Cytokine 66 (2014) 101–105

Contents lists available at ScienceDirect

Cytokine

journal homepage: www.journals .e lsev ier .com/cytokine

Polymorphisms in the TNF-a and IL-10 gene promoters and riskof psoriasis and correlation with disease severity

http://dx.doi.org/10.1016/j.cyto.2014.01.0081043-4666/� 2014 Elsevier Ltd. All rights reserved.

⇑ Corresponding author. Tel.: +20 1005052080.E-mail address: haidy_menna@hotmail.com (H.E Zidan).

Rehab A Karam a, Haidy E Zidan a,⇑, Mohamed Hamed Khater b

a Medical Biochemistry Department, Faculty of Medicine, Zagazig University, Zagazig, Egyptb Dermatology Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt

a r t i c l e i n f o a b s t r a c t

Article history:Received 19 July 2013Received in revised form 9 January 2014Accepted 20 January 2014

Keywords:PsoriasisIL-10TNF-aPolymorphisms

Several cytokines were assumed to play an essential role in the induction and the pathogenesis of psori-asis. The aim of this work was to investigate the role of TNF-a-308 and IL-10-1082 polymorphisms andtheir serum levels in the pathogenesis of psoriasis and determine their relation to disease severity. 110Psoriasis patients and 120 healthy volunteers were genotyped for TNF-a-308 and IL-10-1082 polymor-phism by polymerase chain reaction. Serum level of TNF-a and IL-10 were measured by ELISA. Our studydemonstrated an association of IL-10-1082 polymorphism and psoriasis and between TNF a-308 poly-morphism and psoriasis disease and severity. Serum TNF a increased in patients, while serum IL-10decreased in patients with significant correlation between serum TNF-a and psoriasis severity. Theseresults indicated that TNF-a-308 and IL-10-1082 polymorphisms imparted significant risk towards thedevelopment of psoriasis.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction On the basis of these considerations, we designed this study to

Psoriasis is a chronic immune-mediated skin disease character-ized by clinical presentation of red, heavily scaled skin plaquescontaining dense infiltrates of T cells, macrophages, and dendriticcells (DC) as well as hyperproliferation and incomplete differenti-ation of epidermal keratinocytes [1].

IL-10 is an anti-inflammatory and immunosuppressive sub-stance that plays an important role in the regulation of immuneresponses including psoriasis [2]. The gene for IL-10 is in chromo-some region 1q31–q32. It includes multiple polymorphisms ofwhich the promoter polymorphism-1082 with the level of IL-10production may influence risk, severity or course in many autoim-mune diseases and inflammatory disorders [3,4].

Several studies examined the association between IL-10 genepolymorphisms and the risk of psoriasis but their data wereconflicting [5,6].

TNF-alpha is located in the major histocompatibility complex(MHC) region on the chromosome 6p21.3, region that showedthe strongest signal of association in the genome-wide associationstudy that included psoriatic arthritis patients [7].

Single nucleotide polymorphisms (SNPs) of the TNF-alpha geneshowed association with psoriatic arthritis in some populations[8,9], but showed no association in others [10,11].

investigate whether the polymorphisms of IL-10 A/G-1082(rs1800896) and TNF a-308G/A (rs1800629) and their serum levelscould be risk factors for the development of psoriasis in Egyptianpatients and also we examined the association of these cytokinespolymorphisms and their serum levels with the severity ofpsoriasis.

2. Material and methods

This study included 110 clinically diagnosed plaque psoriasispatients recruited during the period from January 2011 toDecember 2012 from patients admitted to the dermatologydepartment, Zagazig University, Egypt. All subjects underwentcomplete history taking. All patients were not receiving systemictreatment or biologic therapy for psoriasis for at least six monthsbefore analysis.

120 Age and sex matched healthy volunteers were included ascontrol group. The ethical committee of Zagazig Universityapproved this study and a written informed consent was obtainedfrom the patients prior to their inclusion in this work.

Psoriasis Area and Severity Index (PASI) is the most widely usedtool for the measurement of severity of psoriasis. PASI combinesthe assessment of the severity of lesions and the area affected intoa single score in the range 0 (no disease) to 72 (maximal disease)[12]. The body is divided into four sections (head (H) (10% of aperson’s skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). Each

102 R.A Karam et al. / Cytokine 66 (2014) 101–105

of these areas is scored by itself, and then the four scores are com-bined into the final PASI. For each section, the percent of area ofskin involved, is estimated and then transformed into a grade from0 to 6.

Grade 0; 0% of involved area, grade 1; <10% of involved area,grade 2; 10–29% of involved area, grade 3; 30–49% of involved area,grade 4; 50–69% of involved area, grade 5; 70–89% of involved area,grade 6; 90–100% of involved area.

Within each area, the severity is estimated by three clinicalsigns: erythema (redness), induration (thickness) and desquama-tion (scaling). Severity parameters are measured on a scale of0–4, from none to maximum. The sum of all three severity param-eters was then calculated for each section of skin, multiplied by thearea score for that area and multiplied by weight of respective sec-tion (0.1 for head, 0.2 for arms, 0.3 for body and 0.4 for legs) [12].Patients according to severity of psoriasis were classified accordingto the psoriasis Area and Severity Index into 2 groups (PASI 6 20and PASI > 20). The higher PASI score represents a greater degreeof psoriatic severity and extension [13].

2.1. Blood sampling

Blood samples were drawn from all subjects after an overnightfast and divided into 2 portions: 2 ml of whole blood were col-lected into tubes containing EDTA, for genomic DNA extraction.The remaining part was centrifuged at 3000g for 15 min and Serumsamples were stored at �20 �C until analysis.

2.2. Genomic DNA extraction

Genomic DNA was extracted from EDTA whole blood sampleusing a spin column method according to the protocol (QIAampBlood Kit; Qiagen GmbH, Hilden, Germany). DNA was stored at�20 �C till the time of use.

2.3. Amplification of IL-10-1082 polymorphism

The subjects were genotyped for IL-10-1082 polymorphism bypolymerase chain reaction–restriction fragment length polymor-phism (PCR–RFLP) as described by Persico et al. [14]. The forwardprimer F: CCAGGTAGAGCAACACTCCT and reverse primer 50R:CTCTTACCTATCCCTACTTCCGC3’ were used.

PCR was performed at 94 �C for 2 min, followed by 35 cycles at94 �C for 30 s, at 55 �C for 30 s, and 72 �C for 30 s. A final extensionstep was carried out at 72 �C for 7 min.

After RFLP analysis using enzyme (EarI) in 37 �C, the digestionproducts were visualized on a 3% agarose gel stained with ethi-dium bromide. In the presence of the IL-10-1082G allele, EarI cutthe 155 bp PCR product into two bands of 128 and 27 bp,respectively.

2.4. Amplification of TNF-a-308 polymorphism

The subjects were genotyped for TNF-a-308 polymorphism byallele-specific PCR as described by Sargen et al. [15] . The primersF: CTGCATCCCCGTCTTTCTCC, R1: ATAGGTTTTGAGGGGCATCG,and R2: ATAGGTTTTGAGGGGCATCA were used. PCR was per-formed at 96 �C for 3 min, followed by 30 cycles at 96 �C for 45 s,55 �C for 80 s, and 72 �C for 2 min. A final extension step was car-ried out at 72 �C for 3 min. PCR products (836 bp) were separatedon 2% agarose stained with ethidium bromide and translucenceby ultraviolet light, Positive amplification of one allele indicateshomozygosity for that allele, whereas positive amplification ofboth alleles indicates heterozygosity of both alleles.

2.5. Measurement of serum interleukin 10 concentration

The concentrations of IL-10 in serum were determined using adouble antibody sandwich ELISA (kit provided by Biosource EuropeS.A, Belgium) according to the manufacturer’s instructions by usingstandard curve.

2.6. Measurement of serum TNF concentration

The concentrations of TNF in serum were determined using adouble antibody sandwich ELISA kit provided by Biosource EuropeS.A, Belgium) according to the manufacturer’s instructions by usingstandard curve.

2.7. Statistical analysis

The results for continuous variables were expressed asmeans ± SD or median for IL-10 and TNF serum levels and werecompared using student t test or Mann–Whitney test wheneverpossible. Genotype frequencies in cases and controls were testedfor Hardy–Weinberg equilibrium, and any deviation between theobserved and expected frequencies was tested for significanceusing the Chi2 test. The statistical significances of differences infrequencies of variants between the groups were tested using theChi2 test. In addition, the odds ratios (ORs) and 95% confidenceintervals (CIs) were calculated as a measure of the association ofthe polymorphic sites with psoriasis and its severity. Differencewas considered significant at p < 0.05. The difference in severityof psoriasis was tested for independence from other variables bymultiple regression analysis. All data were evaluated using SPSSversion 10.0 of windows.

3. Results

110 Patients with psoriasis were included in this study. Of thesepatients, 27 were males (24.5%) and 83 were females (75.5%). Theirage ranged between 18–60 years. Their mean age and standarddeviation (SD) was 37.50 ± 8.08 years. The PASI score for clinicalassessment ranged between 7 and 65, the mean ± SD was34.5 ± 18.3. Thirty nine of the patients had mild to moderate pso-riasis (PASI 6 20), while the other 71 had severe psoriasis(PASI P 20). The control group included 120 healthy volunteers,43 males (35.8%) and 77 females (64.2%). Their age ranged between18 and 70 years with mean ± SD 38.70 ± 10.8. Controls were ageand sex matched.

The mean value (mean ± SD) of serum IL-10 level estimated inpsoriasis patients was (12.1 ± 9.8 pg/ml) and controls (19.9 ±11.1 pg/ml). A statistically significant difference was found in theserum IL-10 level between patients and controls (p < 0.0001). Themean value (mean ± SD) of serum TNF-a level estimated in psoriasispatients was (143.7 ± 79 pg/ml) and controls (26.8 ± 11.4 pg/ml). Astatistically significant difference was found in the serum TNF-álevel between patients and controls (p < 0.0001) (Table 1).

The genotype and allele frequencies of the investigatedIL-10-1082 promoter polymorphisms in patients and controls aresummarized in Table 2.

Genotype frequencies were following Hardy–Weinberg equilib-rium in cases (p = 0.99) and controls (p = 0.46). The polymorphismsof IL-10 were found to be in significant association with psoriasispatients (p 6 0.02) when genotypes were compared using chi-squared test-3 * 2 contingency table (Table 2). Also, there was sig-nificant difference in allele frequencies of these polymorphismsbetween psoriasis patients and controls when compared with2 * 2 contingency table (p 6 0.009). Carriers of the G allele are morelikely to develop psoriasis (OR = 1.64, 95% CI = 1.11–2.42) (Table 2).

Table 4Serum level of IL-10 and TNF a in relation to their different genotypes.

IL-10-1082 genotype p

AA(28) AG(55) GG(27)

Serum IL-10Mean ± SD 8.2 ± 4.2 8.5 ± 4.1 10.9 ± 5.1 0.01*

TNF-a-308 genotypes

GG(39) GA(53) AA(18)

Serum TNFMean ± SD 92.6 ± 40.9 107.1 ± 55.1 148.4 ± 74.1 0.0001*

* Significant difference between the three genotype groups as measured by oneway analysis of variance test.

Table 1Characteristics of the study groups.

Psoriasis patients(N = 110)

Control group(N = 120)

p

Age range (18–60) (18–70) 0.34Mean ± SD 37.5 ± 8.08 38.7 ± 10.8

SexMale 27(24.5%) 43(35.8%)Female 83(75.5%) 77(64.2%) 0.06

PASIRange (7–65)Mean ± SD 34.5 ± 18.3

IL-10 (pg/ml)Range (5–50) (6.7–70)Mean ± SD 12.1 ± 9.8 19.9 ± 11.1 60.0001Median 10.2 20

TNF- a (pg/ml)Range (60–390) (8–43)Mean ± SD 143.7 ± 79 26.8 ± 11.4 60.0001Median 134.5 31

R.A Karam et al. / Cytokine 66 (2014) 101–105 103

The genotype and allele frequencies of the investigatedTNF-a-308 polymorphism in patients and controls are summarizedin Table 3.

Genotype frequencies were following Hardy–Weinberg equilib-rium in cases (p = 0.65) and controls (p = 0.99). The polymorphismsof TNF-a-308 were found to be in significant association with pso-riasis patients (p 6 0.05) when genotypes were compared usingchi-squared test-3 * 2 contingency table (Table 3). Also, there wassignificant difference in allele frequencies of this polymorphismsbetween psoriasis patients and controls when compared with2 * 2 contingency table (p 6 0.01). Carriers of the G allele are morelikely to develop psoriasis (OR = 1.57, 95% CI = 1.08–2.27) (Table 3).

The relationship between serum level of IL-10 and TNF a anddifferent genotypes in patient group are summarized in Table 4.

Serum levels of IL-10 were different between IL-10-1082 GG pa-tients (10.9 ± 5.1 pg/ml) and IL-10-1082 AG(8.5 ± 4.1 pg/ml) andAA(8.2 ± 4.2 pg/ml) genotypes (p = 0.01). Also, serum levels ofTNF-a were different between TNF-308 AA(148.4 ± 74.1) patientsand TNF-a GA(107.1 ± 55.1) and GG(92.6 ± 40.9) genotypes(p = 0.0001) Table 4.

Table 3Distribution of genotypes and allele frequency of TNF-a-308 polymorphism in psoriasis p

Psoriasis patients (N = 110) n (%) Control g

TNF-a-308GG 39(35.4) 28(23.4)AG 53(48.2) 60(50)AA 18(16.4) 32(26.6)

AlleleG 131(59.6) 116(48.3A 89(40.4) 124(51.7

Table 2Distribution of genotypes and allele frequency of IL-10-1082 polymorphism in psoriasis p

Psoriasis patients (N = 110) n (%) Control gr

IL-10-1082AA 28(25.5) 45(37.5)AG 55(50) 60(50)GG 27(24.5) 15(12.5)

AlleleA 111(50.4) 150(62.5)G 109(49.6) 90(37.5)

Study participants’ characteristics associations with diseaseseverity are summarized in Table 5.

The difference in severity was tested for independence fromother variables by multiple regression analysis. The difference inseverity was found to be dependent on serum TNF level(p < 0.01) (Table 5).

4. Discussion

Psoriasis is a genetically heterogeneous disorder with multiplegenetic and environmental interactions. Based on its geneticframework, disease severity and locations may differ between indi-viduals and populations [16].

As cytokines are important immune mediators, we tested SNPsin the promoter regions of two cytokine genes for association withthis chronic inflammatory skin disease. We chose polymorphismsin the promoter regions of the TNF-a-308 and IL-10-1082 whichhad been associated with a number of immune-mediated diseases,skin diseases, and cancers. We also determined the association ofthese cytokines polymorphisms and their serum levels with theseverity of psoriasis in Egyptian patients.

As regards IL-10-1082 polymorphism, we found significant in-crease in the GG and GA genotypes and G allele in patients groupin comparison to control group.

In accordance to our results Settin et al. [17] found thatIL-10-1082 GG genotypes were higher among psoriasis patientsrecruited from the Nile Delta of Egypt. Similarly, a meta analysis

atients and control groups.

roup (N = 120) n (%) p OR (95% CI)

0.05

)) 0.01 1.57(1.08–2.27)

atients and control groups.

oup (N = 120) n (%) p OR (95% CI)

0.02

0.009 1.64(1.11–2.42)

Table 5Study participants characteristics association with disease severity.

Variable Unstandardized coefficients Standardized coefficients 95% CI T p

B Standard error b

Age 1.12E�02 0.007 0.18 �0.002 to 0.025 1.7 0.09IL-10 0.163 0.175 0.087 �0.185 to 0.510 0.928 0.356TNF 5.422E�02 0.022 0.233 0.011–0.097 2.49 0.014IL-10-1082 �9.6E�02 0.15 �0.07 �0.4 to 0.2 �0.6 0.5TNF-a-308 �6.8E�03 0.096 �0.008 �0.2 to 0. 2 �0.07 0.94

Severity (PASI score) as dependent factor.

104 R.A Karam et al. / Cytokine 66 (2014) 101–105

by Lee et al. [18] found a significant association between IL-10 Gallele and psoriasis in Asian patients.

Additionally, Craven et al. [5] demonstrated an increase in fre-quency of the IL-10 GA genotype, and a lower frequency of bothGG and AA genotypes in the subset of patients with late onsetpsoriasis.

In contrary to our results, Reich et al. [19] and Baran et al. [20]showed no significant difference in IL-10-1082 polymorphismbetween psoriasis patients and controls. Ethnic variation mightexplain these different results and this is may be confirmed by hav-ing similar results with other studies in Egypt.

As regards TNF a-308, our results demonstrated significantincrease in the GG genotype and G allele in psoriasis patients inrelation to control group.

Similar to our results, some studies have found a higher fre-quency of TNF a-308 GG in moderate to severe psoriasis patients[17] or a higher frequency of the TNF a-308G allele in patients withearly-onset psoriasis [5,19]. However, other investigators reportedno difference in the distribution of TNF-a alleles or genotypes be-tween patients and control subjects [5,6,21–23].

Contrary to our results, a meta-analysis by Li et al. [24] con-cluded that the presence of a wild-type G allele might play a pro-tective role in psoriasis. Also, Jia et al. [25] found an associationbetween AA/GA genotype and early onset psoriasis. This discrep-ancy between results may be explained by racial difference [26].

IL-10 is an anti-inflammatory cytokine that suppresses macro-phage production of cytokines/chemokines and enhances solublecytokine receptor release adding that IL-10 modulates antigen pre-sentation by dendritic cells and suppresses co-stimulatory reac-tions by a direct action on T cells [27].

In our study the level of IL-10 was significantly lower in psori-asis patients than the control group. These results were in agree-ment with Jacob et al. [27].

Also McInnes et al. [28] demonstrated that the administrationof recombinant human IL-10 also caused a selective functional sup-pression of the pro-inflammatory activities of circulating mono-cytes recording that low levels of IL-10 have been observed inthe cutaneous lesions of psoriatic patients and with establishedantipsoriatic therapy higher IL-10 mRNA levels can be found inperipheral blood mononuclear cells.

In the contrary, some other studies found that the serum IL-10levels of psoriatic patients were significantly increased in compar-ison to control group [29–32], which could be explained by a com-pensatory attempt of these patients with both skin and articulardisease to regulate the inflammatory process [27].

Regarding serum TNF-a level, in our study, it was markedly ele-vated in psoriasis patients when compared with control group. Ourresults were in agreement with previous studies [33–35]. How-ever, Jacob et al. [27] found no difference in TNF-a level in patientsand controls.

Although, numerous physiological stimuli exist for the synthe-sis of TNF-a [34,36], the increase in TNF-a in psoriasis patientswas disease induced as evidenced by fall in these values withanti-psoriatic treatment [35].

Interestingly, the finding of low levels of IL-10 (Th-2 cytokine)in patients than in controls, is consistent with the hypothesis thatpsoriasis is a Th1 mediated disease and IL-10 is a multifunctionalcytokine with diverse effects on most hematopoietic cells. IL-10downregulates cytokine production such as IL-2 synthesis by Tcells and the synthesis of the pro-inflammatory cytokines IL-1b,IL-6 and tumor necrosis factor a (TNF-a) [35].

Serum level of IL-10 were different between IL-1082 GG patientsand IL-10 AG and AA genotypes (p = 0.01) with higher level in GGgenotype in comparison to other two genotypes. These findingswere consistent with other studies [29,36]. It has been found thatstimulated mononuclear cells from patients homozygous for IL-10G have a higher transcriptional activity and secrete higher levelsof IL-10 [37]. However, in our results IL-1082 GG genotype is morecommon in psoriasis patients than in control group. So, we sug-gested that the role of IL-10-1082G/A polymorphism in the regula-tion of IL-10 production is unlikely to be the major cause of thediminished IL-10 production in psoriasis patients. Thus, othermechanisms regulating the Th1/Th2 balance are also important.Also, these polymorphisms are in close proximity to several tran-scription factors that may interfere with gene transcription [38].

Serum levels of TNF-a were different among TNF-308 AA andTNF-a GA and GG genotypes (p = 0.001). Higher level was foundin AA genotype in comparison to others. These finding were consis-tent with the results of Laddha et al. [39].

Kroeger et al. [40] showed that �308A allele gave a two-foldhigher level of transcription than the �308G allele using a lucifer-ase reporter gene assay suggesting that the �308 G/A polymor-phism plays an important role in the altered TNF-a geneexpression. Similar results were obtained by Wilson et al. [41] ina human B cell line.

In our study the frequency of G allele (associated with lowTNF-a level) is more common in psoriasis patients than in controland this incongruent result could be explained by Linkage Disequi-librium (LD) between alleles across the Major HistocompitabilityComplex (MHC) [41,42]. Thus, associations between MHC haplo-types and TNF phenotypes may not be due to the polymorphismswithin the TNF gene itself, but rather to variation in a linked genethat directly or indirectly regulates expression of TNF. However, inour patients TNF -a level is significantly higher than control group.

The difference in severity was tested for independence fromother variables by multiple regression analysis. The difference inseverity was found to be dependent on serum TNF level(p < 0.01), suggesting the role of these cytokines as objectiveparameters for disease severity. Similar to our results, Takahashiet al. [43] showed that serum level of TNF-alpha was significantlyincreased in patients with psoriasis compared with those ofhealthy controls. Also, increased serum level of this cytokine wascorrelated with PASI. Furthermore, this cytokine level wasdecreased after psoriasis treatment.

In conclusion, our study demonstrated an association ofIL-10-1082 polymorphism and psoriasis and also an associationbetween TNF a-308 polymorphism and psoriasis disease. Also,serum TNF a levels were significantly increased , while serum

R.A Karam et al. / Cytokine 66 (2014) 101–105 105

IL-10 significantly decreased in psoriatic patients in comparison tohealthy controls with significant correlation between serum TNF-aand psoriasis severity. Highlighting the role of these cytokines inthe pathogenesis and the progress of psoriasis is responsible forthe development, maintenance and resolution of psoriatic lesions.

However, we are limited by the small sample which might af-fect the statistical power of our study, thus, we recommend furtherlarge studies to ascertain our findings, also we recommend de-tailed sequential analysis of these cytokines in relation to diseaseseverity and/or treatment modalities as well as analysis of genesrelated haplotypes to ascertain its real role in disease management.

References

[1] Griffiths CE, Barker JN. Pathogenesis and clinical features of psoriasis. Lancet2007;370:263–71.

[2] Kimball AB, Kawamura T, Tejura K, Boss C, Hancox AR, Vogel JC, et al. Clinicaland immunologic assessment of patients with psoriasis in a randomized,double-blind, placebo controlled trial using recombinant human interleukin10. Arch Dermatol 2002;138(10):1341–6.

[3] Eskdale J, Kube D, Tesch H, Gallagher G. Mapping of the human IL-10 gene andfurther characterization of the 50 flanking sequence. Immunogenetics1997;46(2):120–8.

[4] Hirankarn N, Wongpiyabovorn J, Hanvivatvong O, Netsawang J, Akkasilpa S,Wongchinsri J, et al. The synergistic effect of FC gamma receptor IIa andinterleukin-10 genes on the risk to develop systemic lupus erythematosus inThai population. Tissue Antigens 2006;68:399–406.

[5] Craven N, Jackson C, Kirby B. Cytokine gene polymorphis in psoriasis. Br JDermatol 2001;144(4):849–902.

[6] Wongpiyabovorn J, Hirankarn N, Ruchusatsawat K, Yooyongsatit S,Asawanonda P, Poovorawan Y. Association of the interleukin-10 distalpromoter (-2763A/C) polymorphism with late-onset psoriasis. Clin ExpDermatol 2008;33(2):186–9.

[7] Liu Y, Helms C, Liao W, Zaba LC, Duan S, Gardner J, et al. A genome-wideassociation study of psoriasis and psoriatic arthritis identifies new disease loci.PLoS Genet 2008;4:e1000041.

[8] Hohler T, Grossmann S, Stradmann-Bellinghausen B, Kaluza W, Reuss E, deVlam K, et al. Differential association of polymorphisms in the TNF-alpharegion with psoriatic arthritis but not psoriasis. Ann Rheum Dis2002;61:213–8.

[9] Rahman P, Siannis F, Butt C, Farewell V, Peddle L, Pellett F, et al. TNF alphapolymorphisms and risk of psoriatic arthritis. Ann Rheum Dis2006;65:919–23.

[10] Gonzalez S, Martinez-Borra J, Lopez-Vazquez A, Garcia-Fernandez S, Torre-Alonso JC, Lopez-Larrea C. MICA rather than MICB, TNFA, or HLA-DRB1 isassociated with susceptibility to psoriatic arthritis. J Rheumatol2002;29:973–8.

[11] Nishibu A, Oyama N, Nakamura K, Kaneko F. Lack of association of TNF-238Aand -308A in Japanese patients with psoriasis vulgaris, psoriatic arthritis andgeneralized pustular psoriasis. J Dermatol Sci 2002;29:181–4.

[12] Langley RG, Ellis CN. Evaluating psoriasis with psoriasis area and severityindex, psoriasis global assessment, and lattice system physician’s globalassessment. J Am Acad Dermatol 2004;51:563.

[13] K-Kingo SKoks, Slim H, Vasar E. IL-10 promoter polymorphisms influencedisease severity and course in psoriasis. Genes Immun 2003;4:455–7.

[14] Persico M, Capasso M, Persico E, Masarone M, Renzo A, Spano D, et al.Interleukin-10-1082 GG polymorphism influences the occurrence and theclinical characteristics of hepatitis C virus infection. J Hepatol2006;45(6):779–85.

[15] Sargen K, Demaine AG, Kingsnorth AN. Cytokine gene polymorphisms in acutepancreatitis. JOP 2000;1(2):24–35.

[16] Burden AD, Javed S, Bailey M. Genetics of psoriasis: paternal inheritance and alocus on chromosome 6p. J Invest Dermatol 1998;110(6):958–60.

[17] Settin A, Hassan H, El-Baz R, Hassan T. Association of cytokine genepolymorphisms with psoriasis in cases from the Nile Delta of Egypt. Indian JDermatol 2011;56(3):272–7.

[18] Lee YH, Choi SJ, Ji JD, Song GG. Associations between interleukin-10polymorphisms and susceptibility to psoriasis: a meta-analysis. Inflamm Res2012;61(7):657–63.

[19] Reich K, Westphal G, Schulz T. Combined analysis of polymorphisms of thetumor necrosis factor-a and interleukin-10 promoter regions and polymorphicxenobiotic metabolizing enzymes in psoriasis. J Invest Dermatol1999;113:214–34.

[20] Baran W, Szepietowski JC, Mazur G, Baran E. IL-6 and IL-10 promoter genepolymorphisms in psoriasis vulgaris. Acta Derm Venereol 2008;88(2):113–6.

[21] Al-Heresh AM, Proctor J, Jones SM, Dixey J, Cox B, Welsh K, et al. Tumournecrosis factor-alpha polymorphism and the HLA-Cw*0602 allele in psoriaticarthritis. Rheumatology (Oxford) 2002;41(5):525–30.

[22] Gallo E, Cabaleiro T, Román M, Abad-Santos F, Daudén E. Study of geneticpolymorphisms in the tumor necrosis factor a promoter region in spanishpatients with psoriasis. Actas Dermosifiliogr 2012;103(4):301–7.

[23] Tsunemi Y, Nishibu A, Saeki H, Oyama N, Nakamura K, Kishimoto M, et al. Lackof association between the promoter polymorphisms at positions �308 and�238 of the tumor necrosis factor alpha gene and psoriasis vulgaris inJapanese patients. Dermatology 2003;207:371–4.

[24] Li C, Wang G, Gao Y, Liu L, Gao T. TNF-alpha gene promoter �238 G > A and�308 G > A polymorphisms alter risk of psoriasis vulgaris: a meta-analysis. JInvest Dermatol 2007;127:1886–92.

[25] Jia Y, Qin HJ, Zhang JX, Liu XL, Li LJ. Association of the tumour necrosis factor-apolymorphisms rs361525 and rs1800629 with susceptibility to psoriasis: ameta-analysis. Clin Exp Dermatol 2013;38(8):836–44.

[26] Oestreicher JL, Walters IB, Kikuchi T, Gilleaudeau P, Surette J, Schwertschlag U,et al. Molecular classification of psoriasis disease-associated genes throughpharmacogenomic expression profiling. Pharmacogenomics J 2001;1:272–87.

[27] Jacob SE, Nassiri M, Kerdel FA, Vince V. Simultaneous measurement of multipleTh1 and Th2 serum cytokines in psoriasis and correlation with diseaseseverity. Mediator Inflammat 2003;12(5):309–13.

[28] McInnes IB, Illei GG, Dannin CL, Yarboro CH, Crane M, Kuroiwa T, et al. IL-10improves skin disease and modulates endothelial activation and leukocyteeffector function in patients with psoriatic arthritis. J Immunol2001;167:4075–82.

[29] Turner DM, Williams DM, Sankaran D. An investigation of polymorphism inthe interleukin-10 gene. Eur J Immunogenet 1997;24(1):1–8.

[30] Elkayam O, Yaron I, Shirazi I. Serum levels of IL-10, IL-6, IL-1ra, and sIL-2R inpatients with psoriatic arthritis. Rheumatol Int 2000;19(3):101–6.

[31] Borska L, Andrys C, Krejsek J, Hamakova K, Kremlacek J, Ettler K, et al. Serumlevels of the proinflammatory cytokine interleukin-12 and the anti-inflammatory cytokine interleukin-10 in patients with psoriasis treated bythe Goeckerman regimen. Int J Dermatol 2008;47(8):800–5.

[32] Alobaidi AH, Mothana Z, Najem WS, Alsamarai AM. Adiponectin IL-10, IL-23and trace elements serum levels in patients with psoriasis. Am J DermVenereol 2012;1(2):6–23.

[33] Abanmi A, Al Harthi F, Al Agla R, Khan HA, Mohamed T. Serum levels of pro-inflammatory cytokines in psoriasis patients from Saudi Arabia. Int J Dermatol2005;44(1):82–3.

[34] Arican O, Aral M, Sasmaz S, Ciragil P. Serum levels of TNF-a, IFN-c, IL-6, IL-8, IL-12, IL-17 & IL-18 in patients with active psoriasis & correlation with diseaseseverity. Mediat Inflammat 2005;5:273–9.

[35] Verghese B, Bhatnagar S, Tanwar R, Bhattacharjee J. Serum cytokine profile inpsoriasis. A case-control study in a Tertiary Care Hospital from Northern India.Ind J Clin Biochem 2011;26(4):373–7.

[36] Moore KW, de Waal Malefyt R, Coffman RL, O’Garra A. Interleukin-10 and theinterleukin-10 receptor. Annu Rev Immunol 2001;19:683–765.

[37] Miura Y, Thoburn CJ, Bright EC, Chen W, Nakao S, Hess AD. Cytokine andchemokine profiles in autologous graft-versus-host disease (GVHD):interleukin 10 and interferon gamma may be critical mediators for thedevelopment of autologous GVHD. Blood 2002;100:2650–8.

[38] Kube D, Platzer C, von Knethen A, Straub H, Bohlen Hafner M, Tesch H.Isolation of the human interleukin 10 promoter. Characterization of thepromoter activity in Burkitt’s lymphoma cell lines. Cytokine 1996;7:1–7.

[39] Laddha NC, Dwivedi M, Begum R. Increased Tumor Necrosis Factor (TNF)-aand its promoter polymorphisms correlate with disease progression andhigher susceptibility towards vitiligo. PLoS One 2012;7(12):e52298. 20.

[40] Kroeger KM, Carville KS, Abraham LJ. The 2308 tumor necrosis factoralphapromoter polymorphism effects transcription. Mol Immunol 1997;34:391–9.

[41] Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of apolymorphism in the human tumor necrosis factor alpha promoter ontranscriptional activation. Proc Natl Acad Sci USA 1997;94:3195–9.

[42] Sariban E, Imamura K, Luebbers R, Kufe D. Transcriptional and post-transcriptional regulation of tumor necrosis factor gene expression inhuman monocytes. J Clin Invest 1988;81(1506):1510.

[43] Takahashi H, Tsuji H, Hashimoto Y, Ishida-Yamamoto A, Iizuka H. Serumcytokines and growth factor levels in Japanese patients with psoriasis. Clin ExpDermatol 2010;35(6):645–9.