism between TNFsignaling and NIK, IKKa, or IKKb was examined.

Similarly, the synergism between NIK and IKKa or

IKKb was assessed. TNF stimulation alone induced IjBdegradation, however, when NIK, IKKa, or IKKb was

overexpressed, the TNF-induced IjB degradation was

accelerated by NIK or IKKb, but not by IKKa (com-

pare lanes 3 and 5 with lane 4 in Fig. 1D). These data

were consistent with previous reports by others [20,30–32] that IKKb but not IKKa contributes to the IjBaphosphorylation and subsequent degradation in the

TNF/IL-1 signaling. Moreover, when NIK and IKKa or

IKKb were co-expressed, IKKb, but not IKKa, accel-erated the NIK-induced IjBa degradation (compare

lanes 10 and 11 in Fig. 1D). These findings collectively

indicate that the involvement of NIK in the NF-jBactivation is at least 2-fold: one through induction ofIjBa degradation by the NIK–IKKb cascade and the

other through the NIK–IKKa cascade without involv-

ing the IjBa degradation.

Effect of NIK on p65 nuclear localization and transacti-

vation

As it has been shown in Fig. 1 that one of the

mechanisms by which NIK activates NF-jB involvesIKKb and through the IjBa degradation, we examined

the nuclear translocation of p65 by transfecting pEGFP-

p65, expressing full-length p65 in fusion with green

fluorescent protein (GFP-p65). As shown in Fig. 2A,

when cells were transfected with pEGFP-p65 alone,

GFP-p65 was found both in the nucleus and the cyto-

plasm. When GFP-p65 was co-overexpressed with NIK,GFP-p65 located predominantly in the nucleus, whereas

co-overexpression of a kinase-defective mutant of NIK,

NIK(KM), did not alter its intracellular localization.

Since most of the nuclear factors are known to be

mediated by the action of Ran, a small GTPase protein

and the energy source of protein transportation through

the nuclear pore, GFP-p65 and NIK were co-expressed

in 293 cells and the effect of a dominant negative mutantof Ran lacking the GTPase activity (RanQ69L) was

examined. As demonstrated in Fig. 2A, NIK induced

nuclear transportation of GFP-p65, which was abol-

ished by RanQ69L. In Fig. 2B, we further examined the

effect of RanQ69L on the NIK-induced NF-jB-depen-dent gene expression. When p65 was co-overexpressed

with RanQ69L, the fold transactivation was dramati-

cally inhibited (from 16- to 3.6-fold) in a dose-dependentmanner for the amount of plasmid expressing RanQ69L

(lanes 1–5). When NIK was co-transfected with p65, the

gene expression from jB-Luc was further augmented

Fig. 2. Inhibition of NIK-induced p65 nuclear transport and its

transactivation by RanQ69L. (A) Suppression of p65 nuclear transport

by RanQ69L, a dominant negative mutant of Ran. Effects of Ran and

its mutant were examined on the intercellular locations of p65.

pEGFP-P65 was co-transfected with NIK, NIK(KM), Ran or

RanQ69L in various combinations, and its intracellular localization

was examined. (B) Suppression of the p65 transactivation by

RanQ69L. Expression plasmids for NIK, Ran, RanQ69L, and p65

were co-transfected with 4� jBw-luc and NF-jB-dependent gene ex-

pression was measured.

586 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590

(23.5-fold) and the augmentation ion by NIK wascompletely abolished by expression of RanQ69L.

The effect of NIK on the NF-jB transcriptional activity is

mediated through the C-terminal transactivation domain

of p65

Since the NIK-mediated NF-jB activation through

IKKa did not involve IjB degradation (Fig. 1), we ex-

amined if NIK could affect the transcriptional activity ofNF-jB devoid of the IjB-mediated regulation. In order

to examine this possibility, we adopted a heterologous

luciferase reporter system in which gene expression from

the reporter plasmid pFR-luc containing Gal4-binding

sites is under the control of Gal4. We have created a

series of effector plasmids containing the Gal4 DNA-

binding domain fused with various portions of p65(Fig. 3A). These plasmids were co-transfected into 293

cells and the effect of NIK was examined. As demon-

strated in Fig. 3B, NIK stimulated the pM-p65- and

pM-p65 (286–551)-mediated transactivation by 4.8- and

3.0-fold, respectively. Neither transcriptional activity

nor activation by NIK was observed with pM-p65

(1–286) and pM, containing only the Gal4 DNA-bind-

ing domain. Remarkably, NIK stimulated the tran-scriptional activity of pM-p65 (521–551), containing

only the TA1 domain, by approximately 18-fold. When

Ser at 529 in p65 TA1 was substituted by Ala (pM-p65

(521–551:S529A)), NIK could still stimulate its tran-

scriptional activity by 17-fold. However, when Ser 536

in p65 TA1 was substituted by Ala (pM-p65 (521–

551:S536A)), the effect of NIK was greatly reduced.

Fig. 3. Role of C-terminal TA1 domain in the NF-jB activation by NIK. (A) Schematic representation of the p65 and its mutant constructs. The

indicated regions of p65 were cloned into a vector (pM) producing fusion proteins with the Gal4 DNA-binding domain. (B) The effect of NIK on the

Gal4-dependent gene expression driven by various p65 fusion proteins with the Gal4 DNA-binding domain. Cells (293) were transfected with 50 ng of

5�Gal4-TATA-luc reporter plasmid (pFR-luc) in the presence or absence of pcDNA3-NIK (20 ng) together with various pM-p65 constructs (50 ng).

X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 587

These findings suggested that the effect of NIK wasprimarily mediated by TA1 and Ser536 appeared to be

the major target for the effect of NIK.

NIK-mediated NF-jB activation through TA1 domain of

p65 and the role of IKKa

In Fig. 4A, we examined the effect of NIK on the

intracellular localization o of p65 TA1 by creating a

plasmid expressing TA1 in fusion with GFP (pEGFP-TA1). GFP-TA1 was diffusely distributed both in the

cytoplasm and the nucleus, and the intracellular location

of GFP-TA1 was not affected by NIK or RanQ69L. In

addition, NIK did not affect the intracellular localiza-

tion of Gal4 DNA-binding domain (as observed with

GFP-Gal4 in Fig. 4A). Thus, the apparent effect of

NIK–IKKa cascade on the transcriptional activity of

NF-jB is not through the nuclear translocation of p65TA1. However, the expression of RanQ69L abolished

the NIK-induced activation of Gal4-TA1 in a dose-de-

pendent manner (Fig. 4B).

These data collectively indicate that the NIK-induced

activation of Gal4-TA1 depends on the nuclear trans-

port of other component in this cascade. Since a CRM1

inhibitor, leptomycin B, was shown to block nuclear

export of NIK and IKKa, but not IKKb, both NIK andIKKa are likely to shuttle between the cytoplasm and

the nucleus [33]. Others confirmed the nuclear presence

of IKKa in unstimulated cells [1]. Thus, we examined

the effect of RanQ69L on the intracellular localization

of NIK and IKKa. As shown in Fig. 4C, immuno-

staining demonstrated that NIK was primarily localized

in the cytoplasm and the overexpression of either Ran or

RanQ69L did not alter its intracellular localization. Onthe other hand, although IKKa is located in both cy-

toplasm and nucleus, when RanQ69L was expressed, the

nuclear transportation of IKKa was completely

blocked. Thus, the inhibitory effect of RanQ69L on the

transcriptional activity of p65 TA1 (Fig. 4B) might be

through blocking the nuclear translocation of IKKa and

it is suggested that the transcriptional activity of p65

TA1 depends on the nuclear IKKa.

Discussion

It is widely accepted that the nuclear translocation is

a hallmark of the transcriptional activation of NF-jBand its intracellular localization is governed by IjBs[1,2]. However, recent studies revealed that both NF-jBand IjB shuttle in and out of the nucleus [33,34]. In

addition, Birbach et al. [33] reported that the treatment

of cells with a nuclear export blocker leptomycin B re-

sulted in the nuclear accumulation of NIK and IKKabut not IKKb, indicating that NIK and IKKa also

shuttle between the cytoplasm and the nucleus. Our

findings clearly indicate that the NIK–IKKa cascadeinduces the transcriptional activity of NF-jB without

inducing the IjB degradation and that this effect is

mediated through the TA1 domain of p65. Our findings

also indicate that the nuclear transport of IKKa plays a

crucial role for this regulation.

The inhibitory role of RanQ69L, a dominant negative

form of nuclear transporter Ran, was apparent in at

least two steps, nuclear translocation of NF-jB andIKKa (Figs. 2 and 4). It is known that the bidirectional

exchange of macromolecules throughout the nuclear

membrane requires the energy that is provided by Ran

at the cost of GTP conversion to GDP [35]. As evi-

denced by previous studies with NLS of SV40 large T

[36], heterodimeric NLS receptor complex, known as

importin-ab or karypherin-ab, recognizes classical NLS

sequence through its direct interaction by importin-aand importin-b docks the entire ‘‘cargo-carrier’’ com-

plex at the cytoplasmic surface of the nuclear pore. The

complex is then recognized by nuclear transport factor 2

(NTF2) that recruits Ran GTPase and is eventually

translocated into the nucleus [35,37]. The dominant

negative mutant RanQ69L, exhibiting a large confor-

mational change in residues 68–74 responsible for the

interaction with NTF2, interferes with wild-type Ran ininteracting with NTF2 [29]. When the ‘‘cargo’’ protein

does not contain typical NLS, additional ‘‘adaptor’’

proteins such as transportin (also termed karypopherin-

b2) [38,39] may be required for specific recognition for

the nuclear import. NLS is found in NIK, IKKa, andp65. As IKKa was identified as NIK-interacting protein

[22], IKKa is likely to be associated with NIK, even in

the nucleus whereas the large IKK complex containingIKKb is found in the cytoplasm. However, since NIK

also contains the nuclear export signal (NES), the nu-

clear NIK is rapidly exported to the cytoplasm [33].

Thus, it is possible that nuclear NF-jB is activated by

such NIK–IKKa complex when NIK is transiently

translocated to the nucleus.

Although a major step that regulates NF-jB activity

is to remove IjB from the NF-jB/IjB complex, thecapacity of nuclear NF-jB to drive transcription is also

a regulated process. A number of studies support the

possibility that p65 phosphorylation regulates the tran-

scriptional competence of nuclear NF-jB [8–10,40–44].

Although the role of PKA in phosphorylating p65 is still

controversial [45–47], regulation of the transcriptional

competence of p65 by phosphorylation has been widely

accepted. One of the possible effects of p65 phosphory-lation at its TA domain by IKKa in controlling its

transcriptional competency is to recruit co-activator

proteins such as histone acetyl transferases [48,49] and

TLS [50] to NF-jB when it binds to the target promoter

sequence. Alternatively, p65 phosphorylation may pre-

clude the recruitment of co-repressor proteins such as

Groucho family proteins that are known to interact with

588 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590

Fig. 4. NIK-mediated NF-jB activation through p65 TA1 and the effect of RanQ69L on the nuclear transportation of IKKa. (A) Effect of NIK and

RanQ69L on the intracellular localization of TA1 and Gal4 DNA-binding domain. GFP-TA1or GFP-Gal4 was co-overexpressed with NIK, Ran, or

dominant negative mutant of Ran (RanQ69L). Twenty-four hours after transfection, their intercellular locations were examined by fluorescence

microscopy. (B) Suppression of the NIK-mediated transcriptional activation of TA1 by RanQ69L. (C) RanQ69L inhibits the nuclear transportation

of IKKa but not NIK. IKKa or NIK was expressed in 293 cells together with Ran or RanQ69L. Twenty-four hours after transfection, their in-

tercellular locations were detected with anti-IKKa or anti-NIK antibody under fluorescence microscopy.

X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 589

the p65 TA domain [26] and histone deacetylases(HDACs) [51].

In summary, our findings indicate that the p65

phosphorylation may act as another critical step for NF-

jB activation and the NIK–IKKa cascade plays a major

role. Based on the findings with gene knock-out mice, in

which genetic deficiency of IKKb exhibited far more

extensive effects such as embryonic fatality due to ex-

cessive apoptosis in the liver whereas that of NIK orIKKa showed limited effects, either NIK or IKKa could

serve as more feasible molecular targets for a number of

diseases in which NF-jB plays a crucial role.

Acknowledgments

We thank Dr. H. Nakano, Dr. D. Wallach, Dr. S. Hatakeyama,

and Dr. T. Kimura for their generosity in providing the expression

vectors encoding IKKa and IKKb, NIK, Myc-IjBa, Ran and Ran

(Q69L), respectively.

References

[1] S. Ghosh, M. Karin, Cell 109 (Suppl.) (2002) S81–S96.

[2] T. Okamoto, S. Sakurada, J.P. Yang, J.P. Merin, Curr. Top Cell.

Regul. 35 (1997) 149–161.

[3] P.A. Moore, S.M. Ruben, C.A. Rosen, Mol. Cell. Biol. 13 (1993)

1666–1674.

[4] M.L. Schmitz, P.A. Baeuerle, EMBO J. 10 (1991) 3805–3817.

[5] M.L. Schmitz, M.A. dos Santos Silva, P.A. Baeuerle, J. Biol.

Chem. 270 (1995) 15576–15584.

[6] M.L. Schmitz, G. Stelzer, H. Altmann, M. Meisterernst, P.A.

Baeuerle, J. Biol. Chem. 270 (1995) 7219–7226.

[7] D. Wang, A.S. Baldwin Jr., J. Biol. Chem. 273 (1998) 29411–

29416.

[8] D. Wang, S.D. Westerheide, J.L. Hanson, A.S. Baldwin Jr., J.

Biol. Chem. 275 (2000) 32592–32597.

[9] H. Sakurai, H. Chiba, H. Miyoshi, T. Sugita, W. Toriumi, J. Biol.

Chem. 274 (1999) 30353–30356.

[10] L.V. Madrid, M.W. Mayo, J.Y. Reuther, A.S. Baldwin Jr., J. Biol.

Chem. 276 (2001) 18934–18940.

[11] E.B. Traenckner, H.L. Pahl, T. Henkel, K.N. Schmidt, S. Wilk,

P.A. Baeuerle, EMBO J. 14 (1995) 2876–2883.

[12] J.A. DiDonato, M. Hayakawa, D.M. Rothwarf, E. Zandi, M.

Karin, Nature 388 (1997) 548–554.

[13] F. Mercurio, H. Zhu, B.W. Murray, A. Shevchenko, B.L. Bennett,

J. Li, D.B. Young, M. Barbosa, M. Mann, A. Manning, A. Rao,

Science 278 (1997) 860–866.

[14] E. Zandi, D.M. Rothwarf, M. Delhase, M. Hayakawa, M. Karin,

Cell 91 (1997) 243–252.

[15] D.M. Rothwarf, E. Zandi, G. Natoli, M. Karin, Nature 395

(1998) 297–300.

[16] H. Nakano, M. Shindo, S. Sakon, S. Nishinaka, M. Mihara, H.

Yagita, K. Okumura, Proc. Natl. Acad. Sci. USA 95 (1998) 3537–

3542.

[17] L. Ling, Z. Cao, D.V. Goeddel, Proc. Natl. Acad. Sci. USA 95

(1998) 3792–3797.

[18] F.S. Lee, R.T. Peters, L.C. Dang, T. Maniatis, Proc. Natl. Acad.

Sci. USA 95 (1998) 9319–9324.

[19] J. Yang, Y. Lin, Z. Guo, J. Cheng, J. Huang, L. Deng, W. Liao, Z.

Chen, Z. Liu, B. Su, Nat. Immunol. 2 (2001) 620–624.

[20] N. Sizemore, N. Lerner, N. Dombrowski, H. Sakurai, G.R. Stark,

J. Biol. Chem. 277 (2002) 3863–3869.

[21] N.L. Malinin, M.P. Boldin, A.V. Kovalenko, D. Wallach, Nature

385 (1997) 540–544.

[22] C.H. Regnier, H.Y. Song, X. Gao, D.V. Goeddel, Z. Cao, M.

Rothe, Cell 90 (1997) 373–383.

[23] J.D. Woronicz, X. Gao, Z. Cao, M. Rothe, D.V. Goeddel, Science

278 (1997) 866–869.

[24] L. Yin, L. Wu, H. Wesche, C.D. Arthur, J.M. White, D.V.

Goeddel, R.D. Schreiber, Science 291 (2001) 2162–2165.

[25] A. Matsushima, T. Kaisho, P.D. Rennert, H. Nakano, K.

Kurosawa, D. Uchida, K. Takeda, S. Akira, M. Matsumoto, J.

Exp. Med. 193 (2001) 631–636.

[26] T. Tetsuka, H. Uranishi, H. Imai, T. Ono, S. Sonta, N.

Takahashi, K. Asamitsu, T. Okamoto, J. Biol. Chem. 275 (2000)

4383–4390.

[27] M. Shirane, S. Hatakeyama, K. Hattori, K. Nakayama, J. Biol.

Chem. 274 (1999) 28169–28174.

[28] J.P. Yang, M. Hori, T. Sanda, T. Okamoto, J. Biol. Chem. 274

(1999) 15662–15670.

[29] M. Stewart, H.M. Kent, A.J. McCoy, J. Mol. Biol. 284 (1998)

1517–1527.

[30] M. Tanaka, M.E. Fuentes, K. Yamaguchi, M.H. Durnin, S.A.

Dalrymple, K.L. Hardy, D.V. Goeddel, Immunity 10 (1999) 421–

429.

[31] K. Takeda, O. Takeuchi, T. Tsujimura, S. Itami, O. Adachi, T.

Kawai, H. Sanjo, K. Yoshikawa, N. Terada, S. Akira, Science 284

(1999) 313–316.

[32] Y. Hu, V. Baud, M. Delhase, P. Zhang, T. Deerinck, M. Ellisman,

R. Johnson, M. Karin, Science 284 (1999) 316–320.

[33] A. Birbach, P. Gold, B.R. Binder, E. Hofer, R. de Martin, J.A.

Schmid, J. Biol. Chem. 277 (2002) 10842–10851.

[34] T.T. Huang, N. Kudo, M. Yoshida, S. Miyamoto, Proc. Natl.

Acad. Sci. USA 97 (2000) 1014–1019.

[35] E. Conti, E. Izaurralde, Curr. Opin. Cell. Biol. 13 (2001) 310–319.

[36] D. Gorlich, I.W. Mattaj, Science 271 (1996) 1513–1518.

[37] S.K. Vasu, D.J. Forbes, Curr. Opin. Cell. Biol. 13 (2001) 363–375.

[38] V.W. Pollard, W.M. Michael, S. Nakielny, M.C. Siomi, F. Wang,

G. Dreyfuss, Cell 86 (1996) 985–994.

[39] N. Bonifaci, J. Moroianu, A. Radu, G. Blobel, Proc. Natl. Acad.

Sci. USA 94 (1997) 5055–5060.

[40] T. Hayashi, T. Sekine, T. Okamoto, J. Biol. Chem. 268 (1993)

26790–26795.

[41] M. Naumann, C. Scheidereit, EMBO J. 13 (1994) 4597–4607.

[42] T.A. Bird, K. Schooley, S.K. Dower, H. Hagen, G.D. Virca, J.

Biol. Chem. 272 (1997) 32606–32612.

[43] N. Sizemore, S. Leung, G.R. Stark, Mol. Cell. Biol. 19 (1999)

4798–4805.

[44] M. Leitges, L. Sanz, P. Martin, A. Duran, U. Braun, J.F. Garcia,

F. Camacho, M.T. Diaz-Meco, P.D. Rennert, J. Moscat, Mol.

Cell 8 (2001) 771–780.

[45] M. Neumann, T. Grieshammer, S. Chuvpilo, B. Kneitz, M.

Lohoff, A. Schimpl, B.R. Franza Jr., E. Serfling, EMBO J. 14

(1995) 1991–2004.

[46] H. Zhong, H. SuYang, H. Erdjument-Bromage, P. Tempst, S.

Ghosh, Cell 89 (1997) 413–424.

[47] N. Takahashi, T. Tetsuka, H. Uranishi, T. Okamoto, Eur. J.

Biochem. 269 (2002) 4559–4565.

[48] M.E. Gerritsen, A.J. Williams, A.S. Neish, S. Moore, Y. Shi, T.

Collins, Proc. Natl. Acad. Sci. USA 94 (1997) 2927–2932.

[49] H. Zhong, R.E. Voll, S. Ghosh, Mol. Cell 1 (1998) 661–671.

[50] H. Uranishi, T. Tetsuka, M. Yamashita, K. Asamitsu, M.

Shimizu, M. Itoh, T. Okamoto, J. Biol. Chem. 276 (2001)

13395–13401.

[51] L. Chen, W. Fischle, E. Verdin, W.C. Greene, Science 293 (2001)

1653–1657.

590 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590