Special thanks to Dr. David Marks, Kevin Dorn, and LSSURP at

University of Minnesota sponsored by NSF-REU in

Molecular Genetics & Proteomics

Pennycress (Thalspi Arvense L.), a member of the plant family Brassicaceae, is considered a

weed in American agricultural fields. However, recent field trials have shown that Pennycress

can be used as a winter annual in novel double cropping systems with soybean or corn.

Pennycress seeds have high oil content that can be used as a feedstock for biodiesel

production. Additionally, fall planted Pennycress is an effective cover crop that naturally

controls spring weed growth. With these unique agronomic properties, Pennycress has a

potential of becoming a promising non-food biofuel feedstock. In order to develop a widely

deployable double-cropping system, a line of fast maturing Pennycress is necessary to ensure

the early June harvest, making it easier to follow with a soybean or corn crop.

To address this goal, we are investigating the mechanisms controlling flowering in

Pennycress. Like many other plants, winter annual Pennycress utilizes cold temperature as an

environmental cue to go dormant during winter months and flower in the warm spring. This

period of cold exposure that promotes flowering is known as vernalization. Using the

extensive knowledge of these processes in the related model plant species Arabidopsis

thaliana, we are characterizing the Pennycress homologs of the key regulators of flowering

and vernalization. The main goal of this project is to study FT, a downstream floral integrator

gene, and VRN1 an upstream component responsible for vernalization sensitivity, for future

genetic manipulation to create an ideal line of Pennycress for use in the field.

• Used information from Arabidopsis Thaliana to study FT and VRN1 in Pennycress.

• Clone and sequence FT and VRN1.

• Analyze mRNA expression VRN1 under different conditions.

1. Designed FT and VRN1 primers with appropriate 5’ and 3’ cohesive ends.

2. Extracted RNA and created cDNA libraries from plants under different conditions:

unvernalized, vernalized, and flowering

3. Performed PCR reaction with FT and VRN1 with designed primers using different cDNA

libraries.

4. TOPO cloned FT and VRN1 into pCR4®-TOPO, transformed recombinant plasmid into

competent Escherichia coli and PCR screened for positive transformants.

5. Ligated VRN1 into pEGAD-35S::RED, transformed recombinant plasmid into competent

E.coli and PCR screened for positive transformants.

6. Sequenced VRN1 fragments as well as pEGAD-35S::RED_VRN1 .

7. qPCR for VRN1 using different cDNA libraries to obtain the expression level and

UBQ10 for nomalization.

Characterization of Flowering-time Regulating Genes in Thlaspi Arvense L.

INTRODUCTION

CONCLUSION

METHOD LITERATURE CITED

ACKNOWLEDGEMENT

RESULTS

Duc Dang, Kevin Dorn, David Marks

University of Minnesota, College of Biological Sciences, Department of Plant Biology

Life Sciences Summer Undergraduate Research Program

CONSTRUCTS

Fig. 3. Map of pEGAD expression vector, a T-DNA vector

with 35S promoter constitutively expressed in most plants, a

multiple cloning site locus after dsRED, and a plant selection

marker (BASTA)

Fig. 8. Phylogram generated based on the alignment of VRN1 partial sequence

in Pennycress and CDS in other species in Brassicaceae family

7 colonies

Fig. 6. PCR screening results from 7 colonies

of E.coli transformants. Presence of VRN1 in

recombinant pEGAD is confirmed by gel

electrophoresis

OBJECTIVES

MAIN CROP COVER CROP

Plant pennycress

Harvest soybean/corn

Plant soybean/corn

Harvest Pennycress seed

Fig. 1. Double-cropping system of Pennycress and soybean

Fig. 2. Outline of flowering pathway

in Arabidopsis Thaliana

1 kb

ladder

VRN1

FT Study

Fig. 4. Map of pCR®4-TOPO Vector, which has two

antibiotic selective markers (Kanamycin and Ampicillin)

and a ccdB E.coli lethal gene fused with LacZα fragment for

direct positive selection

• Partial VRN1 sequence has 1005 bp, with the last codon of GGA.

• The presence of start codon couldn’t be confirmed, and thus an open reading frame

(ORF) has not been obtained.

• Partial sequence shows high consensus with VRN1 coding sequences (CDS) of other

species in Brassicaceae

1 kb

0.5 kb

1.5 kb

Fig. 7. Relative expression of VRN1 in Pennycress plants under different conditions with regard

to the expression of UBQ10 (Polyubiquitin gene)*

*Data is preliminary. UBQ10 primer efficiency has to be confirmed under different conditions.

Lanes and Content

1: 1 kb ladder

2: 100 bp ladder

3: FT/EcoRI(+)

BamHI(-)

4: FT/AgeI(+)

EcoRI(-)

5: FT/EcoRI

6: FT/StuI

7: FT/BamHI

1 2 3 4

1 kb

0.5 kb

1.5 kb 1 kb

0.5 kb

1.5 kb

1 2 5 6 7

VRN1 Study

Fig. 9. Inconclusive results of amplifying FT from combined cDNA of vernalized and

unvernalized plants using designed primers.

(a) is the agarose gel of PCR products, and (b) is the one of restriction digestion.

(a) (b)

1 2

2 1

0.5 kb

1 kb

0.5 kb

1 kb

(c) (-)

control

Lanes and Content

1: 1 kb ladder

2: 100 bp ladder

(c): PCR products of 3 colonies

of positive transformants.

(d): PCR products of 4 colonies

of positve transformants

(d)

Fig. 10. Inconclusive results on agarose gel of

PCR products from positive transformants with

pCR4®TOPO vector.

• Partial coding sequence of VRN1 in Pennycress was obtained and is highly

conserved across other species (Fig. 7) in Brassicaceae family.

• Preliminary chart of VRN1 expression in Pennycress under three different

conditions supported the prediction of high number of VRN1 transcripts in

vernalized plants for complete repression of FLC to promote flowering.

• FT TOPO cloning results are inconclusive. Further steps to improve primer

efficiency and other different methods of cloning are suggested.

0

1

2

3

4

5

6

7

8

VernalizedUnvernalized

Flowering

(vernalized)

Rel

ati

ve e

xp

ress

ion

Developmental Condition

Vernalized

Unvernalized

Flowering

(vernalized)

FUTURE RESEARCH

• VRN1 Forward Primer with E.coRI site 5' – TC|GAATTC|ATGCCACGCCCTTTCTTCCA - 3'

Fig. 5. First 50 nucleotides of VRN1 coding sequence alignment from species in Brassicaceae family

Species order from top to bottom:

1. Arabidopsis thaliana

2. Arabidopsis lyrata

3. Thellungiella halophila

4. Brassica rapa cultivar

• Determine final VRN1 sequence and obtain full expression profile

• Develop a transformation protocol in Pennycress (in progress)

• Overexpress VRN1 in pennycress and look for developmental phenotypes

• Knock down VRN1 in Pennycress using RNA interference

Dong-Hwan K., Mark D. , Sibum S., and Richard M. A. 2009.

Vernalization: Winter and the Timing of Flowering in Plants. Annu. Rev.

Cell Dev. Biol. 2009.25:277-299

Yoshibumi K. 2004. Genetic Regulation of Time to Flower in Arabidopsis

Thaliana. Annu. Rev. Plant Biol. 2004. 55:521–35

Fall

Late Winter

Late Spring

Early Summer