Current Eye Research, 34, 10–17, 2009Copyright C© Informa Healthcare USA, Inc.ISSN: 0271-3683 print / 1460-2202 onlineDOI: 10.1080/02713680802579196

Pitavastatin AttenuatesLeukocyte-Endothelial Interactions

Induced by Ischemia-Reperfusion Injuryin the Rat Retina

Kenichi Miyaki, Akihisa Matsubara, Akiko Nishiwaki, Kazuyuki Tomida, Hiroshi Morita,Munenori Yoshida, and Yuichiro Ogura

Department of Ophthalmology and Visual Sciences, Nagoya City University Graduate School of Medicine, Nagoya, Japan

ABSTRACT

Purpose: Statins (3-hydroxy-methylglutaryl coenzyme A reductase inhibitors) have been shown tolower serum cholesterol levels in clinical use. Moreover, it has been reported that statins exertpleiotropic and beneficial effects on vascular endothelium. Therefore, we investigated the effects ofpitavastatin, a new statin, on leukocyte accumulation during ischemia-reperfusion injury. Materialsand Methods: Transient retinal ischemia was induced in Long-Evans rats for 60 min by temporal lig-ation of the optic nerve. Pitavastatin (0.12, 0.35, or 1.1 mg/kg) was administered 5 min prior to theinduction of retinal ischemia. Leukocyte-endothelial interactions in the post-ischemic retina wereevaluated in vivo with acridine orange digital fluorography. The number of rolling leukocytes, num-ber of accumulated leukocytes, and diameters of the major retinal artery and vein were evaluated.Intercellular adhesion molecule-1 (ICAM-1) mRNA expression in the retina was semiquantitativelystudied using the RT-PCR method. Results: Pitavastatin-treated rats at doses of 0.35 and 1.1 mg/kgshowed mild arterial narrowing (p < 0.01) and venous dilation (p < 0.01) compared with vehicle-treated (ischemic) rats. In rats treated with 0.35 mg/kg pitavastatin, the number of rolling leuko-cytes was significantly reduced by 35.5% (p < 0.01) 12 hr after reperfusion compared with that ofvehicle-treated rats. With treatment at a dose of 0.35 mg/kg pitavastatin, the number of accumulatedleukocytes was reduced to 68.7% (p < 0.01) 24 hr after reperfusion. Moreover, pitavastatin treatmentsignificantly reduced ICAM-1 mRNA expression in the retina during ischemia-reperfusion injury.Conclusions: Pitavastatin effectively attenuated ischemia-induced leukocyte-endothelial interactionsin the rat retina.

Keywords: intercellular adhesion molecule-1; leukocyte; pitavastatin; retinal ischemia-reperfusion injury

INTRODUCTION

Leukocytes are not only important in protecting thebody against infectious disease and as a healing mech-anism but also contribute to negative aspects of inflam-

Received 27 April 2008; accepted 24 October 2008.Correspondence: Akihisa Matsubara, M.D., Department of Ophthal-mology and Visual Sciences, Nagoya City University GraduateSchool of Medicine, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya467-0001, Japan. E-mail: matubara@med.nagoya-cu.ac.jp

mation. Ischemia-reperfusion injury refers to damageto tissue caused when blood supply returns to the tis-sue after a period of ischemia and is greatly augmentedby reperfusion. Leukocytes are thought to play a sig-nificant role in ischemia-reperfusion injury,1 becausetheir accumulation results in tissue injury by imped-ing blood flow or by producing superoxide radicals2

and inflammatory cytokines.3 In our previous studyusing this model, we demonstrated that rolling andaccumulated leukocytes were present in the retina, as

10

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

Pitavastatin Improved Leukocyte Dynamics in Retina

observed by acridine orange digital fluorography,4,5

and that mRNA expression of the leukocyte adhe-sion molecules P-selectin and intercellular adhesionmolecule-1 (ICAM-1) was significantly increased.6 In-hibition of selectin or ICAM-1 have been suggested as apossible treatment for ischemia-reperfusion injury,7−9

and we have demonstrated that selectin inhibitor at-tenuates leukocyte rolling, accumulation, and subse-quent tissue injury after ischemia-reperfusion in therat retina.5 In this study, we utilized this model forleukocyte microcirculatory disturbance model.

Statins, 3-hydroxy-3-methylglutaryl coenzyme A(HMG-CoA) reductase inhibitors are used as an impor-tant therapeutic modality for hypercholesterolemia. Inaddition, statins may have beneficial therapeutic ef-fects that are independent of their cholesterol-loweringactions.10 Interestingly, it has been reported that statinsshow anti-inflammatory actions by inhibiting activa-tion of leukocyte adhesion molecules.11 Honjo et al. re-ported that cerivastatin inhibits leukocyte-endothelialinteractions and prevents neuronal death induced byischemia-reperfusion injury in the rat retina.12 How-ever, the dose of cerivastatin used was relatively highcompared with that used clinically, and clinical ad-ministration of cerivastatin is currently impossible dueto its withdrawal from the market after numerous re-ports of fatal rhabdomyolysis.13 Pitavastatin is a newgeneration of statin, developed and available in Japansince 2003, and is more potent in its capacity to inhibitHMG-CoA reductase than previously used statins suchas pravastatin. Metabolism of pitavastatin by the cy-tochrome P450 (CYP) system is minimal as it is princi-pally metabolized by CYP 2C9, with little involvementof the CYP 3A4 isoenzyme, thereby potentially reduc-ing the risk of drug-drug interactions with other drugsknown to inhibit CYP enzymes.14 Pitavastatin at a doseof 0.35 mg/kg in rats is believed to produce the sameplasma concentration as oral administration of 4 mg inhumans, which is the clinical dose.15

We have reported on a retinal microcirculatory disor-der involved in leukocyte-endothelial cell interactionsusing acridine orange digital fluorography to visualizeleukocytes and to quantitatively evaluate their behav-ior in the retinal microcirculation in vivo.5,16−18 Thus,the present study was designed to determine whetherpitavastatin attenuates leukocyte-endothelial interac-tion induced by ischemia-reperfusion injury in the ratretina in vivo.

MATERIALS AND METHODS

Animal Preparation

All experiments were performed in accordance withthe ARVO Statement for the Use of Animals in Oph-thalmic and Vision Research. Long-Evans male pig-

mented rats, weighing 200–250 g each, were used.The animals were anesthetized with a mixture (1:1)of xylazine hydrochloride (4 mg/kg) and ketamine hy-drochloride (10 mg/kg), and the ocular surface wasanesthetized with topical eye drops containing 0.4%oxybuprocaine hydrochloride. The eyes were dilatedwith 0.5% tropicamide and 2.5% phenylephrine hy-drochloride. A contact lens was used to keep thecornea clear during the experiment. Transient retinalischemia and reperfusion were induced as describedpreviously.4,19 An optic nerve ligation model was uti-lized in this study to keep visibility of the fundus afterischemia-reperfusion. After lateral conjunctival perit-omy and disinsertion of the lateral rectus muscle, theoptic nerve of the right eye was exposed. A 6-0 nylon su-ture was passed around the optic nerve and tighteneduntil blood flow ceased in all of the retinal vessels. Com-plete nonperfusion was confirmed using an operatingmicroscope and maintained for 60 min. Thereafter, non-perfusion was confirmed, and the suture was removed.Reperfusion of the vessels was observed through theoperating microscope. Sham-operated rats (n = 5) un-derwent similar surgery but without tightening of thesuture.

Drug Administration

Pitavastatin was provided by Kowa Co. Ltd. (Nagoya,Japan). The ischemic rats were divided into fourgroups: pitavastatin-treated (0.12 mg/kg, 0.35 mg/kg,or 1.1 mg/kg) and vehicle-treated rats. The dose ofpitavastatin (0.35 mg/kg) used in rats is believed toproduce the same plasma concentration as oral admin-istration of 4 mg in humans, which is the clinical dose.15

Pitavastatin-treated rats were administered each doseof pitavastatin intravenously 5 min prior to reperfu-sion; vehicle-treated rats were given the same volumeof saline. Sham-operated (non-ischemic) rats were usedas controls.

Acridine Orange Digital Fluorography

Leukocyte dynamics in the rat retina were observedwith acridine orange digital fluorography, as de-scribed previously.20−22 A scanning laser ophthalmo-scope (Rodenstock Instruments, Munich, Germany)coupled with a computer-assisted image analysis sys-tem was used to prepare continuous high-resolutionimages of the fundus stained by the metachromatic flu-orochrome acridine orange (AO; Wako Pure Chemical,Osaka, Japan), which is widely used as a probe to quan-tify and analyze the structure of nucleic acids in bio-chemical and cytochemical studies. An argon blue laserwas used as the illumination source. Immediately afterthe AO solution was injected intravenously, leukocyteswere stained among circulating blood cells. Moreover, 11

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

K. Miyaki et al.

nuclei of vascular endothelial cells were also stained.The obtained images were recorded on a DVD for fur-ther analysis. The image was obtained in real time (30frames/sec) to 640 horizontal and 480 vertical pixelswith an intensity resolution of 256 steps. The diametersof major retinal vessels, the flux of rolling leukocytes,and the number of leukocytes accumulated in the reti-nal microcirculation were evaluated using this system.

The diameters of major retinal vessels were measuredat 1 disc diameter from the center of the optic disc inmonochromatic images recorded before AO injection.Each vessel diameter was calculated in pixels as the dis-tance between the half-height points determined sepa-rately on each side of the density profile of the vesselimage and converted into real values using the calibra-tion factor. The averages of the individual arterial andvenous diameters were used as the arterial and venousdiameters for each rat.

Rolling leukocytes were defined as leukocytes thatmoved at a velocity slower than that of free-flowingleukocytes. The number of rolling leukocytes was cal-culated from the number of cells crossing a fixed areaof the vessel at a distance of 1 disc diameter from theoptic disc center per min. The flux of rolling leukocyteswas defined as the total number of rolling leukocytesalong all major veins.

The number of leukocytes accumulated in the retinalmicrocirculation was evaluated 30 min after AO injec-tion. The number of fluorescent dots in the retina within8 to 10 areas of 100 pixels square at a distance of 1 discdiameter from the edge of the optic disc was counted.The average number of individual areas was used asthe number of leukocytes accumulated in the retinalmicrocirculation for each rat. Five different rats wereused at each timepoint in each group.

Semiquantification of ICAM-1 GeneExpression by Reverse Transcription PCR

To investigate the mechanism of pitavastatin-mediatedinhibition of the leukocyte-endothelial interactions, wedetermined mRNA expression of adhesion moleculesin rat retina 24 hr after reperfusion, after which the ratswere sacrificed. The sensory retinas were dissectedcarefully after enucleation and frozen immediatelyin liquid nitrogen. Total RNA was prepared fromfrozen tissue samples using Isogen (Nippon Gene Inc.,Tokyo, Japan) in accordance with the manufacturer’smanual. Residual DNA was removed by treatmentwith RQ1 RNase-free DNase (RQ1; Promega, Madi-son, WI, USA). Five micrograms of total RNA wasreverse transcribed into cDNA in a 20-µl reactionmixture containing Superscript II (GIBCO BRL) and

oligo (dT) primers. The cDNA was amplified usingspecific primers with a PCR system (Gene Amp PCRSystem 2400; Applied Biosystems, Inc., Foster City,CA, USA). The cDNA amplification conditions weredetermined to be optimal: 0.5 ng cDNA, 1.5 U TaqDNA polymerase (Promega), in a total volume of a25-µl mixture containing 12.5 pmol of each primer.The sequences for the ICAM-1 were upstream primer,5′-AGACACAAGCAAGAGAAGAA-3′; downstreamprimer, 5′- GAGAAGCCCAAACCCGTATG-3′.Oligonucleotide primer pairs from separate exonswere prepared for ICAM-1. The following condi-tions were used: denaturization at 94◦C for 30 sec,annealization at 54◦C for 30 sec, and polymerizationat 72◦C for 30 sec. The reaction was carried out for30 cycles. In addition, 28S mRNA was amplified as areference marker using the same RT-PCR technique(25 cycles: 30 sec at 94◦C, 30 sec at 54◦C, and 30 sec at72◦C). For 28S, a pair of oligonucleotide primers, 5′-TGTTGACGCGATGTGATTTCTGC-3′ (forward) and5′- TCTACACCTCTCATGTCTCTTCA -3′ (reverse),was prepared on the basis of a genomic sequence thatcontained no intron. We quantified PCR productsduring the exponential phase of amplification. Asnegative controls of 28S amplification, isolated totalRNAs were treated in the same way except that noreverse transcriptase was added. PCR products wererun on 2% agarose gel and stained with ethidiumbromide, and bands were visualized by scanningwith laser densitometry (FMBIO II, Hitachi, Japan).Molecular identity and homogeneity of the resultingPCR fragments were checked by DNA sequencing.

Analysis of the DNA-stained agarose gels was evalu-ated by band intensity comparison of 28S expressionversus each cytokine with NIH image. Each PCR reac-tion was repeated three times in all four eyes in eachtime group.

Statistical Analysis

All values are presented as mean ± SD. Data were com-pared by one-way analysis of variance (ANOVA); post-hoc comparisons were tested by using the Bonferroniprocedure. All values with p < 0.05 were consideredto be statistically significant.

RESULTS

Acridine Orange Digital Fluorography

Diameters of Major Retinal Vessels

Figure 1 illustrates changes in major retinal vessel di-ameters in rats at both timepoints after reperfusion.After ischemia-reperfusion, arterial vasoconstriction

12

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

Pitavastatin Improved Leukocyte Dynamics in Retina

Figure 1. Time course of major retinal arterial (A) and venous (B) diameters 12 hr (gray box) and 24 hr (black box) afterischemia-reperfusion injury. Post-ischemic arterial vasoconstriction was significantly suppressed in 0.35 and 1.1 mg/kgpitavastatin-treated rats compared with that in vehicle-treated rats (ischemic). Venous vasodilations in 0.35 and 1.1 mg/kgpitavastatin-treated rats were significantly suppressed compared with that in vehicle-treated rats (ischemic). Values are mean ±SD. †p < 0.01 compared with control rats (non-ischemic); *p < 0.01 compared with vehicle-treated rats (ischemic). Five differentrats were used at each timepoint in each group.

and venous vasodilation occurred in the major retinalvessels. In the group treated with 0.12 mg/kg pitavas-tatin, vasoconstriction tended to decrease; however, nosignificant differences were observed when comparedwith vehicle-treated rats. The rats treated with 0.35 and1.1 mg/kg pitavastatin showed mild arterial narrow-ing when compared with vehicle-treated rats at both 12and 24 hr after reperfusion (p < 0.01).

In veins, significant vasodilation was observed at 12and 24 hr after reperfusion (129.2% and 136.1% invehicle-treated rats, respectively, compared with con-trols). In the group treated with 0.12 mg/kg pitavas-tatin, vasodilation tended to decrease; however, nosignificant differences were observed when comparedwith vehicle-treated rats. In rats treated with 0.35 and1.1 mg/kg pitavastatin, venous vasodilation was sig-nificantly suppressed at both timepoints comparedwith that in vehicle-treated rats (p < 0.01). Thus,inhibition of arterial narrowing and venous dilationin pitavastatin-treated rats were observed in a dose-dependent manner.

Rolling Leukocytes

Immediately after AO was infused, many free-flowingleukocytes were visualized. In all ischemic eyes, someleukocytes were observed slowly rolling along majorretinal veins, but not along any major retinal arter-ies throughout the experiments. No rolling leukocyteswere observed along the major retinal veins in non-

ischemic control of sham-operated rats. In the grouptreated with 0.12 mg/kg pitavastatin, the number ofrolling leukocytes tended to decrease; however, nosignificant differences were observed when comparedwith vehicle-treated rats. In rats treated with 0.35 and1.1 mg/kg pitavastatin, the number of rolling leuko-cytes was significantly reduced by 35.5% and 45.2%12 hr after reperfusion compared with that in vehicle-treated (ischemic) rats (p < 0.01; Fig. 2). Thus, reductionof the rolling leukocytes in pitavastatin-treated rats wasobserved in a dose-dependent manner.

Leukocytes Accumulated in the RetinalMicrocirculation

Figure 3 indicates the number of leukocytes accumu-lating in the retinal microcirculation. In non-ischemiccontrol rats, few leukocytes could be recognized at anytimepoint. The number of accumulated leukocytes inischemic vehicle-treated eyes was significantly higherthan that of non-ischemic controls (p < 0.01). Withtreatment at a dose of 0.35 mg/kg pitavastatin, thenumber of accumulated leukocytes was reduced to 69.2% (p < 0.01) and 68.7% (p < 0.01) at 12 and 24 hr afterreperfusion, respectively (Fig. 3). The number of accu-mulated leukocytes in the rats treated with 0.12 mg/kgpitavastatin was reduced to 90.0% (p < 0.01) comparedwith those in vehicle-treated rats 12 hr after reper-fusion, showing that even low doses of pitavastatinsignificantly reduced the number of accumulated

13

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

K. Miyaki et al.

Figure 2. The number of rolling leukocytes per minute inmajor retinal veins 12 hr (gray box) and 24 hr (black box)after ischemia-reperfusion injury. Leukocyte rolling wasinhibited significantly in 0.35 and 1.1 mg/kgpitavastatin-treated rats compared with that invehicle-treated rats (ischemic). Values are mean ± SD. †p <

0.01 compared with control rats (non-ischemic); *p < 0.01compared with vehicle-treated rats (ischemic). Five differentrats were used at each timepoint in each group.

leukocytes. Thus, reduction in the number of leuko-cytes accumulated in pitavastatin-treated rats was ob-served in a dose-dependent manner.

Gene Expression of ICAM-1 in the Retina

ICAM-1 mRNA expression in the retina was semiquan-titatively studied with the RT-PCR method. Treatmentwith 0.35 mg/kg pitavastatin significantly decreasedICAM-1 mRNA expression in the retina, which wasupregulated by ischemia-reperfusion injury (Fig. 4).

DISCUSSION

It is thought that one of the causes of retinalischemia-reperfusion injury is due to accumulationof leukocytes in the retina, and that the inhibitionof leukocyte accumulation results in attenuation ofneuronal death in the retina. In fact, inhibition ofleukocyte accumulation in the post-ischemic retinaby blocking adhesion molecules has been shown inprevious studies to reduce retinal damage duringretinal ischemia-reperfusion injury.4,5

Leukocyte-endothelial interactions are regulated bymultistep processes,23 with each step being mediatedby distinct adhesion molecules.24 Leukocyte rolling isthe first step in a cascade of events that leads to firmadhesion and transmigration through the endothe-lium. This initial step that represents mild adhesionbetween leukocytes and endothelial cells is inducedmostly by the selectin family at an early stage; strong

Figure 3. Leukocyte accumulation at 24 hr after reperfusion. (A) A small number of leukocytes can be found in non-ischemicrats. (B) Increasing numbers of leukocytes accumulated in vehicle-treated rats (ischemic). (C) Significant reduction of leukocyteaccumulation was seen in statin (0.35 mg/kg)-treated rats. (D) The number of leukocytes accumulated in the retina 12 hr (graybox) and 24 hr (black box) after ischemia-reperfusion injury. Values are mean ± SD. †p < 0.01 compared with control rats (non-ischemic); *p < 0.01 compared with vehicle-treated (ischemic) rats. Five different rats were used at each timepoint in each group.

14

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

Pitavastatin Improved Leukocyte Dynamics in Retina

Figure 4. (A) ICAM-1 and 28S as a control of mRNA expression after ischemia-reperfusion injury. (B) The density ratio ofICAM-1 was analyzed by semiquantitative RT-PCR. †p < 0.01 compared with control rats (non-ischemic); *p < 0.01 comparedwith vehicle-treated rats (ischemic).

adhesion is then induced because of the upregulation ofCDllb/CD18 and activation of ICAM-1. In this study, itwas demonstrated that pitavastatin treatment reducedthe number of rolling and accumulated leukocytes ina dose-dependent manner and decreased ICAM-1 ex-pression during retinal ischemia-reperfusion injury inrats. These results suggest that the decrease in ICAM-1 expression caused by pitavastatin treatment resultsin the reduction of the number of accumulated leuko-cytes, because ICAM-1 plays an essential role in leuko-cyte adhesion.9

Tomida et al. showed that hypercholesterolemia it-self induces leukocyte accumulation in the rat retina.18

However, serum lipid levels are unchanged by pitavas-tatin administration in rats. It has also been reportedthat pitavastatin prevents NMDA-induced retinal gan-glion cell death by suppressing leukocyte recruitmentin rats.25 Therefore, it may be suggested that the con-trol action of pitavastatin on leukocyte rolling and ac-cumulation is not due to reduction of LDL cholesterol,but rather is based on pleiotropic effects of the drug.The possible molecular mechanisms are discussed:(1) Pitavastatin decreases mRNA expression of ad-hesion molecules through inhibition of small G pro-tein RhoA activation, depending on its HMG-CoAreductase inhibitory action. Hiraoka et al. showedthat pitavastatin inhibits MCP-1-induced enhance-ment of THP-1 adhesion to vascular endotheliumthrough RhoA GTPase.26 (2) Weitz-Schmidt et al.showed that several statins and LFA703, a statin-derived compound, bind directly to leukocyte functionantigen-1 (LFA-1) and inhibit LFA-1-mediated leuko-cyte adhesion.27,28 Although RhoA activation was notmeasured in the present study, and it is unknown

whether pitavastatin binds to LFA-1, there is a pos-sibility that these pleiotropic effects of pitavastatin at-tenuate ischemia-induced leukocyte-endothelial inter-actions in the rat retina after ischemia.

After ischemia-reperfusion, arterial vasoconstrictionand venous vasodilation occurred in major retinal ves-sels. However, treatment with pitavastatin reducedchanges in the diameters of the major retinal vessels.Vascular endothelium is a main source of relaxing(e.g., NO) and contracting (e.g., endothelin) factors,and accumulated leukocytes produce a large amountof NO.29,30 The interactions between these factors me-diate the vascular tone.31 Hangai et al. showed thatendothelial nitric oxide synthase mRNA increased to apeak at 12 hr and decreased progressively beyond 24 hruntil the final measurement at 96 hr of reperfusion afterretinal ischemia for 60 min.32 They also showed that in-ducible nitric oxide synthase (iNOS) mRNA was highlyupregulated 12 and 24 hr after reperfusion, when theretina was subjected to ischemia for 2 hr.30 In thisstudy, venous vasodilation in statin-treated (0.35 and1.1 mg/kg) rats was significantly suppressed at 12 and24 hr after reperfusion, compared with that in vehicle-treated rats. Statin treatment reduced the number of ac-cumulated leukocytes and therefore the amount of NO.This would partially contribute to suppression of va-sodilation by the drug.

These results suggest that pitavastatin may be use-ful in the treatment of retinal diseases caused by is-chemia. In fact, it is reported that pitavastatin protectsagainst neuronal retinal damage induced by ischemia-reperfusion injury in rats33 and NMDA-induced retinalganglion cell death.25 Inhibitory effects of pitavastatin

15

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

K. Miyaki et al.

on leukocyte-endothelial interactions may be one of themechanisms of neuroprotective effect. Intravenous ad-ministration of pitavastatin at a dose of 0.35 mg/kgin rats is believed to produce the same plasma con-centration as oral administration of 4 mg in humans,which is the clinical dose.15 In addition, pitavastatin isnot affected by first-pass liver metabolism when orallyadministered.34 Although pitavastatin was adminis-trated intravenously in this study, it is likely that thesame results would be obtained in clinical oral admin-istration of pitavastatin due to its metabolic features.

In conclusion, pitavastatin significantly inhibits leuko-cyte rolling along the major retinal veins and leukocyteaccumulation during the reperfusion period. More-over, these results suggest therapeutic potential ofpitavastatin in the treatment of ischemia-reperfusioninjury.

Declaration of interest: The authors report no conflictof interest. The authors alone are responsible for thecontent and writing of the paper.

REFERENCES1. Suzuki S, Toledo-Pereyra LH, Rodriguez FJ, Cejalvo D. Neu-

trophil infiltration as an important factor in liver ischemiaand reperfusion injury. Modulating effects of FK506 and cy-closporine. Transplantation 1993;55:1265–1272.

2. Werns SW, Shea MJ, Lucchesi BR. Free radicals in ischemic my-ocardial injury. J Free Rad Biol Med 1985;1:103–110.

3. Ghezzi P, Dinarello CA, Bianchi M, Rosandich ME, Repine JE,White CW. Hypoxia increases production of interleukin-1 andtumor necrosis factor by human mononuclear cells. Cytokine1991;3:189–194.

4. Tsujikawa A, Ogura Y, Hiroshiba N, Miyamoto K, Kiryu J,Honda Y. In vivo evaluation of leukocyte dynamics in retinal is-chemia reperfusion injury. Invest Ophthalmol Vis Sci 1998;39:793–800.

5. Matsubara A, Tomida K, Matsuda Y, et al. Protective effects ofselectin ligands/inhibitor (SKK-60060) against retinal ischemia-reperfusion injury. Exp Eye Res 2000;71:283–293.

6. Nishiwaki A, Ueda T, Ugawa S, Shimada S, Ogura Y. Upreg-ulation of P-selectin and intercellular adhesion molecule-1 af-ter retinal ischemia-reperfusion injury. Invest Ophthalmol Vis Sci2003;44:4931–4935.

7. Winn RK, Liggitt D, Vedder NB, Paulson JC, Harlan JM. Anti-P-selectin monoclonal antibody attenuates reperfusion injury tothe rabbit ear. J Clin Invest 1993;92:2042–2047.

8. Winn RK, Vedder NB, Mihelcic D, Flaherty LC, Langdale L,Harlan JM. The role of adhesion molecules in reperfusion injury.Agents Actions 1993;41:113–126.

9. Tsujikawa A, Ogura Y, Hiroshiba N, et al. Retinal ischemia-reperfusion injury attenuated by blocking of adhesionmolecules of vascular endothelium. Invest Ophthalmol Vis Sci1999;40:1183–1190.

10. Davignon J. Beneficial cardiovascular pleiotropic effects ofstatins. Circulation 2004;109:39–43.

11. Shovman O, Levy Y, Gilburd B, Shoenfeld Y. Anti-inflammatoryand immunomodulatory properties of statins. Immunol Res2002;25:271–285.

12. Honjo M, Tanihara H, Nishijima K, et al. Statin inhibitsleukocyte-endothelial interaction and prevents neuronal deathinduced by ischemia-reperfusion injury in the rat retina. ArchOphthalmol 2002;120:1707–1713.

13. Charatan F. Bayer decides to withdraw cholesterol loweringdrug. BMJ 2001;323:359.

14. Mukhtar RY, Reid J, Reckless JP. Pitavastatin. Int J Clin Prac2005;59:239–252.

15. Kojima J, Fujino H, Abe H, Yosimura M, Kanda H, Kimata H.Identification of metabolites of NK-104, an HMG-CoA reductaseinhibitor, in rat, rabbit, and dog bile. Biol Pharm Bull 1999;22:142–150.

16. Matsubara A, Tamai K, Matsuda Y, et al. Protec-tive effect of polyethylene glycol-superoxide dismutase onleukocyte dynamics in rat retinal microcirculation underlipid hydroperoxide-induced oxidative stress. Exp Eye Res2005;81:193–199.

17. Tamai K, Matsubara A, Tomida K, et al. Lipid hydroperoxidestimulates leukocyte-endothelium interaction in the retinal mi-crocirculation. Exp Eye Res 2002;75:69–75.

18. Tomida K, Tamai K, Matsuda Y, Matsubara A, Ogura Y. Hy-percholesterolemia induces leukocyte entrapment in the retinalmicrocirculation of rats. Curr Eye Res 2001;23:38–43.

19. Stefansson E, Wilson CA, Schoen T, Kuwabara T. Experimen-tal ischemia induces cell mitosis in the adult rat retina. InvestOphthalmol Vis Sci 1988;29:1050–1055.

20. Kimura H, Kiryu J, Nishiwaki H, Ogura Y. A new fluorescentimaging procedure in vivo for evaluation of the retinal microcir-culation in rats. Curr Eye Res 1995;14:223–228.

21. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Honda Y. Quanti-tative evaluation of leukocyte dynamics in retinal microcircula-tion. Invest Ophthalmol Vis Sci 1995;36:123–130.

22. Nishiwaki H, Ogura Y, Kimura H, Kiryu J, Miyamoto K, Mat-suda N. Visualization and quantitative analysis of leukocytedynamics in retinal microcirculation of rats. Invest OphthalmolVis Sci 1996;37:1341–1347.

23. Butcher EC. Leukocyte-endothelial cell recognition: Three (ormore) steps to specificity and diversity. Cell 1991;67:1033–1036.

24. Lawrence MB, Springer TA. Leukocytes roll on a selectin atphysiologic flow rates: Distinction from and prerequisite foradhesion through integrins. Cell 1991;65:859–873.

25. Nakazawa T, Takahashi H, Nishijima K, et al. Pitavastatin pre-vents NMDA-induced retinal ganglion cell death by suppress-ing leukocyte recruitment. J Neurochem 2007;100:1018–1031.

26. Hiraoka M, Nitta N, Nagai M, Shimokado K, Yoshida M. MCP-1-induced enhancement of THP-1 adhesion to vascular endothe-lium was modulated by HMG-CoA reductase inhibitor throughRhoA GTPase-, but not ERK1/2-dependent pathway. Life Sci2004;75:1333–1341.

27. Wan MX, Schramm R, Klintman D, Welzenbach K, Weitz-Schmidt G, Thorlacius H. A statin-based inhibitor of lympho-cyte function antigen-1 protects against ischemia/reperfusion-induced leukocyte adhesion in the colon. Br J Pharmacol2003;140:395–401.

28. Weitz-Schmidt G, Welzenbach K, Brinkmann V, et al. Statinsselectively inhibit leukocyte function antigen-1 by binding to anovel regulatory integrin site. Nat Med 2001;7:687–692.

29. Clark RS, Kochanek PM, Schwarz MA, et al. Inducible nitricoxide synthase expression in cerebrovascular smooth muscleand neutrophils after traumatic brain injury in immature rats.Ped Res 1996;39:784–790.

30. Hangai M, Yoshimura N, Hiroi K, Mandai M, Honda Y. In-ducible nitric oxide synthase in retinal ischemia-reperfusion in-jury. Exp Eye Res 1996;63:501–509.

31. Hiramatsu T, Forbess J, Miura T, Roth SJ, Cioffi MA,Mayer JE, Jr. Effects of endothelin-1 and endothelin-A re-

16

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.

Pitavastatin Improved Leukocyte Dynamics in Retina

ceptor antagonist on recovery after hypothermic cardioplegicischemia in neonatal lamb hearts. Circulation 1995;92:400–404.

32. Hangai M, Miyamoto K, Hiroi K, et al. Roles of constitutive nitricoxide synthase in post-ischemic rat retina. Invest Ophthalmol VisSci 1999;40:450–458.

33. Kawaji T, Inomata Y, Takano A, et al. Pitavastatin: Protec-tion against neuronal retinal damage induced by ischemia-reperfusion injury in rats. Curr Eye Res 2007;32:991–997.

34. Hayashi T, Yokote K, Saito Y, Iguchi A. Pitavastatin: Efficacyand safety in intensive lipid lowering. Expert Opin Pharmacother2007;8:2315–2327.

17

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 11

/03/

14Fo

r pe

rson

al u

se o

nly.