EPIDEMIOLOGY

Prevalence of OXA-Type b-Lactamases AmongAcinetobacter baumannii Isolates from Northwest of Iran

Nasrollah Sohrabi,1,2 Safar Farajnia,3,4 Mohammad Taghi Akhi,2 Mohammad Reza Nahaei,2

Behrooz Naghili,1 Amir Peymani,5 Zohreh Amiri,6 Mohammad Ahangarzadeh Rezaee,2 and Nazli Saeedi 4

Carbapenems have been considered as last line antibiotics for treatment of multidrug-resistant (MDR) Acine-tobacter baumannii but carbapenem resistant A. baumannii has been increased during the last decade in manyparts of the world. OXA-type b-lactamase enzymes are the most common cause of carbapenem resistance inA. baumannii and presence of ISAba1 in upstream of these genes may increase the expression of these OXA genes.The aim of this study was to determine, for the first time, the antibiotic resistance pattern and prevalence of OXAtype b-lactamases among nosocomial A. baumannii isolates from northwest of Iran. A total of 100 A. baumanniiisolates were recovered from hospitalized patients in a university hospital in northwest of Iran. Sixty-twopercent of isolates were resistant to imipenem. All isolates carried blaOXA-51-like gene. Among imipenem resistantisolates, 88.7% carried blaOXA-23-like, 1.6% carried blaOXA-40-like, and 3.2% had blaOXA-58-like resistance genes.Ninety percent of isolates contained ISAba1 element and in 74.2% of imipenem resistant isolates, ISAba1 waslocated in upstream of blaOXA-23-like. The results of this study demonstrated high prevalence of OXA-typecarbapenemase among MDR A. bumanii in the Northwest of Iran.

Introduction

Acinetobacter baumannii is a gram-negative, nonmo-tile, and nonfermentative coccobacilli that is involved in

nosocomial infections especially in intensive care unit (ICU)wards.1,11 This bacterium is the causative agent of severaltypes of infections including pneumonia, meningitis, bac-teremia, and urinary tract infections.8

Carbapenems are among the drugs of choice for treatmentof infections caused by multi resistant gram-negative bacil-li,22 but carbapenem resistance in A. baumannii has been in-creased worldwide during the last decade. There aredifferent mechanisms involved in resistance to carbapenemantibiotics in A. baumannii among them production of OXA-type b-lactamases is the most prevalent.19,21 At the presentfive groups of OXA-type b-lactamases has been described inA. baumannii: OXA-23-like; OXA-40-like; OXA-51-like; OXA-58-like, and OXA-143-like.10,31

The first description of OXA type b-lactamase in A. bau-mannii was from Scotland in 1985 that was initially namedARI-1; this gene was later sequenced and named OXA-23.6,17

In recent years, OXA-23-producing A. baumannii strains havebeen reported from different parts of the world.15 A secondgroup of OXA type b-lactamases is OXA-40-like that wasinitially found in carbapenem resistant A. baumannii fromSpain.2 It shares 60% amino acid identity with OXA-23 and iscoded chromosomally or by plasmid. The third group com-prises of OXA-51-like that naturally occurs in A. baumannii,hence is chromosomally located. This gene shows 56%and 63% amino acid identity with OXA-23 and OXA-40-likerespectively.18 The fourth group is OXA-58-like that wasrecently identified in France.20 This enzyme is often plasmidmediated and shares < 50% amino acid identity with theother three groups,18 and recently, OXA-143 a fifth enzymewas identified in a clinical A. baumannii isolate from Brazil. Itshares 88% amino acid identity with OXA-40, 63% withOXA-23, and 52% with OXA-58.10

Insertion sequences (ISs) are the smallest and the mostabundant transposable elements. These elements containstrong promoters that play a major role in the expression ofthe antibiotic resistance genes located downstream from thesite of insertion of these mobile elements.12 Recently an IS

1Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.2Department of Microbiology, Tabriz University of Medical Sciences, Tabriz, Iran.3Biotechnology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.4Tuberculosis and Lung Disease Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.5Department of Microbiology, Qazvin University of Medical Sciences, Qazvin, Iran.6Department of Biology, Faculty of Sciences, Razi University, Kermanshah, Iran.

MICROBIAL DRUG RESISTANCEVolume 18, Number 4, 2012ª Mary Ann Liebert, Inc.DOI: 10.1089/mdr.2011.0077

385

that is named ISAba1 was identified in A. baumannii.4 It hasbeen recently suggested that presence of ISAba1 in upstreamof the OXA type b-lactamases genes can increase the ex-pression of these genes.5,28 ISAba1 might act as a strongpromoter that promotes increasing of expression of genessituated downstream from the site of insertion.28 The role ofISAba1 in the expression of the antibiotic resistance gene of A.baumannii has also been demonstrated for AmpC encodinggene, the naturally occurring cephalosporinase.4

The aim of this study was to investigate the prevalence ofOXA-type b-lactamases and the presence of ISAba1 in up-stream of these genes among A. baumannii isolates in hos-pitalized patients in the northwest of Iran.

Materials and Methods

Bacterial isolation and identification

In this prospective study between March 2008 and June2009 a total of 100 consecutive, nonduplicate A. baumanniiisolates were recovered from clinical specimens of hospital-ized patients in Imam Reza hospital (a 580-bed referralhospital with four 12-bed ICUs. The isolates were obtainedfrom invasive and noninvasive sites which include blood,tracheal aspirates, wound, sputum, abscess drainage,wound, bronchial washing, and urine. The samples weretransferred to the laboratory of the Department of Micro-biology in the faculty of Medicine and were immediatelyinoculated in MacConkey and blood agars.

The initial identification of isolates was carried out usingstandard microbiological and biochemical methods whichinclude gram-stain, colony morphology, glucose oxidation,citrate utilization, oxidase test, and growth ability at 44�C.1

Then identification of A. baumannii was confirmed usingblaOXA-51 PCR.29

Antibiotic susceptibility testing

To determine antibiotic susceptibility pattern of isolates,disc diffusion testing was carried out using Clinical La-boratory Standard Institute (CLSI) guidelines (2006).3 Anti-biotic discs used were ceftriaxone (30 mg), ceftazidime (30mg),cefepime (30mg), trimethoprim-sulfamethoxazole (1.25/23.75mg), gentamicin (10mg), amikacin (30mg) ciprofloxacin(5 mg), levofloxacin (5 mg), ampicillin-sulbactam (10/10 mg),pipracillin (100 mg), piperacillin-tazobactam (100/10mg),ticarcillin-clavulanic acid (75/10mg), imipenem (10mg), mer-

openem (10mg), colistin (10mg), and polymyxin B (300 units;MAST, Merseyside, United Kingdom). The discs were placedon Mueller Hinton agar plates inoculated with bacterial sus-pension equal to 0.5 McFarland and incubated at 37�C over-night. The diameter of the zone of growth inhibition wasmeasured using the CLSI guidelines (2006).3 Escherichia coliATCC 25922 and Pseudomonas aeruginosa ATCC 27853 wereused as controls. Isolates resistant to two or more classes ofantibiotics were classified as multidrug resistant strains.18

PCR analysis

All A. baumannii isolates were grown for 24 hrs at 37�C inMacConkey agar. DNA was extracted by boiling method.PCR was performed using specific primers,25 with an auto-mated thermal cycler (Eppendorf, Hamburg, Germany) inthe PCR cycling conditions: an initial denaturation at 94�Cfor 4 min followed by 35 cycles of denaturation at 94�C for1 min, annealing at specific temperature for each gene for1 min (Table 1), and extension at 72�C for 1 min with a finalextension cycle at 72�C for 7 min. Gel electrophoresis wasperformed for 90 min in a 1.2% agarose gel at 85 V. The genesinvestigated were consisted of blaOXA-23-like, blaOXA-40-like,blaOXA-51-like, blaOXA-58-like, and ISAba1 (Table 1).25 A. bau-mannii reference strains NCTC 12516, NCTC 13305, NCTC13304, and NCTC 13302 were used as positive controls forthe blaOXA-51-like, blaOXA-58-like, blaOXA-23-like, and blaOXA-40-like, respectively.

To determine the association between ISAba1 and blaOXA-23-like, blaOXA-58-like, and blaOXA-51-like genes, PCR mappingwas performed using ISAba1 forward primer and OXA23,OXA51, and OXA-58 reverse primers for imipenem resistantA. baumannii isolates (Table 1).25 PCR reactions were per-formed with the PCR cycling conditions: an initial cycle ofdenaturation at 94�C for 4 min followed by 35 cycles of de-naturation at 94�C for 1 min, annealing at 54�C (ISAba1F/OXA23R), 55�C (ISAba1F/OXA51R, and ISAba1F/OXA58R)for 1 min and extension at 72�C for 1 min with a final ex-tension cycle at 72�C for 5 min.

Results

A total of 100 A. baumannii isolate were recovered fromdifferent clinical specimens including: tracheal aspirate(37%), urine (21%), sputum (9%), blood (7%), bronchialwashing (6%), catheter (6%), wound (5%), abscess drainage

Table 1. Primers Used for Detection of OXA-Type b-Lactamases and ISAba1

Sequence in Acinetobacter baumannii

Primers Sequence (5¢-3¢) Product size (bp) Annealing temperature (�C)

OXA51 F AACAAGCGCTATTTTTATTTCAG 641 51OXA51 R CCCATCCCCAACCACTTTTOXA58 F AGTATTGGGGCTTGTGCT 453 49OXA58 R AACTTCCGTGCCTATTTGOXA40 F ATGAAAAAATTTATACTTCCTATATTCAGC 825 56OXA40 R TTAAATGATTCCAAGATTTTCTAGCOXA23 F GATGTGTCATAGTATTCGTCGT 1,057 54OXA23 R TCACAACAACTAAAAGCACTGTISAba1 F CATTGGCATTAAACTGAGGAGAAA 451 53ISAba1 R TTGGAAATGGGGAAAACGAA

386 SOHRABI ET AL.

(3%), cerebrospinal fluid (2%), pleural effusion (2%), andascitic fluid (2%). Seventy two (72%) patients were male and28% were female. The mean age of patients was 51 – 18.45years. A. baumannii isolates were obtained from differenthospital wards as follows; ICU wards (37%), neurosurgery(26%), internal wards (24%), infectious wards (9%), generalsurgery unit (3%), and ENT (1%).

Screening for blaOXA-51-like gene revealed that all iso-lates were positive for this gene and confirmed them asA. baumannii.

Results of antimicrobial susceptibility testing in this studyshowed that the lowest rate of resistance was seen againstcolistin (19%) and polymixin B (16%). In addition, 62% ofisolates were resistant to imipenem and meropenem (Table 2).

Of 62 imipenem and meropenem resistant isolates, 55 iso-lates (88.7%) carried blaOXA-23-like. One isolate (1.6%) carriedblaOXA-40-like and two isolates (3.2%) had blaOXA-58-like genes.Ninety (90%) of isolates contained ISAba1 (Table 3).

According to the PCR mapping results, by using ISAba1forward and OXA-23 reverse primers, 46 isolates (74.2%)gave a band of 1.5 kb whereas 3 isolates (4.8%) gave a bandof 1.1 kb, by using ISAba1 forward and OXA-51 reverseprimers. In this study of 55 A. baumannii isolates that con-tained blaOXA-23-like gene, in 46 isolates (83.6%) ISAba1 waslocated in upstream of this gene.

Discussion

A. baumannii is one of the most important gram negativebacteria that is involved in nosocomial infections especially inICU wards. The finding of this study showed that a third of A.baumannii isolates (37%) were obtained from hospitalizedpatients in ICU wards. This result is in line with previousreport about the role of A. baumannii in ICU infections.7,16

Results of this study revealed that 62% of isolates wereresistant to imipenem. In other studies previously done inIran, the resistance rate of A. baumannii isolates to imipenemhas been reported as 27.7% and 52%, respectively.7,24,27

These results indicate that the rate of resistance to carbape-nems has been significantly increased. Results of studiesfrom other countries also show that resistance rate to car-bapenems in recent years has been increased.9,26

Results of PCR amplification for detection of blaOXA-51-likerevealed that all A. baumannii isolates had blaOXA-51 gene.This finding supports the proposal that blaOXA-51-like gene isubiquitous in A. baumannii.29

OXA-23-like was the first OXA-type b-lactamase thatidentified in A. baumannii.17 In our study, 88.7% of imipenem

resistant A. baumannii isolates had blaOXA-23 like gene. This issignificantly higher than the rate of blaOXA-23-like gene re-ported from central part of Iran (25%).7,27 The prevalence ofOXA-23 in Turkey in the northwest of Iran and next to Tabrizcity was 59.1%.9 This similarity in the rate of OXA-23 in thesetwo regions could be explained by proximity of Turkey toTabriz city and high communication between people of theseregions; however this hypothesis requires typing of the iso-lates. Outbreaks of blaOXA-23-producing carbapenem resistantA. baumannii isolates have been recently reported from manycountries and this gene has found a worldwide dissemina-tion.15 In studies conducted by Mak et al. and Zhou et al.,87.5% and 94% of imipenem resistant isolates had blaOXA-23-like gene, respectively.13,32

In this study blaOXA-40-like was isolated only from oneisolate (1.6%) which was much lower than the rate of thisgene reported from Tehran in central part of Iran.7,27 Thehighest prevalence of blaOXA-40-like gene have been reportedfrom European countries such as Spain and Portugal.23,25

In this study, we identified blaOXA-58-like gene only in twoA. baumannii isolates (3.6%) that was lower than the rate (9%)previously reported from central Iran.7,27 In studies con-ducted by Ruiz et al. in Spain and Vahaboglu et al. in Turkey,19% and 17% of isolates contained blaOXA-58-like, respec-tively.25,30

Recently an IS element named ISAba1 was identified inA. baumannii.4 ISAba1 has been associated with over-expression of resistance genes such as AmpC, blaOXA-23-like,and blaOXA-51-like, which confer resistance to carbape-nems.4,5,28 PCR amplification of ISAba1 in this study detectedthis IS in 90% of A. baumannii isolates. This result is inagreement with other studies that have found ISAba1 in mostof A. baumannii isolates, for example, Ruiz et al. and Turtonet al. detected ISAba1 in 74.7% and 84% of isolates, respec-tively.25,28 Results of PCR mapping revealed that most ofresistant A. baumannii isolates (74.2%) had ISAba1 in up-stream of blaOXA-23-like gene. This finding is somewhatsimilar to results of studies done in other countries. In thesestudies 52.6%, 86%, and 94% of imipenem resistant isolateshad ISAba1 in upstream of A. baumannii isolates, respective-ly.13,28,32 These results indicate that ISAba1 is associated withblaOXA-23-like gene in most cases and may be involved inoverexpression of this gene.

Out of 55 A. baumannii isolates that contained blaOXA-23-like, 83.6% (46/55) had ISAba1 in upstream of this gene. Thisresult is in agreement with the results obtained by other re-searchers. Zhou et al. and Turton et al. reported that 97.5%and 100% of isolates with blaOXA-23-like contained ISAba1 in

Table 2. Results of Antibiotic Susceptibility Testing of 100 Acinetobacter baumannii

Isolates Collected from a Hospital in Northwest of Iran

Antimicrobial agent Resistance (%) Antimicrobial agent Resistance (%)

Ceftazidime 92 Gentamicin 86Ceftriaxone 94 Piperacillin 92Cefepime 88 Piperacillin-tazobactam 89Amikacin 81 Ticarcillin-clavulanic acid 83Ciprofloxacin 86 Meropenem 62Levofloxacin 84 Imipenem 62Ampicillin-sulbactam 80 Colistin 19Trimethoprim-sulfamethoxazole 88 Polymixin B 16

CARBAPENEMS RESISTANCE IN A. BAUMANNII 387

upstream of blaOXA-23-like gene.28,32 These results show thatISAba1 might also be responsible for the transposition andmobility of blaOXA-23-like.14

It has been reported that the expression of blaOXA-51 genein most cases is low.28 In this study we detected blaOXA-51-likegene in all A. baumannii isolates, but only three isolates thatwere resistant to imipenem had ISAba1 in upstream ofblaOXA-51-like gene. These findings indicate that the presenceof blaOXA-51-like gene alone is not sufficient to explain resis-tance to carbapenem antibiotics but presence of ISAba1 inupstream of blaOXA-51-like may involve in overexpression ofthis gene and induction of resistance to imipenem.

Findings of this study revealed that none of the two iso-lates with blaOXA-58-like had ISAba1 in upstream of blaOXA-58

gene, which means that the role of other ISs such as ISAba2,ISAba3, other ISs, and hybrid ISs in overexpression of thisgene should be studied.18

In conclusion, this study revealed for the first time thestatus of OXA-type b-lactamase genes in A. baumannii iso-lates in northwest of Iran. This study also showed thatblaOXA-23-like gene was the most prevalent carbapenemaseamong imipenem-resistant A. baumannii isolates in this areaand the most of the blaOXA-23-like producing isolates carriedISAba1 in upstream of this gene. The high frequency of blaOXA-23 with ISAbaI in our institution is a cause of concern,considering a likely clonal dissemination; efforts to controlthe transmission should be considered.

Acknowledgments

This study was supported by a research grant from In-fectious and Tropical Diseases Research Center of TabrizUniversity of Medical Sciences, Tabriz, Iran (Grant no. 21168).We thank Dr. Mohammad Mehdi Feizabadi and MorovatTaherikalani for gift of the A. baumannii reference strains.

Disclosure Statement

No competing financial interests exist.

References

1. Bergogne-Berezin, E., and K.J. Towner. 1993. Acinetobacterspp. as nosocomial pathogens: microbiological, clinical, andepidemiological features. Clin. Microbiol. Rev. 9:148–165.

2. Bou, G., A. Oliver, and J. Martinez-Beltran. 2000. OXA-24,a novel class D beta-lactamase with carbapenemase activityin an Acinetobacter baumannii clinical strain. Antimicrob.Agents Chemother. 44:1556–1561.

3. Clinical and Laboratory Standard Institute (CLSI). 2006.Performance standards for antimicrobial susceptibility test-ing: 16th Informational Supplement Document M100-S16.CLSI, Wayne, PA.

4. Corvec, S., N. Caroff, and E. Espaze. 2003. AmpC hyper-production in Acinetobacter baumannii clinical isolates. J.Antimicrob. Chemother. 52:629–635.

5. Corvec, S., L. Poirel, T. Naas, H. Drugeon, and P. Nord-

mann. 2007. Genetics and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-23 in Acinetobacter bau-mannii. Antimicrob. Agents Chemother. 51:1530–1533.

6. Donald, H.M., W. Scaife, S.G.B. Amyes, and H.K. Young.

2000. Sequence analysis of ARI-1, a novel OXA beta-lactamase, responsible for imipenem resistance in Acine-tobacter baumannii. Antimicrob. Agents Chemother. 44:

196–199.7. Feizabadi, M.M., B. Fathollahzadeh, M. Taherikalani, M.

Rasoolinejad, N. Sadeghifard, M. Aligholi, S. Soroush,

and S. Mohammadi-Yegane. 2008. Antimicrobial suscepti-bility patterns and distribution of blaOXA genes among Aci-netobacter spp. isolated from patients at Tehran hospitals.Jpn. J. Infect. Dis. 61:274–278.

8. Fournier, P.E., and H. Richet. 2006. The epidemiology andcontrol of Acinetobacter baumannii in health care facilities.Clin. Infect. Dis. 42:692–699.

9. Gur, D., V. Korten, S. Unal, L. Deshpande, and M. Cas-

tanheira. 2008. Increasing carbapenem resistance due to theclonal dissemination of oxacillinase (OXA-23 and OXA-58)-producing Acinetobacter baumannii: report from the TurkishSENTRY Program site. J. Med. Microbiol. 57:1529–1532.

10. Higgins, P.G., L. Poirel, M. Lehmann, P. Nordmann, and

H. Seifert. 2009. OXA-143, a novel carbapenem-hydrolyzingclass D b-lactamase in Acinetobacter baumannii. Antimicrob.Agents Chemother. 53:5035–5038.

11. Katsaragakis, S., H. Markogiannakis, K.G. Toutouzas, P.

Drimousis, A. Larentzakis, E.M. Theodoraki, and D.

Theodorou. 2008. Acinetobacter baumannii infections in asurgical intensive care unit: predictors of multi-drug resis-tance. World J. Surg. 32:1194–1202.

12. Mahillon, J., and M. Chandler. 1998. Insertion sequensce.Microbiol. Mol. Biol. Rev. 62:725–774.

13. Mak, J.K., M.J. Kim, J. Pham, J. Tapsall, and P.A. White.

2009. Antibiotic resistance determinants in nosocomialstrains of multidrug-resistant Acinetobacter baumannii. J.Antimicrob. Chemother. 63:47–54.

14. Mugnier, P.D., L. Poirel, M. Pitout, and P. Nordmann.

2008. Carbapenem resistant and OXA-23-producing Acine-tobacter baumannii isolates in the United Arab Emirates. Clin.Microbiol. Infect. 14:879–882.

15. Mugnier, P.D., L. Poirel, T. Naas, and P. Nordmann. 2010.Worldwide dissemination of the blaOXA-23 carbapenemasegene of Acinetobacter baumannii. Emerg. Infect. Dis. 16:35–40.

16. Papa, A., V. Koulourida, and E. Souliou. 2009. Molecularepidemiology of carbapenem-resistant Acinetobacter bau-mannii in a newly established Greek hospital. Microb. DrugResist. 15:257–260.

17. Paton, R., R.S. Miles, J. Hood, and S.G.B. Amyes. 1993.ARI-1: b-lactamase-mediated imipenem resistance in Acine-tobacter baumannii. Int. J. Antimicrob. Agents 2:81–87.

18. Peleg, A.Y., H. Seifert, and D.L. Paterson. 2008. Acineto-bacter baumannii: emergence of a successful pathogen. Clin.Microbiol. Rev. 21:538–582.

19. Perez, F., A. Hujer, K. Hujer, B. Decker, P. Rather, and R.

Bonomo. 2007. Global challenge of multidrug-resistant

Table 3. Distribution of OXA-Type b-Lactamase

Genes in Imipenem Resistant

Acinetobacter baumannii Isolates

Resistance determinants Cases (no.) Percent

blaOXA-51-like only 1 1.6blaOXA-51-like + blaOXA-40-like 1 1.6blaOXA-51-like + blaOXA-58-like 2 3.2blaOXA-51-like + blaOXA-23-like 9 14.5blaOXA-51-1ike + ISAba1- blaOXA-23-like 46 74.2blaOXA-51-1ike + ISAba1- blaOXA-51-like 3 4.8Total 62 100

388 SOHRABI ET AL.

Acinetobacter baumannii. Antimicrob. Agents Chemother.51:3471–3484.

20. Poirel, L., S. Marque, C. Heritier, C. Segonds, G. Chaba-

non, and P. Nordmann. 2005. OXA-58, a novel class Db-lactamase involved in resistance to carbapenems in Aci-netobacter baumannii. Antimicrob. Agents Chemother. 49:

202–208.21. Poirel, L., and P. Nordmann. 2006. Carbapenem resistance

in Acinetobacter baumannii: mechanism and epidemiology.Clin. Microbiol. Infect. 12:826–836.

22. Quale, J., S. Bratu, D. Landman, and R. Heddurshetti. 2003.Molecular epidemiology and mechanisms of carbapenemresistance in Acinetobacter baumannii endemic in New YorkCity. Clin. Infect. Dis. 37:214–220.

23. Quinteira, S., F. Grosso, H. Ramos, and L. Peixe. 2007.Molecular epidemiology of imipenem-resistant Acinetobacterhaemolyticus and Acinetobacter baumannii isolates carryingplasmid-mediated OXA-40 from a Portuguese hospital.Antimicrob. Agents Chemother. 51:3465–3466.

24. Rahbar, M., K.M. Monnavar, K.K. Vatan, A. Fadaei-haq,

and F. Shakerian. 2008. Carbapenem resistance in gram-negative bacilli isolates in an Iranian 1000-bed TertiaryHospital. Pak. J. Med. Sci. 24:537–540.

25. Ruiz, M., S. Marti, F. Fernandez-Cuenca, A. Pascual, and J.

Vila. 2007. High prevalence of carbapenem-hydrolysingoxacillinases in epidemiologically related and unrelatedAcinetobacter baumannii clinical isolates in Spain. Clin. Mi-crobiol. Infect. 13:1192–1198.

26. Stoeva, T., P.G. Higgins, E. Savov, R. Markovska, I. Mitov,

and H. Seifert. 2009. Nosocomial spread of OXA-23 andOXA-58 beta-lactamase-producing Acinetobacter baumannii ina Bulgarian hospital. J. Antimicrob. Chemother. 63:618–620.

27. Taherikalani, M., B. Fatolahzadeh, M. Emaneini, S. Sor-

oush, and M.M. Feizabadi. 2009. Distribution of different

carbapenem resistant clones of Acinetobacter baumannii inTehran hospitals. New Microbiol. 32:265–271.

28. Turton, J.F., M.E. Ward, N. Woodford, M.E. Kaufmann, R.

Pike, D.M. Livermore, and T.L. Pitt. 2006. The role ofISAba1 in expression of OXA carbapenemase genes in Aci-netobacter baumannii. FEMS Microbiol. Lett. 27:351–353.

29. Turton, J.F., N. Woodford, J. Glover, S. Yarde, M.E.

Kaufmann, and T.L. Pitt. 2006. Identification of Acineto-bacter baumannii by detection of the blaOXA-51-like carbape-nemase gene intrinsic to this species. J. Clin. Microbiol.44:2974–2976.

30. Vahaboglu, H., F. Budak, M. Kasap, G. Gacar, S. Torol, A.

Karadenizli, F. Kolayli, and C. Eroglu. 2006. High preva-lence of OXA-51-type class b-lactamases among ceftazidime-resistant clinical isolates of Acinetobacter spp.: co-existencewith OXA-58 in multiple centres. J. Antimicrob. Chemother.58:537–542.

31. Walther-Rasmussen, J., and N. Høiby. 2006. OXA-typecarbapenemases. J. Antimicrob. Chemother. 57:373–383.

32. Zhou, H., B.R. Pi, Q. Yang, Y.S. Yu, Y.G. Chen, L.J. Li, and

S.S. Zheng. 2007. Dissemination of imipenem-resistantAcinetobacter baumannii strains carrying the ISAba1 blaOXA-23

genes in a Chinese hospital. J. Med. Microbiol. 56:1076–1080.

Address correspondence to:Safar Farajnia, Ph.D.

Molecular Biology LabBiotechnology Research Center

Tabriz University of Medical SciencesTabriz 51656-65811

Iran

E-mail: farajnias@tbzmed.ac.ir

CARBAPENEMS RESISTANCE IN A. BAUMANNII 389