Upload File

supplementary figure 2

1
A B Supplementary Figure 2 CAF 4 37.6% 90.8% PDPN + cells 0.44% PDPN - cells CAF1 CAF 2 CAF 3 + CAF 3 - CAF 4 + CAF4 - 0 0.1 0.2 0.3 PDPN/18S PDPN high low

Upload: moriah

Post on 05-Jan-2016

21 views

Category:

Documents


0 download

Report

DESCRIPTION

Supplementary Figure 2. PDPN + cells. A. 90.8%. CAF 4. 37.6%. PDPN - cells. 0.44%. low. PDPN. high. B. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary Figure 2

A

B

Supplementary Figure 2

CAF 4

37.6%

90.8%

PDPN + cells

0.44%

PDPN - cells

CAF1 CAF2 CAF3 +

CAF3 -

CAF4 +

CAF4 -

0

0.1

0.2

0.3

PDPN/18S

PDPN high low

Figure S1 · 2020. 12. 15. · 1 1 Supplementary Figures 2 3 Figure S1. PPARg expression attenuated the production of cleaved IL-1b in NLRP3 in- 4 flammasome reconstituted HEK293T

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Supplementary Figure S1

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary Figure 2: PBX1 induces morphological and cytoskeletal changes consistent with differentiation in NB. A) Morphology of SHSY5Y cells. Cells

Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Figure S2

A B C 3500x8900x 5600x14 000x 1500x5000x Supplementary Figure 1 TiO 2 Carbon black SWCNT

Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Supplementary Data · Supplementary Figure S2. Cobimetinib/ponatinib co-treatment increases death of pancreatic cancer cells (A) CTG assay measuring the effect of Dox-inducible STAT3

Supplementary Figure 1 | Schematic illustration of the …mai.group.whut.edu.cn/chs/lw/slected/201703/P... · 2017-06-04 · Supplementary Figure 7 | XPS analysis of NiMoO 4 electrode

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Supplementary Figure 1

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–)

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Figure 1

Supplementary Figure S1. HGF enhanced HCC metastasis. (A ...Supplementary Figure S1. HGF enhanced HCC metastasis. (A)Serum EGF level in HCC patients pre- and postoperation.Student-