of April 6, 2018.This information is current as

RearrangementsOccurs in T Cells After Termination of TCRKiller-Cell Ig-Like Receptor Expression Regulation of Inhibitory and Activating

Eric Vivier and Marc BonnevilleMoretta,Elisabeth Houssaint, Nicolas Schleinitz, Alessandro

François Romagne, Emmanuel Scotet, Xavier Saulquin,Jean-François Morcet, Franck Halary, François Davodeau, Frédéric Vely, Marie-Alix Peyrat, Christelle Couedel,

http://www.jimmunol.org/content/166/4/2487doi: 10.4049/jimmunol.166.4.2487

2001; 166:2487-2494; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/166/4/2487.full#ref-list-1

, 26 of which you can access for free at: cites 54 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2001 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Regulation of Inhibitory and Activating Killer-Cell Ig-LikeReceptor Expression Occurs in T Cells After Termination ofTCR Rearrangements1

Frederic Vely,2† Marie-Alix Peyrat, 2* Christelle Couedel,2* Jean-Francois Morcet,*Franck Halary,* Francois Davodeau,* Francois Romagne,§ Emmanuel Scotet,*Xavier Saulquin,* Elisabeth Houssaint,* Nicolas Schleinitz,† Alessandro Moretta,¶ Eric Vivier, †‡

and Marc Bonneville3*

A small fraction of T cells expresses killer-cell Ig-like receptors (KIR), a family of MHC class I-specific receptors that can modulateTCR-dependent activation of effector functions. Although KIR1 cells are enriched within Ag-experienced T cell subsets, theprecise relationships between KIR1 and KIR 2 T cells and the stage of KIR induction on these lymphocytes remain unclear. Inthis study, we compared KIR2 and KIR 1 ab T cell clones, sorted by means of the CD158b (KIR2DL2/KIR2DL3/KIR2DS2)specific mAb GL183. We isolated several pairs of CD158b1 and CD158b2 ab T cell clones sharing identical productive andnonproductive TCR transcripts. We showed that expression of functional KIR on T cells is regulated after termination of TCRrearrangements. Transcriptional regulation of KIR genes was documented in multiple T cell clones generated from the samedonor, and the presence of KIR transcripts was also detected in KIR2 T cells. These results document a complex regulation of KIRexpression in T cells at both pre and posttranscriptional levels, under the control of yet undefined signals provided in vivo.TheJournal of Immunology,2001, 166: 2487–2494.

N atural killer and T cells play central and complementaryfunctions in immunity against transformed or virus-in-fected cells. Although T cell-mediated elimination of

target cells is achieved through recognition of Ags bound to MHCmolecules, NK cell activation is in most cases negatively affectedby the presence of MHC class I products on target cells (1–3). Themolecular basis of these opposite behaviors of T and NK cells waselucidated with the identification of several NKR able to deliverinhibitory signals to effector cells upon recognition of MHC classIa or Ib molecules (4–7). In humans, these inhibitory MHC recep-tors fall into two major groups showing homology to either C-typelectins or Ig. Among members of the first group were identifiedseveral HLA-E-reactive heterodimeric receptors comprising an in-variant CD94 subunit paired to NKG2 polypeptides (8–9). Inhib-itory NKR belonging to the Ig superfamily (also referred to as

killer-cell Ig-like receptors (KIR)4) are either monomeric(KIR2DL1/KIR2DL2/KIR2DL3/KIR2DL4/KIR3DL1) or ho-modimeric (KIR3DL2) (5, 6). Although KIR2DL1 and KIR2DL2/2DL3 receptors recognize products of particularHLA-Cw alleles(e.g.,Cw2/4/5/6/15/1602/1701for the former, andCw1/3/7/8/12/13/14/1601/1603for the latter), KIR3DL1 receptors interact withmultiple HLA-B molecules (Bw*04), KIR3DL2 receptors may rec-ognize particular HLA-A (e.g.,A*03 and A*011) alleles andKIR2DL4 receptor recognizes the nonclassical HLA-G molecule(11–17). A novel family of broadly distributed leukocyte Ig-likereceptors (LIRs)/Ig-like transcripts (ILTs) has been more recentlydiscovered (18–20). On lymphocytes, ILT-2 (LIR-1) has beenshown to interact with a broad spectrum of HLA-A and HLA-Balleles as well as with HLA-G (18, 21).

Inhibitory NKR (KIR-long (KIR-L) molecules, LIR-1/ILT-2,NKG2A) harbor an intracytoplasmic immunoreceptor tyrosine-based inhibition motif, which is responsible for the inhibitory func-tion of the receptor (5, 7). Activating NKR have also been de-scribed. Activating NKR (KIR-short (KIR-S) molecules, LIR-7/ILT-1) have no intracytoplasmic immunoreceptor tyrosine-basedinhibition motif, but are associated with immunoreceptor tyrosine-based activation molecule-bearing transduction polypeptides suchas killer cell-activating receptor-associated protein/DAP12 (KIR-Smolecules, NKG2C) or FcRg (LIR-7/ILT-1) (7).

NKRs are not specific NK cell markers. Their distribution in-cludes subsets ofab andgd T lymphocytes (14, 22–25). NKR1

ab T cells are preferentially found within Ag-experienced subsets(26), thus suggesting selective NKR induction or expansion ofNKR1 T cells during in vivo T cell responses. In this regard,cytokines such as IL-15 and TGF-b have been implicated in the

*Institut National de la Sante et de la Recherche Medicale, Unite 463, Institut deBiologie, Nantes, France;†Centre d’Immunologie, Institut National de la Sante´ et dela Recherche Medicale/Centre National de la Recherche Scientifique de MarseilleLuminy, Marseille, France;‡Institut Universitaire de France, Paris, France;§Immu-notech SA, Marseille, France; and¶Istituto di Istologia, Universita di Genoa, Genoa,Italy

Received for publication November 23, 1999. Accepted for publication December1, 2000.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisementin accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported in part by the Association pour la Recherche sur le Cancerby institutional grants from Institut National de la Sante et de la Recherche Medicaleand by ZENECA (to F.V.).2 F.V., M.-A.P., and C.C. contributed equally to this work.3 Address correspondence and reprint requests to Dr. Marc Bonneville, InstitutNational de la Sante et de la Recherche Medicale, Unite 463, Institut de Biologie, 9quai Moncousu, 44035 Nantes Cedex 01, France. E-mail address: bonnevil@nantes.inserm.fr

4 Abbreviations used in this paper: KIR, killer-cell Ig-like receptor; BLC, B lympho-blastoid cell; RT, reverse transcription; LIR, leukocyte Ig-like receptor; ILT, Ig-liketranscript; KIR-L, KIR-long; KIR-S, KIR-short.

Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

induction of CD94/NKG2A dimers observed on some CD81 Tcells following their in vitro activation (27, 28). Whether a similarmechanism applies for KIR is yet unclear; in particular, directevidence for in vitro or in vivo induction of KIR on mature lym-phoid cells is still lacking.

Here, we have studied the Ag specificity and TCR features ofKIR1 and KIR2 ab T lymphocytes derived from cells involved ina chronic in vivo response against EBV. We characterized severalpairs of KIR1 and KIR2 T cell clones expressing identical TCRtranscripts, indicating that regulation of KIR expression occurs af-ter termination of TCR rearrangements.

Materials and MethodsAbs and reagents

The following mAb have been described earlier (4) and were used for flowcytometry analyses, immunomagnetic sorting, as well as for functionalassays: EB6 (CD158a, anti-KIR2DL1 (p58.1) and KIR2DS1 (p50.1));GL183 (CD158b, anti-KIR2DL2/2DL3 (p58.2) and KIR2DS2 (p50.2));Z276 (anti-KIR3DL1 (p70)); Q66 (anti-KIR3DL2 (p140)); and FS172 (anti-KIR2DS4 (p50.3)). Synthetic peptides corresponding to previously definedEBV epitopes (BMLF1/HLA-A2, GLCTLVAML; BZLF1/HLA-B4002,SENDRLRLL; and BZLF1/HLA-B35, PCVLWPVLPEPLPQGQLTAYHVS) (29) were obtained from Chiron Mimotopes (Victoria, Australia).

Cells

B lymphoblastoid cells (BLC) were grown in RPMI 1640 medium with 2mM L-glutamine and 8% pooled human serum (culture medium). SynovialT cell lines were isolated, cultured, sorted, and cloned as described (29,30). The HLA haplotypes of donors A and B were as follows: HLA-A2,-B27, -B61, -Cw1, and Cw15 for donor A, HLA-A24, -A31, -B35, -B60,-Cw3, and -Cw7 for donor B. For immunomagnetic sorting, T cells wereincubated with anti-KIR mAb for 45 min, washed once, and rotated for 4 hat 4°C with magnetic beads coated with sheep anti-mouse IgG (Dynal,Oslo, Norway). After eight washes, bead-adherent cells were either seededat 0.3 cells/well (for direct cloning) or expanded in bulk cultures in culturemedium supplemented with rIL-2 (150 IU/ml; Chiron Mimotopes) andrestimulated at 3-wk intervals with purified lectin (leukoagglutinin, 0.5mg/ml; Sigma, Les Ulis, France) in the presence of irradiated allogeneicPBMC and BLC (25, 31).

Flow cytometry analysis

Cells were phenotyped by indirect immunofluorescence as described (25,31). In brief, cells were incubated first with unconjugated mAb for 30 minat room temperature, washed, and incubated with FITC-conjugated rabbitanti-mouse Ig antiserum (BioAtlantic, Nantes, France) for 30 min on ice.After washing, cells were analyzed by flow cytometry on a FACScan ap-paratus (Becton Dickinson, Mountain View, CA) using the LYSYS II soft-ware package on a FACStation. For intracellular staining, cells were per-meabilized in saponin buffer (PBS plus 0.1% BSA plus 0.1% saponin(Sigma) previous staining and flow cytometry was performed as describedabove using reagents reconstituted in saponin buffer. All washes were per-formed in saponin buffer.

Analysis of TCR transcripts

For TCRa transcripts, RNA from 53 106 T cells was extracted usingTRIzol reagent (Life Technologies, Rockville, MD) according to the sup-plier’s instructions, and was dissolved in 40ml water. Reverse transcription(RT) was performed on 2.5ml of the RNA solution in a final volume of12.5ml for 30 min at 45°C in a mix containing 50 mM Tris-HCl (pH 8.3),75 mM KCl, 3 mM MgCl2, 10 mM DTT, 10 U rRNasin (Promega, Mad-ison, WI), 1 mM of each dNTP, 100 U Moloney murine leukemia virusreverse transcriptase (Life Technologies) and 25 pM of the Ca-specificprimer 59-TGAAGTCCATAGACCTCATGTC. For each clone, five PCRwere performed using sets of degenerate Va primers described elsewhere(32). Each PCR was completed to 50ml with a 13 mix of Taq DNApolymerase (Pharmacia, Piscataway, NJ), 1.25 U ofTaqDNA polymerase,25 pM of mixed Va primers. Amplification was performed as described(31, 33). Amplified products were directly sequenced (without previousplasmid cloning) as described (31–33) using Sequenase (Amersham, Ar-lington Heights, IL) and the Ca sequencing primer, 59-CTTTGTGACACATTTGTTTGAG.

For TCRb transcripts, RT was performed using a CbI reverse primer(59-GCAGACAGGACCCCTTGCTGG) as described above. Amplifica-

tion was performed using the following degenerate Vb primers: 59-CAYN-RVDMYRTBTMYTGGTA and 59-CMYRMHMMYMTKTWYTGGTA(Y 5 C1T, N 5 A1C1G1T, R5 A1G, V 5 G1A1C, D 5 G1A1T,M 5 A1C, B 5 G1T1C, H 5 A1T1C, K 5 G1T, W 5 A1T). Asecond PCR was then performed using a nested Cb primer (59-GTGGC-CAGGCACACCAGTGTG) as described (31–33). Bands of interest werepurified and sequenced as described above.

Functional assays

COS cell transfection assay was performed by the DEAE-dextran chloroquinemethod (34). In brief, 1.53 104 COS cells were cotransfected with 100 ng ofan expression vector coding for an EBV protein and 100 ng of an expressionvector coding for an HLA allele. Transfected COS cells were tested 48 h aftertransfection for their ability to trigger TNF secretion by 105 responding T cellsafter a 6-h incubation at 37°C. TNF released in culture supernatants was quan-titated by a bioassay using Wehi 164 cells (35).

For the peptide-induced “fratricide” assay, CTL were incubated for 2 hwith 10 mM peptide and washed once, and cell lysis was estimated by flowcytometry on the basis of forward/side scatter patterns and propidium io-dide exclusion (29).

For 51Cr-release assays, cytotoxic activity of CTL clones was also es-timated by a regular51Cr-release assay against51Cr-labeled BLC loadedwith antigenic peptide at a 10/1 E:T ratio, and the percent of specific targetlysis calculated as previously described (31). Peptide loading of BLC wasperformed as described in Ref. 29. In brief,51Cr-labeled BLC were incu-bated with 10mM of synthetic antigenic peptide for 1 h in 200ml of RPMI1640 plus 8% FCS, then washed three times in RPMI 1640/FCS previousto use in CTL assays. In some instances, the CTL assay was performed inthe presence of GL183 mAb; in this case, effector cells were preincubatedfor 15 min with GL183 mAb (1/4 final hybridoma supernatant) and thenadded to peptide-loaded target cells expressing the relevant HLA restrict-ing element (e.g., HLA-B35 in the experiment shown in Fig. 2) with orwithout the relevant KIR ligand.

KIR repertoire analysis

DNA and total RNA were prepared from 53 106 T cell clones using theTRIzol reagent (Life Technologies) according to the manufacturer’sinstructions. Total RNA (5mg) was used for cDNA conversion in a totalvolume of 30ml using a first-strand cDNA synthesis kit (Life Tech-nologies). Determination of the KIR repertoire was performed by PCRusing for each amplification either 200 ng of genomic DNA for genomictyping, or 2 ml of cDNA synthesis reaction for transcripts detection.Specific oligonucleotides for genomic and cDNA sequences, and PCRconditions were described previously (36, 37). To verify the specificityof the primers designed to detect KIR sequences, vectors containing asingle KIR cDNA sequence (KIR2DS1,KIR2DL1, KIR2DL3, orKIR2DS2) or a bacterial artificial chromosome (BAC) containingKIR2DL1, KIR3DL1, KIR3DL2, andKIR2DS4genes (kindly providedby Dr. N. Wagtmann), were used as matrices in the PCR-based assay.At a concentration of 0.1 pg of plasmid or 200 ng of BAC, only specificamplifications of theKIR cDNA or genomic sequences by appropriateprimer pairs were detected.

Semiquantitative PCR analysis and sequencing

To compare the amount of KIR2DL3 or KIR2DS2 transcripts in T cellclones, 5ml of diluted (1021 to 1023) or not (100) cDNA were used in aPCR assay to coamplify humanb-actin and KIR2DL3 or KIR2DS2. Thematrix concentration of the various T cell clones that led to a similar humanb-actin amplification was determined and the amplification levels ofKIR2DL3 or KIR2DS2 at these concentrations were compared.

Full-length cDNAs ofKIR2DL3were obtained from T cell clones RNAby RT-PCR using oligo(dT) RT and PCR amplification using 59-KIR2DL3/2DS2 primer (TCGCTCATGGTCGTCAGCATGGTGTGT)and 39-KIR2DL3/2DS2 primer (AGGGCTCAGCATTTGGAAGTTCCGT). Amplified products were cloned in pGEM-T-easy vector and se-quenced using M13 reverse and T7 primers (ABI Prism 3; Perkin-Elmer,Norwalk, CT).

ResultsIsolation of CD1581 and CD1582 ab T cells sharing identicalin-frame and out-of-frame TCR transcripts

Several indirect observations, such as the preferential KIR expres-sion on T cells with memory features (26), suggest that surface

2488 REGULATION OF KIR EXPRESSION ON T CELLS

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

KIR are induced at late stages of T cell differentiation, after ter-mination of TCR rearrangements. However, this hypothesis re-mains to be formally proven. Indeed despite numerous attempts, ithas not been possible to induce or modulate surface KIRs on es-tablished T cell clones in vitro, even in the presence of cytokines(e.g., IL-15, IL-4, IL-12, IFN-g, and TGFb) known to affect sur-face expression of lectin-like NKRs, such as CD94-NKG2 het-erodimers (27, 38). A way to demonstrate this would be to isolatepairs of clones differing by their KIR phenotype but expressingidentical TCRs. To this end, we attempted to isolate KIR1 andKIR2 ab T cell clones showing the same antigenic specificity.CD158b1 (GL1831) KIR1 T cell lines were generated from twosynovial T cell lines derived from rheumatoid arthritis patients,which were previously shown to be selected in vivo by a restrictedset of well-defined EBV-derived Ags (29, 39). The specificity ofunsorted (predominantly CD158b2) and CD158b1 T cells derivedfrom these patients was then determined by testing their reactivityto COS cells cotransfected with cDNAs coding for various EBV/HLA combinations (29, 34). The CD158b1 cell lines derived fromboth patients reacted to few dominant EBV/HLA combinationsalso recognized by unsorted autologous T cell lines (data notshown). T cell clones were then generated from CD158b1 andunsorted T cell lines, checked for CD158b expression, andscreened for their reactivity against the aforementioned dominantviral Ag in a peptide-induced fratricide assay. Several CD158b2

and CD158b1 clones recognizing the same EBV epitope (BMLF1/A2) were isolated from one patient (A). Similarly, we obtainedfrom the other patient (B), CD158b2 and CD158b1 T cell clonesreacting against another EBV Ag (BZLF1/HLA-B35 epitope).Representative CD158b2 (A4.5, B2.5) and CD158b1 (AGL10,BGL19) T cell clones derived from patients A (A4.5, AGL10) andB (B2.5, BGL19) are shown in Fig. 1. TCRa and b transcriptsderived from these clones were then amplified by RT-PCR and thecorresponding V(D)J junctional regions sequenced. TCRa- andb-chains with identical junctional sequences were identified in thetwo pairs of KIR1 and KIR2 T cell clones reacting against theabove Ags (Table I). Of note, KIR1 and KIR2 T cell clones sharednot only in-frame but also out-of-frame TCR transcripts (Table I),thus proving that they were the progeny of the same mature T cellclone. Taken together, these data formally demonstrated that theregulation of KIR cell surface expression occurs after terminationof TCR gene rearrangements.

Functional analysis of KIR1 and KIR2 ab T cell clones

The functionality of KIRs on the aforementioned T cell clones wasstudied by analyzing the effect of KIR engagement on T cell clonecytolytic activity. Cross-linking of CD158b using mAb GL183induced partial inhibition of anti-CD3 redirected lysis of murineFcR1 P815 cells by the CD158b1 clone BGL19, when comparedwith its CD158b2 counterpart (clone B2.5) (data not shown). Sim-ilar results were obtained when KIR were cross-linked by theirphysiological ligands (i.e., using HLA-Cw31 or Cw71 targets)and the T cell clone activated by its nominal peptidic Ag. Indeed,EBV peptide-loaded BLC lacking CD158b ligands (e.g., HLA-Cw41 targets) were more efficiently lysed by the CD158b1 cloneBGL19 than those expressing CD158b ligands (e.g., HLA-Cw3/71

targets) (Fig. 2A,right). By contrast, Cw41 and Cw3/71 BLCloaded with the HLA-B35-restricted BZLF1 peptidic Ag werelysed to a similar extent by the KIR2 clone B2.5 (Fig. 2A,left).This difference was exclusively accounted for by KIR engagementbecause efficient cytolysis of Cw3/71 target cells by clone BGL19was fully restored when masking KIR during the CTL assay (Fig.2B). Taken together, these results indicated that the CD158b mol-ecules on clone BGL19 were functional as inhibitory receptors forHLA-Cw3/Cw7.

Transcriptional and posttranscriptional control of KIRexpression inab T cells

A PCR-based analysis of the KIR repertoire was performed onKIR1 and KIR2 T cell clone DNA and RNA. Genotype of T cellclones derived from donor B (B2.5, BGL19) is2DL11, 2DL2-,2DL31, 3DL11, 3DL21, 2DS1-, 2DS2-, 2DS3-, 2DS41, 2DS5-,and3DS12 (Table II and Fig. 3). Genotype of cells from donor Aorigin (AGL10 and A4.5) is2DL11, 2DL21, 2DL31, 3DL11,3DL21, 2DS11, 2DS21, 2DS3-, 2DS41, 2DS5-, and3DS12 (Ta-ble II and Fig. 3). Evidence for a transcriptional regulation ofKIRgenes was obtained by comparing the transcripts and the genesdetected in a given cell (Table II and Fig. 3). In AGL10 cells,neither 2DS1 nor 2DS4 transcripts were detected, while2DS1and2DS4genes were present. Similarly, in A4.5 cells, no transcriptsfor 2DL1, 2DL2, 3DL1, 3DL2, 2DS1, or 2DS4 were detected de-spite the presence of the corresponding genes.

FIGURE 1. Identification of pairs of KIR1 andKIR2 T cell clones reacting against identical MHC/EBV peptide complexes.A, Flow cytometry analysisof T cell clones derived from patients A and B usingKIR-specific mAb. Shown are the fluorescence histo-grams (in log scale) obtained by staining T cell cloneswith GL183 mAb (open histogram) or an irrelevantisotype-matched mAb (filled histogram). Backgroundstaining was obtained with all the other NKR-specificmAb tested (i.e., EB6, ZIN276, DEC66, andFSTR172).B, Identification of EBV Ags recognizedby KIR1 and KIR2 T cell clones. T cell clone reac-tivity was evaluated against EBV peptides correspond-ing to the major EBV epitopes identified at the poly-clonal level (see text). Because EBV Ags wererecognized in the context of autologous HLA alleles, Tcell specificity could be determined by an effector frat-ricide assay after a 2-h incubation with peptide as de-scribed (29).M, BMLF1/A2 peptide (upper panel),BZFL1/B35 peptide (lower panel);f, BZLF1/B40peptide (upperand lower panels).

2489The Journal of Immunology

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The comparison of KIR transcription patterns in KIR1 vs KIR2

T cell clones isolated from the same individuals prompted us toinvestigate whether an additional regulation pathway of KIR ex-pression occurred in T cells, at posttranscriptional levels. B2.5 andBGL19 cells transcribed all theirKIR genes, although the formerdid not express any surface KIR and the latter expressed exclu-sively KIR2DL3 protein at the cell surface (Table II and data notshown). A4.5 T cells transcribed two KIRs, 2DL3 and 2DS2, butdid not express the corresponding protein at the cell surface. Sim-ilarly, out of the seven transcripts detected in AGL10 T cell clone,only CD158b is expressed at the surface (KIR2DL2 and/orKIR2DL3 and/or KIR2DS2) (Fig. 3). The “missing” KIR proteinswere also absent in intact or permeabilized cells, as indicated byflow cytometry analysis using a large panel of KIR-specific mAb(see Table III). Similar complex control ofKIR gene expressionwas documented in 14 additional T cell clones derived from donorA and 2 additional clones from donor B (Table III). Several ex-planations, such as low levels ofKIR gene transcription and/or lackof reactivity of mAb to the corresponding KIR protein (e.g., due toKIR polymorphism), could account for the presence of KIR tran-scripts in the absence of the corresponding protein. To exclude thatpolymorphism of KIR2DL3 was responsible for the absence ofstaining using CD158b mAb, we cloned and sequenced the full-length KIR2DL3 cDNA obtained from B2.5 and BGL18 T cellclones. Both sequences were totally identical withKIR2DL3clone6 sequence (GenBank accession number U24074; data not shown).We then attempted to amplify full-length KIR2DL3 cDNA fromA18.1 and AGL16 T cell clones using 59-KIR2DL3 primer and39-KIR2DL3 primer. In these experiments, only KIR2DS2 clone49 (GenBank accession number U24079) was cloned and se-quenced (data not shown). Therefore, B2.5 T cells and A18.1 Tcells express bona fide KIR2DL3 and KIR2DS2 transcripts, al-though no cell surface expression of the corresponding proteincould be detected. We then performed a semiquantitative PCRanalysis of KIR2DS2 and KIR2DL3 transcripts in AGL16 andA18.1, as well as in BGL18 and B2.5 T cell clones, respectively.A lower KIR2DL3 transcription level was observed in B2.5, ascompared with BGL18 T cells (Fig. 4A). Similarly, a lowerKIR2DS2 transcription level was observed in A18.1 as comparedwith AGL16 T cells (Fig. 4B). These data thus indicate that quan-titative differences in KIR transcripts are likely responsible for thedistinct KIR surface phenotypes observed in A18.1 and AGL16, aswell as in B2.5 and BGL18 T cell clones.

Further analysis of the pathways that regulate KIR expressionwas performed in clonal NK cell lines. NK92, NK3.3, and NKLhuman NK cell lines were cell surface phenotyped using CD158bmAb. As described earlier, NK3.3 is CD158b1 whereas bothNK92 and NKL are CD158b2 (data not shown). Despite the lackof detectable KIR molecules at the cell surface, KIR2DL3 tran-scripts were detected in NK92 cells. The specificity of KIR2DL3RT-PCR detection was assessed by the lack of KIR2DL3 tran-scripts in NKL (Fig. 4C,upper panel). Consistent with the resultsobtained in T cells, the level of KIR2DL3 transcripts is muchhigher in the CD158b1 NK3.3 cells, than in the CD1582 NK92cells (Fig. 4C,lower panel).

FIGURE 2. KIR-mediated inhibition of clone BGL19 cytotoxic activ-ity. A, CTL activity of B2.5 and BGL19 clones was estimated at a 10/1 E:Tratio against BZLF1/B35 peptide-loaded HLA-B351 BLC carrying or notp58.2 KIR ligands (E, B BLC (Cw3/7);F, BM9 BLC (Cw4/4)).B, Res-toration of CTL activity of BGL19 T cell clone against KIR-L1 targetsfollowing masking of KIRs on effector cells. CTL activity of clones B2.5and BGL19 was estimated at a 10/1 E:T ratio against B BLC (Cw3/7) orBM9 BLC (Cw4/4) loaded with 10mM of BZLF1/B35 peptide, in theabsence (M) or presence (f) of GL183 mAb (1/4 final hybridomasupernatant).

Table I. TCR junctional sequences derived from CD158b1 and CD158b– ab T cell clonesa

T Cell Clone

TCR Transcripts

TCRV CDR3 TCRJ RF

A4.5 BV4S1 tgc agc gtt gga acc ggt gga act aat gaa aaa ctg ttt ttt ggc BJ1S41(CD158b–) C S V G T G G T N E K L F F G

AGL10 AV15S1 tgt gca gag agt ata gga aag ctt atc ttc gga AJ231(CD158b1) C A E S I G K L I F G

AV18S1 tgt gcc tcc ccc gaa ctg aca gct ggg gga aat tgc agt ttg ga AJ24 –

B2.5 BV12S1 tgt gcc acc ggc ggg gga ggg atg gat gag cag ttc ttc ggg BJ2S11(CD158b–) C A T G G G G M D E Q F F G

BGL19 AV7S2 tgt gct gtg aga tct tca gga gga agc tac ata cct aca ttt gga AJ61(CD158b1) C A V R S S G G S Y I P T F G

AV22S1 tgt gct ctt gca ata atg cag gca aca tgc tca cct ttg ga AJ39 –

a A4.5 and AGL10 clones were derived from donor A; B2.5 and BGL19 clones were derived from donor B. RF, Reading frame (1, in frame; –, out of frame). TCR geneswere designated according to the last World Health Organization–International Union of Immunological Societies nomenclature (54).

2490 REGULATION OF KIR EXPRESSION ON T CELLS

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

DiscussionTwo groups of cell surface receptors have been identified in NKand T cell subsets, which define a repertoire of MHC class I rec-ognition. Ig-like molecules include KIR and LIR/ILT molecules,whereas C-type lectins include CD94/NKG2 heterodimers in hu-mans as well as CD94/NKG2 heterodimers and Ly-49 ho-modimers in the mouse (5, 6). The shaping of this MHC class Irepertoire appears to differ between lectin-like and Ig-like mole-cules. Indeed the cell surface expression of murine Ly-49 is influ-enced by the level of expression of cognate MHC class I molecules(40, 41), whereas KIR cell surface expression does not seem to bedirectly affected by the nature or expression levels of HLA class Imolecules (14, 42). Besides, activation ofCD94/NKG2gene tran-scription and/or cell surface export of intracytoplasmic CD94/NKG2 heterodimers can be induced on developing and maturelymphoid cells after short-term in vitro culture in the presence ofIL-15 (27). By contrast, all attempts to induce KIR in vitro onmature T or NK cells have failed so far. These results, whichconfirm that expression of KIRs and NKR homologous to C-typelectin is regulated through distinct pathways (43), have left openthe issues as to when and how KIR are induced. The absence ofboth KIR transcripts (data not shown) and proteins (44) in thymo-cytes, and by contrast their selective expression on fully differen-tiated NK cells (45) and Ag-experienced T cells (26), suggests lateKIR induction during lymphoid cell development. Along this linethe existence of KIR1 and KIR2 T cell clones sharing identicalproductive and nonproductive TCR transcripts formally provesthat induction/modulation of KIR expression occurs after termina-tion of TCR rearrangements. In line with previous studies (25, 27,28), the KIR phenotype of our T cell clones was highly stable (i.e.,they remained KIR1 or KIR2 irrespective of their activation status(data not shown)), thus strongly suggesting that KIR inductionoccurred in vivo and not during the process of synovial T cell linegeneration. Cytokines are probably involved in KIR cell surfaceexpression, as suggested by the in vitro induction of KIR on de-veloping CD341 hematopoietic progenitor cells upon treatmentwith Flt-3 ligand and IL-15 (46). However, whether the same fac-tors will be required to induce KIR on precursor and mature lym-phoid cells remains open. In this regard, preliminary experimentsfailed to demonstrate any effect on KIR expression by T cell clonesof exogenously added IL-15, either alone or in combination withIL-2 (M.-A.P. and M.B., unpublished observations).

KIR expression on T cells has been mainly described on CD81

memory T cells (26). KIR engagement by autologous MHC classI molecules can regulate in vitro CD3/TCR-mediated cytotoxicityand cytokine production suggesting a role of KIR in the control ofT cell activation (22, 23, 25, 27, 43, 47–49). In a previous study,activation of KIR1 CTL clones following recognition of tumorAgs was shown to be abrogated by KIR (50). Interestingly, in ourstudy, the inhibitory effect of KIR on TCR-mediated activation ofab T cell clones was partial. The efficiency of KIR-mediatedinhibition is likely affected by numerous parameters such as the

FIGURE 3. KIR gene transcription patterns of T cell clones. The detec-tion of transcripts and genes for each KIR was performed by RT-PCR andgenomic PCR as described previously (36). The same panels of KIR am-plification were obtained in three independent experiments.

Table II. KIR genotype and phenotype of CD158b1 and CD158b– ab T cell clonesa

KIR

B2.5 BGL19 A4.5 AGL10

DNA RNA Prot DNA RNA Prot DNA RNA Prot DNA RNA Prot

2DL1 1 1 – 1 1 – 1 – – 1 1 –2DL2 – – – – – – 1 – – 1 1 1?2DL3 1 1 – 1 1 1 1 1 – 1 1 1?2DL4 ND 1 ND ND 1 ND ND – ND ND 1 ND3DL1 1 1 – 1 1 – 1 – – 1 1 –3DL2 1 1 – 1 1 – 1 – – 1 1 –2DS1 – – – – – – 1 – – 1 – –2DS2 – – – – – – 1 1 – 1 1 1?2DS3 – – ND – – ND – – ND – – ND2DS4 1 1 – 1 1 – 1 – – 1 – –2DS5 – – ND – – ND – – ND – – ND3DS1 – – ND – – ND – – ND – – ND

a Analysis of the KIR repertoire on T cell clone-derived genomic DNA or cDNA was performed using previously described primers (36). The KIR nomenclature is from Ref.36. Presence of the corresponding KIR protein (Prot) either on the cell surface or intracellularly was studied by flow cytometry on, respectively, intact or saponin-permeabilizedcells using a panel of KIR-specific mAbs: EB6 (CD158a, KIR2DL1/KIR2DS1), GL183 (CD158b, KIR2DL2-2DL3/KIR2DS2), ZIN276 (anti-KIR3DL1), DEC66 (anti-KIR3DL2), and FSTR172 (anti-KIR2DS4). While KIR recognized by GL183 mAb on clone BGL19 was unambiguously assigned to KIR2DL3, GL1831 receptors on cloneAGL10 could correspond to either KIR2DL2, 2DL3, or 2DS2.

2491The Journal of Immunology

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

avidity of TCR/ligand interactions and more generally the globalavidity of the interactions between effector and target cells. Suchfactors may easily explain the differences observed between thetwo situations and are in line with recent data revealing unexpectedcomplexity in the biological function of KIR on T cells (51, 52).

KIR belong to a multigenic and multiallelic family, and thepolymorphism ofKIR genes is still incompletely documented (37,53). KIR genes are currently subdivided into inhibitory KIR(KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR3DL1, andKIR3DL2) and activating isoforms (KIR2DS1, KIR2DS2,KIR2DS3, KIR2DS4, KIR2DS5, and KIR3DS). Eighteen distinctKIR genotypes have been previously documented (36). T cellclones derived from donor B shared the most common genotypecorresponding to group 1 individuals described earlier (36), whilecells from donor A harbored a newly described genotype (TableII). Given the limited number of individuals analyzed thus far (36),these numbers are certainly underestimated and, therefore, it is notsurprising to detect here newKIR genotypes such as the one dis-played by cells from donor A.

A variable KIR transcription pattern from one NK clone to an-other, but a good matching between the presence of a given KIRtranscript and its corresponding protein within a given clone, hasbeen previously reported (36). These data suggested that the reg-ulation of KIR expression only operated at a transcriptional, butnot at a posttranscriptional, level. We confirm here the transcrip-tional regulation of the genes encoding for KIR-L and KIR-S pro-teins in both T and NK cells. But, in addition, we found that KIR-Land KIR-S transcripts were frequently detected in T cell clones andin one NK cell line in the absence of the corresponding protein,revealing that RT-PCR data that document KIR transcription pat-tern should be interpreted with caution. This discrepancy betweenKIR-L/KIR-Sgene transcription and protein expression could beexplained by transient KIR modulation (e.g., following receptorcross-linking). However, we failed to detect any intracellular KIRwithin permeabilized cells, in addition to those already detected onthe surface (Table III). Furthermore, kinetic analysis of KIR sur-

FIGURE 4. Semiquantitative PCR analysis of KIR transcripts inCD158b1 and CD158b2 T cell clones and NK cell lines. Coamplificationof either KIR2DL3 (AandC) or KIR2DS2 (B) and actin transcripts wereperformed using 5ml of undiluted (1020 and C, upper panel) or dilutedcDNAs (1021, 1022, and 1023). A, Comparison of KIR2DL3 transcriptsfrom CD158b1 (BGL18) or CD158b2 (B2.5) T cell clones.B, Comparisonof KIR2DS2 transcripts from CD158b1 (AGL16) or CD158b2 (A18.1) Tcell clones.C (upper panel),Detection of KIR2DL3 transcripts fromCD158b1 (NK3.3) or CD158b2 (NK92 and NKL) NK cell lines.C (lowerpanel), Comparison of KIR2DL3 transcripts from CD158b1 (NK3.3) orCD158b2 (NK92) NK cell lines.

Table III. KIR transcript patterns of KIR1 and KIR– T cell clones derived from donors A and Ba

KIR SurfaceExpression Clone 2DL1 2DL2 2DL3 2DL4 3DL1 3DL2 2DS1 2DS2 2DS3 2DS4 2DS5 3DS1

Patient A Genotype 1 1 1 ND 1 1 1 1 – 1 – –CD158b1 AGL10 Transcripts 1 1 1 1 1 1 – 1 – – – –

AGL16 – 1 1 1 1 1 1 1 – – – –AGL6 – 1 1 1 1 1 1 1 – – – –AGL12 – – 1 1 1 1 1 1 – – – –AGL18 – 1 – 1 1 – 1 1 – – – –AGL19 – 1 1 1 1 1 – 1 – – – –

KIR–b A4.5 Transcripts – – 1 – – – – 1 – – – –A18.1 – 1 1 1 1 – – 1 – – – –AZ4 – 1 1 1 1 – – 1 – – – –A14.11 – 1 1 1 1 – – – – – – –A5.23 – 1 1 1 1 – – – – – – –A1.15 – – 1 – – 1 – – – – – –A2.10 – – – 1 – – – – – – – –AMS8.25 – 1 – 1 – – – – – – – –AZ1 – – – 1 1 – – – – – – –AZ8 – 1 1 1 1 – 1 1 – 1 – –

Patient B 1 – 1 ND 1 1 – – – 1 – –CD158b1 BGL19 Transcripts 1 – 1 1 1 1 – – – 1 – –KIR–b B2.5 Transcripts 1 – 1 1 1 1 – – – 1 – –

B12.21 – – 1 1 1 – – – – 1 – –B12.4 – – – 1 1 – – – – – – –

a The presence of KIR genes and transcripts was detected using genomic PCR and RT-PCR.b No staining of KIR– T cell clones was detected using EB6 (anti-KIR2DL1/2DS1 mAb), GL183 (anti-KIR2DL2/2DL3/2DS2/2DS3 mAb), ZIN276 (anti-KIR3DL1 mAb),

DEC66 (anti-KIR3DL2 mAb), or FSTR172 (anti-KIR2DS4 mAb). The same results were obtained in three independent experiments for AGL10, A4.5, BGL19, and B2.5 clonesand two independent experiments for the others clones.

2492 REGULATION OF KIR EXPRESSION ON T CELLS

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

face phenotype and transcripts in T cell clones at various timepoints after antigenic activation demonstrated stable transcriptionand surface expression of KIR, irrespective of the T cell cloneactivation status (data not shown). In addition, we have shown thatthe level of KIR-L and KIR-S transcripts are positively correlatedto the cell surface expression of the corresponding KIR protein.

Thus, although the factors that induceKIR gene transcription arestill unknown, our data show that the regulation of KIR expressionoccurs in T cells after termination of TCR rearrangements, that athreshold of KIR-L and KIR-S transcripts must be reached toachieve efficient T and NK cell surface expression of the KIRproteins at the cell surface, and that the transcriptional and post-transcriptional pathways that regulatesKIR genes expression in Tand NK cells are at least in part shared betweenKIR-L andKIR-S.

AcknowledgmentsWe thank Dr. Miguel Lopez-Botet (Hospital de la Princesa, Madrid, Spain)and Dr. Nicolaı Wagtmann (Novo, Nordisk, Denmark) for providing Absand BAC, respectively.

References1. Raulet, D. H., and W. Held. 1995. Natural killer cell receptors: the offs and ons

of NK cell recognition.Cell 82:697.2. Yokoyama, W. M. 1998. Natural killer cell receptors.Curr. Opin. Immunol.

10:298.3. Karre, K., H. G. Ljunggren, G. Piontek, and R. Kiessling. 1986. Selective rejec-

tion of H-2-deficient lymphoma variants suggests alternative immune defensestrategy.Nature 319:675.

4. Moretta, A., C. Bottino, M. Vitale, D. Pende, R. Biassoni, M. C. Mingari, andL. Moretta. 1996. Receptors for HLA-class-I molecules in human natural killercells.Annu. Rev. Immunol. 14:619.

5. Lanier, L. L. 1998. NK cell receptors.Annu. Rev. Immunol. 16:359.6. Long, E. O. 1999. Regulation of immune responses through inhibitory receptors.

Annu. Rev. Immunol. 17:875.7. Tomasello, E., M. Blery, E. Vely, and E. Vivier. 2000. Signaling pathways en-

gaged by NK cell receptors: double concerto for activating receptors, inhibitoryreceptors and NK cells.Semin. Immunol. 12:139.

8. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea,G. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al. 1998. HLA-Ebinds to natural killer cell receptors CD94/NKG2A, B and C.Nature 391:795.

9. Lee, N., M. Llano, M. Carretero, A. Ishitani, F. Navarro, M. Lopez-Botet, andD. E. Geraghty. 1998. HLA-E is a major ligand for the natural killer inhibitoryreceptor CD94/NKG2A.Proc. Natl. Acad. Sci. USA 95:5199.

10. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, and T. Spies.1999. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285:727.

11. Wagtmann, N., S. Rajogopalan, C. C. Winter, M. Peruzzi, and E. O. Long. 1995.Killer cell inhibitory receptors specific for HLA-C and HLA-B identified bydirect binding and by functional transfer.Immunity 3:801.

12. Litwin, V., J. Gumperz, P. Parham, J. H. Philips, and L. L. Lanier. 1994. NKB1:an NK cell receptor involved in the recognition of HLA-B.J. Exp. Med. 180:537.

13. Gumperz, J. E., V. Litwin, J. H. Phillips, L. L. Lanier, and P. Parham. 1995. TheBw4 public epitope of HLA-B molecules confers reactivity with natural killer cellclones that express NKB-1, a putative HLA receptor.J. Exp. Med. 181:1133.

14. Gumperz, J. E., N. M. Valiante, P. Parham, L. L. Lanier, and D. Tyan. 1996.Heterogeneous phenotypes of expression of the NKB1 natural killer cell class Ireceptor among individuals of different human histocompatibility leukocyte an-tigens types appear genetically regulated, but not linked to major histocompati-bility complex haplotype.J. Exp. Med. 183:1817.

15. Lanier, L. L., J. E. Gumperz, P. Parham, I. Melero, M. Lopez-Botet, andJ. H. Phillips. 1995. The NKB1 and HP-3E4 NK cell receptors are structurallydistinct glycoproteins and independently recognize polymorphic HLA-B andHLA-C molecules.J. Immunol. 154:3320.

16. Dohring, C., D. Scheidegger, J. Samaridis, M. Cella, and M. Colonna. 1996. Ahuman killer inhibitory receptor specific for HLA-A.J. Immunol. 156:3098.

17. Pende, D., R. Biassoni, C. Cantoni, S. Verdiani, M. Falco, C. Di Donato,L. Accame, C. Bottino, A. Morreta, and L. Moretta. 1996. The natural killer cellreceptor specific for HLA-A allotypes: a novel member of the p58/p70 family ofinhibitory receptors which is characterized by three Ig-like domains and is ex-pressed as a 140kD disulphide-linked dimer.J. Exp. Med. 184:505.

18. Colonna, M., F. Navarro, T. Bellon, M. Liano, P. Garcia, J. Samaridis,L. Angman, M. Cella, and M. Lopez-Botet. 1997. A common inhibitory receptorfor major histocompatibility complex class I molecules on human lymphoid andmyelomonocytic cells.J. Exp. Med. 186:1809.

19. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, and M.-L.Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viralMHC class I molecule.Immunity 7:273.

20. Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, and E. O. Long. 1997. Anew human gene complex encoding the killer cell inhibitory receptors and relatedmonocyte/macrophage receptors.Curr. Biol. 7:615.

21. Navarro, F., M. Llano, T. Bellon, M. Colonna, D. E. Geraghty, andM. Lopez-Botet. 1999. The ILT2(LIR1) and CD94/NKG2A NK cell receptorsrespectively recognize HLA-G1 and HLA-E molecules co-expressed on targetcells.Eur. J. Immunol. 29:277.

22. Mingari, M. C., C. Vitale, A. Cambiaggi, F. Schiavetti, G. Melioli, S. Ferrini, andA. Poggi. 1995. Cytolytic T lymphocytes displaying natural killer (NK)-like ac-tivity: expression of NK-related functional receptors for HLA class I molecules(p58 and CD94) and inhibitory effect on the TCR-mediated target cell lysis orlymphokine production.Int. Immunol. 7:697.

23. Phillips, J. H., J. E. Gumperz, P. Parham, and L. L. Lanier. 1995. Superantigen-dependant, cell-mediated cytotoxicity inhibited by MHC class I receptors on Tlymphocytes.Science 268:403.

24. Aramburu, J., M. A. Balboa, A. Ramırez, A. Silva, F. Acevedo,F. Sanchez-Madrid, M. O. De Landazuri, and M. Lopez-Botet. 1990. A novelfunctional cell surface dimer (Kp43) expressed by natural killer cells and T cellreceptor-g/d1 lymphocytes. I. Inhibition of the IL-2 dependent proliferation byanti-Kp43 monoclonal antibody.J. Immunol.144:3228.

25. Halary, F., M.-A. Peyrat, E. Champagne, M. Lopez-Botet, A. Moretta,L. Moretta, H. Vie, J.-J. Fournie, and M. Bonneville. 1997. Control of self-reactive cytotoxic T lymphocytes expressinggd T cell receptors by natural killerinhibitory receptors.Eur. J. Immunol. 27:2812.

26. Mingari, M. C., F. Schiavetti, M. Ponte, C. Vitale, E. Maggi, S. Romagnani,J. Demarest, G. Pantaleo, A. S. Fauci, and L. Moretta. 1996. Human CD81 Tlymphocyte subsets that express HLA class I-specific inhibitory receptors repre-sent oligoclonally or monoclonally expanded cell populations.Proc. Natl. Acad.Sci. USA 93:12433.

27. Mingari, M. C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo,A. Moretta, and L. Moretta. 1998. HLA class I-specific inhibitory receptors inhuman T lymphocytes: interleukin 15-induced expression of CD94/NKG2A insuperantigen- or alloantigen-activated CD81 T cells.Proc. Natl. Acad. Sci. USA95:1172.

28. Bertone, S., F. Schiavetti, R. Bellomo, C. Vitale, M. Ponte, L. Moretta, andM. C. Mingari. 1999. Transforming growth factor-b-induced expression ofCD94/NKG2A inhibitory receptors in human T lymphocytes.Eur. J. Immunol.29:23.

29. Scotet, E., M. A. Peyrat, A. X. Saulquin, C. Retiere, C. Couedel, F. Davodeau,N. Dulphy, A. Toubert, J. D. Bignon, A. Lim, et al. 1999. Frequent enrichmentfor CD8 T cells reactive against common herpes viruses in chronic inflammatorylesions: towards a reassessment of the physiopathological significance of T cellclonal expansions found in autoimmune inflammatory processes. Eur. J. Immu-nol. 29:973.

30. David-Ameline, J., A. Lim, F. Davodeau, M. A. Peyrat, J. M. Berthelot,G. Semana, C. Pannetier, J. Gaschet, H. Vie, J. Even, and M. Bonneville. 1996.Selection of T cells reactive against autologous B lymphoblastoid cells duringchronic rheumatoid arthritis.J. Immunol. 157:4697.

31. Davodeau, F., M. A. Peyrat, M. M. Hallet, J. Gaschet, I. Houde, R. Vivien,H. Vie, and M. Bonneville. 1993. Close correlation between Daudi and myco-bacterial antigen recognition by humangd T cells and expression of V9JPC1g/V2DJC d-encoded T cell receptors.J. Immunol. 151:1214.

32. Couedel, C., M. Bodinier, M. A. Peyrat, M. Bonneville, F. Davodeau, andF. Lang. 1999. Selection and long-term persistence of reactive CTL clones duringan EBV chronic response are determined by avidity, CD8 variable contributioncompensating for differences in TCR affinities.J. Immunol. 162:6351.

33. Davodeau, F., M. A. Peyrat, F. Romagne, A. Necker, M. M. Hallet, H. Vie, andM. Bonneville. 1995. Dual T cell receptorb chain expression on human T lym-phocytes.J. Exp. Med. 181:1391.

34. Brichard, V., A. Van Pel, T. Wolfel, C. Wolfel, E. De Plaen, B. Lethe, P. Coulie,and T. Boon. 1993. The tyrosinase gene codes for an antigen recognized byautologous cytolytic T lymphocytes on HLA-A2 melanomas.J. Exp. Med. 178:489.

35. Espevik, T., and J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164clone 13, for measuring cytotoxic factor/tumor necrosis factor from humanmonocytes.J. Immunol. Methods 95:99.

36. Uhrberg, M., N. M. Valiante, B. P. Shum, H. G. Shilling, K. Lienert-Weidenbach,B. Corliss, D. Tyan, L. L. Lanier, and P. Parham. 1997. Human diversity in killercell inhibitory receptor genes.Immunity 7:753.

37. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach,K. L. Arnett, A. D’Andrea, J. H. Phillips, L. L. Lanier, and P. Parham. 1997.Functionally and structurally distinct NK cell receptor repertories in the periph-eral blood of two human donors.Immunity 7:739.

38. Mingari, M. C., A. Moretta, and L. Moretta. 1998. Regulation of KIR expressionin human T cells: a safety mechanism that may impair protective T-cell re-sponses.Immunol. Today 19:153.

39. Scotet, E., J. David-Ameline, M. A. Peyrat, A. Moreau-Aubry, D. Pinczon,A. Lim, J. Even, G. Semana, J. M. Berthelot, R. Breathnach, et al. 1996. T cellresponse to Epstein-Barr virus transactivators in chronic rheumatoid arthritis.J. Exp. Med. 184:1791.

40. Raulet, D. H., W. Held, I. Correa, J. R. Dorfman, M. F. Wu, and L. Corral. 1997.Specificity, tolerance and developmental regulation of natural killer cells definedby expression of class I-specific Ly49 receptors.Immunol. Rev. 155:41.

41. Hoglund, P., J. Sundback, M. Y. Olsson-Alheim, M. Johansson, M. Salcedo, C.Ohlen, H.-G. Ljunggren, C. L. Sentman, and K. Karre. 1997. Host MHC class Igene control of NK-cell specificity on the mouse.Immunol. Rev. 155:11.

42. Cambiaggi, A., C. Verthuy, P. Naquet, F. Romagne, P. Ferrier, R. Biassoni,A. Moretta, L. Moretta, and E. Vivier. 1997. Natural killer cell acceptance of H-2mismatch bone marrow grafts in transgenic mice expressing HLA-Cw3 specifickiller cell inhibitory receptor.Proc. Natl. Acad. Sci. USA 94:8088.

2493The Journal of Immunology

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

43. Andre, P., C. Brunet, S. Guia, H. Gallais, J. Sampol, E. Vivier, andF. Dignat-George. 1999. Differential regulation of killer cell Ig-like receptors andCD94 lectin-like dimers on NK and T lymphocytes from HIV-1-infected indi-viduals.Eur. J. Immunol. 29:1076.

44. Mingari, M. C., M. Ponte, C. Cantoni, C. Vitale, F. Schiavetti, S. Bertone,R. Bellomo, A. Tradori Cappai, and R. Biassoni. 1997. HLA-class I-specificinhibitory receptors in human cytolytic T lymphocytes: molecular characteriza-tion, distribution in lymphoid tissues and co-expression by individual T cells.Int.Immunol. 9:485.

45. Andre, P., O. Spertini, S. Guia, P. Rihet, F. Dignat-George, H. Brailly, J. Sampol,P. J. Anderson, and E. Vivier. 2000. Modification of P-selectin glycoproteinligand-1 with a natural killer cell-restricted sulfated lactosamine creates an alter-nate ligand for L-selectin.Proc. Natl. Acad. Sci. USA 97:3400.

46. Yu, H., T. A. Fehniger, P. Fuchshuber, K. S. Thiel, E. Vivier, W. E. Carson, andM. A. Caligiuri. 1998. Flt3 ligand promotes the generation of a distinct CD31

human natural killer cell progenitor that responds to interleukin-15.Blood. 92:3647.

47. Ferrini, S., A. Cambiaggi, R. Meazza, S. Sforzini, S. Marciano, M. C. Mingari,and L. Moretta. 1994. T cell clones expressing the natural killer cell-related p58receptor molecule display heterogeneity in phenotypic properties and p58 func-tion. Eur. J. Immunol. 24:2294.

48. Battistini, L., G. Borsellino, G. Sawicki, F. Poccia, M. Salvetti, G. Ristori, andC. F. Brosnan. 1997. Phenotypic and cytokine analysis of human peripheral bloodgd T cells expressing NK cell receptors.J. Immunol. 159:3723.

49. Bakker, A. B., J. H. Phillips, C. G. Figdor, and L. L. Lanier. 1998. Killer cellinhibitory receptors for MHC class I molecules regulate lysis of melanoma cellsmediated by NK cells,gd T cells, and antigen-specific CTL.J. Immunol. 160:5239.

50. Ikeda, H., B. Lethe, F. Lehmann, N. Van Baren, J.-F. Baurain, C. De Smet,H. Chambost, M. Vitale, A. Moretta, T. Boon, and P. G. Coulie. 1997. Charac-terization of an antigen that is recognized on a melanoma showing partial HLAloss by CTL expressing an NK inhibitory receptor.Immunity 6:199.

51. Cambiaggi, A., S. Darche, S. Guia, P. Kourilsky, J.-P. Abastado, and E. Vivier.1999. Modulation of T-cell functions in KIR2DL3 (CD158b) transgenic mice.Blood 94:2396.

52. Ugolini, S., and E. Vivier. 2000. Regulation of T cell function by NK cell re-ceptors for classical MHC class I molecules.Curr. Opin. Immunol. 12:295.

53. Wilson, M. J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, andJ. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ILT gene families.Proc. Natl. Acad. Sci. USA 97:4778.

54. WHO-IUIS nomenclature sub-committee on TCR designation. 1995. Nomencla-ture for T-cell receptor (TCR) gene segments of the immune system.Immuno-genetics. 42:451.

2494 REGULATION OF KIR EXPRESSION ON T CELLS

by guest on April 6, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from