The RUN Domain of Rubicon Is Important for hVps34Binding, Lipid Kinase Inhibition, and AutophagySuppression*□S

Received for publication, March 24, 2010, and in revised form, November 2, 2010 Published, JBC Papers in Press, November 9, 2010, DOI 10.1074/jbc.M110.126425

Qiming Sun‡, Jing Zhang‡, Weiliang Fan‡, Kwun Ngok Wong‡, Xiaojun Ding§, She Chen§, and Qing Zhong‡1

From the ‡Division of Biochemistry and Molecular Biology, Department of Molecular and Cell Biology, University of California,Berkeley, California 94720 and the §National Institute of Biological Sciences, Beijing 102206, China

The class III phosphatidylinositol 3-kinase (PI3KC3) plays acentral role in autophagy. Rubicon, a RUN domain-containingprotein, is newly identified as a PI3KC3 subunit through itsassociation with Beclin 1. Rubicon serves as a negative regula-tor of PI3KC3 and autophagosome maturation. The molecularmechanism underlying the PI3KC3 and autophagy inhibitionby Rubicon is largely unknown. Here, we demonstrate thatRubicon interacts with the PI3KC3 catalytic subunit hVps34via its RUN domain. The RUN domain contributes to the effi-cient inhibition of PI3KC3 lipid kinase activity by Rubicon.Furthermore, a Rubicon RUN domain deletion mutant fails tocomplement the autophagy deficiency in Rubicon-depletedcells. Hence, these results reveal a critical role of the RubiconRUN domain in PI3KC3 and autophagy regulation.

The class III PI3K (PI3KC3)2 is essential for autophagy,protein sorting, phagosome maturation, and cytokinesis (1–4). PI3KC3 is composed of the human Vps34 (hVps34) cata-lytic subunit and two regulatory subunits (p150 and Beclin 1)that are highly conserved from yeast to human. Functionalequivalents of Beclin 1/hVps34/p150 in yeast (Atg6/Vps15/Vps34) are essential for autophagy and vacuolar protein sort-ing (3, 5). The specificity of PI3KC3 in yeast is determined bydifferent complex compositions. Two regulatory proteins,Atg14 and Vps38, direct the core PI3K complex to either thepre-autophagosome structure for autophagy or the endosomefor vacuolar protein sorting (3, 6), respectively.Along with several other groups, we have recently purified

a mammalian PI3KC3 holocomplex that includes hVps34,p150, Beclin 1, UVRAG, Barkor/Atg14(L), and Rubicon (alsocalled p120 and Baron) (7–12). PI3KC3 forms two mutuallyexclusive protein subcomplexes that localize to different sub-cellular organelles and execute distinct functions. One com-plex is composed of the PI3KC3 core complex (hVps34, p150,

and Beclin 1) and Barkor/Atg14(L). Barkor/Atg14(L) is thetargeting factor for this complex to nascent autophagosomes(7). The other complex consists of the PI3KC3 core complexand UVRAG. UVRAG positively regulates PI3KC3 activityand autophagy maturation (13). UVRAG is also required forendocytosis through its interaction with C-VPS/HOPS (13,14). Rubicon (RUN domain protein as Beclin 1-interactingand cysteine-rich containing) is a newly identified PI3KC3subunit (7–12). It serves as a negative regulator of autophago-some and endosome maturation (9, 10, 12).Understanding the functional mode and structure basis of

Rubicon in autophagy is crucial. Here, we demonstrate thatRubicon resides in the UVRAG subcomplex of PI3KC3. Inter-estingly, we detected no direct interaction between Rubiconand Beclin 1, although it was originally purified in the Beclin 1complex. Instead, Rubicon physically interacted with UVRAGand hVps34. We have mapped the interaction domain of Ru-bicon with hVps34 to the RUN domain. The RUN domain iscritical for the function of Rubicon in suppressing PI3KC3lipid kinase activity and autophagy maturation.

EXPERIMENTAL PROCEDURES

Cell Culture—293T and U2OS cells were cultured inDMEM supplemented with 10% FBS. For tetracycline-induc-ible cells, Tet system approved FBS (Clontech) was used. Forimmunoprecipitation, cell extracts were incubated with 2 �gof antibody for 4 h and collected with protein A-Sepharosebeads (Amersham Biosciences) for 4 h at 4 °C. The immuno-complexes were then washed three times and subjected toSDS-PAGE. Immunoblotting was performed following stand-ard procedures.Plasmids and Antibodies—The full-length cDNA for hu-

man Rubicon (KIAA0226) was generated by PCR on the basisof a partial cDNA clone purchased from Kazusa. Anti-Rubi-con antibodies were generated by Abmart, Abgent, and CellSignaling. Other antibodies used in this study include anti-FLAG (M2, Sigma), anti-HA (Roche Applied Science), anti-Myc (9E10, Santa Cruz Biotechnology), anti-tubulin (SantaCruz Biotechnology), anti-UVRAG (Abgent), and anti-LC3(Sigma). pcDNA5/FRT/TO (Invitrogen) was modified by in-troducing the coding sequence of a 3�FLAG tag (betweenNotI and XhoI) and designated as pcDNA5-FLAG. The Rubi-con coding sequence was inserted between BamHI and NotIto generate the reading frame of Rubicon-FLAG, which wasused for setting up a stable cell line. pcDNA4/TO (Invitrogen)

* The work was supported, in whole or in part, by National Institutes ofHealth Grant RO1 CA133228 (to Q. Z.). The work was also supported by aNew Investigator Award for Aging from the Ellison Medical Foundationand the Hellman Family Fund (to Q. Z.).

□S The on-line version of this article (available at http://www.jbc.org) con-tains supplemental Figs. S1–S4.

1 To whom correspondence should be addressed: Dept. of Molecular andCell Biology, University of California, 316 Barker Hall, Berkeley, CA 94720.Tel.: 510-643-6842; Fax: 510-642-7038; E-mail: qingzhong@berkeley.edu.

2 The abbreviations used are: PI3KC3, class III phosphatidylinositol 3-kinase;hVps34, human Vps34; PI(3)P, phosphatidylinositol 3-phosphate; Ni-NTA,nickel-nitrilotriacetic acid; CCD, coiled-coil domain; aa, amino acids.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 1, pp. 185–191, January 7, 2011© 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

JANUARY 7, 2011 • VOLUME 286 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 185

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

was modified by introducing the coding sequence of a Myctag (between NotI and XhoI) and designated aspcDNA4-Myc, into which Rubicon coding sequence werecloned between BamHI and NotI.PI3K Kinase Assay—The procedure was modified from a

protocol described previously (13). FLAG-tagged hVps34 ex-pressed in cells was immunoprecipitated with M2 beads(Sigma) and extensively washed and preincubated at roomtemperature for 10 min in 60 �l of reaction containing 2 �g ofsonicated phosphatidylinositol. The reaction was initiated bythe addition of 5 �l of ATP mixture (1 �l of 10 mM unlabeledATP, 1 �l of [�-32P]ATP, and 3 �l of H2O) and incubated for15 min at room temperature. The reaction was terminated,dried using a SpeedVac system, and resuspended in 20 �l ofCHCl3/MeOH (1:1). The resultant assay product was sepa-rated on dried silica alumina thin liquid chromatographyplates with running buffer (9:7:2 CHCl3/MeOH and 4 M

NH4OH). Radiolabeled phosphatidylinositol 3-phosphate(PI(3)P) was visualized with a Fuji phosphorimaging scanner.Recombinant Protein Purification—The protocol for re-

combinant protein production from insect cells is similar to atandem affinity purification procedure described previously(7). For the recombinant proteins purified from mammaliancells, whole cell lysates from transfected 293T cells were pre-pared in tandem affinity purification buffer, and recombinantproteins were collected with M2 beads. After extensive wash-ing, the proteins were eluted with FLAG peptide (0.1 mg/ml)and analyzed.Immunostaining—Cells were grown on 6-well plates with

coverslips. One day later, cells were fixed with 4% paraformal-dehyde solution in PBS at room temperature for 10 min. Afterpermeabilization with PBS buffer containing 0.1% TritonX-100 at room temperature for 20 min, cells were incubatedwith primary antibodies at 37 °C for 2 h. Upon extensivewashing, cells were incubated with different fluorescent dye-conjugated secondary antibodies at 37 °C for 2 h. Slides wereexamined using a laser scanning confocal microscope (ZeissLSM 510 META VIS/UV).Inducible shRNA and Complementation Cell Lines—The

shRNA sequences were designed with siRNA Target Finderprovided by Ambion and were cloned into BglII and HindIIIsites of the pSUPERIOR.puro vector (Oligoengine). The in-ducible shRNA cell lines were established according to theprotocol. The shRNA coding sequence for human Rubiconknockdown is GATCCCCGCAGTGGAACAGAACAACCT-TCAAAGAGGTTGTTCTGTTCCACTGCTTTTTA (withthe targeted sequence of Rubicon underlined). The inducibleknockdown stable cell lines were generated from U2OSTetR

cells (7). To measure the knockdown efficiency, cells weretreated with 500 ng/ml doxycycline for 3 days, followed byWestern blotting against Rubicon. In complementation as-says, RNAi-resistant wild-type Rubicon and mutants (inpcDNA4-GFP-FLAG) were generated by site-specific mu-tagenesis with primer p1 (catgctgcagtgcctggaagcCgtCgaG-caAaaTaaTccccgcctcctggctcagatc) and p2 (gatctgagccaggag-gcggggAttAttTtgCtcGacGgcttccaggcactgcagcatg). Theseconstructs were expressed in Rubicon-depleted cells, and sta-

ble cell lines were established by selection against 200 �g/mlZeocin, 0.5 �g/ml blasticidin, and 1 �g/ml puromycin.Transmission Electron Microscopy Analysis—For electron

microscopy, cells were fixed with 2% glutaraldehyde in 0.1 M

sodium cacodylate buffer (pH 7.2) for 2 h, followed by 1% os-mium tetroxide in 0.1 M sodium cacodylate buffer (pH 7.2) for2 h. Samples were blocked with 0.5% aqueous uranyl acetateovernight and subjected to low temperature dehydration andinfiltration with a graded series of Epon/Araldite, followed byembedding in 100% Epon/Araldite. Thin sections (60 nm)were cut and stained with Reynolds lead citrate using an FEITecnai 12 transmission electron microscope.

RESULTS

Composition of the Rubicon-containing PI3KC3 Complex—The PI3KC3 complex has recently been purified in mammaliancells by several groups (7–11). In addition to the catalytic subunithVps34, the regulatory subunit p150, Beclin 1, UVRAG, andBarkor/Atg14(L), a novel protein called Rubicon was also identi-fied in this complex (7, 9, 10). Rubicon is involved in autophago-somematuration and is likely involved in endosomematurationalso (9, 10). Rubicon contains 972 amino acids, with a coiled-coildomain, an FYVE-like domain, and a recognizable RUN domainthat is shared by a group of proteins interacting with smallGTPases (15–17).The stoichiometry of the PI3KC3 complex is complicated

by the formation of two mutually exclusive subcomplexescharacterized by Barkor/Atg14(L) and UVRAG, respectively(7, 8). These two subcomplexes have organelle-specific distri-butions. The Barkor/Atg14(L) complex is localized to auto-phagosomes (7, 8), whereas the UVRAG complex resides pre-dominantly on endosomes (14). Although Rubicon has beenidentified as a component of PI3KC3, it is still not clear whichPI3KC3 subcomplex it associates with or whether it forms aunique subcomplex of PI3KC3. To clarify this question, weperformed sequential affinity purifications of cellular com-plexes of Rubicon to elucidate its complex compositions.Rubicon fused to a ZZ tag (two tandem repeats of the PrA

IgG binding domain) at the amino terminus and a FLAG tagat the COOH terminus was used as bait (Fig. 1A) to purify itsendogenous complex following a procedure described previ-ously in U2OS cells (7, 11, 18). In the Rubicon complex,UVRAG, hVps34, p150, and Beclin 1 (but not Barkor/Atg14(L)) were detected by mass spectrometry (Fig. 1A). Ru-bicon consistently coprecipitated with hVps34 (Fig. 1B).These data confirmed the presence of Rubicon in the PI3KC3complex and assigned Rubicon to the subcomplex withUVRAG.Rubicon Binds Directly to UVRAG and hVps34—Although

Rubicon has been shown to interact with the PI3KC3 complex(Fig. 1) (9, 10), the component through which it binds toPI3KC3 directly has not been characterized. To test whichcomponent(s) of PI3KC3 directly interact with Rubicon, wepurified recombinant full-length Rubicon, hVps34, UVRAG,Beclin 1, and Barkor/Atg14(L) from baculovirus-infected in-sect cells or mammalian cells (Fig. 2A) and tested their inter-actions in an in vitro pulldown assay. All of these recombinantproteins were purified to near homogeneity (Fig. 2A). Both

Role of the Rubicon RUN Domain in Autophagy

186 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 1 • JANUARY 7, 2011

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

Rubicon and Barkor/Atg14(L) possessed an additional His6tag. These two proteins were bound to a nickel-nitrilotriaceticacid (Ni-NTA) column first, followed by incubation of indi-vidual PI3KC3 subunits. In this in vitro pulldown assay, Rubi-con directly bound to hVps34 and UVRAG (Fig. 2B). Interest-ingly, there was no direct interaction between Rubicon andBeclin 1, although Rubicon was identified in the Beclin 1 com-plex (9, 10). As a control, we found that Barkor/Atg14(L) in-teracted with Beclin 1, but neither hVps34 nor UVRAGbound directly (Fig. 2B).The RUN Domain of Rubicon Interacts with hVps34—We

mapped the interaction domain of Rubicon for UVRAG andhVps34 binding. A series of deletion mutants were generated,including deletions of the RUN domain, coiled-coil domain(CCD), and FYVE-like domain of full-length Rubicon, as wellas three large polypeptide fragments containing the RUN do-main, CCD, or FYVE domain (Fig. 3A). The interaction ofthese mutants with UVRAG was evaluated by an immunopre-cipitation assay. Deletion of the RUN domain, CCD, or FYVE-like domain was not enough to abolish the interaction be-tween Rubicon and UVRAG (Fig. 3A, lanes 3–5). Twofragments of Rubicon encompassing amino acids (aa) 300–600 and 600–972, but not the N-terminal fragment 1–300,interacted with UVRAG efficiently (Fig. 3A), which is consis-

tent with a previous report that a large region (aa 393–849) ofRubicon binds to UVRAG (9).Because we detected a direct interaction between Rubicon

and hVps34, we further investigated the interaction domainof Rubicon with hVps34. The C terminus of Rubicon (aa 300–972) could pull down hVps34 probably through UVRAG (sup-plemental Fig. S1) (9, 10). Unexpectedly, the N-terminal re-gion of Rubicon (aa 1–300), which does not interact withUVRAG (9, 10), strongly bound to hVps34 in the co-immuno-precipitation assay (Fig. 3B). We further divided the first 300amino acids into three fragments, including the RUN domainalone (aa 49–180). Although the expression of the RUN do-main alone was much lower compared with the other twofragments, the weakly expressed RUN domain bound tohVps34 strongly (Fig. 3B).The RUN Domain Contributes to Rubicon Inhibition of

hVps34 Lipid Kinase Activity—Binding of the Rubicon RUNdomain to hVps34 led to the speculation that the RUN do-main might be involved in PI3KC3 regulation. We measuredPI3KC3 lipid phosphorylation activity in HEK293T cells ex-pressing wild-type or mutant Rubicon. PI3KC3 phosphor-ylates the 3�-hydroxyl position of the phosphatidylinositolring to produce PI(3)P (19, 20). The production of PI(3)P byPI3KC3 could be visualized and quantified by fluorescence ofthe GFP-tagged double FYVE finger of the Hrs protein (15).

FIGURE 1. Rubicon is part of the PI3KC3 complex with UVRAG. A, cell ex-tracts from U2OS cells expressing ZZ-Rubicon-FLAG at physiological levelsor vector alone (control (Con)) were collected and purified sequentiallythrough IgG beads and FLAG M2 beads. The resulting complex was re-solved by 4 –12% gradient SDS-PAGE and silver staining and analyzed bymass spectrometry. The identified proteins are indicated. M, molecular massmarkers; TAP, tandem affinity purification. B, U2OS cell extracts were immu-noprecipitated (IP) with anti-hVps34 or anti-Rubicon antibody, and the re-sulting immunoprecipitates were analyzed by Western blotting (immuno-blotting (IB)).

FIGURE 2. Rubicon physically interacts with UVRAG and hVps34. A, full-length FLAG-tagged (F) or FLAG-His-double-tagged (FH) recombinanthVps34, Beclin 1, and Barkor/Atg14(L). Rubicon and UVRAG were purifiedfrom baculovirus-infected insect cells or transfected HEK293T cells. B, Rubi-con interacts directly with UVRAG and hVps34 in the purified system. Puri-fied Rubicon-FLAG-His6 or Barkor/Atg14(L)-FLAG-His6 was first bound toNi-NTA beads. Purified recombinant proteins for hVps34, UVRAG, and Beclin1 were then allowed to pass through the Ni-NTA beads (even-numberedlanes). Bound proteins were detected by Western blotting using anti-FLAGantibody. The empty Ni-NTA beads were used as controls (odd-numberedlanes).

Role of the Rubicon RUN Domain in Autophagy

JANUARY 7, 2011 • VOLUME 286 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 187

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

Because the FYVE probe specifically binds to PI(3)P, we couldmeasure PI3KC3 activity by detecting FYVE fluorescence.PI(3)P production was compromised in Rubicon-expressingcells compared with that in wild-type cells (Fig. 4, A and B),consistent with the inhibitory role of Rubicon in PI3KC3 lipidphosphorylation (10). We then expressed different fragments

of Rubicon to test their effect on PI3KC3 activity. Because theexpression of the RUN domain alone was low probably be-cause its expression requires the surrounding regions (Fig.3B), we expressed the N terminus of Rubicon (aa 1–300) anda large C terminus (aa 180–972) to score their effect onPI(3)P production. The RUN domain-containing fragment

FIGURE 3. Rubicon binds to hVps34 via the RUN domain. A, in Rubicon, the three highlighted domains are the RUN domain, CCD, and FYVE-like domain.FLAG-tagged wild-type Rubicon and deletion mutants, including deletions of the RUN domain, CCD, or FYVE-like domain from full-length Rubicon, as wellas three large polypeptide fragments containing the RUN domain, CCD, or FYVE-like domain were coexpressed with Myc-UVRAG in HEK293T cells. Cell ex-tracts were immunoprecipitated (IP) with anti-FLAG antibody. The bound proteins (B) or the 5% input extract was detected by immunoblotting (IB) usingthe antibodies indicated. WCL, whole cell lysate. B, the N terminus of Rubicon (aa 1–300) was further divided into three FLAG-tagged fragments containingaa 1– 48, 49 –180 (RUN domain), and 181–300, respectively. These deletion constructs were coexpressed with Myc-hVps34 in HEK293T cells. The cell extractswere immunoprecipitated with FLAG M2 beads, followed by Western blotting for Myc-hVps34 and FLAG-tagged Rubicon fragments.

FIGURE 4. The RUN domain of Rubicon contributes to efficient inhibition of hVps34 lipid kinase activity. A, vector alone, the N-terminal region (aa1–300), and the C-terminal region (aa 181–972) of Rubicon were coexpressed with GFP-2�FYVE in HEK293T cells. GFP-2�FYVE puncta were observed un-der a fluorescence microscope. 3-MA, 3-methyladenine. B, quantitative analysis (summarized from 100 cells) of GFP-2�FYVE puncta in the cells described inA. C, FLAG-tagged hVps34 was coexpressed in HEK293T cells with one of the following Myc-tagged proteins: Beclin 1, Barkor/Atg14(L), UVRAG, Rubicon, orRubicon-�RUN. D, cell lysates from the cells described in C were immunoprecipitated with M2 beads and assayed for PI3K kinase activity in a TLC assay. Thephosphorylation product [32P]PI(3)P was separated by TLC and further visualized using a Fuji phosphorimaging scanner.

Role of the Rubicon RUN Domain in Autophagy

188 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 1 • JANUARY 7, 2011

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

was efficient in suppressing PI(3)P production (Fig. 4, A andB), suggesting that Rubicon binding of hVps34 via the RUNdomain plays an important role in hVps34 inhibition. As apositive control, PI(3)P production could be efficientlyblocked by treatment with the PI3K inhibitor 3-methylad-enine (Fig. 4, A and B). In addition, the N terminus of Rubiconalso reduced the number of LC3 puncta (supplemental Fig.S2), suggesting that autophagy is also blocked by thisfragment.To consolidate the function of the Rubicon RUN domain in

PI3KC3 regulation, we measured the lipid phosphorylationactivity in an in vitro TLC lipid kinase assay. In this assay, theproduction of PI(3)P by PI3KC3 could be detected and quan-tified by radiolabeling the phosphate group of phosphoinosi-tol (19, 20). hVps34 was coexpressed with Barkor/Atg14(L),UVRAG, and Rubicon (Fig. 4C), and its lipid kinase activitywas tested accordingly. Both Barkor/Atg14(L) and UVRAGstimulated hVps34 lipid kinase activity (Fig. 4D), supportingtheir positive roles in hVps34 activation. Coexpression ofwild-type Rubicon efficiently blocked UVRAG-mediatedhVps34 activity (Fig. 4D, lane 4), indicating that Rubicon canantagonize UVRAG-mediated hVps34 stimulation. A Rubiconmutant with a RUN domain deletion significantly reduced theinhibitory activity of Rubicon in PI(3)P production (�40%)(Fig. 4D, lane 5). This suggests that the RUN domain of Rubi-con contributes to its efficient suppression of PI3KC3 lipidkinase activity.The RUN Domain Is Important for Rubicon Function in

Autophagy—Two recent studies suggested that Rubicon playsa negative role in autophagosome maturation (9, 10). We in-vestigated the function of the RUN domain in autophagy reg-ulation. We employed two of the most representative ap-proaches for autophagy regulation, electron microscopyanalysis and p62 degradation, to study the structural require-ment of the RUN domain in autophagy.In Rubicon-depleted cells, autophagosome maturation was

promoted, which led to the accumulation of late autophagicvacuoles, probably due to the inability of lysosomes to digestincreased autophagosomes in time. Autophagic vacuolescould be detected under the electron microscope. We per-formed the electron microscopy analysis with wild-type andRubicon RNAi-depleted cells. Rubicon was depleted by anshRNA against Rubicon that was inducibly expressed uponthe addition of doxycycline in U2OS cells. In Rubicon-de-pleted cells, we observed abundant mature autophagic vacu-oles that were highly enriched in cytosolic content and or-ganelles (Fig. 5A, arrows). Autophagic vacuoles were rarelyobserved in parental U2OS or shRNA-non-induced cells (Fig.5A). This observation is consistent with previously publishedresults (9, 10).Rubicon depletion also led to the accumulation of LC3 cy-

tosolic puncta representing autophagic vacuoles (supplemen-tal Fig. S3). A significant portion of LC3 cytosolic puncta co-localized with Rab5 (an early endosome marker), Rab7 (a lateendosome marker), and LAMP1 (a lysosome marker) (supple-mental Fig. S1), suggesting that late autophagic vacuoles thatfuse with endosomes and lysosomes accumulate in Rubicon-depleted cells. These data confirmed that autophagosome

maturation is accelerated when Rubicon is depleted, consis-tent with previously published results (9, 10).We further tested whether ectopically expressed Rubicon

could slow autophagosome maturation and therefore relievethe accumulation of mature autophagic vacuoles. We estab-lished Rubicon RNAi-depleted cells stably complementedwith RNAi-resistant wild-type Rubicon (supplemental Fig.S4). Rubicon RUN domain deletion (aa 1–180) and C-termi-nal deletion (aa 800–972) mutants were also stably expressedin Rubicon-depleted U2OS cells. Autophagic vacuoles wereobserved and counted in these cells under an electron micro-scope. Expression of wild-type Rubicon or the Rubicon mu-tant with the C-terminal deletion was sufficient to ablate theautophagic vacuole accumulation in Rubicon-depleted cells,but expression of the Rubicon mutant with the RUN domaindeletion failed to complement this phenotype (Fig. 5, B andC). Hence, the RUN domain is crucial for the negative func-tion of Rubicon in autophagosome maturation.Degradation of the selective autophagy substrate p62 (21,

22) was also examined in Rubicon-depleted and Rubicon-complemented cells. p62 autophagic degradation was acceler-ated in Rubicon-depleted cells, which was rescued by comple-mentation with wild-type Rubicon and the C-terminaldeletion mutant, but not with the RUN domain deletion mu-tant (Fig. 5D). This result is consistent with the EM results,indicating that the RUN domain of Rubicon is important forthe negative regulator role of Rubicon in autophagicdegradation.

DISCUSSION

Rubicon is a recently identified PI3KC3 subunit that is re-quired for suppression of autophagosome maturation. In thisstudy, we demonstrated that Rubicon preferentially interactswith UVRAG in the endosomal PI3KC3 subcomplex. In addi-tion to a physical interaction with UVRAG, Rubicon alsobinds to the catalytic subunit hVps34 via its RUN domain.This binding contributes to its suppression of hVps34 lipidkinase activity. Finally, the RUN domain is critical for Rubi-con function in autophagosome maturation and autophagicdegradation. Although the RUN domain is proposed to inter-act with small GTPases, we have revealed here a unique roleof the RUN domain in hVps34 interaction and autophagyregulation.Several proteins have been reported to interact with

hVps34, including Rab5 (23–27). Recent biochemical purifica-tions from several laboratories have disclosed six to sevensubunits of PI3KC3, including hVps34, p150/Vps15, Beclin1/Atg6, UVRAG, Barkor/Atg14(L), and Rubicon (7, 9–11). Allof them except Rubicon have a functional counterpart inyeast. Also, similar to the yeast PI3K complex, mammalianPI3KC3 forms two mutually exclusive subcomplexes (7,9–11). One subcomplex contains the core complex and Bar-kor/Atg14(L). Because of its localization on early autophago-somes and functionality in autophagosome formation (7), werefer to this complex as the autophagosomal PI3KC3 com-plex. The other subcomplex contains the core complex,UVRAG, and Rubicon. This complex is localized mainly toendosomes; we therefore refer to it as the endosomal PI3KC3

Role of the Rubicon RUN Domain in Autophagy

JANUARY 7, 2011 • VOLUME 286 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 189

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

complex. Emerging evidence suggests that this subcomplex isinvolved in both autophagosome and endosome maturation(9, 10, 12).However, the architecture of the mammalian PI3KC3 com-

plex is slightly different from its counterpart in yeast. For ex-ample, Barkor/Atg14(L) and UVRAG interact with hVps34via Beclin 1 in mammalian cells (7, 13), whereas two regula-tory proteins, Atg14 (Barkor-like) and Vps38 (UVRAG-like)mediate the interaction between hVps34 and Beclin 1/Atg6(3). Furthermore, because Rubicon and its autophagy-inhibit-ing functions through the PI3KC3 complex have no homolo-gous function in yeast, the autophagy inhibition activity ofRubicon could be unique to multicell organisms. However,the mechanism of PI3KC3 and autophagy inhibition by Rubi-con is largely unknown. Interestingly, we found no direct in-teraction between Beclin 1 and Rubicon, although Rubiconwas named as a Beclin 1-interacting protein (9, 10). Instead,Rubicon interacts with UVRAG and hVps34 directly (Fig. 2).The physical interaction between Rubicon and hVps34 mighthelp to explain its inhibitory effect on PI3K activity. The data

presented in this study support a critical role of the RUN do-main in the inhibitory function of Rubicon. However, the in-teraction between the central region of Rubicon and UVRAG(9, 10) might also contribute to the negative regulation of Ru-bicon, which needs further investigation. We also cannot ex-clude the possibility that Rubicon could interact with hVps34through region(s) other than the RUN domain. Nevertheless,our data demonstrate that the RUN domain is not only suffi-cient for hVps34 binding but also critical for regulatingPI3KC3 lipid kinase activity and autophagy.The RUN domain was originally found in a group of pro-

teins that interact with small GTPases (15–17). It was there-fore proposed as a binding surface for small GTPases. Ourresults indicate that the RUN domain can also bind hVps34.This may provide a possible link between many RUN domain-containing proteins and PI3K regulation, the detailed mecha-nism of which is still largely unknown and needs to be furtherexplored through more structural and functional analyses.In this study, we have identified a previously unknown

function of the RUN domain of Rubicon in PI3KC3 and auto-

FIGURE 5. The Run domain is important for autophagy suppression by Rubicon. A, Rubicon shRNA-non-induced U2OS cells (4i DOX�) and doxycycline-induced RNAi-depleted cells (4i DOX�) were observed under a transmission electron microscope. Autophagic vacuoles are indicated by arrows. Clone 4expressing shRNA against Rubicon (Rubicon 4i) was used in this study. Scale bars � 2 �m. B, Parental U2OS cells (U2OS cells expressing the tet repressor(U2OS-TR)), Rubicon shRNA-non-induced U2OS cells (4i DOX�), RNAi-depleted cells (4i DOX�), and Rubicon-depleted cells complemented with vectoralone, FLAG-tagged wild-type Rubicon, the Rubicon C-terminal deletion (�CT; aa 800 –972), and the Rubicon RUN domain deletion (�RUN; aa 1–180) wereobserved under a transmission electron microscope. Autophagic vacuoles are marked by arrows. C, quantitative results (summarized from 50 cells/cell line)of the autophagic vacuoles (AVs) described in B. D, Rubicon was detected by anti-FLAG M2 antibody; p62 and tubulin were detected with the respectiveantibodies by immunoblotting of the cells described in B.

Role of the Rubicon RUN Domain in Autophagy

190 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 1 • JANUARY 7, 2011

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

phagy regulation. Dissecting the molecular mechanism of thismolecule will provide exciting insight into the mechanism ofthe autophagic pathways. Such information should be criticalfor the development of novel therapeutic tools for multiplehuman pathological conditions with dysfunctions ofautophagy.

Acknowledgments—We thank Cell Signaling and Abgent for anti-Rubicon antibodies and Livy Wilz for critical reading of themanuscript.

REFERENCES1. Sagona, A. P., Nezis, I. P., Pedersen, N. M., Liestøl, K., Poulton, J.,

Rusten, T. E., Skotheim, R. I., Raiborg, C., and Stenmark, H. (2010) Nat.Cell Biol. 12, 362–371

2. Schu, P. V., Takegawa, K., Fry, M. J., Stack, J. H., Waterfield, M. D., andEmr, S. D. (1993) Science 260, 88–91

3. Kihara, A., Noda, T., Ishihara, N., and Ohsumi, Y. (2001) J. Cell Biol.152, 519–530

4. Kinchen, J. M., Doukoumetzidis, K., Almendinger, J., Stergiou, L.,Tosello-Trampont, A., Sifri, C. D., Hengartner, M. O., and Ravichand-ran, K. S. (2008) Nat. Cell Biol. 10, 556–566

5. Cao, Y., and Klionsky, D. J. (2007) Cell Res. 17, 839–8496. Obara, K., Sekito, T., and Ohsumi, Y. (2006)Mol. Biol. Cell 17,

1527–15397. Sun, Q., Fan, W., Chen, K., Ding, X., Chen, S., and Zhong, Q. (2008)

Proc. Natl. Acad. Sci. U.S.A. 105, 19211–192168. Itakura, E., Kishi, C., Inoue, K., and Mizushima, N. (2008)Mol. Biol. Cell

19, 5360–53729. Matsunaga, K., Saitoh, T., Tabata, K., Omori, H., Satoh, T., Kurotori, N.,

Maejima, I., Shirahama-Noda, K., Ichimura, T., Isobe, T., Akira, S.,Noda, T., and Yoshimori, T. (2009) Nat. Cell Biol. 11, 385–396

10. Zhong, Y., Wang, Q. J., Li, X., Yan, Y., Backer, J. M., Chait, B. T., Heintz,N., and Yue, Z. (2009) Nat. Cell Biol. 11, 468–476

11. Sun, Q., Fan, W., and Zhong, Q. (2009) Autophagy 5, 713–716

12. Sun, Q., Westphal, W., Wong, K. N., Tan, I., and Zhong, Q. (2010) Proc.Natl. Acad. Sci. U.S.A. 107, 19338–19343

13. Liang, C., Feng, P., Ku, B., Dotan, I., Canaani, D., Oh, B. H., and Jung,J. U. (2006) Nat. Cell Biol. 8, 688–699

14. Liang, C., Lee, J. S., Inn, K. S., Gack, M. U., Li, Q., Roberts, E. A., Vergne,I., Deretic, V., Feng, P., Akazawa, C., and Jung, J. U. (2008) Nat. Cell Biol.10, 776–787

15. Mari, M., Macia, E., Le Marchand-Brustel, Y., and Cormont, M. (2001)J. Biol. Chem. 276, 42501–42508

16. Kukimoto-Niino, M., Takagi, T., Akasaka, R., Murayama, K., Uchikubo-Kamo, T., Terada, T., Inoue, M., Watanabe, S., Tanaka, A., Hayashizaki,Y., Kigawa, T., Shirouzu, M., and Yokoyama, S. (2006) J. Biol. Chem.281, 31843–31853

17. Recacha, R., Boulet, A., Jollivet, F., Monier, S., Houdusse, A., Goud, B.,and Khan, A. R. (2009) Structure 17, 21–30

18. Fan, W., Tang, Z., Chen, D., Moughon, D., Ding, X., Chen, S., Zhu, M.,and Zhong, Q. (2010) Autophagy 6, 614–621

19. Backer, J. M. (2008) Biochem. J. 410, 1–1720. Lindmo, K., and Stenmark, H. (2006) J. Cell Sci. 119, 605–61421. Bjørkøy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn,

A., Stenmark, H., and Johansen, T. (2005) J. Cell Biol. 171, 603–61422. Komatsu, M., Waguri, S., Koike, M., Sou, Y. S., Ueno, T., Hara, T., Mi-

zushima, N., Iwata, J., Ezaki, J., Murata, S., Hamazaki, J., Nishito, Y., Ie-mura, S., Natsume, T., Yanagawa, T., Uwayama, J., Warabi, E., Yoshida,H., Ishii, T., Kobayashi, A., Yamamoto, M., Yue, Z., Uchiyama, Y., Komi-nami, E., and Tanaka, K. (2007) Cell 131, 1149–1163

23. Stein, M. P., Feng, Y., Cooper, K. L., Welford, A. M., and Wandinger-Ness, A. (2003) Traffic 4, 754–771

24. Slessareva, J. E., Routt, S. M., Temple, B., Bankaitis, V. A., and Dohlman,H. G. (2006) Cell 126, 191–203

25. Simonsen, A., Lippe, R., Christoforidis, S., Gaullier, J. M., Brech, A., Cal-laghan, J., Toh, B. H., Murphy, C., Zerial, M., and Stenmark, H. (1998)Nature 394, 494–498

26. Wurmser, A. E., and Emr, S. D. (2002) J. Cell Biol. 158, 761–77227. Christoforidis, S., Miaczynska, M., Ashman, K., Wilm, M., Zhao, L., Yip,

S. C., Waterfield, M. D., Backer, J. M., and Zerial, M. (1999) Nat. CellBiol. 1, 249–252

Role of the Rubicon RUN Domain in Autophagy

JANUARY 7, 2011 • VOLUME 286 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 191

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from

and Qing ZhongQiming Sun, Jing Zhang, Weiliang Fan, Kwun Ngok Wong, Xiaojun Ding, She Chen

Inhibition, and Autophagy SuppressionThe RUN Domain of Rubicon Is Important for hVps34 Binding, Lipid Kinase

doi: 10.1074/jbc.M110.126425 originally published online November 9, 20102011, 286:185-191.J. Biol. Chem. 

  10.1074/jbc.M110.126425Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/286/1/185.full.html#ref-list-1

This article cites 27 references, 12 of which can be accessed free at

by guest on July 26, 2018http://w

ww

.jbc.org/D

ownloaded from