Upload File

supplementary figure 1c

1
Supplementary Figure 1C

Upload: rhonda-winters

Post on 31-Dec-2015

19 views

Category:

Documents


0 download

Report

DESCRIPTION

Supplementary Figure 1C. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary Figure 1C

Supplementary Figure 1C

Letter to the Editors · 48 Supplementary Figures Supplementary Figure 1. Injection of liver purified iNKT cells, depleted of iNKT cells, failed to increase the survival of PR8 infected

Supplementary Figure 1

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Figure 2

Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–)

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

Supplementary Figure 1 | Schematic illustration of the …mai.group.whut.edu.cn/chs/lw/slected/201703/P... · 2017-06-04 · Supplementary Figure 7 | XPS analysis of NiMoO 4 electrode

Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis

Supplementary Figures · 2019-04-22 · 1 Supplementary Figures: S Figure 1. Cellular and molecular presence of B cells, iNKT cells, and δγTCR T cells in allergic inflammatory tissue

Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1

Supplementary Figure 1

Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Data · Supplementary Figure S2. Cobimetinib/ponatinib co-treatment increases death of pancreatic cancer cells (A) CTG assay measuring the effect of Dox-inducible STAT3

Supplementary Figure S1. HGF enhanced HCC metastasis. (A ...Supplementary Figure S1. HGF enhanced HCC metastasis. (A)Serum EGF level in HCC patients pre- and postoperation.Student-

Supplementary Figure S1

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative