Gene 573 (2015) 198–204

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Research paper

High resolutionmelting analysis of theNR1I3 genetic variants: Is there anassociation with neonatal hyperbilirubinemia?

Tian Pei Cheung a, Hans Van Rostenberghe a, Rosliza Ismail a, Noor Namirah Nawawi a,Nurul Amierah Abdullah a, Noraida Ramli a, Nor Rosidah Ibrahim a, Noorizan Hj. Abd. Majid a,Narazah Mohd Yusoff b, Hisahide Nishio c, Surini Yusoff a,d,⁎a Department of Pediatrics, School of Medical Sciences, Universiti Sains Malaysia, Kelantan 16150, Malaysiab Advanced Medical and Dental Institute, Universiti Sains Malaysia, Pulau Pinang 11800, Malaysiac Department of Pediatrics, Department of Community Medicine and Social Healthcare Science, Kobe University Graduate School of Medicine, Kobe 650-0017, Japand Human Genome Center, School of Medical Sciences, Universiti Sains Malaysia, Kelantan 16150, Malaysia

Abbreviations: CAR, constitutive androstane recepsubfamily 1, group I, member 3; HRM, high resolution mephate glucuronosyltransferase 1A1; gtPBREM, glucuronresponsive enhancer module; TSB, total serum bilirubin; Sphism; PCR, polymerase chain reaction; Ta, annealing tem⁎ Corresponding author at: Department of Pediatric

Universiti Sains Malaysia, Kelantan 16150, Malaysia.E-mail address: surini@usm.my (S. Yusoff).

http://dx.doi.org/10.1016/j.gene.2015.07.0450378-1119/© 2015 The Authors. Published by Elsevier B.V

a b s t r a c t

a r t i c l e i n f o

Article history:Received 29 January 2015Received in revised form 28 May 2015Accepted 13 July 2015Available online 16 July 2015

Keywords:Neonatal jaundiceHyperbilirubinemiaConstitutive androstane receptorHigh resolution meltingMalayBuccal

Constitutive androstane receptor (CAR) encoded by the nuclear receptor subfamily 1, group I, member 3 (NR1I3)gene regulates the elimination of bilirubin through activating the components of the bilirubin clearance pathway.Hence, NR1I3 genetic variants may affect bilirubin metabolism and result in neonatal hyperbilirubinemia. Thusfar, research which investigates the association between NR1I3 variants and neonatal hyperbilirubinemia hasnot been undertaken in any population. The present study aimed to evaluate the influence of MPJ6_1I3008(rs10157822), IVS8+116TNG (rs4073054) and 540ANG (rs2307424) on neonatal hyperbilirubinemia develop-ment in the Malay population. Buccal swabs were collected from 232 hyperbilirubinemia and 277 control termnewborns with gestational age ≥37 weeks and birth weight ≥2500 g. The NR1I3 variants were genotyped byusing high resolution melting (HRM) assays and verified by DNA sequencing. Gender, mode of delivery andbirthweight did not differ between hyperbilirubinemia and control groups. The genotypic and allelic frequenciesofMPJ6_1I3008, IVS8+116TNG and 540ANGwere not significantly different between the groups. However, strat-ification by gender revealed a significant inverse association between homozygous variant genotype ofMPJ6_1I3008 and risk of neonatal hyperbilirubinemia in the females (OR, 0.44; 95% CI, 0.20–0.95; p = 0.034).This study demonstrates that thehomozygous variant genotype ofMPJ6_1I3008was associatedwith a significantreduced risk of neonatal hyperbilirubinemia in the females.

© 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license(http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction

Neonatal hyperbilirubinemia or jaundice is a benign and commonclinicalmanifestation of thenewborns (AmericanAcademyof PediatricsSubcommittee on Hyperbilirubinemia, 2004; Bhutani et al., 2010). Theprevalence is 60% in term and 80% in preterm newborns (Rennie et al.,2010; The Lancet, 2010). Hyperbilirubinemia occurs due to an elevatedproduction of bilirubin from senescent erythrocytes or reduced elimina-tion of bilirubin from the body (Kaplan et al., 2002). Although neonatalhyperbilirubinemia is a natural phenomenon, an elevated serum biliru-bin level has the potential to produce permanent brain damage

tor; NR1I3, nuclear receptorlting; UGT1A1, uridine diphos-osyltransferase phenobarbital-NP, single nucleotide polymor-perature.s, School of Medical Sciences,

. This is an open access article under

(kernicterus) or even death if it is not recognized and treated properly(Johnson et al., 2009).

Uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) is thekey enzyme which conjugates bilirubin with glucuronic acid for the sub-sequent bilirubin elimination (Bosma et al., 1994). The promoter regionof the UGT1A1 gene contains glucuronosyltransferase phenobarbital-responsive enhancer module (gtPBREM) that is regulated by constitutiveandrostane receptor (CAR) (Sugatani et al., 2001). In response to pheno-barbital induction, CAR binds to the gtPBREM resulting in an elevatedUGT1A1 transcription thereby enhancing the metabolism of bilirubin(Sugatani et al., 2001). Besides, other transcription factors which alsoregulate the transcription of UGT1A1 by binding to the gtPBREM includethe pregnane X receptor (Sugatani et al., 2005), aryl hydrocarbon recep-tor (Yueh et al., 2003), nuclear erythroid-related factor 2 (Yueh andTukey, 2007), peroxisome proliferator-activated receptor α (Senekeo-Effenberger et al., 2007) and glucocorticoid receptor (Sugatani et al.,2005).

CAR is an orphan nuclear receptor encoded by the nuclearreceptor subfamily 1, group I, member 3 (NR1I3) gene (Baes et al.,

the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

http://crossmark.crossref.org/dialog/?doi=10.1016/j.gene.2015.07.045&domain=pdfhttp://creativecommons.org/licenses/by-nc-nd/4.0/http://dx.doi.org/10.1016/j.gene.2015.07.045mailto:surini@usm.myhttp://dx.doi.org/10.1016/j.gene.2015.07.045http://creativecommons.org/licenses/by-nc-nd/4.0/http://www.sciencedirect.com/science/journal/03781119www.elsevier.com/locate/gene

199T.P. Cheung et al. / Gene 573 (2015) 198–204

1994; Nuclear Receptors Nomenclature Committee, 1999). CAR mainlyfunctions in transactivating hepatic xenobiotic-metabolizing enzymesincluding cytochrome P450s (Chen et al., 2003; Park et al., 2012) andtransferases [glutathione S-transferase (GST), sulfotransferases andUGT1A1] (Sugatani et al., 2001). Genetic variants in the NR1I3 geneare associated with neonatal hyperbilirubinemia because CARmonitorsthe elimination of bilirubin through activating components [solute car-rier organic anion transporter (SLCO1B1), GSTA1, GSTA2, UGT1A1 andmultidrug resistance-associated protein 2 (MRP2)] in the bilirubinclearance pathway (Huang et al., 2003). During hyperbilirubinemia,CAR activates these components to result in a greater bilirubinclearance (Huang et al., 2003). Hence, it is possible that the NR1I3variants may affect bilirubin metabolism and thus result in neonatalhyperbilirubinemia.

Thus far, research which investigates the association between vari-ants in the NR1I3 gene and neonatal hyperbilirubinemia occurrencehas not been undertaken in any population. Based on the NR1I3 variantscreening results (Ikeda et al., 2003; Chew et al., 2013), the presentstudy aimed to determine the influence of common variantsMPJ6_1I3008 (rs10157822), IVS8+116TNG (rs4073054) and 540ANG(rs2307424) on the development of neonatal hyperbilirubinemia inthe Malay population.

2. Materials and methods

2.1. Study subjects

This was a comparative cross-sectional study involving subjectsadmitted to and/or born in Hospital Universiti Sains Malaysia (HUSM),Kelantan, Malaysia from April 2013 to October 2014. Ethical approvalof the study was obtained from Human Research Ethics Committeeof Universiti Sains Malaysia (No. USMKK/PPP/JEPeM[263.3.(12)]).Informed consent was obtained from the parents before recruiting atotal of 509 subjects which comprised 232 hyperbilirubinemia and277 non-hyperbilirubinemia newborns. Subjects from both groupswere Malay term newborns with gestational age ≥37 weeks and birthweight ≥2500 g.

Newborns who developed total serum bilirubin (TSB) levels≥250 μmol/L within the first week after birth were recruited into thehyperbilirubinemia group. Control subjects were newborns withoutsignificant hyperbilirubinemia (TSB levels b250 μmol/L). Newbornswho exhibited the following criteria were excluded from the study:prolonged hyperbilirubinemia, hemolysis, polycythemia, birth trauma,diabeticmother, ABO or Rh incompatibility, glucose-6-phosphate dehy-drogenase (G6PD) deficiency, sepsis, asphyxia, congenital pneumonia,infection, gross congenital malformations and other medical conditionsthat could lead to neonatal hyperbilirubinemia.

2.2. Genomic DNA extraction and genotyping

Buccal swab, a non-invasive and cost-effective sampling tool wasused to collect genomic DNA from the newborns. Briefly, two sterilebuccal swabs were twirled gently on the inside of both cheeks forabout 30 s. Genomic DNA was isolated using Exgene™ Blood SV mini

Table 1HRM primer pairs for genotyping NR1I3 variants.

rs number SNP ID(Reference)

rs10157822 MPJ6_1I3008 (Ikeda et al., 2003)

rs4073054 IVS8+116TNG (Chew et al., 2013)

rs2307424 540ANG (Ikeda et al., 2003; Chew et al., 2013)

F: forward; R: reverse.

kit (GeneAll, Korea) according to the manufacturer's protocol. Theextracted genomic DNA was stored at−20 °C prior to genotyping.

The NR1I3 nucleotide sequence was obtained from the NationalCenter for Biotechnology Information (NCBI) (accession number:NG_029113.1). To genotypeMPJ6_1I3008 (rs10157822), IVS8+116TNG(rs4073054) and 540ANG (rs2307424) single nucleotide polymor-phisms (SNPs), high resolution melting (HRM) analysis was employedby using the PikoReal 96 real-timepolymerase chain reaction (PCR) sys-tem (Thermo Fisher Scientific Inc., United States). The technique com-bined real-time PCR and post-PCR HRM in a single experiment. Primerpairs (Table 1) were designed with the aid of Primer3 web version4.0.0 (Rozen and Skaletsky, 2000) and analyzed using PCR PrimerStats (Stothard, 2000) and NCBI BLAST (Altschul et al., 1990). Smallamplicons (99–114 base pairs) were critical to increase the sensitivityof the HRM assays and to avoid multiple melting domains that wouldcomplicate the interpretation of the results.

The HRM assay required only a single preparation. Briefly, the HRMassay for each SNP was carried out in 10 μL of final volume in a 96-wellPiko PCR white plate (Thermo Fisher Scientific Inc., United States): 5 μLof 2× Precision Melt Supermix (Bio-Rad Laboratories, Inc., CA) wasadded to 0.2 μL of each forward and reverse primer (10 μM; Sigma-Aldrich, Malaysia), 1 μL of DNA template (1 ng/μL) and 3.6 μL of distilledwater.

The real-time PCR condition consisted of an initial denaturation stepat 95 °C for 2 min that was followed by 40 cycles of denaturation (95 °Cfor 10 s), annealing (58 °C for 30 s) and extension (72 °C for 30 s). Theannealing temperature (Ta) was optimized by gradually increasing ordecreasing the Ta from 54 to 60 °C until an optimal HRM melt profilewas obtained. Although the same Ta was used for all three primerpairs, HRM assay for each SNP was conducted separately to producesimple melt profiles that facilitated easy interpretation. The subsequentHRM program comprised heteroduplex formation (denaturation at95 °C for 30 s and renaturation at 60 °C for 1 min) and high resolutionmelt with continuous fluorescence readings from 60 to 95 °C in 0.2 °Cincrements.

HRM data was analyzed by the PikoReal Software version 2.1(Thermo Fisher Scientific Inc., United States). Genotypes of the sampleswere assigned by comparing the melting patterns with that of knownstandards. Samples constituting the same nucleotide sequence woulddemonstrate a similar melting pattern in the graphs. Hence, threedifferent melting patterns were produced and that implied the threegenotypes of a SNP.

2.3. DNA sequencing

To confirm the validity and reliability of the HRM genotyping resultsas well as to assign a genotype for each HRM pattern, representativesamples demonstrating different melting patterns, random samplesand those which generated unusual or ambiguous HRM results weresubjected to DNA sequencing. A commercial kit (GeneAll® Expin™ComboGP, Korea)was used to purify these samples prior to sequencing.The sequencing electropherograms were viewed by using Finch TVversion 1.4.0 (Geospiza Inc., Seattle, WA, USA) and compared with the

Primer sequence(5′ to 3′)

Amplicon size (bp)

F: TGCAGCAGATTCCACTCTCCR: GGGAACAGACTGCTTTGAGT

99

F: GGTGAAACATTGAGCTTGGGR: GCTGAAACGATGTGAGACAGG

114

F: CCTGAAAGATGAGGGGAGGTR: TGGTCACACACTTCGCAGA

106

200 T.P. Cheung et al. / Gene 573 (2015) 198–204

NR1I3 sequence from NCBI to derive the genotype for each sequencedsample.

2.4. Statistical analysis

Statistical analysis was conducted by using IBM® SPSS statistics ver-sion 20 (SPSS, Chicago, IL, USA) and Epi Info 7 (Dean et al., 2011). To de-termine the significance of difference between the hyperbilirubinemiaand control groups for the baseline demographic data and the frequen-cies of genotype and allele, Pearson's chi-square test was employed forcategorical variables while independent t test was used to analyzenumerical variables. The association between variant genotypes andrisk of developing neonatal hyperbilirubinemia was explored by usingbinary logistic regression analysis with wild-type genotype served asthe reference (odd ratio (OR) of 1.00). p value b0.05 was consideredstatistically significant.

3. Results

3.1. Characteristics of study subjects

A total of 509 newborns were enrolled in this study, comprising 232hyperbilirubinemia subjectswith TSB ≥250 μmol/L and 277 control sub-jects with TSB b250 μmol/L. The baseline demographic and clinical datawere compared between the two subject groups. None of the newbornin either group had demonstrated any clinical condition that is criticalfor the development of neonatal hyperbilirubinemia. We did notfind any significant difference in the gender, mode of delivery andbirth weight between hyperbilirubinemia and control subjects. Onaverage, the peak TSB level was observed on day four of life of thehyperbilirubinemia newborns. In these patients, their peak TSB levels

MMPJJ6_

G

G

A

_1I3

GG

GA

AA

30008 IIVSS8+

T

T

G

+116

TT

TG

GG

6

G

Fig. 1. Segments of the DNA sequence electropherograms to characterize and confirm the genoheterozygotes. Genotypes are labeled above the electropherograms. Arrows indicate nucleotid

were in the range of 250–324 μmol/L in 144 (62.1%) newborns and 81(34.9%) newborns were between 325 and 399 μmol/L. Seven (3.0%)out of 232 hyperbilirubinemia newborns developed peak TSB ≥400μmol/L which necessitated exchange transfusion.

3.2. NR1I3 variant analysis

A 100% concordance rate was achieved for the genotyping resultsproduced by HRM and DNA sequencing analysis (data not shown).DNA sequencing electropherograms (Fig. 1) verified the nucleotidechanges that were demonstrated by the characteristic HRM meltingpatterns. As shown in Figs. 2 and 3, distinctive HRM melting patternswere produced from different genotypes. DNA samples with identicalnucleotide sequencewere clustered into the same groups and exhibitedsimilar melting patterns. Contrary, difference in the nucleotide was dis-tinguished by melting temperature shift and changes in the meltingcurve shape. MPJ6_1I3008 (GNA) and 540ANG which involved adenine(A) and guanine (G) base variation generated similar melting patterns(Fig. 3). However, the melting temperature of the samples with compa-rable genotypes (for an example, GA of MPJ6_1I3008 versus AG of540ANG) was not identical due to different base compositions andlengths of the amplicons.

The frequencies of genotypes and alleles of MPJ6_1I3008,IVS8+116TNG and 540ANG were compared between thehyperbilirubinemia and control groups. The distributions of all variantgenotypes and alleles between the groups were not significantly differ-ent (p N 0.05). The risk of developing neonatal hyperbilirubinemia foreach NR1I3 variant genotype was estimated by logistic regressionanalysis (data not shown). The heterozygous and homozygous variantgenotypes of all variants were positively associated with the neonatalhyperbilirubinemia risk (OR N 1.00), although the associations were

T>>GG 5440A

AA

AG

GG

A>G

A

G

G

G

type for each HRMmelting pattern. Two peaks were observed in the electropherograms ofe changes.

IVVS8

A

C

8+116TT>GG

B

D

B

D

Fig. 2.HRMmelt profiles for discriminating the genotypes of IVS8+116TNG. Fluorescence signals of the (A) normalizedmelt curvewere normalized to relative values of 100 and 0. Uniquemelting patterns for each genotype were observed in the (B) normalized and temperature shifted derivative HRM graph, (C) normalized RFU difference graph and (D) normalizedand temperature shifted difference graph [the sample curves were subtracted from the standards (knownwild type, heterozygote and homozygous variant) to magnify small differencesbetween each melt curve cluster]. Genotype of each melting pattern was assigned after confirmed with DNA sequencing. RFU, relative fluorescence units.

201T.P. Cheung et al. / Gene 573 (2015) 198–204

not statistically significant. Besides, the OR and 95% CI between hetero-zygous and homozygous variant genotypes for each variant were alsosimilar.

The results obtained were also stratified by gender (Table 2).The heterozygous genotypes of MPJ6_1I3008 in both genders wereassociated with a reduced neonatal hyperbilirubinemia risk, althoughthe associationswere not statistically significant. Thesewere not similarto the overall risk association of MPJ6_1I3008 which demonstrated anelevated risk. Likewise, no statistically significant risk association wasfound for the homozygous variant genotype in males (OR, 1.06;95% CI, 0.55–2.01; p=0.870). Stratification by gender revealed a signif-icant inverse association between homozygous variant genotype ofMPJ6_1I3008 and risk of neonatal hyperbilirubinemia in the femalenewborns (OR, 0.44; 95% CI, 0.20–0.95; p = 0.034).

For IVS8+116TNG,we did notfindany significant risk association forthe heterozygous genotype in both genders, and the homozygous vari-ant genotype inmales. Although the homozygous variant genotypewasnot present in the female hyperbilirubinemia newborns, a reducednumber (less than five) of the genotype was found in males and femalecontrols. Stratification analysis of the 540ANG also revealed that in bothgenders, the association between neonatal hyperbilirubinemia risk andvariant genotypes was not statistically significant.

4. Discussion

The development of neonatal jaundice is multifactorial which in-volves genetic and environmental components (American Academy ofPediatrics Subcommittee on Hyperbilirubinemia, 2004; Bhutani et al.,2004). To date, review of the literature revealed no studieswhich deter-mine the association between variants in the NR1I3 gene and neonatalhyperbilirubinemia. In Malay newborns, we did not find any significant

difference in genotypic distribution ofMPJ6_1I3008, IVS8+116TNG and540ANG between hyperbilirubinemia and control newborns. However,we found a significant inverse association between female newbornswith homozygous variant genotype ofMPJ6_1I3008 and risk of neonatalhyperbilirubinemia when gender-based stratification analysis was per-formed. The results suggest the protective role of homozygous variantgenotype against neonatal hyperbilirubinemia in the female Malays.

To the best of our knowledge, comprehensive scanning of the NR1I3variants was only conducted among the Japanese individuals adminis-trating drugs (Ikeda et al., 2003) and healthy Singapore Asians (Chewet al., 2013). The Japanese study identified a total of 29 SNPs includingthree SNPs that were reported previously (Ikeda et al., 2003). Amongall the SNPs, 16 (includingMPJ6_1I3008)were located in the 5′-flankingregion, three in exons and ten in introns. Another study conducted onhealthy Singapore Asians revealed a total of 38 SNPs and 13 out ofwhich were novel ones (13 SNPs in 5′-flanking region, one in exonand 24 in introns) (Chew et al., 2013). The variant allele frequency ofMPJ6_1I3008 in our population (43.3% and 47.3% in patients and con-trols respectively) was lower than the Japanese (66.4%) (Ikeda et al.,2003). This 5′-flanking SNPmay have an effect on the promoter regula-tory activity but the exact mechanism remains to be clarified. Variationin the distribution between the Malays and Japanese highlights thepossible influence of ethnicity and background of subjects on geneticvariation.

A study from Singapore showed that the homozygous variant geno-type of IVS8+116TNG was not detected in 54 healthy Malay subjectsand the variant allele frequency was 8.3% (Chew et al., 2013). However,both the heterozygous and homozygous variant genotypes were pres-ent in our subjects with a higher frequency (16.4%). The exonic SNP540ANG (Pro180Pro) was mapped to the ligand binding domain ofNR1I3 (di Masi et al., 2009). In-silico analysis showed that the silent

M

54

i

MPJ

40A

i

iii

J6_1

A>G

1I3

G

0088

ii

ivv

Fig. 3.HRMmelting patterns generated fromMPJ6_1I3008 (i and ii) and 540ANG (iii and iv)were almost similar. Both SNPs involved changes inA andG bases. Therewas a slight differencein the melting pattern of AA genotype between the SNPs.

Table 2Stratification of neonatal hyperbilirubinemia risk association of NR1I3 variants by gender.

Patients Controls Odd ratio (95% CI) p value

MPJ6_1I3008Males (n) 133 136Wild type (GG) 43 (32.3) 44 (32.4) 1.00 (reference) –Heterozygous (GA) 57 (42.9) 60 (44.1) 0.97 (0.56–1.69) 0.920Homozygous variant (AA) 33 (24.8) 32 (23.5) 1.06 (0.55–2.01) 0.870

Females (n) 99 141Wild type (GG) 35 (35.4) 37 (26.2) 1.00 (reference) –Heterozygous (GA) 50 (50.5) 70 (49.6) 0.76 (0.42–1.36) 0.348Homozygous variant (AA) 14 (14.1) 34 (24.1) 0.44 (0.20–0.95) 0.034a

IVS8+116TNGMales (n) 133 136Wild type (TT) 93 (69.9) 91 (66.9) 1.00 (reference) –Heterozygous (TG) 36 (27.1) 41 (30.1) 0.86 (0.50–1.46) 0.576Homozygous variant (GG) 4 (3.0) 4 (2.9) 0.98 (0.24–4.03) 0.976

Females (n) 99 141Wild type (TT) 80 (80.8) 104 (73.8) 1.00 (reference) –Heterozygous (TG) 19 (19.2) 32 (22.7) 0.77 (0.41–1.46) 0.426Homozygous variant (GG) 0 (0.0) 5 (3.5) NA 0.052

540ANGMales (n) 133 136Wild type (AA) 35 (26.3) 43 (31.6) 1.00 (reference) –Heterozygous (AG) 63 (47.4) 58 (42.6) 1.33 (0.75–2.36) 0.322Homozygous variant (GG) 35 (26.3) 35 (25.7) 1.23 (0.64–2.35) 0.533

Females (n) 99 141Wild type (AA) 24 (24.2) 37 (26.2) 1.00 (reference) –Heterozygous (AG) 58 (58.6) 71 (50.4) 1.26 (0.68–2.34) 0.465Homozygous variant (GG) 17 (17.2) 33 (23.4) 0.79 (0.36–1.73) 0.562

Figures in parenthesis are percentage or 95% CI as applicable.a Statistically significant.

202 T.P. Cheung et al. / Gene 573 (2015) 198–204

203T.P. Cheung et al. / Gene 573 (2015) 198–204

coding SNP may regulate NR1I3 splicing by modulating the splicingfactor (SRp55) binding (Chew et al., 2013). The variant allele frequencyof the SNP in our study (47.8%) was comparable to those of the healthySingapore Malays (45.3%) (Chew et al., 2013). Although the Malaypopulations from Singapore and Malaysia may share similar geneticcomposition, discrepancy in the frequenciesmay still exist due to differ-ent characteristics of the subjects, geographical factors and sample size.

A higher incidence of neonatal hyperbilirubinemia in the Asianscompared with the Caucasians suggests that genetic factors could bethe underlying cause for the disease occurrence (Huang et al., 2004;Morioka et al., 2010). Genetic factors that predispose to neonatalhyperbilirubinemia including the UGT1A1, G6PD and SLCO1B1 variantshave been extensively explored in various ethnicities (Watchko andLin, 2010; Yusoff et al., 2010; Liu et al., 2013; D'Silva et al., 2014;Tiwari et al., 2014). Generally, these variants contribute to neonatalhyperbilirubinemia by disrupting the balance between bilirubinproduction and elimination (Kaplan et al., 2002). However, no studieshave targeted the NR1I3 gene yet.

Since the protein product of NR1I3, CAR, regulates the bilirubinexcretion by inducing important components (SLCO1B1, GSTA1,GSTA2, UGT1A1 and MRP2) involved in bilirubin clearance, and theability of CAR to stimulate an enhanced bilirubin elimination in re-sponse to hyperbilirubinemia (Huang et al., 2003), therefore, it is possi-ble that NR1I3 genetic variants which encode receptors with decreasedamount or functions may affect the occurrence and severity of neonatalhyperbilirubinemia. The resultingCARmaydemonstrate variable induc-tion or stimulatory activities on the related components. Additionally,the regulation of UGT1A1 transcription by CAR which binds to thegtPBREM (Sugatani et al., 2001) also suggests that any abnormality inCAR due to the NR1I3 variants may modulate the binding efficiencyand lead to a decreased production of UGT1A1 enzyme. Thus, the vari-ants may indirectly reduce the metabolism of bilirubin and lead to neo-natal hyperbilirubinemia. However, our findings demonstrated thatfemale neonates with homozygous variant genotype of MPJ6_1I3008have a lower risk of hyperbilirubinemia.

Extensive literature search shows that no studies have provided the-oretical or functional explanation regarding the genetic mechanism ofthe protective role conferred by homozygous variant MPJ6_1I3008against neonatal hyperbilirubinemia or other diseases. However, someother mutations demonstrate protective effects in which individualswith homozygous mutations are protected whereas heterozygous indi-viduals may have delayed disease progression. For instances, hemoglo-binopathies (homozygous hemoglobin C and hemoglobin E, sickle-celltrait and beta thalassemia trait) protect against malaria in endemic re-gions (Ayi et al., 2004; Williams et al., 2005); heterozygous von HippelLindau (VHLR200W) protects against anemia (Miasnikova et al., 2011);and homozygous CCR5Δ32 (a 32-bpdeletion in the host-cell chemokinereceptor CCR5) protects against HIV infection (Sullivan et al., 2001).Since each mutation has different mechanisms in protecting againstdisease, further studies are thus required to elucidate the geneticmechanism of the NR1I3 variants (MPJ6_1I3008, IVS8+116TNG and540ANG).

Other risk factors that are also associated with neonatalhyperbilirubinemia comprise hemolysis, cephalohematoma, exclusivebreastfeeding, infant of diabetic mother, East Asian ethnicity andmale gender (American Academy of Pediatrics Subcommittee onHyperbilirubinemia, 2004; Maisels et al., 2009; Muchowski, 2014). Inour study, we have excluded subjects who demonstrated potentialmedical conditions that were related to hyperbilirubinemia becausethese conditions could lead to and affect the severity of the disease.According to the clinical practice guideline by the American Academy ofPediatrics, male gender has been assigned as one of the risk factors(American Academy of Pediatrics Subcommittee on Hyperbilirubinemia,2004) based on a study in Northern California which found a strong pos-itive association betweenmale gender and hyperbilirubinemia (OR, 1.95;p = 0.007) (Newman et al., 2000). However, findings from our study

showed that the male gender was not a significant predictor of neonatalhyperbilirubinemia in the Malay subjects.

In this study, the use of HRM analysis has facilitated a sensitive andrapid genotyping of the NR1I3 variants. Further, the analysis is also rel-atively inexpensive and straightforward than traditional genotypingtechniques by requiring single preparation and allowing easy interpre-tation of genotyping results. The non-invasive nature of buccal swabsampling is more suitable for newborns comparedwith blood samplingwhile able to raise participation rate considerably. Our study hasdemonstrated that HRM genotyping of DNA material derived frombuccal swab yielded satisfactory and reliable results. A study whichalso employed buccal swab sampling indicated that buccal epithelialcells provided a reliable source of DNA and promising results were ob-tained from genetic analysis such as short tandem repeat analysis,Taqman allelic discrimination assay, PCR-restriction fragment lengthpolymorphism (PCR-RFLP) and whole exome sequencing (Said et al.,2014).

It is important to note that the analysis of genetic variants responsi-ble for neonatal hyperbilirubinemia should be as extensive as possibleand incorporate various genes (Watchko et al., 2009). Therefore, addi-tional genetic variants including those that are involved in the bilirubinmetabolism should also be analyzed to inspect the linkage among them.Variants in the NR1I3 gene were only studied thoroughly among popu-lations in Japan and Singapore (Ikeda et al., 2003; Chew et al., 2013).Findings from these studies can then be employed to further explorethe contribution of different NR1I3 variants on the development ofneonatal hyperbilirubinemia.

5. Conclusion

In conclusion, our results suggested a female-specific significant in-verse association of the homozygous variant genotype of MPJ6_1I3008with the risk of neonatal hyperbilirubinemia. Besides, MPJ6_1I3008,IVS8+116TNG and 540ANG were not significantly associated with theneonatal hyperbilirubinemia risk when compared between the groupsin Malay population.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

We thank all the staff in Hospital Universiti Sains Malaysia neonatalward and parents of the subjects for their valuable contributions to theproject. The study was supported by APEX Delivering Excellence Grant2012 (No. 1002/PPSP/910342) of Universiti Sains Malaysia.

References

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignmentsearch tool. J. Mol. Biol. 215, 403–410.

American Academy of Pediatrics Subcommittee on Hyperbilirubinemia, 2004. Clinicalpractice guideline. Management of hyperbilirubinemia in the newborn infant 35 ormore weeks of gestation. Pediatrics 114, 297–316.

Ayi, K., Turrini, F., Piga, A., Arese, P., 2004. Enhanced Phagocytosis of Ring-parasitizedMutant Erythrocytes: A Common Mechanism that may Explain Protection AgainstFalciparum Malaria in Sickle Trait and Beta-thalassemia Trait.

Baes, M., Gulick, T., Choi, H.S., Martinoli, M.G., Simha, D., Moore, D.D., 1994. A new orphanmember of the nuclear hormone receptor superfamily that interacts with a subset ofretinoic acid response elements. Mol. Cell. Biol. 14, 1544–1552.

Bhutani, V.K., Johnson, L.H., Jeffrey Maisels, M., Newman, T.B., Phibbs, C., Stark, A.R.,Yeargin-Allsopp, M., 2004. Kernicterus: epidemiological strategies for its preventionthrough systems-based approaches. J. Perinatol. 24, 650–662.

Bhutani, V.K., Vilms, R.J., Hamerman-Johnson, L., 2010. Universal bilirubin screening forsevere neonatal hyperbilirubinemia. J. Perinatol. 30, S6–S15.

Bosma, P.J., Seppen, J., Goldhoorn, B., Bakker, C., Oude Elferink, R.P., Chowdhury, J.R.,Chowdhury, N.R., Jansen, P.L., 1994. Bilirubin UDP-glucuronosyltransferase 1 is theonly relevant bilirubin glucuronidating isoform in man. J. Biol. Chem. 269,17960–17964.

http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0005http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0005http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0010http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0010http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0010http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0015http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0015http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0015http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0020http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0020http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0020http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0025http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0025http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0030http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0030http://refhub.elsevier.com/S0378-1119(15)00870-7/rf9000http://refhub.elsevier.com/S0378-1119(15)00870-7/rf9000http://refhub.elsevier.com/S0378-1119(15)00870-7/rf9000

204 T.P. Cheung et al. / Gene 573 (2015) 198–204

Chen, Y., Ferguson, S.S., Negishi, M., Goldstein, J.A., 2003. Identification of constitutiveandrostane receptor and glucocorticoid receptor binding sites in the CYP2C19 pro-moter. Mol. Pharmacol. 64, 316–324.

Chew, S.C., Lim, J.S.L., Singh, O., Wong, M., Lee, E.J.D., Chowbay, B., 2013. Genetic variationsof NR1I3 and NR2B1 in Asian populations. Drug Metab. Pharmacokinet. 28, 169–176.

Dean, A.G., Arner, T.G., Sunki, G.G., Friedman, R., Lantinga, M., Sangam, S., Zubieta, J.C.,Sullivan, K.M., Brendel, K.A., Gao, Z., Fontaine, N., Shu, M., Fuller, G., Smith, D.C.,Nitschke, D.A., Fagan, R.F., 2011. Epi Info™, A Database and Statistics Program forPublic Health Professionals. CDC, Atlanta, GA, USA.

di Masi, A., Marinis, E.D., Ascenzi, P., Marino, M., 2009. Nuclear receptors CAR and PXR:molecular, functional, and biomedical aspects. Mol. Asp. Med. 30, 297–343.

D'Silva, S., Colah, R.B., Ghosh, K., Mukherjee, M.B., 2014. Combined effects of the UGT1A1and OATP2 gene polymorphisms as major risk factor for unconjugatedhyperbilirubinemia in Indian neonates. Gene 547, 18–22.

Huang, W., Zhang, J., Chua, S.S., Qatanani, M., Han, Y., Granata, R., Moore, D.D., 2003.Induction of bilirubin clearance by the constitutive androstane receptor (CAR).Proc. Natl. Acad. Sci. 100, 4156–4161.

Huang, M.J., Kua, K.E., Teng, H.C., Tang, K.S., Weng, H.W., Huang, C.S., 2004. Risk factors forsevere hyperbilirubinemia in neonates. Pediatr. Res. 56, 682–689.

Ikeda, S., Kurose, K., Ozawa, S., Sai, K., Hasegawa, R., Komamura, K., Ueno, K., Kamakura, S.,Kitakaze, M., Tomoike, H., Nakajima, T., Matsumoto, K., Saito, H., Goto, Y.-i., Kimura,H., Katoh, M., Sugai, K., Minami, N., Shirao, K., Tamura, T., Yamamoto, N., Minami,H., Ohtsu, A., Yoshida, T., Saijo, N., Saito, Y., Sawada, J.-i., 2003. Twenty-six novel singlenucleotide polymorphisms and their frequencies of the NR1I3 (CAR) gene in aJapanese population. Drug Metab. Pharmacokinet. 18, 413–418.

Johnson, L., Bhutani, V.K., Karp, K., Sivieri, E.M., Shapiro, S.M., 2009. Clinical report fromthe pilot USA Kernicterus Registry (1992 to 2004). J. Perinatol. 29, S25–S45.

Kaplan, M., Muraca, M., Hammerman, C., Rubaltelli, F.F., Vilei, M.T., Vreman, H.J.,Stevenson, D.K., 2002. Imbalance Between Production and Conjugation of Bilirubin:A Fundamental Concept in the Mechanism of Neonatal Jaundice. Pediatrics 110, e47.

Lancet, The, 2010. Detection and treatment of neonatal jaundice. Lancet 375, 1845.Liu, J., Long, J., Zhang, S., Fang, X., Luo, Y., 2013. Polymorphic variants of SLCO1B1 in

neonatal hyperbilirubinemia in China. Ital. J. Pediatr. 39, 1–5.Maisels, M.J., Bhutani, V.K., Bogen, D., Newman, T.B., Stark, A.R., Watchko, J.F., 2009.

Hyperbilirubinemia in the newborn infant ≥35weeks' gestation: an update with clar-ifications. Pediatrics 124, 1193–1198.

Miasnikova, G.Y., Sergueeva, A.I., Nouraie, M., Niu, X., Okhotin, D.J., Polyakova, L.A., Ganz,T., Prchal, J.T., Gordeuk, V.R., 2011. The Heterozygote Advantage of the ChuvashPolycythemia VHLR200W Mutation may be Protection Against Anemia.

Morioka, I., Morikawa, S., Yusoff, S., Harahap, I.S.K., Nishimura, N., Yokoyama, N., Matsuo,M., Rostenberghe, H.V., Nishio, H., 2010. Genetic disorders associated with neonataljaundice. East. J. Med. 15, 155–162.

Muchowski, K.E., 2014. Evaluation and treatment of neonatal hyperbilirubinemia. Am.Fam. Physician 89, 873–878.

Newman, T.B., Xiong, B., Gonzales, V.M., Escobar, G.J., 2000. Prediction and prevention ofextreme neonatal hyperbilirubinemia in a mature health maintenance organization.Arch. Pediatr. Adolesc. Med. 154, 1140–1147.

Nuclear Receptors Nomenclature Committee, 1999. A unified nomenclature system forthe nuclear receptor superfamily. Cell 97, 161–163.

Park, Y.J., Lee, E.K., Lee, Y.K., Park, D.J., Jang, H.C., Moore, D.D., 2012. Opposing regulation ofcytochrome P450 expression by CAR and PXR in hypothyroid mice. Toxicol. Appl.Pharmacol. 263, 131–137.

Rennie, J., Burman-Roy, S., Murphy, M.S., 2010. Neonatal jaundice: summary of NICE guid-ance. BMJ 340.

Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologistprogrammers. In: Krawetz, S., S, M. (Eds.), Bioinformatics Methods and Protocols:Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386.

Said, M., Cappiello, C., Devaney, J.M., Podini, D., Beres, A.L., Vukmanovic, S., Rais-Bahrami,K., Luban, N.C., Sandler, A.D., Tatari-Calderone, Z., 2014. Genomics in prematureinfants: a non-invasive strategy to obtain high-quality DNA. Sci. Rep. 4.

Senekeo-Effenberger, K., Chen, S., Brace-Sinnokrak, E., Bonzo, J.A., Yueh, M.-F., Argikar, U.,Kaeding, J., Trottier, J., Remmel, R.P., Ritter, J.K., Barbier, O., Tukey, R.H., 2007. Expres-sion of the human UGT1 locus in transgenic mice by 4-chloro-6-(2,3-xylidino)-2-pyrimidinylthioacetic acid (WY-14643) and implications on drug metabolismthrough peroxisome proliferator-activated receptorα activation. DrugMetab. Dispos.35, 419–427.

Stothard, P., 2000. The sequence manipulation suite: JavaScript programs for analyzingand formatting protein and DNA sequences. Biotechniques 28, 1102–1104.

Sugatani, J., Kojima, H., Ueda, A., Kakizaki, S., Yoshinari, K., Gong, Q.-H., Owens, I.S.,Negishi, M., Sueyoshi, T., 2001. The phenobarbital response enhancer module in thehuman bilirubin UDP-glucuronosyltransferase UGT1A1 gene and regulation by thenuclear receptor CAR. Hepatology 33, 1232–1238.

Sugatani, J., Sueyoshi, T., Negishi, M., Miwa, M., 2005. Regulation of the human UGT1A1gene by nuclear receptors constitutive active/androstane receptor, pregnane Xreceptor, and glucocorticoid receptor. In: Helmut, S., Lester, P. (Eds.), Methods inEnzymology. Academic Press, pp. 92–104.

Sullivan, A.D., Wigginton, J., Kirschner, D., 2001. The coreceptor mutation CCR5Δ32 influ-ences the dynamics of HIV epidemics and is selected for by HIV. Proc. Natl. Acad. Sci.98, 10214–10219.

Tiwari, P.K., Bhutada, A., Agarwal, R., Basu, S., Raman, R., Kumar, A., 2014. UGT1A1 genevariants and clinical risk factors modulate hyperbilirubinemia risk in newborns.J. Perinatol. 34, 120–124.

Watchko, J.F., Lin, Z., 2010. Exploring the genetic architecture of neonatalhyperbilirubinemia. Semin. Fetal Neonatal Med. 15, 169–175.

Watchko, J.F., Lin, Z., Clark, R.H., Kelleher, A.S., Walker, M.W., Spitzer, A.R., Group, f.t.P.H.S.,2009. Complex multifactorial nature of significant hyperbilirubinemia in neonates.Pediatrics 124, e868–e877.

Williams, T.N., Mwangi, T.W., Roberts, D.J., Alexander, N.D., Weatherall, D.J., Wambua, S.,Kortok, M., Snow, R.W., Marsh, K., 2005. An immune basis for malaria protection bythe sickle cell trait. PLoS Med. 2 (e128).

Yueh, M.-F., Tukey, R.H., 2007. Nrf2-Keap1 signaling pathway regulates human UGT1A1expression in vitro and in transgenic UGT1 mice. J. Biol. Chem. 282, 8749–8758.

Yueh, M.-F., Huang, Y.-H., Hiller, A., Chen, S., Nguyen, N., Tukey, R.H., 2003. Involvement ofthe Xenobiotic Response Element (XRE) in Ah receptor-mediated induction ofhuman UDP-glucuronosyltransferase 1A1. J. Biol. Chem. 278, 15001–15006.

Yusoff, S., Takeuchi, A., Ashi, C., Tsukada, M., Ma'Amor, N.H., Zilfalil, B.A., Yusoff, N.M.,Nakamura, T., Hirai, M., Harahap, I.S.K., Lee, M.J., Nishimura, N., Takaoka, Y.,Morikawa, S., Morioka, I., Yokoyama, N., Matsuo, M., Nishio, H., Van Rostenberghe,H., 2010. A polymorphic mutation, c.-3279TNG, in the UGT1A1 promoter is a riskfactor for neonatal jaundice in the Malay population. Pediatr. Res. 67, 401–406.

http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0035http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0035http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0035http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0040http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0040http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0050http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0050http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0055http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0055http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0060http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0060http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0060http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0065http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0065http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0070http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0070http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0075http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0075http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0075http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0080http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0080http://refhub.elsevier.com/S0378-1119(15)00870-7/rf2000http://refhub.elsevier.com/S0378-1119(15)00870-7/rf2000http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0085http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0090http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0090http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0095http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0095http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0095http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0100http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0100http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0105http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0105http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0110http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0110http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0115http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0115http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0115http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0120http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0120http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0125http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0125http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0125http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0130http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0130http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0135http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0135http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0135http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0140http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0140http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0145http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0145http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0145http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0145http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0145http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0155http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0155http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0160http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0160http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0160http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0165http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0165http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0165http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0165http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0170http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0170http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0170http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0175http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0175http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0175http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0180http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0180http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0185http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0185http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0190http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0190http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0195http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0195http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0200http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0200http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0200http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0205http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0205http://refhub.elsevier.com/S0378-1119(15)00870-7/rf0205

High resolution melting analysis of the NR1I3 genetic variants: Is there an association with neonatal hyperbilirubinemia?1. Introduction2. Materials and methods2.1. Study subjects2.2. Genomic DNA extraction and genotyping2.3. DNA sequencing2.4. Statistical analysis

3. Results3.1. Characteristics of study subjects3.2. NR1I3 variant analysis

4. Discussion5. ConclusionConflict of interestAcknowledgmentsReferences