Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · figure...
TRANSCRIPT
![Page 1: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/1.jpg)
© Julien Chaillot, 2019
Étude de l'homéostasie de la taille chez la levure opportuniste Candida albicans
Thèse
Julien Chaillot
Doctorat en biologie cellulaire et moléculaire
Philosophiæ doctor (Ph. D.)
Québec, Canada
![Page 2: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/2.jpg)
![Page 3: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/3.jpg)
III
Résumé
L’homéostasie de la taille est un processus important de la prolifération
cellulaire mais les mécanismes moléculaires sont mal compris. Les cellules
eucaryotes doivent atteindre une taille seuil avant la division, ce qui
permet de maintenir une taille constante sur le long terme. Ce processus
est régulé à un point de contrôle, à la fin de la phase G1, appelé START
chez les levures. Le contrôle de la taille cellulaire a été étudié chez la levure
modèle Saccharomyces cerevisiae mais n’a jamais été étudié chez les
levures pathogènes. Dans cette thèse, nous avons utilisé Candida albicans
comme organisme modèle pour étudier la régulation de la taille chez les
levures opportunistes. Nous avons criblé des collections de mutants de
délétions hétérozygotes et homozygotes de C. albicans afin d’identifier des
gènes régulateurs de la taille.
Nous avons analysé la distribution de taille de 279 mutants homozygotes
et 4 348 mutants hétérozygotes (recouvrant 90% du génome). Nous avons
comparé nos résultats à différents criblages effectués sur la levure modèle
S. cerevisiae. Ces comparaisons montrent que peu de régulateurs sont
conservés entre C. albicans et S. cerevisiae et que la régulation de la taille
est processus très plastique.
Par exemple, le mutant dot6 a un phénotype petit chez C. albicans mais
n’a pas de phénotype de taille chez S. cerevisiae. Nous avons montré que
Dot6 est un facteur de transcription nécessaire pour l’activation des gènes
de la biogénèse des ribosomes. Dot6 est également un régulateur de
START et joue un rôle dans l’adaptation de la taille suivant les sources de
carbone disponibles.
Nous avons également mis en évidence un nouveau rôle pour la protéine
kinase Hog1/p38 dans la régulation de la taille chez C. albicans en
![Page 4: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/4.jpg)
IV
absence de stress. Ce rôle n’a jamais été démontré chez S. cerevisiae. Nous
avons montré que Hog1, ainsi que toute la voie HOG, sont des régulateurs
négatifs de START. Nous avons mis en évidence que Hog1 régule à la fois
la croissance cellulaire via Sfp1, un régulateur majeur de la biogénèse des
ribosomes et des protéines ribosomales, et le cycle cellulaire via le
complexe SBF (Swi4/Swi6), des facteurs de transcription nécessaires pour
la transition G1/S.
Nous avons également découvert qu’Ahr1, un facteur de transcription
n’ayant pas d’orthologue chez S. cerevisiae, est nécessaire pour la
régulation de la taille et aussi requis pour l’adaptation de la taille en
fonction des acides aminés disponibles. Nous avons montré qu’Ahr1 agit
dans la voie Tor1-Sch9 et régule négativement START.
En conclusion, notre travail a permis de découvrir de nouveaux
régulateurs de START, de caractériser leur fonction et de les placer dans
différentes voies. Comme la dérégulation de la voie Hog1/p38 est associée
à des pathologies humaines, nous proposons C. albicans comme
organisme modèle pour l’étude de cette voie et son implication dans
l’homéostasie de la taille chez les organismes eucaryotes.
![Page 5: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/5.jpg)
V
Abstract
Cell size homeostasis is an important process of cell proliferation but the
molecular mechanisms are poorly understood. Eukaryotic cells must reach
a threshold size before entering the cell cycle, which helps to maintain a
constant size over the long term. This process is regulated at the end of the
G1 phase, a check point called START. Cell size control has been studied
in the model yeast Saccharomyces cerevisiae but has never been studied in
pathogenic fungi. In this thesis, we used Candida albicans as a model
organism to study the regulation of size in pathogenic yeasts. We have
screened heterozygous and homozygous deletion collections of C. albicans
to identify genes that control cell size.
We analyzed the size distribution of 279 homozygous mutants and 4,348
heterozygous mutants (covering 90% of the genome). We compared our
results with different screens performed on the model yeast S. cerevisiae.
These comparisons showed that few regulators were conserved between S.
cerevisiae and C. albicans and suggesting that the cell size regulation is
evolutionary plastic.
For example, dot6 mutant has a small phenotype in C. albicans but has no
size phenotype in S. cerevisiae. We have shown that Dot6 is a
transcriptional factor necessary for the activation of ribosome biogenesis
genes. Dot6 is also a regulator of START and plays a critical role in
adapting size according to the carbon sources available in the medium.
We also uncovered a novel stress-independent role of the Hog1/p38 MAPK
in size regulation in C. albicans a role that has never been demonstrated in
S. cerevisiae. We have shown that Hog1, as well as the entire HOG
pathway, are negative regulators of START. We have shown that Hog1
regulates both growth via Sfp1, a major transcriptional regulator of
![Page 6: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/6.jpg)
VI
ribosomal biogenesis and ribosomal proteins, and the cell cycle via the
SBF complex (Swi4/Swi6), transcriptional factors necessary for the G1/S
transition.
We also found that Ahr1, a transcription factor with no obvious ortholog in
S. cerevisiae, has a role for the adaptation of the size according to the
amino acids available in the medium. We have shown that Ahr1 is a
negative START regulator and is controlled by the Tor1-Sch9 pathway.
In conclusion, our work has permitted to discover new regulators of
START, to characterise their function and to map them in different
pathways. As the Hog1/p38 pathway is linked to many human
pathologies, we think that C. albicans is a useful model to study of this
pathway and dissect its role in size control in eukaryotes.
![Page 7: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/7.jpg)
VII
Table des matières
Résumé .................................................................................................. III
Abstract .................................................................................................. V
Table des matières ................................................................................. VII
Liste des figures ....................................................................................... X
Liste des tableaux ................................................................................... XI
Liste des abréviations et des sigles ......................................................... XII
Remerciements ..................................................................................... XVI
Avant-propos ...................................................................................... XVIII
Introduction ............................................................................................. 1
Chapitre 1 - Genome-wide screen for haploinsufficient cell size genes in the opportunistic yeast Candida albicans. ............................................... 40
1.1 - Résumé .................................................................................... 40
1.2 - Article ....................................................................................... 41
1.2.1 - Abstract ........................................................................... 42
1.2.2 - Introduction ..................................................................... 43
1.2.3 - Materials and methods ..................................................... 45
1.2.4 - Results and discussion ..................................................... 50
1.2.5 - Acknowledgments ............................................................ 56
1.2.6 - References ........................................................................ 57
1.2.7 - Figures ............................................................................. 61
Chapitre 2 - The p38/HOG stress-activated protein kinase network couples growth to division in Candida albicans. ...................................... 63
2.1 - Résumé .................................................................................... 63
2.2 - Article ....................................................................................... 64
2.2.1 - Abstract ........................................................................... 65
2.2.2 - Introduction ..................................................................... 66
2.2.3 - Results ............................................................................. 70
2.2.4 - Discussion ....................................................................... 80
2.2.5 - Methods ........................................................................... 86
2.2.6 - Acknowledgments ............................................................ 90
2.2.7 - References ........................................................................ 91
2.2.8 - Figures ........................................................................... 102
![Page 8: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/8.jpg)
VIII
Chapitre 3 - Integration of growth and cell size via the TOR pathway and the Dot6 transcription factor in Candida albicans. ................................ 114
3.1 - Résumé .................................................................................. 114
3.2 - Article ..................................................................................... 115
3.2.1 - Abstract ......................................................................... 116
3.2.2 - Introduction ................................................................... 117
3.2.3 - Materials and Methods ................................................... 120
3.2.4 - Results ........................................................................... 126
3.2.5 - Discussion ..................................................................... 133
3.2.6 - Acknowledgments .......................................................... 137
3.2.7 - References ...................................................................... 138
3.2.8 - Figures ........................................................................... 143
Chapitre 4 - Caractérisation d’un nouveau régulateur de la taille : Ahr1 .. ..................................................................................... 155
4.1 - Le mutant ahr1 présente un phénotype de petite taille ............ 155
4.2 - Ahr1 est un régulateur négatif de START ................................ 158
4.3 - Ahr1 interagit génétiquement et physiquement avec Sch9 ....... 160
4.4 - Ahr1 régule la croissance suivant les acides aminés disponibles....
................................................................................................. 162
4.5 - La localisation d’Ahr1 est régulée par la voie TOR.................... 165
4.6 - Discussion .............................................................................. 168
4.7 - Matériels et Méthodes ............................................................. 171
Chapitre 5 - Discussion générale et perspectives ............................... 175
5.1 - Conservation des mécanismes du contrôle de la taille cellulaire .... ................................................................................................. 177
5.2 - La régulation de la taille cellulaire est un processus évolutif plastique ........................................................................................... 179
5.2.1 - Rôle de Hog1 dans le contrôle de la taille cellulaire ......... 180
5.2.2 - Rôle de Dot6 dans le contrôle de la taille cellulaire .......... 182
5.2.3 - Rôle de Ahr1 dans le contrôle de la taille cellulaire ......... 185
5.3 - Lien entre nutriments et taille cellulaire .................................. 186
5.4 - Lien entre virulence et taille cellulaire ..................................... 187
5.5 - C. albicans – Organisme modèle .............................................. 189
Conclusion ........................................................................................... 191
Bibliographie ........................................................................................ 193
![Page 9: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/9.jpg)
IX
Annexe 1 - The monoterpene carvacrol generates endoplasmic reticulum stress in the pathogenic fungus Candida albicans ................................. 212
Résumé ............................................................................................. 212
Article ................................................................................................ 213
Abstract ........................................................................................ 214
Introduction .................................................................................... 215
Materials and methods.................................................................... 217
Results ........................................................................................ 221
Discussion ...................................................................................... 227
Acknowledgments ........................................................................... 229
References ...................................................................................... 230
Figures ........................................................................................ 236
Annexe 2 - pH-dependant antifungal activity of valproic acid against the Human fungal pathogen Candida albicans ............................................ 244
Résumé ............................................................................................. 244
Article ................................................................................................ 245
Abstract ........................................................................................ 246
Introduction .................................................................................... 247
Materials and methods.................................................................... 250
Results ........................................................................................ 255
Discussion ...................................................................................... 261
References ...................................................................................... 265
Figures ........................................................................................ 270
![Page 10: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/10.jpg)
X
Liste des figures
Figure 1 - Modèles de régulation de la taille cellulaire 3 Figure 2 - Principe du Coulter Counter 4 Figure 3 - Modèle de régulation de la taille bactérienne par DnaA 6 Figure 4 - Régulation des gènes RiBi et RP 10 Figure 5 - Cycle cellulaire de S. cerevisiae 11 Figure 6 - Processus de la transition G1/S 12 Figure 7 - Corrélation négative entre la taille et le temps passé en G1 13 Figure 8 - Régulation de la taille chez S. pombe 17 Figure 9 - Diversité de la taille de Cryptococcus neoformans 21 Figure 10 - Phylogénie des clades Candida et Saccharomyces 24 Figure 11 - Formes morphologiques de C. albicans 28
Figure 12 - C. albicans en forme pseudohyphe, levure et hyphe 30 Figure 13 - Formes phénotypiques de C. albicans 32 Figure 14 - Distribution de la taille du mutant ahr1 156 Figure 15 - Courbes de croissance du mutant ahr1 et du WT 157 Figure 16 - Taille des hyphes du mutant ahr1 et du révertant 158 Figure 17 - Budding index du mutant ahr1 et du WT 159 Figure 18 - Expression de RNR1 et PCL2 en fonction de la taille 159 Figure 19 - Intéraction génétique entre SCH9 et AHR1 161 Figure 20 - Coimmunoprécipitation entre Ahr1 et Sch9 162 Figure 21 - Analyse transcriptionnelle du mutant ahr1 163 Figure 22 - Temps de doublement des mutants ahr1 et sch9 164 Figure 23 - Taille cellulaire en fonction du temps de doublement 165 Figure 24 - Photos de microscopie d’une souche exprimant Ahr1-GFP 166 Figure 25 - Modèle de la régulation de START 169 Figure 26 - Interaction génétique entre Nrm1 et le complexe SBF 178 Figure 27 - Effet de la doxycycline sur la taille du mutant dot6 185
![Page 11: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/11.jpg)
XI
Liste des tableaux
Tableau 1 - Oligonucléotides utilisées dans cette étude 173 Tableau 2 - Souches utilisées dans cette étude 174
![Page 12: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/12.jpg)
XII
Liste des abréviations et des sigles
ADN Acide désoxyribonucléique
Ahr1 Adhesion and Hyphal Regulator
AmB Amphotéricine B
ARN Pol Acide Ribonucléique Polymerase
ARNm Acide Ribonucléique messager
ATP Adenosine Triphosphate
bp base pair
Ca Candida albicans
CDK Cyclin-Dependant Kinase
CFU Colony-Forming Unit
CGD Candida Genome Database
CHI Complex happloinsuffisiency
ChIP Chromatin immunoprecipitation
CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
CSP Caspofungine
CTZ Clotrimazole
CWI Cell Wall Integrity
DAPI 4',6-diamidino-2-phénylindole
DBC Double Barcode
DMSO diméthylsulfoxyde
DNA Deoxyribose Nucleic Acid
ds Double Strand
dNTP DeoxyNucleotide TriPhosphate
DO Densité Optique
Dot6 Disruptor Of Telomeric silencing
DTT Dithiothréitol
ER Endoplasmic Reticulum
F Forward
FACS Fluorescence-activated cell sorting
![Page 13: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/13.jpg)
XIII
FCZ Fluconazole
FDR False Discovery Rate
FIC Fractional Inhibitory Concentration
FISH Fluorescence In Situ Hybridization
FITC Fluorescein isothiocyanate
fL femtolitre
G1 Gap 1
G2 Gap 2
G3 Genes, Genomes, Genetics
GFP Green Fluorescent Protein
GRACE Gene Replacement And Conditional Expression
GO Gene Ontology
GSEA Gene Set Enrichment Analysis
GTP Guanosine Triphosphate
GUT Gastrointestinally induced Transition
HA human influenza hemagglutinin
HCGP Haploid deletion Chemical-Genetic Profiling
HDAC Histone Deacetylase
HIV Human Immunodeficiency Virus
Hog1 High Osmolarity Glycerol response
IGF Insulin-like Growth Factor
ITZ Itraconazole
Kog1 Kontroller Of Growth
Lge Désigne un phénotype de grande taille
LDH Lactate Deshydrogénase
M Mitosis
MAPK Mitogen-activated protein kinases
Mb Megabase
MBF MCB-binding factor
MCF Micafungine
MCZ Miconazole
![Page 14: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/14.jpg)
XIV
mg milligramme
MIC Minimum Inhibitory Concentration
Min minutes
mL millilitre
mM millimolaire
MM Milieu Minimum
MoA Mechanism of Action
mTOR mechanistic Target Of Rapamycin
ND Non determined
ng nanogramme
NS Non Significatif
ORF Open Reading Frame
OriC Origine de réplication d’E. coli
PAC Polymerase A and C
PalmC palmitoylcarnitine
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
pg picogramme
pH Potentiel Hydrogène
PKA Protein Kinase A
PI Propidium Iodide
PI3K phosphatidylinositol 3-kinase
PMSF Fluorure de phénylméthylsulfonyle
PVDF PolyVinyliDene Fluoride
R Reverse
Rb Retinoblastoma protein
RiBi Ribosome Biogenesis
RNA Ribonucleic acid
RP Ribosomal Protein
RPMI Roswell Park Memorial Institute medium
S Synthesis
![Page 15: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/15.jpg)
XV
SARM Staphylococcus aureus Résistant à la Méticilline
SBF SCB-binding factor
Sc Saccharomyces cerevisiae
SC Synthetic Complete
SCB SBF cell-cycle box
SD Standard deviation
SDS dodécylsulfate de sodium
Sec Seconde
SGD Saccharomyces Genome Database
SIDA Syndrome d'Immuno Déficience Acquise
SILAC Stable Isotope Labeling by Amino acids in Cell culture
Tco89 Tor Complex One
TCZ Teroconazole
TGF Transforming Growth Factor
Tod6 Twin Of Dot6
TOR Target Of Rapamycin
TRB Terbinafine
µg microgramme
µM micromollaire
UPR Unfolded Protein Response
VPA Valproic Acid (Acide valproïque)
VVC Vulvovaginal Candidiasis
WGD Whole Genome Duplication
Whi Désigne un phénotype de petite taille
WT Wild Type
XTT tetrazolium salt
YPD Yeast Peptone Dextrose
![Page 16: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/16.jpg)
XVI
Remerciements
Je tiens à remercier mon directeur de thèse, Dr Adnane Sellam, de m’avoir
accueilli dans son laboratoire et pour son soutien tout au long de mon
doctorat.
Je remercie également tous les membres de l’équipe avec qui j’ai travaillé
pendant toutes ces années : Anaïs Burgain, Faiza Tebbji, Carlos Garcia,
Emilie Pic et Inès Khemiri.
Merci à Julie-Christine Lévesque pour son aide en microscopie et en
cytométrie.
Je remercie les coauteurs qui ont participé aux projets publiés dans cette
thèse : Mike Tyers (Université de Montréal), Jaideep Mallick (Université de
Montréal), Michael A. Cook (Samuel Lunenfeld Research Institute) et
Jacques Corbeil (Université Laval) ; ainsi que tous les collaborateurs qui
nous ont fourni des souches et des plasmides : Catherine Bachewich
(Université Concordia), Joachim Ernst (Université de Düsseldorf), Joseph
Heitman (Université de Duke), Julia Köhler (Boston Children's Hospital),
Daniel Kornitzer (Technion), Christian Landry (Université Laval), Robbie
Loewith (Université de Genève), Aaron Mitchell (Université Carnegie
Mellon), André Nantel (National Research Council Canada), Suzanne Noble
(Université de Californie à San Francisco), Janet Quinn (Université de
Newcastle), Dominique Sanglard (Université de Lausanne), Ana Traven
(Université Monash), Jonathan Thorner (Université de Californie Riverside)
et Malcolm Whiteway (Université Concordia).
Je remercie également les membres du jury, Christian Landry, Hugo
Wurtele et Yves Bourbonnais d’avoir accepté d’évaluer mon manuscrit et
ma soutenance de thèse.
![Page 17: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/17.jpg)
XVII
Enfin, je remercie mes parents, Jean-Yves et Marie Dominique, mon frère
David ainsi que ma conjointe Carolina d’être présents pour moi.
![Page 18: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/18.jpg)
XVIII
Avant-propos
L’article du chapitre 1 est intitulé “Genome-Wide Screen for
Haploinsufficient Cell Size Genes in the Opportunistic Yeast Candida
albicans”. Il a été publié le 9 février 2017 dans le journal G3 (Genes,
Genomes, Genetics). Je suis le premier auteur de cet article. J’ai effectué
les vérifications de taille pour valider le criblage et j’ai participé à l’analyse
des résultats. Michael Cook et Jacques Corbeil ont participé aux analyses
bioinformatiques du séquençage. Adnane Sellam a déterminé le « Budding
Index », a participé à l’analyse des résultats, a rédigé l’article et a supervisé
le projet.
L’article du chapitre 2 est intitulé “The p38/HOG stress-activated protein
kinase network couples growth to division in Candida albicans. Cet article
a été publié en mars 2019 dans le journal Plos Genetics. J’ai effectué une
partie du criblage et les tests d’interaction génétique. Adnane Sellam et
Julien Richard Albert ont réalisé le criblage. Jaideep Malick a réalisé les
co-immunoprécipitations. Michael A Cook a réalisé les analyses bio-
informatiques. Faiza Tebbji a réalisé les ChIP-chip. Adnane Sellam est le
premier auteur de cet article. Il a réalisé les puces à ADN, les ChIP-chip,
les ChIP-qPCR, a rédigé l’article et a supervisé le projet avec Mike Tyers.
L’article du chapitre 3 est intitulé “Integration of Growth and Cell Size via
the TOR Pathway and the Dot6 Transcription Factor in Candida albicans”.
Il a été publié en février 2019 dans le journal Genetics. Je suis le premier
auteur de cet article. J’ai créé les souches nécessaires pour l’étude, j’ai fait
les tests d’interactions génétiques, les expériences de microscopie, les
courbes de croissance, déterminer la distribution de taille des souches et
j’ai participé à la rédaction de l’article. Jaideep Malick et Faiza Tebbji ont
réalisé les Western-Blot. Adnane Sellam a réalisé les puces à ADN, les RT-
![Page 19: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/19.jpg)
XIX
qPCR et la détermination des « Budding Index ». Il a également rédigé
l’article et supervisé le projet.
Le chapitre 4 est intitulé « Caractérisation d’un nouveau régulateur de la
taille : Ahr1 ». Ce chapitre présente des résultats non publiés. Adnane
Sellam a réalisé les puces ADN et la détermination du « Budding Index ».
Jaideep Malick a réalisé l’expérience de co-immunoprécipitation. J’ai créé
les mutants utilisés dans l’étude, fait les analyses de cytométrie en flux, de
microscopie ainsi que les courbes de croissance et déterminé la
distribution de taille des souches.
L’article de l’annexe 1 est intitulé « The Monoterpene Carvacrol Generates
Endoplasmic Reticulum Stress in the Pathogenic Fungus Candida
albicans ». Il a été publié le 26 mai 2015 dans le journal Antimicrobial
Agents & Chemotherapy. Je suis co-premier auteur de l’article avec Faiza
Tebbji. J’ai réalisé les expériences de microscopie, les RT-PCR et les tests
de synergisme. Faiza Tebbji a réalisé les tests de sensibilité au carvacrol.
Charles Boone, Mohamed Bellaoui et Grant Brown ont réalisé les essais
chemogénétiques sur les souches haploïdes de Saccharomyces cerevisiae.
Mohamed Bellaoui et Adnane Remmal sont les premiers à avoir observé
l’effet du carvacrol sur S. cerevisiae et C. albicans. Adnane Sellam a
supervisé le projet et a rédigé l’article.
L’article de l’annexe 2 est intitulé « pH-Dependant Antifungal Activity of
Valproic Acid against the Human Fungal Pathogen Candida albicans ». Il a
été publié le 9 octobre 2017 dans le journal Frontiers in Microbiology. Je
suis le premier auteur de cet article. J’ai réalisé les tests de sensibilité à
l’acide valproïque, les tests de synergismes et la microscopie confocale.
Faiza Tebbji a réalisé les expériences testant l’effet protecteur du VPA sur
des cellules épithéliales humaines. Carlos Garcia a évalué l’efficacité du
VPA sur les souches cliniques résistantes et sur les biofilms. René Pelletier
![Page 20: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/20.jpg)
XX
a fourni les souches cliniques. Adnane Sellam a supervisé le projet et a
rédigé l’article.
J’ai également participé à l’article « A phenotypic small-molecule screen
identifies halogenated salicylanilides as inhibitors of fungal
morphogenesis, biofilm formation and host cell invasion.” Les auteurs sont
Carlos Garcia, Anaïs Burgain, Émilie Pic, Inès Khemiri et Adnane Sellam.
L’article a été publié le 1er aout 2018 dans le journal Scientific Reports. Cet
article ne sera pas discuté dans cette thèse (Garcia et al. 2018).
![Page 21: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/21.jpg)
1
Introduction
L’homéostasie de la taille
Généralités
Les organismes vivants ont une différence de masse allant de moins de
0,1pg (par exemple les mycoplasmes) à plus de 1 000 tonnes (par exemple
les séquoias). Il y a donc une différence de l’ordre de 1022. Parmi les
espèces unicellulaires, la différence de masse est de l’ordre de 109, les plus
petites étant les mycoplasmes et les plus grandes les amibes. Dans un
même organisme, la taille de différents types de cellules varient
grandement, de quelques micromètres pour les cellules sanguines chez
l’Homme, jusqu’à un mètre pour les neurones, par exemple.
La taille d’une cellule est limitée par sa surface. Plus une cellule est
grande, plus le rapport surface/volume diminue, ce qui est un
désavantage pour les échanges entre la cellule et le milieu extérieur. La
taille est également limitée par la diffusion passive. En effet, la diffusion
passive (des nutriments ou de l’oxygène), est inefficace sur des longues
distances (Schulz and Jorgensen 2001), une taille optimale semble donc
être nécessaire pour assurer les échanges entre la cellule et le milieu
extérieur ainsi que pour le transport intracellulaire. Par exemple, certains
processus comme la transcription ou la traduction se réalisent
généralement proche du centre de la cellule, ce qui peut créer un gradient
de métabolites ou de nutriments dans les cellules de grande taille.
Dans une population de cellules en division, il y a habituellement peu de
variation de taille. Si la distribution de la taille est modifiée, par exemple
par un changement de nutriment, la distribution de taille revient à celle
précédent le changement. Ces observations indiquent que les cellules en
division contrôlent leurs tailles de façon active et en réponse à
![Page 22: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/22.jpg)
2
l’environnement. Ces observations montrent aussi que les cellules
adaptent leurs tailles suivant l’environnement, probablement pour
optimiser le rapport surface/volume afin de favoriser les échanges avec le
milieu extérieur. De plus, ceci suggère qu’il y a une coordination entre les
processus contrôlant la croissance (biomasse) et la division afin de
maintenir la taille.
La taille cellulaire dépend également de la ploïdie. Par exemple la levure
Saccharomyces cerevisiae est plus petite en phase haploïde qu’en phase
diploïde. Ce phénomène pourrait être expliqué par le fait que
l’augmentation de la ploïdie augmente également le taux de transcription,
puis le taux de traduction et ainsi la cellule produit plus de masse.
L’augmentation de la ploïdie est une stratégie utilisée chez l’Homme pour
former des cellules géantes. Par exemples, les mégacaryocytes augmentent
la ploïdie pour former des cellules de 100µm de diamètre. Ensuite, ces
cellules se fragmentent pour former des thrombocytes (Mazzi et al. 2018).
Conceptuellement, l’homéostasie de la taille peut être régulée de
différentes façons (Figure 1) :
-par un mécanisme « Timer » dans lequel la division se produit après un
temps fixe depuis la naissance de la cellule fille.
-par un mécanisme « Adder » dans lequel la cellule ajoute un volume
constant après chaque division (Taheri-Araghi et al. 2015).
-par un mécanisme « Sizer » dans lequel la cellule fille doit atteindre une
taille seuil pour se diviser.
![Page 23: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/23.jpg)
3
Figure 1 – Modèles de régulation de la taille cellulaire. Dans le modèle « Timer », la
cellule grossit pendant un temps fixe avant de se diviser. Dans le modèle « Adder », la
cellule ajoute un volume constant avant de se diviser, indépendamment de la taille à la
naissance. Dans le modèle « Sizer », la cellule doit atteindre une taille seuil avant de se
diviser, indépendamment de la taille de la cellule à la naissance (Varsano, Wang, and Wu
2017).
Techniques pour l’analyse de la taille cellulaire
Coulter Counter
Le Coulter Counter est un appareil inventé par Wallace H. Coulter dans les
années 1940 et breveté en 1953. Il permet de quantifier des particules ou
des cellules et de mesurer leur volume. L’appareil est utilisé pour la
quantification de microbes et de cellules mammifères. Il est
![Page 24: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/24.jpg)
4
particulièrement utilisé en biologie médicale pour réaliser des
hémogrammes. Pour mesurer le volume des cellules, elles sont mises en
suspension dans un électrolyte et sont aspirées par une pompe. Les
cellules passent entre des électrodes et n’étant pas conductrices, elles
génèrent une variation de l’impédance qui est proportionnelle au volume
de la cellule (Figure 2).
Figure 2 - Principe du Coulter Counter. Les cellules sont en suspension dans un électrolyte.
La solution est aspirée par une pompe et des électrodes mesurent l’impédance provoquée
par les cellules. L’impédance est proportionnelle au volume des cellules. L’ordinateur
produit un graphique avec la fréquence en fonction du volume, en femtolitre (fL). Ici, par
exemple le WT a un volume médian d’environ 50 fL et le mutant de délétion sfp1 a un
volume médian d’environ 25 fL.
Microscopie
La taille cellulaire peut être quantifiée par microscopie optique. Cette
méthode a été utilisée par Navarro et Nurse pour mesurer la longueur et la
![Page 25: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/25.jpg)
5
largeur de S. pombe (Navarro and Nurse 2012). Cependant, cette méthode a
le désavantage d’être fastidieuse.
Calcul de la biomasse
Certains auteurs estiment la taille en mesurant la quantité de protéines ou
d’ARN dans la cellule. Par exemple, la quantité de protéines peut être
déterminée par marquage au FITC. Le marquage par le FITC peut être
analysé par cytométrie de flux (Cipollina et al. 2005).
Régulation de la taille des organismes procaryotes
La taille des bactéries varie énormément, elle va de 10-4 fL pour les
bactéries marines du genre Candidatus (ce volume représente environ 1%
d’une bactérie E. coli) à 108 fL pour Thiomargarita namibiensis (8 fois plus
volumineuse qu’E. coli) (Young 2006). Cette bactérie est plus grande que
l’œil d’une drosophile et peut être visible à l’œil nu (Schulz et al. 1999).
Régulation de la taille des Bacilles – Division symétrique
La taille des cellules bactériennes est influencée par le milieu (Schaechter,
Maaloe, and Kjeldgaard 1958; Trueba and Woldringh 1980) et elle est
corrélée au taux de croissance (Monds et al. 2014). Dans un milieu riche,
le temps de génération est moins élevé qu’en milieu pauvre, alors que la
taille des cellules est plus élevée en milieu riche qu’en milieu pauvre.
L’existence d’une molécule capable de mesurer la taille de la cellule est
débattue (Robert 2015). DnaA, une molécule activatrice de la réplication de
l’ADN, a été proposée comme une protéine contrôlant la taille cellulaire
(Lobner-Olesen et al. 1989) : l’augmentation de son expression réduit la
taille cellulaire, suggérant que la concentration en DnaA influence la taille
cellulaire. Dans ce modèle, les cellules grossissent et il y a accumulation
de la molécule DnaA à un niveau suffisant pour initier la réplication de
l’ADN (Figure 3). Donc, les cellules de petites tailles devraient grossir plus
![Page 26: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/26.jpg)
6
longtemps afin d’accumuler assez de DnaA, ce qui permet de maintenir
l’homéostasie de la taille.
Figure 3 – Accumulation de DnaA, dépendamment de la taille, sur l’origine de réplication
du chromosome jusqu’à ce qu’un seuil soit atteint pour initier la réplication de l’ADN.
(Amodeo and Skotheim 2016)
Une autre protéine candidate est FtsZ, une GTPase essentielle dans la
formation du septum et permettant la cytocinèse. La réduction de
l’expression de cette protéine engendre des cellules de grande taille
(Palacios, Vicente, and Sanchez 1996). FtsZ contrôle la division de façon
spatiale et temporelle. Cette protéine est inhibée par MinC, qui se situe
aux extrémités de la cellule et crée un gradient jusqu’au centre. Pendant
l’élongation, la concentration en MinC devient plus faible au centre de la
cellule, ce qui permet l’activation de FtsZ (Rothfield, Taghbalout, and Shih
2005; Lutkenhaus 2008).
Des études sur B. subtilis, P. aeruginosa et E. coli ont montré que la taille
ajoutée entre la cellule fille (sb) et la division (sd) est constante : Δ= sd- sb
![Page 27: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/27.jpg)
7
(Taheri-Araghi et al. 2015; Deforet, van Ditmarsch, and Xavier 2015). Le
volume ajouté varie suivant les conditions de cultures. Ceci signifie que les
bactéries régulent la taille en ajoutant un volume constant à chaque
génération, donc il s’agit d’un mécanisme « Adder ». Du fait que ces bacilles
se divisent de façon symétrique, ce mécanisme permet de maintenir la
taille sur le long terme.
Archéobactéries
Les archéobactéries ont une taille comparable aux bactéries. Les
mécanismes contrôlant le cycle cellulaire partagent des similarités avec les
procaryotes et avec les eucaryotes. Par exemple, la protéine FtsZ est
conservée chez les bactéries et les archéobactéries. Comme chez les
eucaryotes, le cycle cellulaire est divisé en quatre phases : G1, S, G2 et M
(Lindås and Bernander 2013).
Halobacterium salinarum, une archéobactérie halophile, maintient sa taille
en ajoutant un volume constant entre chaque division. Le modèle « Adder »
semble donc être partagé entre les bactéries et les archéobactéries (Eun et
al. 2018).
Régulation de la taille des eucaryotes unicellulaires
Parmi les eucaryotes unicellulaires, S. cerevisiae et S. pombe ont été
utilisés pour l’étude du cycle cellulaire et la régulation de la taille (Sveiczer
and Horvath 2017; Wood and Nurse 2015; Jorgensen et al. 2002). S.
cerevisiae est une levure qui se divise par bourgeonnement alors que S.
pombe se divise de façon symétrique. Due à cette différence
morphologique, la taille semble être régulée à la transition G1/S pour S.
cerevisiae et à la transition G2/M pour S. pombe.
Saccharomyces cerevisiae
Croissance cellulaire
![Page 28: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/28.jpg)
8
La croissance, c’est-à-dire la production de biomasse, est importante dans
le contrôle de la taille cellulaire. La croissance est assurée par
l’accumulation de masse cellulaire via les macromolécules : protéines,
acides nucléiques, sucres et lipides. La synthèse des protéines est un
processus indispensable pour la croissance cellulaire. Ce processus est
réalisé par les ribosomes. En phase de croissance, la cellule doit assurer
une synthèse abondante des ribosomes d’environ 2 000 par minute (Warner
1999). La biogénèse des ribosomes est corrélée aux conditions
environnementales et est régulée essentiellement par la voie TOR (Target
Of Rapamycin).
De nombreuses expériences indiquent que la traduction joue un rôle
fondamental dans la régulation de la taille cellulaire. Premièrement, le
traitement des cellules avec des inhibiteurs de la traduction, comme la
cycloheximide, provoque un défaut de taille (Popolo, Vanoni, and
Alberghina 1982). Ensuite, il a été montré que les souches déficientes en
gènes de la biogénèse des ribosomes et de protéines ribosomales ont un
phénotype de petite taille (Jorgensen et al. 2002; Soifer and Barkai 2014).
Les plus petites souches identifiées sont des mutants de délétions de Sfp1
et Sch9, qui sont deux régulateurs de la biogénèse des ribosomes,
suggérant que ce processus est important pour la croissance et le contrôle
de la taille. De plus, il a été montré que muter des gènes codants la petite
sous unité des ribosomes provoque un phénotype de grande taille, alors
que les mutants de la grande sous unité présentent un phénotype de petite
taille. Ces observations suggèrent que l’initiation de la traduction ainsi que
l’élongation ont un rôle dans la régulation de la taille cellulaire (Soifer and
Barkai 2014). Enfin, les souches déficientes en facteurs d’élongation de la
traduction ainsi qu’en facteurs d’initiation ont également un défaut de
taille (Jorgensen et al. 2002).
![Page 29: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/29.jpg)
9
TOR est un complexe protéique situé au niveau des vacuoles (Urban et al.
2007; Sturgill et al. 2008). Chez S. cerevisiae, il existe deux complexes
TOR : TORC1 et TORC2. TORC1 est composée des protéines Tor1 ou Tor2,
Kog1, Tco89 et Lst8. TORC2 est composé de Tor2, Lst8, Avo1, Avo2, Avo3,
Bit2 et Bit61 (Loewith et al. 2002; Wedaman et al. 2003; Reinke et al.
2004). TOR permet de percevoir les nutriments dans le milieu extérieur
(azote, carbone) et aussi les facteurs de stress (De Virgilio and Loewith
2006). TOR favorise la croissance via l’augmentation de la traduction, la
transcription des gènes nécessaires pour la biogénèse des ribosomes et de
la glycolyse (Averous and Proud 2006; Ma and Blenis 2009; Laplante and
Sabatini 2012). TOR contrôle la biogénèse des ribosomes via Sch9, Sfp1,
Rrn3 et Maf1 (Rohde et al. 2008).
Sch9 est une kinase qui contrôle la biogénèse des ribosomes en régulant
les ARN polymérases I, II et III (Lee, Moir, and Willis 2009; Huber et al.
2011). La régulation de la biogénèse des ribosomes se fait également via les
facteurs de transcriptions Dot6 et Tod6 (Figure 4) (Huber et al. 2011).
Sch9 régule aussi l’initiation de la traduction en phosphorylant la protéine
ribosomale Rps6 et le facteur d’initiation eIF2 (Urban et al. 2007).
Sfp1, un facteur de transcription, régule la transcription des protéines
ribosomales et des protéines nécessaire à la biogénèse des ribosomes
(Figure 4) (Marion et al. 2004; Blumberg and Silver 1991; Jorgensen et al.
2002).
Rrn3 est un facteur de transcription requis pour la transcription de l’ADN
ribosomal, régulé par l’ARN Pol I (Claypool et al. 2004).
TOR régule l’ARN Pol III via Sch9 et Maf1 (Pluta et al. 2001).
![Page 30: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/30.jpg)
10
Figure 4 Régulation des gènes de la biogénèse des ribosomes (RiBi) et les protéines
ribosomales (RP). Sfp1 se fixe sur les séquences RRPE pour activer les gènes RiBi et RP.
Dot6 et Tod6 se fixent sur les séquences PAC pour inhiber les gènes RiBi. (Loewith and
Hall 2011).
Cycle cellulaire
Le cycle cellulaire eucaryote est une succession de processus qui permet à
une cellule de donner naissance à deux cellules filles identiques. Il est
composé de la phase G1, dans laquelle la cellule grossit et prépare la
phase S, qui est la phase dans laquelle la cellule duplique son génome.
Ensuite, il y a la phase G2 et enfin la phase M, phase dans laquelle la
cellule se divise.
Le cycle cellulaire est régulé par des CDK (Cyclin Dependant Kinase) dont
l’activité est régulée par des cyclines. Chez S. cerevisiae, neuf cyclines sont
connues : Cln1, Cln2, Cln3 qui contrôlent la transition G1/S ; Clb5 et
Clb6 qui contrôlent la phase S et Clb1, Clb2, Clb3 et Clb4 qui contrôlent
![Page 31: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/31.jpg)
11
les phases G2 et M (Figure 5). Cdc28 (ou CDK1) est la seule CDK qui
contrôle le cycle cellulaire chez S. cerevisiae, ainsi que chez C. albicans.
Figure 5 – Cycle cellulaire de S. cerevisiae. La Cdk1 est la seule Cdk qui contrôle le cycle
cellulaire. Les Cln1, 2 et 3 régulent la transition G1/S. Clb5 et 6 régulent la synthèse de
l’ADN (phase S). Les cyclines B 1 à 4 régulent la transition G2/M. Schéma adapté de
https://studentreader.com/KF645/mitosis-factors-cyclin-cdks/
Les cyclines contrôlent l’activité kinase de la protéine Cdc28 et permettent
l’activation de facteurs de transcriptions dans l’ordre nécessaire pour la
progression du cycle cellulaire (Haase and Wittenberg 2014).
Les complexes Cln3/Cdc28 et Cln1-2/Cdc28 permettent l’activation des
complexes SBF (Swi4/Swi6) et MBF (Mbf1/Swi6) en inhibant les
inhibiteurs Whi5 et Nrm1 (Figure 6). SBF et MBF sont positionnés sur les
promoteurs des gènes permettant l’entrée en phase S (Ferrezuelo et al.
2010; Simon et al. 2001; de Bruin et al. 2006) .
Clb5-6/Cdc28 initient la synthèse de l’ADN (Schwob et al. 1994) et
inhibent l’activité des complexes Cln1-3/Cdc28 (Basco, Segal, and Reed
1995).
![Page 32: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/32.jpg)
12
Clb1-2/Cdc28 activent Mcm1 et Fkh2 qui régulent la transition G2/M.
Ceci permet l’expression d’environ 35 gènes, dont Ace2, Swi5 et Cdc5, afin
d’activer la mitose (Cho et al. 1998).
La transition M/G1 est régulée par Mcm1 qui est lui-même réprimé par
Yox1 et Yhp1. Mcm1 permet la synthèse de Swi4 et Cln3 et des gènes de
pré-réplication de l’ADN (Cdc6, Mcm2-7).
Figure 6 - Processus de la transition G1/S (Haase and Wittenberg 2014). Le complexe SBF
est inhibé par Whi5. Cln3/Cdk1 inhibe Whi5, ce qui permet au complexe SBF de transcrire
les cyclines 1 et 2. Cln3/Cdk1 active également le complexe MBF. Cln1-2/Cdk1 activent à
leurs tours les complexes SBF et MBF. Le complexe MBF transcrit Nrm1, qui est un
inhibiteur de MBF et permet la sortie de la phase G1. Clb2/Cdk1 inhibe les complexes SBF
et MBF.
START : modèle « Sizer »
En 1974, Leland Hartwell a proposé que la croissance et la division soient
couplées à START, un point de contrôle situé en fin de phase G1 (Hartwell
et al. 1974). À START, les cellules arrêtent le cycle cellulaire en réponse
aux hormones, à des stress ou à une carence nutritionnelle. De plus, les
cellules doivent atteindre une taille seuil pour pouvoir passer START et se
![Page 33: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/33.jpg)
13
diviser. Comme S. cerevisiae se divise de façon asymétrique, la cellule fille
est plus petite que la cellule mère et doit passer plus de temps en phase
G1 pour passer START (Figure 7). Ce point de contrôle permet d’assurer le
maintien de la taille cellulaire sur le long terme. START est également
modulé par le milieu extracellulaire : les cellules cultivées en milieu riche
ont une plus grande taille qu’en milieu pauvre.
Figure 7 – Corrélation négative entre la taille cellulaire à la naissance et le temps passé en
G1. Figure adaptée de (Turner, Ewald, and Skotheim 2012).
La cycline 3 (Cln3) est une protéine importante de START. Cln3 est
nécessaire pour la régulation temporelle du cycle cellulaire, mais n’est pas
nécessaire à la viabilité chez S. cerevisiae, contrairement à l’homologue
Cln3 chez C. albicans (Chapa y Lazo, Bates, and Sudbery 2005). Cette
![Page 34: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/34.jpg)
14
observation suggère qu’il existe une autre voie chez S. cerevisiae qui
permet de passer START. Cette fonction redondante serait controlée par
Bck2 (Wijnen and Futcher 1999).
La concentration de Cln3 augmente pendant la phase G1 et se fixe à la
CDK Cdc28. Ce complexe permet la phosphorylation de Whi5 (Tyers,
Tokiwa, and Futcher 1993; Dirick, Bohm, and Nasmyth 1995; Stuart and
Wittenberg 1995). Cette phosphorylation lève l’inhibition de Whi5 sur le
complexe SBF (Figure 6) (facteurs de transcription Swi4/Swi6) (Costanzo
et al. 2004; de Bruin et al. 2004; Schaefer and Breeden 2004). Whi5 est
par conséquent délocalisé du noyau vers le cytoplasme par la protéine
Msn5 (Taberner, Quilis, and Igual 2009). Cln3/Cdc28 phosphoryle
également le complexe SBF, mais cette phosphorylation ne semble pas être
nécessaire pour l’activation de SBF (Geymonat et al. 2004).
L’activation de SBF et MBF permet la synthèse d’environ 200 gènes
nécessaire pour la synthèse de l’ADN et pour le bourgeonnement. Parmi
ces gènes, les cyclines CLN1 et CLN2 sont transcrites afin d’assurer la
poursuite du cycle cellulaire en s’associant avec Cdc28 et en continuant
l’inactivation de Whi5 (Eser et al. 2011; de Bruin et al. 2004), ce qui forme
une boucle d’activation. Cette boucle d’activation permet l’engagement
irréversible du cycle cellulaire (Skotheim et al. 2008; Charvin et al. 2010;
Doncic and Skotheim 2013). Cln1-Cln2/Cdc28 phosphorylent également
Sic1, un inhibiteur des complexes Clb/Cdc28 (Verma, Feldman, and
Deshaies 1997; Feldman et al. 1997). La phosphorylation de Sic1 permet
son ubiquitination et sa dégradation, permettant l’activation de Clb5-
6/Cdc28 et activant la réplication de l’ADN (Nash et al. 2001; Schneider,
Yang, and Futcher 1996; Tyers 1996). Clb5 a également un rôle dans la
phosphorylation de Sic1, ce qui permet encore d’amplifier la boucle
d’activation (Yang et al. 2013).
![Page 35: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/35.jpg)
15
Comme les levures sont capables de contrôler activement leurs tailles, ceci
suggère qu’il existe un ou plusieurs senseurs. Le senseur qui permet
d’indiquer à la cellule la taille n’est pas encore connu. Néanmoins, Cln3 et
Whi5 sont les deux principaux candidats.
Cln3 est séquestrée dans le réticulum endoplasmique par la protéine Ydj1
(Verges et al. 2007). En fin de la phase G1, la quantité d’Ydj1 devient
limitante et Cln3 est libéré et s’accumule par la suite dans le noyau pour
enclencher la phase S. D’autres auteurs ont émis l’hypothèse que c’est
l’accumulation de l’activité de Cln3/Cdc28 qui permet d’activer la
transition G1/S (Schneider et al. 2004).
Whi5 joue également un rôle essentiel dans la régulation de START. La
concentration nucléaire en Whi5 diminue pendant la phase G1. La
protéine étant diluée, elle ne joue plus son rôle d’inhibition de SBF et MBF
(Schmoller et al. 2015). Il a également été montré que la concentration en
Swi4 augmente pendant la phase G1, ce qui fait diminuer le ratio
Whi5/Swi4 (Dorsey et al. 2018). Donc, la quantité de Swi4 augmente au
cours de la phase G1 et permet le passage de START.
Modèle « Adder »
Le couplage entre la croissance et la division à START permet de contrôler
la taille sur le long terme. Cependant, une cellule fille née à une taille plus
petite passera plus de temps en G1 mais bourgeonnera tout de même à
une taille plus petite. START semble donc être un mécanisme imparfait et
suggère qu’un ou plusieurs autres mécanismes permettent de contrôler la
taille sur le long terme. Soifer et al ont montré que les levures ajoutent un
volume constant entre deux bourgeonnements (Soifer, Robert, and Amir
2016; Chandler-Brown et al. 2017). Au niveau moléculaire, l’hypothèse de
dilution de Whi5 au cours de la phase G1 est cohérent avec le modèle
« Adder » (Soifer, Robert, and Amir 2016; Schmoller et al. 2015).
![Page 36: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/36.jpg)
16
Le mécanisme « Adder » serait donc conservé chez les bactéries, les
archéobactéries et les eucaryotes.
Schizosaccharomyces pombe
S. pombe se divise de façon symétrique. La progression du cycle cellulaire
est régulée par Cdc2, la seule Cdk retrouvée chez cette levure. Cdc2
contrôle l’entrée en mitose et contrôle la longueur de la phase G2 (Nurse
1990). Contrairement à S. cerevisiae, la régulation de la taille se fait
majoritairement en phase G2/M (Jorgensen and Tyers 2004).
La taille serait contrôlée par la protéine Pom1, qui est localisée aux
extrémités de la cellule. Pom1 est un inhibiteur des kinases Cdr1 et Cdr2,
qui sont eux-mêmes des inhibiteurs de Wee1. Ce dernier inhibe la Cdk
Cdc2 par phosphorylation sur la Tyrosine 15 (Figure 8a) (Gould and Nurse
1989). Cdr1 et Cdr2 localisent au centre de la cellule (Deng and Moseley
2013). Pendant la croissance, la concentration de la protéine Pom1
diminue au centre de la cellule. L’inhibition de Cdr1 et Cdr2 est par
conséquent levée et Wee1 est inhibé, ce qui permet l’activation de Cdc2
(Figure 8b) (Martin and Berthelot-Grosjean 2009; Moseley et al. 2009).
Cependant, une mutation de la Tyrosine 15 de Cdc2 par un acide aminé
non phosphorylable ne perturbe pas la taille cellulaire des levures,
suggérant que d’autres mécanismes contrôlent la taille cellulaire
(Coudreuse and Nurse 2010).
Une autre hypothèse est que la concentration de Cdr2 augmente
proportionnellement à la croissance de la cellule et permet l’inhibition de
Wee1 (Pan et al. 2014; Russell and Nurse 1987).
![Page 37: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/37.jpg)
17
Figure 8 - Régulation de la taille chez S. pombe. (Marshall et al. 2012). a) Pom1 inhibe
l’activité de Cdr1 et Cdr2. Wee1 inhibe Cdc2. b) Pendant la croissance cellulaire, la
concentration de Pom1 diminue au centre de la cellule et Pom1 ne peut plus inhiber Cdr1 et
Cdr2. Cdr1 et Cdr2 inhibent Wee1, ce qui permet l’activation de Cdc2.
Métazoaires
La taille des cellules au sein d’un même tissu est homogène (Ginzberg,
Kafri, and Kirschner 2015; Lloyd 2013). La régulation cellulaire est un
processus extrêmement important pour former des organes et des
organismes de taille physiologique. La taille d’un animal dépend à la fois
du nombre de cellules et de la taille des cellules. La différence de taille des
organismes selon les espèces animales est principalement une différence
de nombre de cellules plutôt que de la taille des cellules. Par exemple,
l’Homme possède 3 000 fois plus de cellules qu’une souris (Conlon and
Raff 1999). Nous avons vu que la régulation de la taille est influencée par
l’environnement extérieur. Chez les métazoaires, l’environnement physique
peut également contrôler la taille cellulaire. Par exemple, les neurones
arrêtent de grandir quand ils touchent leurs cibles (Guthrie 2007). La
croissance et la prolifération sont différentiellement contrôlées selon le
![Page 38: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/38.jpg)
18
type de cellule et de tissus, plusieurs niveaux de contrôles sont donc
nécessaires. De plus, la croissance et la division ne sont pas toujours
couplées. Par exemple, les neurones peuvent grossir sans se diviser. Au
contraire, les ovocytes fécondés peuvent se diviser sans grossir.
L’équivalent de START est appelé le « Restriction Point » chez les
métazoaires (Wells 2002; Blagosklonny and Pardee 2002; Zetterberg,
Larsson, and Wiman 1995). Cependant, cette coordination semble être
principalement régulée par des facteurs extracellulaires plutôt que des
facteurs intracellulaires (Conlon et al. 2001; Conlon and Raff 2003). La
croissance et la division nécessitent des signaux distincts. Des molécules
mitogènes sont nécessaires pour favoriser la division cellulaire et des
facteurs de croissances sont nécessaires pour la croissance (Conlon et al.
2001; Rathmell et al. 2000).
La voie de régulation contrôlant la croissance la mieux caractérisée est la
voie IGF/PI3K/AKT/mTORC1 (Laplante and Sabatini 2012; Tumaneng,
Russell, and Guan 2012).
Mammifères
Chez les mammifères, la croissance est contrôlée par la voie TOR, qui
contrôle principalement la traduction via le facteur de transcription C-Myc
et la protéine kinase S6K. C-Myc augmente la production des ARN
ribosomiques et la taille du nucléole afin de favoriser la synthèse des
protéines (Grewal et al. 2005; Saucedo and Edgar 2002; Wang, Dillon, et
al. 2011). Myc est considéré comme l’analogue fonctionnel de Sfp1 (Cook
and Tyers 2007). Les facteurs extracellulaires, comme les facteurs de
croissances et les molécules mitogènes semblent être importants pour la
régulation de la taille (Conlon and Raff 2003). Des criblages chez l’Homme
ont permis d’identifier différents régulateurs de la taille, comme le gène
PRR16/Largen, qui est un activateur de la traduction et contrôle l’activité
mitochondriale (Yamamoto et al. 2014). Un autre criblage a permis
![Page 39: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/39.jpg)
19
d’identifier la p38 comme un régulateur de la taille chez l’Homme (Liu et
al. 2018).
Drosophile
Chez la drosophile, l’inactivation de mTOR par la rapamycine provoque un
délai du cycle cellulaire et une diminution de la taille cellulaire (Zhang et
al. 2000). S6K (l’analogue fonctionnel de Sch9) est un substrat de mTOR
dont l’inactivation génétique ou l’inactivation par traitement à la
rapamycine provoque des ailes de petites tailles (Montagne et al. 1999;
Chung et al. 1992). mTOR contrôle la croissance cellulaire via la
traduction et la biogénèse des ribosomes et augmente également la
production de nucléotides afin de favoriser la production d’ARN
(ribosomiques et messagers) ainsi que la traduction et produire des dNTP
nécessaire à la réplication de l’ADN.
Les nutriments sont également importants pour la régulation de la taille.
Une carence nutritive peut provoquer une diminution de la taille des ailes
de 15% (Edgar 2006) alors que des nutriments en excès n’influence par la
taille des drosophiles.
Nématodes
Les nématodes Caenorhabditis elegans et Ascaris lumbricoides ont été
longuement étudiés. Ces deux espèces ont la même taille après l’éclosion,
mais à la taille adulte, A. lumbricoides est 109 fois plus gros que C.
elegans. La différence entre C. elegans et A. lumbricoides est que ce dernier
produit des cellules de plus grande taille afin de produire un organisme
allant jusqu’à 40 cm de long.
La taille cellulaire peut influencer la taille des organes ainsi que la taille de
l’organisme. Par exemple, le nombre de cellules de C. elegans est fixe, mais
des perturbations peuvent modifier la taille des cellules et ainsi modifier la
![Page 40: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/40.jpg)
20
taille de l’organisme adulte (Irle and Schierenberg 2002; Cook and Tyers
2007). Différents criblages pour identifier les gènes régulant la taille ont
permis d’identifier les voies TGF-β et MAPK sma-5 (Small Body Size). Les
mutations dans ces voies peuvent produire des vers 10 fois plus petits
qu’un ver sauvage (Savage-Dunn et al. 2003; Watanabe, Ishihara, and
Ohshima 2007). La voie TGF-β semble également avoir un rôle dans la
croissance des cellules en favorisant l’augmentation de la ploïdie et a pour
conséquence d’augmenter la taille de l’organisme (Lozano et al. 2006).
Régulation de la taille et virulence fongique
De nombreux champignons sont pathogènes pour l’Homme. Les plus
importants sont Candida, Aspergillus, Cryptococcus et Histoplasma. Il n’est
pas encore établi s’il y a un lien direct entre la régulation de la taille des
champignons et la virulence. Cependant, plusieurs études suggèrent que
la taille d’un pathogène fongique est un déterminant important de la
virulence.
Cryptococcus neoformans
En 2009, une forme « géante » de C. neoformans a été mise en évidence
dans un modèle d’infection de souris (Figure 9) (Zaragoza et al. 2010). Ces
cellules géantes possèdent une capsule et la cellule elle-même (sans la
capsule) a aussi une grande taille. Ces cellules sont plus résistantes au
stress osmotique et aux radiations gamma et les macrophages ne peuvent
pas les phagocyter (Okagaki et al. 2010). La grande taille et la capsulation
sont favorisées par l’environnement de l’hôte, notamment la température à
37°C (Garcia-Rodas et al. 2011). La diversité des cellules (avec et sans
capsule) permet l’invasion de l’hôte et l’échappement au système
immunitaire. Ces cellules ont également une ploïdie élevée, indiquant
qu’elles dupliquent leur génome sans se diviser.
![Page 41: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/41.jpg)
21
Figure 9 - Diversité de la taille de Cryptococcus neoformans. A. Cellules sans capsule. B.
Cellules avec capsule. (Zaragoza et al. 2010)
Histoplasma capsulatum
H. capsulatum est une levure pathogène dimorphique, mais contrairement
à C. albicans, cette levure produit des hyphes à 25°C et elle se propage
sous forme levure à 37°C à l’intérieure de l’Homme (Wang and Lin 2012). À
37°C, ce champignon produit deux types de propagules, des microconidies
et des macroconidies. Les microconidies, qui sont les formes infectieuses,
ont une petite taille qui leur confère l’avantage de se loger dans les alvéoles
pulmonaires et de persister dans les cellules phagocytaires (Seider et al.
2010). Ce champignon produit donc des cellules de différentes formes et
taille suivant l’environnement.
Paracoccidioides brasiliensis
Cette levure est caractéristique par sa diversité de forme et de taille au sein
d’une population. Une mutation du gène CDC42 provoque une diminution
de la taille et de sa variabilité. Ce mutant est plus facilement phagocyté
par les macrophages et il est non virulent dans des modèles d’infection de
souris. Ceci suggère que la diversité de la taille, ainsi que la grande taille
de cette levure sont des attributs importants pour le pouvoir pathogène de
ce champignon (Almeida et al. 2009). Cependant, il n’est pas exclu que
CDC42 régule d’autres processus nécessaire pour la virulence pendant
l’infection.
![Page 42: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/42.jpg)
22
Mucor circinelloides
Mucor circinelloides présente une diversité de taille qui dépend du groupe
de compatibilité sexuelle de la cellule (+ ou -). Les cellules produites par
des souches (–) sont plus grandes et peuvent provoquer la lyse des cellules
de l’hôte à l’inverse des cellules (+) qui ont une petite taille et sont non-
pathogènes (Li et al. 2011).
![Page 43: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/43.jpg)
23
C. albicans et les candidoses
C. albicans est une levure de la division des Ascomycètes et de l’ordre des
Saccharomycetales. Le nom de classification a été proposé par Christine
Marie Berkhout dans sa thèse de doctorat de l’Université d’Utrecht, aux
Pays-Bas, en 1923 (Barnett 2004). Candida provient du mot latin
« candidus », signifiant « blanc ». Albicans est le participe présent du mot
latin « albicō », signifiant « blanc » également.
C. albicans est une levure opportuniste retrouvée chez l’Homme et
différents animaux comme les oiseaux, les bovins, les chevaux, les chats
(Edelmann, Kruger, and Schmid 2005)… La levure fait partie de la flore
commensale humaine de la bouche, du tractus digestif et du vagin. C.
albicans est maintenu sous sa forme commensale par d’autres
microorganismes et par le système immunitaire de l’hôte. En cas de
perturbation de la flore commensale, par prise d’antibiotiques ou
d’immunosuppresseurs, à cause du tabagisme (Akram et al. 2018), ou
suite à une immunodéficience (SIDA, chimiothérapie), la levure peut
devenir virulente et provoquer une candidose. C. albicans est un
pathogène très polyvalent et est devenu un agent pathogène majeur. En
Amérique du Nord, 10% des septicémies sont causées par des levures du
genre Candida, généralement par l’espèce C. albicans (C. albicans
représente 90% des septicémies à levure) (Marchetti et al. 2004; Edmond
et al. 1999; Bille, Marchetti, and Calandra 2005). Les Candida sont la
troisième cause d’infection nosocomiale aux États-Unis (Wisplinghoff et al.
2004), après Escherichia coli et Staphylococcus aureus.
Quelques espèces de Candida, dont C. albicans, utilisent un code
génétique non standard. En effet, le codon CUG code généralement pour
une leucine mais code pour une sérine chez certaines espèces de Candida
![Page 44: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/44.jpg)
24
(Santos et al. 1997), d’où le nom du clade CTG de C. albicans et les
espèces proches (Figure 10).
Figure 10 - Phylogénie des clades Candida et Saccharomyces. Le Clade Candida est
caractérisé par l’utilisation du codon CTG qui code pour une sérine. S. cerevisiae se trouve
dans le clade WGD = Whole Genome Duplication. (Butler et al. 2009)
Épidémiologie et manifestations cliniques des candidoses
Parmi les 200 espèces du genre Candida, 14 sont pathogènes pour
l’Homme : C. albicans, C. auris, C. dubliensis, C. glabrata, C. kefyr, C.
krusei, C. lusitaniae, C. parapsilosis, C. tropicalis, C. guilliermondii, C.
famata, C. lipolytica, C norvengensis, C. rugosa (Lopez-Martinez 2010;
Satoh et al. 2009; Pfaller et al. 2006). C. albicans est l’espèce la plus
fréquemment isolée.
![Page 45: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/45.jpg)
25
Les candidoses sont en augmentation partout dans le monde. Elles sont
favorisées par l’âge, la prise d’antibiotiques, de stéroïdes et
d’antidépresseurs, par les transplantations d’organe et de moelle osseuse,
par le diabète, divers cancers, le SIDA et la malnutrition (Lopez-Martinez
2010).
Les candidoses peuvent avoir différentes formes :
-Candidose buccale, ou muguet, caractérisée par des plaques blanchâtres
sur la langue, le palais, les joues et le pharynx. Cette infection touche
jusqu’à 90% des patients atteints du SIDA, dans ce cas, l’infection peut se
propager dans le système digestif. C’est la forme la plus fréquente de
candidose et peut être très agressive pour les prématurés, les femmes
allaitantes et les personnes âgées. (Lalla, Patton, and Dongari-Bagtzoglou
2013). Les autres facteurs de risque sont le cancer, l’utilisation d’une
prothèse dentaire ou la prise d’antibiotiques.
-Candidose vulvovaginal, caractérisée par une leucorrhée et des
démangeaisons. 50 à 75% des femmes ont au moins une candidose
vaginale au cours de leur vie, à tout âge (Sobel 2007). Ce type d’infection
est favorisé par la prise de contraceptifs ou d’antibiotiques, par l’obésité,
chez les femmes enceintes et par les thérapies hormonales (Fidel 2004).
-Candidose balano-préputial, caractérisée par une douleur, des pustules,
une irritation, parfois par un ulcère et une sécrétion sur le gland du pénis
et sur le prépuce. Ce type d’infection est favorisé par le manque d’hygiène,
le diabète et l’immunodéficience.
-Onychomycose, caractérisée par une décoloration de l’ongle, ou au
contraire une couleur verte-jaune, une séparation à l’extrémité de l’ongle,
l’apparition d’un œdème et une douleur. C’est une infection fréquente chez
les diabétiques.
-Candidose mucocutanée, caractérisée par une douleur sur la surface
infectée, une hyperkératose et des ulcères de la peau. Cette infection peut
![Page 46: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/46.jpg)
26
se propager dans les tissus profonds puis provoquer une septicémie et le
décès.
-Candidose invasive, caractérisée par une septicémie, une endocardite,
une méningite ou une endophtalmie (Pappas 2006). La septicémie à
Candida est la 4ème infection du sang la plus courante. Elle est responsable
de 50 000 décès par an dans le monde. Les Candidoses invasives sont
favorisées par la prise d’antibiotique, la chirurgie et l’immunodéficience.
Traitements des candidoses
Le traitement d’une candidose dépend de la zone d’infection. Un guide est
publié pour aider les cliniciens à choisir le traitement approprié. (Pappas et
al. 2016; Lopez-Martinez 2010). Dans un premier temps, il est nécessaire
d’éliminer les facteurs de prédisposition : arrêter la prise d’antibiotiques,
de stéroïdes ou d’immunosuppresseurs ; traiter l’humidité localement ou
ajuster le pH vaginal. La prise de probiotiques peut également être efficace
dans le cas d’une infection vaginale (Jurden et al. 2012; Abad and Safdar
2009). En revanche, quand le facteur de prédisposition est une pathologie,
comme le SIDA, le diabète ou bien un cancer, la prise d’antifongique est
nécessaire.
Il existe trois principales classes d’antifongiques utilisées contre les
candidoses : les polyènes, les azoles et les échinochandines.
Les polyènes et les azoles sont utilisés pour les traitements oraux,
vaginaux, cutanés et en intraveineuse pour les infections systémiques
(Moosa et al. 2004; Silverman, Pories, and Caro 1989).
Les échinochandines sont utilisées en intraveineuses et sont
recommandées pour le traitement des candidoses systémiques (Bassetti et
al. 2018; Pappas et al. 2016).
Ces antifongiques ont plusieurs limitations. Ils peuvent provoquer des
effets secondaires, comme des allergies, des insuffisances rénales, des
nausées et des maux de tête (Sawant and Khan 2017). De plus, des
![Page 47: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/47.jpg)
27
résistances à ces antifongiques apparaissent. Il est donc nécessaire de
trouver de nouvelles molécules pour traiter les candidoses (Perfect 2017).
Génome
C. albicans est un diploïde et possède 8 chromosomes allant de 3,3 à 0,95
Mb (chromosomes 1 à 7 et le chromosome R) (Olaiya and Sogin 1979). Un
premier séquençage a été achevé en 2004 (Jones et al. 2004). Un haut
niveau d’hétérozygotie, de recombinaison intrachromosomique et
d’aneuploïdie a été observé dans différentes souches. Cette plasticité
génomique a un effet sur l’adaptation de la levure à différents stress, sur la
résistance aux antifongiques (Wertheimer, Stone, and Berman 2016) et
génère de la variation phénotypique (Holmes et al. 2006). La fréquence de
perte d’hétérozygotie et d’aneuploïdie est 1 000 fois plus élevée in vivo qu’in
vitro et l’instabilité génomique a un impact sur la virulence de cette levure
(Satpati et al. 2017; Forche et al. 2018). En effet, l’instabilité génétique
influence le taux de croissance de la levure, sa morphologie, la résistance
aux stress ou aux antifongiques (Braunsdorf and LeibundGut-Landmann
2018; Schonherr et al. 2017).
La taille du génome est d’environ 29Mb (forme diploïde) et le génome
possède environ 6 200 ORF (6 600 ORF pour S. cerevisiae), dont 4 400
(70%) ne sont pas caractérisés (http://www.candidagenome.org ; consulté
en novembre 2018). S. cerevisiae et C. albicans ont environ 75 % de gènes
orthologues et 20% des gènes de C albicans n’ont pas d’homologue chez S.
cerevisiae, C. albicans et l’Homme (Odds, Brown, and Gow 2004; Jones et
al. 2004). Bien que la levure ait été considérée comme asexuée, le génome
contient les gènes permettant une reproduction sexuée (Hull and Johnson
1999). Les levures peuvent former des formes tétraploïdes et revenir sous
forme diploïde par perte aléatoire de chromosomes excédentaires (Miller
![Page 48: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/48.jpg)
28
and Johnson 2002; Wu et al. 2005). La méiose n’a jamais été observée
chez cette levure (Bennett and Johnson 2005).
Morphologie
C. albicans est une levure pléomorphique, c’est-à-dire qu’elle présente
différentes morphologies selon l’environnement dans laquelle elle se trouve
(Figure 11). C. albicans a la possibilité de passer d’une forme levure à une
forme hyphe ou pseudohyphe. De plus, la levure peut faire des
« transitions phénotypiques » nommées White, Opaque, GUT
(Gastrointestinally induced Transition) et Gray. Récemment, la forme
Goliath a été décrite, cette forme est observée dans des milieux carencés
en zinc (Malavia et al. 2017).
Figure 11 - Représentation des différentes formes morphologiques de C. albicans (Gow
and Yadav 2017).
Transition levure-hyphe
![Page 49: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/49.jpg)
29
C. albicans est capable de se diviser sous forme levure ou bien sous forme
filamenteuse (hyphe ou pseudohyphe) (Figures 11 et 12). La forme levure
prolifère par bourgeonnement avec une forme ellipsoïdale. La forme
filamenteuse croît par élongation, la cellule fille ne se sépare pas de la
cellule mère et forme des filaments. Dans le cas d’un pseudo-hyphe, il y a
formation d’une paroi transversale appelée septum. La croissance des
hyphes est assurée par le Spitzenkörper (Berman 2006), un complexe dans
la région apicale de l’hyphe qui est riche en vésicules sécrétoires et
permettant la polymérisation des constituants de la paroi. La forme levure
est favorisée par un pH acide et une température inférieure à 25°C. La
forme hyphe est favorisée par un pH alcalin, une température de 37°C,
une haute concentration en CO2, une carence nutritive, l’hypoxie, la
croissance sur une surface solide et la présence de sérum dans le milieu.
La forme pseudo-hyphe est favorisée à 35°C, pH=6 et en carence azotée. Le
dimorphisme levure/hyphe semble nécessaire pour la virulence. De
nombreux mutants incapables de faire la transition entre les formes
levures et hyphes perdent leur capacité à coloniser et envahir l’hôte,
suggérant que les deux formes sont nécessaires pour la virulence (Lo et al.
1997; Saville et al. 2003). La forme levure serait nécessaire pour la
colonisation et la dissémination (Saville et al. 2003) alors que la forme
hyphe serait nécessaire pour l’invasion des tissus et l’échappement au
système immunitaire (Berman and Sudbery 2002; Malinverni et al. 1985).
![Page 50: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/50.jpg)
30
Figure 12 - Photos de C. albicans en forme pseudohyphe (Pseudohyphae), levure (Yeast)
et hyphe (Hyphae). La barre d’échelle représente 5 µm (Sudbery 2011).
Transitions phénotypiques
C. albicans est capable d’exprimer des phénotypes différents suivant les
conditions environnementales. La transition phénotypique est définie
comme la capacité de subir spontanément et de manière réversible des
transitions de morphologie (Soll 1992). Certains phénotypes semblent être
les formes commensales et d’autres les formes pathogènes. Quatre formes
phénotypiques ont été décrites chez C. albicans : White, Gray, Opaque et
GUT (Gastrointestinally-IndUced Transition).
Dans les conditions de laboratoire, la forme la plus commune est la forme
White. Les colonies White sont blanches, lisses et rondes. La transition
White-Opaque a été décrite en 1985 (Slutsky et al. 1987). Les colonies
Opaques sont plus grosses, plus rugueuses et plus grises que les formes
White. Les cellules Opaques sont compétentes pour la reproduction
![Page 51: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/51.jpg)
31
parasexuée (Miller and Johnson 2002) contrairement aux cellules White.
La forme White est plus virulente dans les candidoses systémiques alors
que la forme Opaque est plus virulente dans les infections cutanées. La
transition White/Opaque est favorisée par la présence de 5% de CO2, une
température de 25°C et la présence de N-acetylglusosamine (Tao et al.
2014).
La forme Gray a été décrite en 2014 (Tao et al. 2014). Les colonies sont
lisses et grises. La forme Gray diffère des formes White et Opaque par la
morphologie et la signature transcriptionnelle (Figure 13A). Cette forme
permet la colonisation de la langue. C’est une forme plus efficace pour la
reproduction parasexuée que la forme White, mais moins efficace que la
forme Opaque. La forme Gray est stabilisée à 37°C en présence de N-
acetylglucosamine (Tao et al. 2014).
En 2013, la forme GUT (gastrointestinally induced transition) est décrite
comme une forme commensale de l’intestin (Pande, Chen, and Noble
2013). Cette forme ressemble morphologiquement à la forme Opaque, mais
avec des vacuoles plus proéminentes (Figure 13B). Les gènes du
catabolisme des acides gras sont surexprimés dans la forme GUT, ce qui
explique pourquoi elle est bien adaptée au système digestif des
mammifères, qui est enrichi en acide gras (Wong and Jenkins 2007).
![Page 52: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/52.jpg)
32
Figure 13 - Photos de différentes formes phénotypiques de C. albicans. (A) Formes White,
Gray et Opaque (Tao et al. 2014). La barre d’échelle représente 10 µm. (B) Formes White
et GUT (Pande, Chen, and Noble 2013).
Biofilms
Les biofilms sont des communautés microbiennes organisées. Ils peuvent
se former sur des surfaces abiotiques (cathéter, matériel chirurgical…) et
biotiques (dents).
La formation de biofilm se fait en plusieurs étapes. Premièrement, les
cellules libres se fixent sur une surface. Cette étape permet la synthèse
d’une famille de gènes codante pour des adhésines (Green et al. 2004) et
des gènes régulants la formation des hyphes (Nobile and Mitchell 2005).
Ensuite, elles forment des hyphes et sécrètent une matrice extracellulaire
composé de glycoprotéines et d’ADN (Pierce et al. 2017). Cette matrice
extracellulaire permettrait aux cellules de se défendre contre les
phagocytes et les antifongiques car ces derniers diffusent mal dans les
biofilms (Alonso et al. 2017; Sellam et al. 2009).
![Page 53: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/53.jpg)
33
C. albicans en forme de biofilm est plus résistant qu’en forme planctonique
aux antifongiques et au système immunitaire. In vivo, des formes levures
peuvent s’échapper du biofilm, ce qui favorise la dissémination. Les
biofilms sont donc des réservoirs pour des infections persistantes (Ramage
et al. 2005).
Plasticité évolutive de la régulation transcriptionelle chez les
ascomycetes : « transcriptional rewiring »
S. cerevisiae et C. albicans ont un génome similaire et se divisent tous les
deux par bourgeonnement, mais ces deux levures ont aussi des
différences :
-S. cerevisiae est saprophyte alors que C. albicans est un opportuniste, ce
qui signifie que ces espèces ne vivent pas dans les mêmes environnements
et donc n’ont pas les mêmes besoins nutritifs.
-C. albicans a un cycle parasexuel (reproduction sans méiose) alors que S.
cerevisiae est capable de se diviser par méiose.
Chez ces espèces, des différences dans les voies de régulation peuvent
modifier l’expression des gènes (dans le temps et le niveau d’expression) et
ainsi modifier les phénotypes et créer une diversité phénotypique. Même
pour des processus très conservés, comme la synthèse des ribosomes, les
voies de régulation peuvent différer. Par exemple, les deux principaux
facteurs de transcriptions régulant l’expression des protéines ribosomales
sont Rap1 et Hmo1 chez S. cerevisiae (Gadal et al. 2002), alors que ces
deux gènes n’ont aucun rôle dans ce processus chez C. albicans. Ce rôle
est assuré par Tbf1 et Cbf1 chez C. albicans (Lavoie et al. 2010).
Un exemple documenté de « rewiring » transcriptionnel provient du facteur
de transcription Gal4. Chez S. cerevisiae, cette protéine induit la
transcription des gènes GAL1, GAL7 et GAL10, qui codent pour les
enzymes de la galactolyse, quand le glucose est absent et le galactose
![Page 54: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/54.jpg)
34
présent (Holden et al. 2004). C. albicans possède des orthologues de toutes
ces enzymes (Brown, Sabina, and Johnston 2009; Fitzpatrick et al. 2010;
Martchenko et al. 2007) ainsi que de Gal4 (Holden et al. 2004; Sellam,
Hogues, et al. 2010). Cependant, chez C. albicans, Gal4 ne joue aucun rôle
dans la transcription des gènes GAL1-7-10 (Martchenko et al. 2007) et est
impliqué dans la glycolyse (Askew et al. 2009). Quant aux enzymes, elles
restent impliquer dans le métabolisme du galactose. Rtg1 et Rtg3 ont été
identifiés comme les facteurs de transcription permettant l’expression des
gènes GAL1, GAL7 et GAL10 chez C. albicans (Dalal et al. 2016). Chez S.
cerevisiae, Rtg1 et Rtg3 interviennent dans une voie de signalisation entre
la mitochondrie et le noyau (Jia et al. 1997). Les enzymes de la galactolyse
sont donc exprimées en présence de galactose dans les deux espèces sous
le contrôle de facteurs de transcription différents. Cependant, le taux
d’expression de GAL1 en présence de galactose est plus élevé chez S.
cerevisiae (900 fois) que C. albicans (12 fois) et le gène est induit plus
rapidement chez C. albicans. Enfin, C. albicans répond à une
concentration en galactose plus faible par rapport à S. cerevisiae (Dalal et
al. 2016). Cet exemple de « rewiring » montre que le changement de
régulateur à un impact temporel et sur le niveau d’expression des gènes
cible, ce qui induit une diversité phénotypique.
En conclusion, même si les génomes de S. cerevisiae et C. albicans sont
proches (75% de similarité), des gènes orthologues entre les deux espèces
peuvent avoir des fonctions différentes. L’analyse de séquence n’est donc
pas suffisante pour déduire la fonction d’un gène.
Cycle cellulaire
Morphologiquement, le cycle cellulaire de C. albicans ressemble à celui de
la levure modèle S. cerevisiae : en forme levure, les deux espèces se
divisent de façon asymétrique par bourgeonnement. Le cycle cellulaire est
![Page 55: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/55.jpg)
35
régulé par des cyclines et par la Cdk Cdc28 chez les deux espèces.
L’analyse du génome et l’expérience ont montré des différences dans la
régulation du cycle cellulaire entre les deux espèces. Par exemple, la
cycline 3 (Cln3) est essentielle chez C. albicans mais pas chez S. cerevisiae,
ce qui suggère que Cln3 a un rôle plus déterminant chez C. albicans
(Chapa y Lazo, Bates, and Sudbery 2005). De plus, S. cerevisiae possède
quatre cyclines B : Clb1, 2, 3 et 4 alors que C. albicans possède deux
cyclines B : Clb2 et 4 (Bensen et al. 2005).
Le cycle cellulaire de C. albicans est caractérisé par quatre vagues de
transcriptions successives régulées par le complexe SBF (Swi4/Swi6) et les
facteurs de transcription Fkh2, Mcm1 et Ace2 (Cote, Hogues, and
Whiteway 2009). Ces vagues de transcription correspondent aux
transitions G1/S, S/G2, G2/M et M/G1.
Pendant la transition G1/S, les gènes exprimés sont enrichis en gènes de
la réplication de l’ADN, du cycle cellulaire et de la cohésion des
chromatines. Ces gènes sont régulés par le complexe MBF, constitué des
facteurs de transcriptions Swi4 et Swi6 (Hussein et al. 2011). Le complexe
MBF est lui-même régulé par Nrm1 et par le complexe Cln3/Cdc28.
Les gènes exprimés pendant la transition S/G2 sont impliqués dans
l’organisation des chromosomes et le cycle cellulaire. Ces gènes sont
régulés par le facteur de transcription Fkh2.
Les gènes de la transition G2/M sont impliqués dans la cytokinèse, la
séparation de la cellule mère et de la cellule fille, ces gènes sont régulés
par Mcm1.
![Page 56: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/56.jpg)
36
Les gènes de la transition M/G1 sont impliqués dans le complexe de pré-
réplication, le bourgeonnement et de la biogenèse de la paroi et ils sont
régulés par Ace2.
Croissance
Comme chez S. cerevisiae, la croissance est régulée par le complexe TOR
chez C. albicans. Cependant, il n’existe qu’un seul homologue de TOR1
chez C. albicans, alors qu’il y a deux homologues de TOR chez S. cerevisiae
(TOR1 et TOR2). Le rôle de la voie TOR dans la réponse aux nutriments et
dans la régulation de la biogénèse des ribosomes est conservé entre les
deux espèces (Bastidas, Heitman, and Cardenas 2009).
Sch9 et Sfp1 sont également conservés entre les deux espèces (Kastora et
al. 2017). La kinase Sch9 est nécessaire pour la croissance en forme levure
et en forme hyphe en activant la traduction via la phosphorylation de la
protéine ribosomale S6 (Liu et al. 2010; Chowdhury and Kohler 2015).
Régulation de la taille et virulence de C. albicans
Comme nous avons vu précédemment, C. albicans présente de nombreux
phénotypes suivant son environnement (levure, hyphe, White, Opaque,
GUT, Gray Goliath). Ces formes phénotypiques ont une influence sur le
commensalisme et la virulence. Les cellules Gray sont plus petites que les
Opaques, qui sont plus petites que les formes White. Les plus grosses
cellules sont les GUT dues à la grande taille des vacuoles. Les cellules
présentants ces phénotypes diffèrent en taille mais aussi en structure de la
paroi ainsi que dans leur signature transcriptionnelle. Il est donc difficile
de mettre en évidence un rôle direct de la taille sur la virulence. En
revanche, la forme hyphe semble être nécessaire pour échapper aux
cellules phagocytaires en provoquant des forces mécaniques qui font
éclater les phagocytes. De plus, il a été montré que les polynucléaires
![Page 57: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/57.jpg)
37
neutrophiles peuvent discriminer les pathogènes, comme C. albicans, en
fonction de leur taille afin d’adapter la réponse du système immunitaire
(Branzk et al. 2014). Ces études suggèrent que la grande taille est un
facteur de virulence alors que la petite taille est une forme commensale.
![Page 58: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/58.jpg)
38
Problématique, hypothèse et objectifs
Problématique
L’homéostasie de la taille cellulaire est un processus indispensable pour
assurer le bon fonctionnement des processus physiologiques. Maintenir
une taille cellulaire homogène sur le long terme permet d’assurer les
transports intracellulaires, d’optimiser les échanges avec le milieu
extérieur et d’optimiser les réactions métaboliques. Chez l’Homme, la
dérégulation de la taille cellulaire caractérise certaines pathologies, comme
les cancers (Jorgensen and Tyers 2004). Chez certaines levures
pathogènes, comme C. neoformans ou H. capsulatum, l’adaptation de la
taille semble être un facteur de virulence. En effet, ces espèces présentent
une taille hétérogène pendant l’infection de l’hôte, ce qui permettrait de
favoriser l’invasion de l’hôte (pour les cellules de petites tailles) et
d’échapper au système immunitaire (pour les cellules de grandes tailles).
Les mécanismes de la régulation de l’homéostasie de la taille n’ont jamais
été étudiés chez les champignons pathogènes. Afin d’étudier la taille
cellulaire chez ces organismes, nous avons choisi C. albicans comme
modèle d’étude. Cette espèce est la levure la plus souvent rencontrée
parmi les infections fongiques chez l’Homme. De plus, de nombreux outils
de biologie moléculaire et cellulaire ont été développés ces dernières
décennies pour cette levure modèle.
Hypothèse
Les études de l’homéostasie de la taille réalisées chez S. cerevisiae ont
montré que c’est un phénomène complexe, faisant intervenir différents
processus comme la traduction, le transport intracellulaire, le métabolisme
ou encore la transcription. S. cerevisiae et C. albicans ont une morphologie
similaire : elles ont une forme ellipsoïdale et se divisent par
![Page 59: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/59.jpg)
39
bourgeonnement. Elles vivent dans des niches différentes : S. cerevisiae est
un saprophytes et C. albicans est un opportuniste. Ceci signifie qu’elles
doivent s’adapter à des environnements et des stress différents. De plus,
elles ont divergé et de nombreux cas de « rewiring » évolutifs ont été
rapportés. En étudiant la régulation de la taille chez C. albicans, on
s’attend à identifier de nombreux nouveaux régulateurs de la taille, dû à
leur différence de niches et au « rewiring ». Ce travail permettra de mettre
en évidence les différences entre les champignons saprophytes et
opportunistes, permettra de mieux comprendre la régulation de la taille
cellulaire chez les eucaryotes et pourrait mener à la découverte de cibles
thérapeutiques.
Objectifs
Le premier objectif de mes travaux est d’effectuer un criblage sur des
mutants de délétions hétérozygotes et homozygotes de C. albicans afin
d’identifier des gènes nécessaires pour la régulation de la taille cellulaire.
Le deuxième objectif est de caractériser des nouveaux régulateurs de la
taille identifiés dans les criblages. Pour cela, nous utilisons des techniques
de génétiques afin d’identifier de potentiels interactions entre les nouveaux
régulateurs de START, des techniques de biologie moléculaire et de
génomique fonctionnelle pour étudier la fonction de ces régulateurs.
![Page 60: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/60.jpg)
40
Chapitre 1 - Genome-wide screen for
haploinsufficient cell size genes in the
opportunistic yeast Candida albicans.
1.1 - Résumé
Le point de contrôle START, appelé le « Restriction Point » chez les
métazoaires, est la phase du cycle cellulaire où les cellules s’engagent dans
la division de façon irréversible. Ce point de contrôle est un processus peu
compris de la prolifération cellulaire. Chez toutes les espèces eucaryotes,
une taille seuil doit être atteinte avant de passer START afin de coordonner
la croissance et la division cellulaire, ce qui permet d’assurer l’homéostasie
de la taille sur le long terme. Alors que des études ont été effectuées sur
les levures saprophytes S. cerevisiae et S. pombe pour étudier le
déterminisme génétique de la taille, nous avons peu de connaissance sur
les levures pathogènes. Puisque de nombreux régulateurs de START sont
happloinsuffisants pour la régulation de la taille cellulaire chez S.
cerevisiae, nous avons effectué une analyse de la taille sur des mutants
hétérozygotes. Pour cela, nous avons séquencé une banque de 5 639
mutants hétérozygotes possédant un « code-barre » triée en fonction de la
taille des cellules par élutriation. Notre étude a permis d’identifier des
régulateurs et des processus biologiques connus de l’homéostasie de la
taille. Nous avons également identifié des gènes spécifiques de C. albicans.
Une fraction des gènes identifiés sont également requis pour la virulence,
ce qui suggère que la régulation de la taille est un processus élémentaire
pour la virulence et l’adaptation de C. albicans dans l’hôte.
![Page 61: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/61.jpg)
41
1.2 - Article
Genome-wide screen for haploinsufficient cell size genes in the
opportunistic yeast Candida albicans.
Julien Chaillot,* Michael A. Cook,† Jacques Corbeil,*,‡ and Adnane
Sellam*,§,1
G3: Genes, Genomes, Genetics February 1, 2017 vol. 7 no. 2 355-360;
https://doi.org/10.1534/g3.116.037986
*Infectious Diseases Research Centre, Centre Hospitalier Universitaire
(CHU) de Québec Research Center,‡Department of Molecular Medicine,
§ Department of Microbiology, Infectious Disease and Immunology, Faculty
of Medicine, Université Laval, Quebec City, Quebec, G1V 4G2 Canada,
† Centre for Systems Biology, Samuel Lunenfeld Research Institute, Mount
Sinai Hospital, Toronto, G1V 4G2 Canada
1 Corresponding author: CHU de Québec Research Center, RC-0709, 2705
Laurier Blvd., Quebec City, QC G1V 4G2, Canada. E-mail: adnane.sellam@
crchudequebec.ulaval.ca
![Page 62: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/62.jpg)
42
1.2.1 - Abstract
One of the most critical but still poorly understood aspects of eukaryotic
cell proliferation is the basis for commitment to cell division in late G1
phase, called Start in yeast and the Restriction Point in metazoans. In all
species, a critical cell size threshold coordinates cell growth with cell
division and thereby establishes a homeostatic cell size. While a
comprehensive survey of cell size genetic determinism has been performed
in the saprophytic yeasts Saccharomyces cerevisiae and
Schizosaccharomyces pombe, very little is known in pathogenic fungi. As a
number of critical Start regulators are haploinsufficient for cell size, we
applied a quantitative analysis of the size phenome, using elutriation-
barcode sequencing methodology, to 5639 barcoded heterozygous deletion
strains of the opportunistic yeast Candida albicans. Our screen identified
conserved known regulators and biological processes required to maintain
size homeostasis in the opportunistic yeast C. albicans. We also identified
novel C. albicans-specific size genes and provided a conceptual framework
for future mechanistic studies. Interestingly, some of the size genes
identified were required for fungal pathogenicity suggesting that cell size
homeostasis may be elemental to C. albicans fitness or virulence inside the
host.
Keywords: Candida albicans, cell size, haploinsufficiency, Start control
![Page 63: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/63.jpg)
43
1.2.2 - Introduction
In eukaryotic species, growth and division are coupled at Start (Restriction
Point in metazoans), the point in late G1 at which the cell commits to the
next round of division (Jorgensen and Tyers 2004). Cells must grow to
reach a critical size threshold at Start and thereby establish a homeostatic
cell size. Pioneering studies in the eukaryotic model Saccharomyces
cerevisiae revealed that a large proportion of the genome (>10%) and of
cellular functions impact on the size of cells, in processes ranging from
ribosome biogenesis (Ribi) and mitochondrial function, to signal
transduction and cell cycle control (Jorgensen et al. 2002; Zhang et al.
2002; Soifer and Barkai 2014). While follow-on studies revealed many
crucial players in size regulation, such as the G1 repressor Whi5 and the
Ribi master regulators Sch9 and Sfp1, both the central mechanism by
which cells sense their size and the means by which they alter their size
set-point to meet environmental demands remain elusive (Turner et al.
2012).
Candida albicans is a diploid ascomycete yeast that is an important
commensal and opportunistic pathogen in humans colonizing primarily
mucosal surfaces, gastrointestinal and genitourinary tracts, and skin
(Berman and Sudbery 2002). Interest in C. albicans is not limited to
understanding its function as a pathogenic organism, as it has an
ecological niche that is obviously distinct from the classic model
ascomycete S. cerevisiae. C. albicans has served as an important
evolutionary milepost with which to assess conservation of biological
mechanisms. Recent investigations uncovered an extensive degree of
rewiring of fundamental signaling and transcriptional regulatory networks
as compared to S. cerevisiae and other fungi (Lavoie et al. 2009; Sellam et
al. 2009; Blankenship et al. 2010; Homann et al. 2009; Sandai et al.
2012).
![Page 64: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/64.jpg)
44
Haploinsufficiency is a phenotypic feature wherein a deletion of one allele
in a diploid genome leads to a discernable phenotype. In eukaryotes, a
number of critical size regulators, such as the G1 cyclin Cln3 and the AGC
kinase Sch9 in S. cerevisiae, and the Myc oncogene in Drosophila
melanogaster are haploinsufficient (Jorgensen et al. 2002; Barna et al.
2008; Sudbery et al. 1980). Here, we exploited gene haploinsufficiency to
identify genes and biological process that influence size control in C.
albicans. Given the importance of C. albicans as an emerging eukaryotic
model, very little is known regarding the genetic networks that control size
homeostasis in this opportunistic yeast. A systematic screen using
elutriation-based size fractioning (Cook et al. 2008) coupled to barcode
sequencing (Bar-seq) identified 685 genes (10% of the genome) that
influenced size control under optimal growth conditions. While C. albicans
and S. cerevisiae share the morphological trait of budding, and core cell
cycle and growth regulatory mechanisms (Berman 2006; Cote et al. 2009),
a limited overlap was obtained when comparing the size phenome of both
yeasts. This genome-wide survey will serve as a primary entry point into
the global cellular network that couples cell growth and division in C.
albicans.
![Page 65: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/65.jpg)
45
1.2.3 - Materials and methods
Strains and growth conditions
C. albicans SC5314 and CAI4 (ura3::imm434/ura3::imm434
iro1/iro1::imm434) (Fonzi and Irwin 1993) wild-type (WT) strains, and
mutants of the Merck DBC (Double BarCoded) heterozygous diploid
collection (Xu et al. 2007) were routinely maintained at 30° on YPD (1%
yeast extract, 2% peptone, 2% dextrose, and 50 mg/ml uridine) or
synthetic complete (0.67% yeast nitrogen base with ammonium sulfate,
2.0% glucose, and 0.079% complete supplement mixture) media. The
Merck DBC collection is available for public distribution through the NRC’s
Royalmount Avenue Research Facility (Montreal, Canada).
Combination of C. albicans mutants into a single pool
A sterilized 384-well pin tool was used to transfer DBC mutant cells into
Nunc Omni Trays containing YPD-agar, and colonies were grown for 48 hr
at 30°. Missing or slow growing colonies were grown separately by
repinning 3.5 µl from the initial liquid cultures. Each plate was overlaid
with 5 ml of YPD, and cells were resuspended using Lazy-L spreader and
harvested by centrifugation for 5 min at 1800 × g. The obtained cell pellet
was resuspended in 20 ml fresh YPD and DMSO was added to 7% (v/v).
Mutant pools were aliquoted and stored at −80°.
Cell size selection by centrifugal elutriation
The mutant pool was size-fractioned using centrifugal elutriation with the
Beckman JE-5.0 elutriation system. This technique separates cells on the
basis of size. A tube of pooled mutant population was thawed on ice and
used to inoculate 2 L of YPD at an OD595 of 0.05. Mutant cells were grown
![Page 66: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/66.jpg)
46
for four generations at 30°C under agitation to reach ∼5 × 1010 cells. Cells
were then pelleted by centrifugation and resuspended in 50 ml fresh YPD.
To disrupt potential cell clumps and separate weakly attached mother and
daughter cells, the 50 mL pooled cells were gently sonicated twice for 30
sec. The resuspended cells were directly loaded into the elutriator chamber
of the Beckman JE-5.0 elutriation rotor. A 1 mL sample of cells was
retained separately as a pre-elutriated cell fraction. The flow rate of the
pump was set to 8 mL/min to ensure the loading of cells. To elute small
cell size mutant fractions, the pump flow rate was increased in a step-wise
fashion (in 2–4 mL/min increments). For each flow rate, a volume of 250
mL was collected from the output line of the rotor.
Bar-seq
Bar-seq was performed using Illumina HiSeq2500 platform. Genomic DNA
was extracted from each cell fraction using YeaStar kit (Zymo Research).
The 20-bp UpTag barcode of each strain were amplified by PCR (Xu et al.
2007). Primers used for PCR recognize the common region of each barcode
and contain the multiplexing tag and sequences required for hybridization
to the Illumina flow cell. PCR products were purified from an agarose gel
using the QIAquick Gel Extraction kit (Qiagen) and quantified by
QuantiFluor dsDNA System (Promega). Bar-seq data were processed as
following: after filtering out low frequency barcode counts, the complete set
of replicate barcode reads were normalized using a cyclic loess algorithm
(R package “limma”). Reads from individual elutriation fractions, relative to
the pre-elutriation population, were further M-A loess normalized and
converted to Z scores.
Confirmation of cell size phenotypes
![Page 67: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/67.jpg)
47
Cell size determination was performed using a Z2-Coulter Counter
channelizer (Beckman Coulter). The Coulter principal is based on electrical
impedance measurement, which is proportional to cell volume (Coulter
1953). C. albicans cells were grown overnight in YPD at 30°, diluted 1000-
fold into fresh YPD and grown for 5 hr at 30° to reach a final density of 5 ×
106–107 cells/ml, a range in which size distributions of the different WT
strain used in this study do not change. A total of 100 µl of exponentially
growing cells was diluted in 10 ml of Isoton II electrolyte solution,
sonicated three times for 10 sec and the distribution measured at least
three times on a Z2-Coulter Counter. Size distribution data were
normalized to cell counts in each of 256 size bins and size reported as the
peak median value for the distribution. Data analysis and size distribution
visualization were performed using the Z2-Coulter Counter AccuComp
software.
Determination of critical cell size
Critical sizes of cln3/CLN3, cdc28/CDC28 and sch9/SCH9 mutants were
determined using budding index as a function of size. G1 daughter cells
were obtained using the JE-5.0 centrifugal elutriation system (Beckman
Coulter) as described previously (Tyers et al. 1993). C. albicans G1-cells
were released in fresh YPD medium and fractions were harvested at an
interval of 10 min to monitor bud index. Additional fractions were collected
to assess transcript levels of the RNR1 and ACT1 as cells progressed along
the G1 phase.
Real-time quantitative PCR
A total of 108 G1 phase cells were harvested, released into fresh YPD
medium, grown for 10 min prior to harvesting by centrifugation and stored
at −80°. Total RNA was extracted using the RNAeasy purification kit
![Page 68: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/68.jpg)
48
(Qiagen) and glass bead lysis in a Biospec Mini 24 bead-beater, as
previously described (Sellam et al. 2009). cDNA was synthesized from 2 µg
of total RNA using the SuperScript III Reverse Transcription system [50
mm Tris-HCl, 75 mm KCl, 10 mm dithiothreitol, 3 mm MgCl2, 400 nm
oligo(dT)15, 1 m random octamers, 0.5 mm dNTPs, and 200 U Superscript
III reverse transcriptase]. The total volume was adjusted to 20 µl, and the
mixture was then incubated for 60 min at 42°. Aliquots of the resulting
first-strand cDNA were used for real-time quantitative PCR (qPCR)
amplification experiments. qPCR was performed using the iQ 96-well PCR
system for 40 amplification cycles and QuantiTect SYBR Green PCR
master mix (Qiagen). Transcript levels of RNR1 were estimated using the
comparative Ct method, as described by Guillemette et al. (2004), and the
C. albicans ACT1 open reading frame as a reference. The primer sequences
were as follows: RNR1-forward: 5′-GACTATCTACCATGCTGCTGTTG-3′;
RNR1-reverse: 5′-GGTGCAACCAACAAGGAGTT-3′; ACT1-forward: 5′-
GAAGCCCAATCCAAAAGA-3′; and ACT1-reverse: 5′-
CTTCTGGAGCAACTCTCAATTC-3′.
Gene ontology analysis
Gene ontology (GO) term enrichment of size mutants was determined using
the Generic GO Term Finder tool (http://go.princeton.edu/cgi-
bin/GOTermFinder), with multiple hypothesis correction (Boyle et al.
2004). Descriptions related to gene function in Supplemental Material,
Table S2 were extracted from the Candida Genome Database (CGD)
database (Inglis et al. 2012). Information related to gene
essentiality/dispensability was taken from O’Meara et al. (2015) and the
CGD database.
Data availability
![Page 69: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/69.jpg)
49
The authors state that all data necessary for confirming the conclusions
presented in the article are represented fully within the article.
![Page 70: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/70.jpg)
50
1.2.4 - Results and discussion
The Cln3-Cdc28 kinase complex and Sch9 are haploinsufficient for
cell size
In S. cerevisiae, a number of critical Start regulators are haploinsufficient
for cell size, including the rate-limiting G1 cyclin Cln3 and a number of
essential ribosome biogenesis factors, such as the AGC kinase Sch9
(Sudbery et al. 1980; Jorgensen et al. 2002). To test whether size
haploinsufficiency exists in C. albicans homologs, size distributions of the
heterozygous mutants of AGC kinase Sch9, the cyclin Cln3 G1, and its
associated cyclin-dependent kinase Cdc28 were examined. Both
cln3/CLN3 and cdc28/CDC28 showed an increase of size as compared to
their congenic parental strain, with median sizes 13% (59 fl) and 19% (62
fl) larger than the WT strain (52 fl), respectively (Figure 1A). As in S.
cerevisiae, sch9/SCH9 exhibited a reduced size of ∼23% (40 fl) as
compared to WT.
Two hallmarks of Start, namely SBF-dependent transcription and bud
emergence, were delayed in both cln3/CLN3 and cdc28/CDC28 and
accelerated in sch9/SCH9, demonstrating that the Cln3-Cdc28 complex
and Sch9 regulate the cell size threshold at Start. The cln3/CLN3 mutant
passed Start after growing to 92 fl, 24% higher than the parental WT cells,
which budded at 74 fl (Figure 1B). Similarly, cdc28/CDC28 reached Start
at 105 fl, which is 41% higher than WT. The onset of G1/S transcription
was delayed in both mutants, as judged by the expression peak of the G1-
transcript RNR1 (Figure 1C). The small mutant sch9/SCH9 passed Start
at 30 fl, a size 60% smaller than the WT, and displayed accelerated G1/S
transcription (Figure 1, B and C). These data demonstrate that, as in S.
cerevisiae, size haploinsufficiency in C. albicans can be used to screen for
dosage-dependent regulators of growth and division at Start.
![Page 71: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/71.jpg)
51
A high-throughput screen for cell size haploinsufficiency
To identify all dosage-sensitive regulators of size in C. albicans, a genome-
wide screen was performed where pooled mutants were separated based on
their size by centrifugal elutriation and their abundance determined by
Bar-seq. This method has been previously validated in S. cerevisiae (Cook
et al. 2008), yielding a high degree of overlap when compared to a strain-
by-strain analyses (Jorgensen et al. 2002) (Figure 2A). In the current
study, we screened a comprehensive set of 5470 heterozygous deletion
diploid strains from the Merck DBC collection (Xu et al. 2007) for cell size
defects. This collection covers 90% of the 6046 protein-coding open
reading frames based on the current CGD annotation (Binkley et al. 2014).
Two small cell size fractions were obtained by centrifugal elutriation and
were used for these experiments (Figure 2B). Small cells and
corresponding small deletion mutants are enriched in these fractions,
while large cells strains are depleted. To determine mutant abundance in
each fraction, genomic DNA of each pool was extracted and barcodes were
PCR-amplified and sequenced. Abundance of each mutant in each fraction
was appreciated by calculating the ratio of elutriated cells counts over
counts of pre-elutriated cells.
To identify mutants with size defects, a two-step filter was applied. First, a
size cut-off value was determined based on a benchmark set of conserved
small (sch9/SCH9) and large (cln3/CLN3 and cdc28/CDC28) size mutants
for which size was reduced or increased at least 12% as compared to the
parental WT strain. Second, a normalized Z-score of 1.5 and −1.5 was used
to identify both small (whi) and large (lge) size mutants, respectively. A
total of 12 size mutants were excluded from our analysis, since they were
found in both whi and lge datasets (Table S1). Microscopic examination
revealed that these mutants had a remarkable size heterogeneity and grew
predominantly as pseudohyphae. Based on these criteria, we identified 685
mutants that exhibited a size defect in both elutriated fractions. This
![Page 72: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/72.jpg)
52
includes 382 whi and 303 lge mutants (Table S2). As expected, cln3/CLN3
and cdc28/CDC28 mutants were identified as lge mutants, while
sch9/SCH9 was found among the smallest mutant in the elutriated pools.
A total of 15 whi and 15 lge mutants were randomly selected and their size
was measured by electrolyte displacement on a Coulter Z2 channelizer.
The obtained data confirmed size defect in all 30 mutants examined (Table
S3). Size phenotype of two heterozygous mutants, including the
rac1/RAC1 (Bassilana and Arkowitz 2006) and sec15/SEC15 (Guo et al.
2016) previously shown as lge mutants, were confirmed by our analysis.
However, the protein kinase C pkc1/PKC1 mutant exhibited a whi
phenotype in our investigation, while it was previously identified as large
size (Paravicini et al. 1996). To clear up this contradiction, we have created
new pkc1/PKC1 mutants. At least five independent transformants were
sized and the whi phenotype was confirmed for all of them (data not
shown).
Synthesis of ribosome and cell cycle are required for cell size
homeostasis
GO enrichment analysis revealed that mutation in genes related to rRNA
processing and ribosome biogenesis confer small cell size, while mutations
of cell cycle genes result in lge phenotype (Figure 2, C and D and Table
S2). Heterozygous deletion of genes of different functional categories
related to protein translation, including rRNA processing (CSL4, UTP7,
DIS3, NOP53, FCF2, UTP23, DIP2, UTP15, SAS10), ribosome exports (RIX7,
RRS1, NUP84, NUP42, RPS5, NOG1), translation elongation (RIA1, EFT2,
CEF3), and transcription of RNA Pol I and III promoters (CDC73, RPB8,
RPA49, RPB10, SPT5, RPA12, RPC25), exhibited a whi phenotype.
Heterozygous deletion mutation of structural components of both
cytoplasmic (RPL18, RPL20B, RPL21A, RPS5, UBI3) and mitochondrial
(RSM24, RSM26, NAM9, MRPL20) ribosomes decreased cell size. As in S.
![Page 73: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/73.jpg)
53
cerevisiae, mutants of the ribosome biogenesis regulator Sch9 and the
transcription factor Sfp1 had a small size. Overall, as shown in other
eukaryotic organisms, these data lead to the hypothesis that the rate of
ribosome biogenesis or translation is a critical element underlying cell size
control (Jorgensen et al. 2004). Haploinsufficient whi mutants also
corresponded to catabolic processes associated mainly with ubiquitin-
dependent proteolysis (DOA1, GRR1, UBP1, UBP2, UFD2, SSH4, UBX7,
RPN2, TIP120, TUL1, RPT2, PRE1, GID7).
Lge mutants were predominantly defective in functions related to the
mitotic cell cycle (Figure 2D and Table S2). These mutants include genes
required for G1/S transition (G1 cyclin Cln3 and Ccn1, Cdc28 and Met30)
suggesting that delay in G1 phase is the primary cause of their increased
size. We also found that mutations in processes related to DNA replication
(ORC3, ORC4, MCM3, CDC54, RFC3, PIF1, SMC4, ELG1), G2/M transitions
(HSL1, CDC34) and cytoskeleton-dependent cytokinesis (MYO5, INN1,
SEC15, CDC5, CHS1) conferred an increase of cell size. A similar
observation was reported in S. cerevisiae, where a recent genome-wide
microscopic quantitative size survey uncovered that mutants of the G2/M
transition and mitotic exit fail to properly control their size. The large size
of cell cycle mutants support the fact that cell growth and cell cycle are
separate processes and cells continue to grow and increase their size
without commitment to divide. Other investigations propose a model
where, in addition to the G1-phase, size is sensed and controlled at G2/M
checkpoint (Anastasia et al. 2012; King et al. 2013; Harvey and Kellogg
2003; Soifer and Barkai 2014). However, further analysis will be necessary
to provide further insights into the presumptive linkage of each phase of
the cell cycle and size homeostasis in C. albicans.
While a large proportion of whi mutants in C. albicans were related to
ribosome biogenesis, inactivation of genes controlling translation initiation
![Page 74: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/74.jpg)
54
(ASC1, SCD6, PAB1, GCD6, GCD2, SUI1, EIF4E, GCD11) resulted in lge
phenotype. A similar finding was reported in different genome-scale
surveys of size phenome in S. cerevisiae (Jorgensen et al. 2002; Soifer and
Barkai 2014). This large size phenotype in these mutants could be
explained by the fact that regulators of Start onset, such as G1 cyclin Cln3
(Barbet et al. 1996; Polymenis and Schmidt 1997), are sensitive to the rate
of translation initiation.
Plasticity of size phenome and C. albicans fitness
Recent evidence has uncovered an extensive degree of rewiring of both cis-
transcriptional regulatory circuits and signaling pathways across many
cellular and metabolic processes between the two budding yeasts, C.
albicans and S. cerevisiae (Lavoie et al. 2010; Li and Johnson 2010;
Blankenship et al. 2010; Lavoie et al. 2009; Sellam and Whiteway 2016).
In S. cerevisiae, a similar size haploinsufficiency screen was performed in
heterozygous diploid strains of essential genes (Jorgensen et al. 2002). To
assess the extent of conservation and plasticity of the size phenome, genes
that were haploinsufficient for cell size in C. albicans were compared to
their corresponding orthologs in S. cerevisiae. This analysis revealed a
limited overlap between the two species with five whi (rpl18a, sch9, rlp24,
nop2, nog1) and two lge (rpt4, cln3) mutants in common. In fact, genes
with reciprocal size phenotypes were similar in frequency (the whi mutants
rpt2/RPT2 and pkc1\PKC1 in C. albicans had lge phenotype in S.
cerevisiae).
Interestingly, the corresponding homozygous deletion mutants of many C.
albicans haploinsufficient size genes were shown to be required for
virulence. A total of 69 size genes (representing ∼10%), including 47 small
and 22 large size mutants, in our dataset were linked to C. albicans
virulence or adaptation in the human host (Figure 2E). This suggests that
![Page 75: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/75.jpg)
55
cell size is an important virulence trait that can be targeted by antifungal
therapy. Hypothetically, virulence defect in small size mutant could be
linked to the reduced surface of the contact interface between C. albicans,
with either host cells or medical devices in case of biofilm infections.
Indeed, we have previously shown that the whi transcription factor mutant
ahr1 had attenuated virulence and exhibited a decreased attachment
ability to abiotic surface such polystyrene, which consequently impaired
biofilm formation (Askew et al. 2011). On the other hand, virulence defect
in lge mutant could be associated with the fact that cells with large
surfaces had a decreased lifespan which might impact their fitness and
their viability inside the host (Yang et al. 2011; Mortimer and Johnston
1959).
While the link between C. albicans size and virulence remains
uncharacterized, many investigations reported that many other fungal
pathogens such as Cryptococcus neoformans and Mucor circinelloides
adjust their cell size to access to specific niche in the host or to escape
from immune cells (Wang and Lin 2012). In C. albicans, recent
investigations have shown that large gastrointestinally induced transition
cells, as compared to the standard yeast form, define the commensal form
of this fungus (Pande et al. 2013). Furthermore, Tao et al. (2014) recently
uncovered a novel intermediate phase between the White and C. albicans
mating competent opaque phenotypes, called the Gray phenotype. The
Gray cells are similar to opaque cells in general shape, however, they
exhibit a small size and low mating efficiency. The Gray cell type has
unique virulence characteristics, with a high ability to cause cutaneous
infections and a reduced capacity in colonizing internal organs such as
kidney, lung, and brain. Taken together, these lines of evidence emphasize
the possible link between cell size and C. albicans fitness.
![Page 76: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/76.jpg)
56
In summary, we provided the first comprehensive genome-wide survey of
haploinsufficient cell size in a eukaryotic organism. In contrast to S.
cerevisiae, where a similar screen was limited to essential genes
(Jorgensen et al. 2002), our screen spanned the genome. A total of 300
(43.8%) dispensable genes and only 87 (12.7%) essential genes were
haploinsufficient for size. Overall, our screen identified known conserved
regulators (Sch9, Sfp1, Cln3) and biological processes (ribosome biogenesis
and cell cycle control) required to maintain size homeostasis in this
opportunistic yeast. We also identified novel C. albicans size-specific genes
and provided a conceptual framework for future mechanistic studies.
Interestingly, some of the size genes identified were required for fungal
pathogenicity, suggesting that cell size homeostasis may be elemental to C.
albicans fitness or virulence inside the host.
1.2.5 - Acknowledgments
We thank Lynda Robitaille for technical assistance and National Research
Council (NRC) Canada for providing the Merck DBC mutants used in this
work. Work in A.S.’s laboratory is supported by Fonds de Recherche du
Québec-Santé (FRQS) (Établissement de jeunes chercheurs) and the
Natural Sciences and Engineering Research Council of Canada discovery
grant (no. 06625). A.S. is a recipient of the FRQS J1 salary award. Julien
Chaillot was supported by Université Laval Faculty of Medicine and Centre
Hospitalier Universitaire de Québec (CHUQ) foundation Ph.D.
scholarships.
![Page 77: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/77.jpg)
57
1.2.6 - References
Anastasia S. D., Nguyen D. L., Thai V., Meloy M., MacDonough T., et al. ,
2012. A link between mitotic entry and membrane growth suggests a novel model for cell size control. J. Cell Biol. 197(1): 89–104.
Askew C., Sellam A., Epp E., Mallick J., Hogues H., et al. , 2011. The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion. Mol. Microbiol. 79: 940–953.
Barbet N. C., Schneider U., Helliwell S. B., Stansfield I., Tuite M. F., et al. ,
1996. TOR controls translation initiation and early G1 progression in yeast. Mol. Biol. Cell 7(1): 25–42.
Barna M., Pusic A., Zollo O., Costa M., Kondrashov N., et al. , 2008. Suppression of Myc oncogenic activity by ribosomal protein
haploinsufficiency. Nature 456(7224): 971–975.
Bassilana M., Arkowitz R. A., 2006. Rac1 and Cdc42 have different roles in Candida albicans development. Eukaryot. Cell 5(2): 321–329.
Berman J., 2006. Morphogenesis and cell cycle progression in Candida albicans. Curr. Opin. Microbiol. 9(6): 595–601.
Berman J., Sudbery P. E., 2002. Candida albicans: a molecular revolution built on lessons from budding yeast. Nat. Rev. Genet. 3(12):
918–930. Binkley J., Arnaud M. B., Inglis D. O., Skrzypek M. S., Shah P., et al. ,
2014. The Candida genome database: the new homology information page highlights protein similarity and phylogeny. Nucleic Acids Res.
42(Database issue): D711–D716. Blankenship J. R., Fanning S., Hamaker J. J., Mitchell A. P., 2010. An
extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog. 6(2): e1000752.
Boyle E. I., Weng S., Gollub J., Jin H., Botstein D., et al. , 2004. GO: termfinder–open source software for accessing gene ontology information
and finding significantly enriched gene ontology terms associated with a list of genes. Bioinformatics 20(18): 3710–3715.
![Page 78: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/78.jpg)
58
Cook M. A., Chan C. K., Jorgensen P., Ketela T., So D., et al. , 2008. Systematic validation and atomic force microscopy of non-covalent short
oligonucleotide barcode microarrays. PLoS One 3(2): e1546. Cote P., Hogues H., Whiteway M., 2009. Transcriptional analysis of the
Candida albicans cell cycle. Mol. Biol. Cell 20(14): 3363–3373.
Coulter, H., 1953 Means for Counting Particles Suspended in a Fluid. United States Patent No. 2656508.
Fonzi W. A., Irwin M. Y., 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134(3): 717–728.
Guillemette T., Sellam A., Simoneau P., 2004. Analysis of a nonribosomal peptide synthetase gene from Alternaria brassicae and
flanking genomic sequences. Curr. Genet. 45(4): 214–224. Guo P. P., Yong J. Y., Wang Y. M., Li C. R., 2016. Sec15 links bud site
selection to polarised cell growth and exocytosis in Candida albicans. Sci. Rep. 6: 26464.
Harvey S. L., Kellogg D. R., 2003. Conservation of mechanisms controlling entry into mitosis: budding yeast wee1 delays entry into mitosis
and is required for cell size control. Curr. Biol. 13(4): 264–275. Homann O. R., Dea J., Noble S. M., Johnson A. D., 2009. A phenotypic
profile of the Candida albicans regulatory network. PLoS Genet. 5(12): e1000783.
Inglis D. O., Arnaud M. B., Binkley J., Shah P., Skrzypek M. S., et al. , 2012. The Candida genome database incorporates multiple Candida
species: multispecies search and analysis tools with curated gene and protein information for Candida albicans and Candida glabrata. Nucleic Acids Res. 40(Database issue): D667–D674.
Jorgensen P., Tyers M., 2004. How cells coordinate growth and division.
Curr. Biol. 14(23): R1014–R1027. Jorgensen P., Nishikawa J. L., Breitkreutz B. J., Tyers M., 2002.
Systematic identification of pathways that couple cell growth and division in yeast. Science 297(5580): 395–400.
Jorgensen P., Rupes I., Sharom J. R., Schneper L., Broach J. R., et al. , 2004. A dynamic transcriptional network communicates growth
potential to ribosome synthesis and critical cell size. Genes Dev. 18(20): 2491–2505.
![Page 79: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/79.jpg)
59
King K., Kang H., Jin M., Lew D. J., 2013. Feedback control of Swe1p
degradation in the yeast morphogenesis checkpoint. Mol. Biol. Cell 24(7): 914–922.
Lavoie H., Hogues H., Whiteway M., 2009. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi. Curr.
Opin. Microbiol. 12(6): 655–663. Lavoie H., Hogues H., Mallick J., Sellam A., Nantel A., et al. , 2010.
Evolutionary tinkering with conserved components of a transcriptional regulatory network. PLoS Biol. 8(3): e1000329.
Li H., Johnson A. D., 2010. Evolution of transcription networks–lessons from yeasts. Curr. Biol. 20(17): R746–R753.
Mortimer R. K., Johnston J. R., 1959. Life span of individual yeast cells. Nature 183(4677): 1751–1752.
O’Meara T. R., Veri A. O., Ketela T., Jiang B., Roemer T., et al. , 2015. Global analysis of fungal morphology exposes mechanisms of host cell
escape. Nat. Commun. 6: 6741.
Pande K., Chen C., Noble S. M., 2013. Passage through the mammalian gut triggers a phenotypic switch that promotes Candida albicans commensalism. Nat. Genet. 45(9): 1088–1091.
Paravicini G., Mendoza A., Antonsson B., Cooper M., Losberger C., et al. ,
1996. The Candida albicans PKC1 gene encodes a protein kinase C homolog necessary for cellular integrity but not dimorphism. Yeast 12(8): 741–756.
Polymenis M., Schmidt E. V., 1997. Coupling of cell division to cell growth by translational control of the G1 cyclin CLN3 in yeast. Genes Dev.
11(19): 2522–2531.
Sandai D., Yin Z., Selway L., Stead D., Walker J., et al. , 2012. The evolutionary rewiring of ubiquitination targets has reprogrammed the regulation of carbon assimilation in the pathogenic yeast Candida
albicans. MBio 3(6): e00495-12.
Sellam A., Whiteway M., 2016. Recent advances on Candida albicans biology and virulence. F1000 Res. 5: 2582.
![Page 80: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/80.jpg)
60
Sellam A., Tebbji F., Nantel A., 2009. Role of Ndt80p in sterol metabolism regulation and azole resistance in Candida albicans. Eukaryot.
Cell 8(8): 1174–1183. Soifer I., Barkai N., 2014. Systematic identification of cell size regulators
in budding yeast. Mol. Syst. Biol. 10: 761.
Sudbery P. E., Goodey A. R., Carter B. L., 1980. Genes which control cell proliferation in the yeast Saccharomyces cerevisiae. Nature 288(5789): 401–404.
Tao L., Du H., Guan G., Dai Y., Nobile C. J., et al. , 2014. Discovery of a “white-gray-opaque” tristable phenotypic switching system in Candida
albicans: roles of non-genetic diversity in host adaptation. PLoS Biol. 12(4): e1001830.
Turner J. J., Ewald J. C., Skotheim J. M., 2012. Cell size control in yeast. Curr. Biol. 22(9): R350–R359.
Tyers M., Tokiwa G., Futcher B., 1993. Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator
of Cln1, Cln2 and other cyclins. EMBO J. 12(5): 1955–1968.
Wang L., Lin X., 2012. Morphogenesis in fungal pathogenicity: shape, size, and surface. PLoS Pathog. 8(12): e1003027.
Xu D., Jiang B., Ketela T., Lemieux S., Veillette K., et al. , 2007. Genome-wide fitness test and mechanism-of-action studies of inhibitory
compounds in Candida albicans. PLoS Pathog. 3(6): e92. Yang J., Dungrawala H., Hua H., Manukyan A., Abraham L., et al. , 2011.
Cell size and growth rate are major determinants of replicative lifespan. Cell Cycle 10(1): 144–155.
Zhang J., Schneider C., Ottmers L., Rodriguez R., Day A., et al. , 2002. Genomic scale mutant hunt identifies cell size homeostasis genes in S. cerevisiae. Curr. Biol. 12(23): 1992–2001.
![Page 81: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/81.jpg)
61
1.2.7 - Figures
Figure 1 - The Cln3-Cdc28 kinase complex and the AGC kinase Sch9
control Start in C. albicans. (A) Size distributions of the WT strain (CAI4)
as compared to lge mutants cln3/CLN3 and cdc28/CDC28, as well as the
whi mutant sch9/SCH9. (B and C) Start is delayed in cln3/CLN3 and
cdc28/CDC28 and accelerated in sch9/SCH9. (B) Elutriated G1 phase
daughter cells were released into fresh media and monitored for bud
emergence as a function of size. (C) G1/S transcription. RNR1 transcript
level was assessed by quantitative real-time PCR and normalized to ACT1
levels.
![Page 82: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/82.jpg)
62
Figure 2 – Systematic cell size screen using molecular barcode elutriation
and Bar-seq. (A) Centrifugal elutriation separates cells on the basis of size.
Progressive increase of the rate of flow of liquid medium counter to the
direction of centrifugal force elutes yeast cells of increasingly larger size
from the chamber. (B) Size distributions of pooled DBC mutants before
(pre-elutriated) and after elutriation of two small cell fractions (28 and 34
ml/min). (C and D) GO terms enrichment of whi (C) and lge (D) mutants (P
> 1e−05). GO analysis was performed using GOTermFinder
(http://go.princeton.edu/cgi-bin/GOTermFinder). (E) Overlap between C.
albicans genes haploinsufficient for cell size and those affecting virulence
phenotypes. Avirulent mutant phenotypes were obtained from CGD based
on decreased competitive fitness in mice and/or reduced invasion and
damage to host cells.
![Page 83: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/83.jpg)
63
Chapitre 2 - The p38/HOG stress-activated protein
kinase network couples growth to division in
Candida albicans.
2.1 - Résumé
La régulation de la taille cellulaire est un processus complexe qui répond
aux signaux environnementaux. L'analyse de la taille chez la levure
pathogène C. albicans a permis de mettre en évidence 66 gènes qui
modifient considérablement la taille cellulaire. Peu de gènes nécessaires
pour la régulation de la taille chez C. albicans sont conservés chez S.
cerevisiae. Un nouveau régulateur de la taille de C. albicans est la voie
MAPK p38/HOG, une voie conservée qui contrôle la réponse au stress
osmotique. L'activité basale de Hog1 inhibe le complexe de facteurs de
transcriptions SBF d'une manière indépendante du stress pour retarder la
transition G1/S. La voie HOG régule également la biogenèse des ribosomes
par l'intermédiaire du régulateur transcriptionnel Sfp1. Hog1 se lie aux
promoteurs des régulateurs de la biogénèse des ribosomes ainsi qu’à des
régulateurs de la transition G1/S, liant ainsi la croissance et la division
cellulaire. Cette étude a mis en évidence la plasticité évolutive du contrôle
de la taille et a identifié le module HOG comme carrefour de signalisation
coordonnant la croissance et la division.
![Page 84: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/84.jpg)
64
2.2 - Article
The p38/HOG stress-activated protein kinase network couples growth
to division in Candida albicans.
Adnane Sellam1,2*, Julien Chaillot1, Jaideep Mallick3, Faiza Tebbji1, Julien
Richard Albert4, Michael A. Cook5, Mike Tyers3,5*
1 Infectious Diseases Research Centre (CRI), CHU de Québec Research Center (CHUQ),
Université Laval, Quebec City, QC, Canada
2 Department of Microbiology, Infectious Disease and Immunology, Faculty of
Medicine, Université Laval, Quebec City, QC, Canada
3 Institute for Research in Immunology and Cancer (IRIC), Department of
Medicine, Université de Montréal, Montréal, Québec, Canada
4 Department of Medical Genetics, University of British Columbia, Vancouver,
British Columbia, Canada
5 Centre for Systems Biology, Samuel Lunenfeld Research Institute, Mount Sinai
Hospital, Toronto, Canada M5G 1X5
* Correspondence: [email protected] and
![Page 85: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/85.jpg)
65
2.2.1 - Abstract
Cell size is a complex trait that responds to developmental and
environmental cues. Quantitative size analysis of mutant strain collections
disrupted for protein kinases and transcriptional regulators in the
pathogenic yeast Candida albicans uncovered 66 genes that altered cell
size, few of which overlapped with known size genes in the budding yeast
Saccharomyces cerevisiae. A potent size regulator specific to C. albicans
was the conserved p38/HOG MAPK module that mediates the osmostress
response. Basal HOG activity inhibited the SBF G1/S transcription factor
complex in a stress-independent fashion to delay the G1/S transition. The
HOG network also governed ribosome biogenesis through the master
transcriptional regulator Sfp1. Hog1 bound to the promoters and cognate
transcription factors for ribosome biogenesis regulons and interacted
genetically with the SBF G1/S machinery, and thereby directly linked cell
growth and division. These results illuminate the evolutionary plasticity of
size control and identify the HOG module as a nexus of cell cycle and
growth regulation.
![Page 86: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/86.jpg)
66
2.2.2 - Introduction
A central and longstanding problem in cell biology is how cells maintain a
uniform cell size, whether in single-celled organisms or in the multitude of
tissues of metazoans [1, 2]. In most eukaryotes, attainment of a critical cell
size is necessary for commitment to cell division in late G1 phase, called
Start in yeast and the Restriction Point in metazoans. This critical cell size
threshold coordinates cell growth with cell division to establish a
homeostatic cell size [1]. The dynamic control of cell size facilitates
adaptation to changing environmental conditions in microorganisms and
therefore is essential to maximize fitness [3, 4]. In the budding yeast
Saccharomyces cerevisiae, the size threshold is dynamically modulated by
nutrients. Pre-Start G1 phase cells grown in the optimal carbon source
glucose pass Start at a smaller size if shifted to glycerol, whereas cells
shifted from a poor to rich nutrient source pass Start at a larger size [1, 5].
Nutrient conditions similarly dictate cell size in the fission yeast
Schizosaccharomyces pombe, although control is primarily exerted at the
G2/M transition [5]. In metazoans, cell size control is important for tissue,
organ and organism size [6], and is dynamically regulated through changes
in growth rate and cell cycle length [7]. Cell size is often perturbed in
human disease, for example in diabetes, tuberous sclerosis, mitochondrial
disorders, aneuploid syndromes, cancer, and aging [1, 8]. Notably, a loss of
cell size homeostasis, termed pleomorphism, correlates with poor cancer
prognosis [9].
Cell size is fundamentally dictated by the balance between cell growth and
division. The analysis of small-sized mutants in yeast led to key insights
into the cell division machinery [10–14]. In all eukaryotes, cell division is
controlled by the cyclin dependent kinases (CDKs), which serve to
coordinate the replication and segregation of the genome [15]. In S.
cerevisiae, the G1 cyclins Cln1, Cln2 and Cln3 trigger Start, whereas the
![Page 87: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/87.jpg)
67
B-type cyclins Clb1-Clb6 catalyze replication and mitosis, all via activation
of the same Cdc28 kinase catalytic subunit. The expression of ~200 genes
at the end of G1 phase, most vitally CLN1/2, is controlled by transcription
factor complexes composed of Swi4 and Swi6 (SBF), and Mbp1 and Swi6
(MBF). Activation of SBF/MBF depends primarily on the Cln3-Cdc28
kinase, the key target of which is Whi5, an inhibitor of SBF/MBF-
dependent transcription [16, 17]. Another transcriptional inhibitor called
Nrm1 specifically inhibits MBF after Start but does not cause a marked
size phenotype under conditions of nutrient sufficiency [17]. Size control in
S. pombe is exerted through inhibition of G2/M phase CDK activity by the
Wee1 kinase, which is encoded by the first size control gene discovered
[10, 12]. Size is also partially regulated at Start in S. pombe through an
SBF/MBF- like G1/S transcription factor complex and the Nrm1 inhibitor
[18]. The CDK-dependent control of G1/S transcription in metazoans is
analogously mediated by the cyclin D-Rb-E2F axis [16, 19, 20].
Cell growth depends on the coordinated synthesis of protein, RNA, DNA
and other macromolecules [1, 21, 22]. The production of ribosomes
consumes a large fraction of cellular resources and depends on an
elaborate ribosome biogenesis machinery [1] that is controlled in part by
the conserved TOR (Target Of Rapamycin) nutrient sensing network [6]. In
budding yeast, the deletion of ribosome biogenesis (Ribi) factors causes a
small cell size, and loss of two master regulators of Ribi gene expression,
the transcription factor Sfp1 and the AGC kinase Sch9, causes cell to
become extremely small [23]. These observations lead to the hypothesis
that the rate of ribosome biogenesis is one metric that dictates cell size
[24]. Sfp1 and Sch9 are critical effectors of the TOR pathway and form part
of a dynamic, nutrient-responsive network that controls the expression of
Ribi and ribosomal protein (RP) genes [24]. Sfp1 activity is controlled
through its TOR-dependent nuclear localization [23–26] and is physically
linked to the secretory system by its interaction with the Rab escort factor
![Page 88: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/88.jpg)
68
Mrs6 [25, 27]. Sch9 is phosphorylated and activated by TOR, and in turn
inactivates a cohort of repressors of RP genes called Dot6, Tod6 and Stb3
[28]. The TOR network also controls size in S. pombe and metazoans [29].
Systematic genetic analyses in various species have uncovered hundreds
of genes that directly or indirectly affect cell size. Direct size analysis of all
strains in the S. cerevisiae gene deletion collection uncovered a number of
potent size regulators, including Whi5, Sfp1 and Sch9 [23, 30, 31], and
revealed inputs into size control from ribosome biogenesis, mitochondrial
function and the secretory system [24–27]. Subsequent analyses of many
of these size mutants at a single cell level have suggested that the critical
cell size at Start may depend on growth rate in G1 phase and/or on cell
size at birth [32, 33]. Visual screens of S. pombe haploid and heterozygous
deletion collections for size phenotypes also revealed dozens of novel size
regulators, many of which altered size in a genetically additive fashion [34,
35]. Many genes also influence size in metazoan species. A large-scale
RNAi screen in Drosophila melanogaster tissue culture cells revealed
hundreds of genes as candidate size regulators, including known cell cycle
regulatory proteins [36]. Despite overall conservation of the central
processes that control cell growth and division, functionally equivalent size
regulators are often not conserved at the sequence level. For example, the
G1/S transcriptional regulators SBF/MBF and Whi5 bear no similarly to
the metazoan counterparts E2F and Rb, respectively [1]. A number of TOR
effectors are also poorly conserved at the sequence level, including the
ribosome biogenesis transcription factors Sfp1 in yeast and Myc in
metazoans [1].
Candida albicans is a diploid ascomycete yeast that is a prevalent
commensal and opportunistic pathogen in humans. C. albicans is a
component of the normal human flora, colonizing primarily mucosal
surfaces, gastrointestinal and genitourinary tracts, and skin [37]. Although
![Page 89: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/89.jpg)
69
most C. albicans infections entail non-life-threatening colonization of
surface mucosal membranes, immunosuppressed patients can fall prey to
serious infections, such as oropharyngeal candidiasis in HIV patients and
newborns, and lethal systemic infections known as candidemia [38].
Interest in C. albicans is not limited to understanding its function as a
disease-causing organism, as it has an ecological niche that is obviously
distinct from the classic model ascomycete S. cerevisiae. In this regard, C.
albicans has served as an important evolutionary milepost with which to
assess conservation of biological mechanisms, and recent evidence
suggests a surprising extent of rewiring of central signalling and
transcriptional networks as compared to S. cerevisiae [39–43].
In this study, we performed a quantitative analysis of gene deletion
mutants from different collections of protein kinases and transcriptional
regulators in C. albicans. Our results revealed a noticeable degree of
divergence between genes that affect size in C. albicans versus S. cerevisiae
and uncovered previously undocumented regulatory circuits that govern
critical cell size at Start in C. albicans. In particular, we delineate a novel
stress-independent function of the p38/HOG MAPK network in coupling
cell growth to cell division. Our genetic and biochemical analysis suggests
that the HOG module directly interacts with central components of both
the cell growth and cell division machineries in C. albicans.
![Page 90: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/90.jpg)
70
2.2.3 - Results
Analysis of the cell size phenome in C. albicans
The diploid asexual lifestyle of C. albicans complicates loss-of-function
screens because both alleles must be inactivated to reveal a phenotype
unless gene function is haploinsufficient [44]. To identify genes required
for cell size homeostasis in C. albicans, we directly screened three
collections of homozygous diploid gene deletion strains that encompassed
202 transcriptional regulators [42, 45] and 77 protein kinases [41]. We
expected transcription factors and kinases to be enriched in cell size
regulatory genes based on previous studies in budding yeast and fission
yeast. We additionally examined selected homozygous deletion strains of C.
albicans orthologs of known size genes in S. cerevisiae (sch9, pop2, ccr4
and nrm1; note that lower case gene names are used to indicate a
homozygous mutant) that were not present in these deletion collections
(S1 Table). In total, 363 viable mutant strains (279 unique mutants) were
individually assessed for their size distribution under conditions of
exponential growth in rich medium. Clustering of size distributions across
the cumulative datasets revealed distinct subsets of both large and small
mutants, relative to the majority of mutants that exhibited size
distributions comparable to those of wild-type (wt) control strains (Fig 1A
and 1B). Mean, median and mode cell size were estimated for each mutant
strain, and mutants were classified as large or small on the basis of a
stringent cut-off of a 20% increase or decrease in median size as compared
to the parental strain background. This empirical cut-off value was
determined based on a benchmark set of conserved small (sch9, sfp1) and
large (swi4, pop2, ccr4) sized mutants for which median size was reduced
or increased at least 20% as compared to parental strains. Based on this
criterion, we identified 66 mutants that exhibited a size defect compared to
their parental strain, comprised of 32 small-sized mutants (which we refer
to as Whi phenotype, after the "Whiskey" designation used for the first
![Page 91: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/91.jpg)
71
known S. cerevisiae size mutants, [46]) and 34 large-sized mutants
(referred to as a Lge phenotype [22]) (S2 and S3 Tables).
Deletion mutants of the HOG MAPK pathway (hog1, pbs2) and the
morphogenesis checkpoint kinase (swe1) resulted in a small cell size
phenotype. Conversely, mutants defective in functions related to the G1/S
phase transition (swi4, ace2), filamentous growth and nitrogen utilization
(gat1, gzf3, dal81, rob1) caused a large cell size phenotype (S1B and S1C
Fig). As in S. cerevisiae, disruption of the central SBF (Swi4-Swi6) G1/S
transcription factor complex increased cell size, whereas mutation of the
ribosome biogenesis regulators Sch9 and Sfp1 reduced cell size, as did
inactivation of Cbf1, the major transcriptional regulator of ribosomal
protein genes in C. albicans and other ascomycetes [48, 49] (S2 Fig).
Interestingly, 21 of the 66 size mutants identified by our screen have been
shown previously to be required for pathogenesis (p-value = 1.07e-10; S1
Fig). This set of genes included those with functions in transcriptional
control of biofilm and invasive filamentation (cyr1, gcn5, ndt80, ace2,
zcf27) as well as known adhesion genes (ahr1, war1). This overlap
suggested that cell size homeostasis may contribute to C. albicans fitness
inside the host (Fig 1C and S6 Table).
Novel Start regulators in C. albicans
Previous work has shown that disruption of cell growth rate is often
accompanied by a small cell size phenotype, for example by mutations in
RP or Ribi genes [23, 50]. To identify bona fide negative Start regulators, as
opposed to mere growth rate-associated effects, doubling times were
determined for the 32 homozygous small size mutants identified in our
screens (S3 Table). Mutants that exhibited a greater than 10% increase in
doubling time as compared to the wt controls were removed from
subsequent consideration for this study. As expected, amongst the 21
![Page 92: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/92.jpg)
72
remaining candidates predicted to more directly couple growth to division
(Table 1), we recovered two known conserved repressors of Start, namely
Sfp1 and Sch9. Candidate Start regulators in C. albicans included many
conserved genes that do not affect size in S. cerevisiae, including
components of the HOG MAPK pathway (Hog1, Pbs2), genes linked to
respiration (Hap2, Hap43), invasive filamentous growth (Cph2), adhesion
(Ahr1, War1) and metabolism (Ino4, Mig2, Gis2). We also found that
inactivation of Nrm1 resulted in whi phenotype, consistent with its role as
a repressor of the G1/S transition [51]. Interestingly, loss of the
transcription factor Hmo1, a main element in the rewired ribosomal gene
regulons in C. albicans [49], caused a small size phenotype. An
unexpectedly potent size regulator that emerged from our screens was
Dot6, a Myb-like HTH transcription factor that binds to the PAC
(Polymerase A and C) motif [52]. The dot6 deletion was among the smallest
mutants identified in our screens. C. albicans Dot6 is the ortholog of two
redundant transcriptional repressors of rRNA and Ribi gene expression
called Dot6 and Tod6 in S. cerevisiae, which cause only a minor large size
phenotype when deleted together [28].
We demonstrated the effect of six C. albicans size regulators on the timing
of Start by assessing the correlation between size and bud emergence in a
synchronous early G1 phase population of cells obtained by centrifugal
elutriation. We used this assay to determine the effect of three potent novel
size control mutants that conferred a small size phenotype (ahr1, hog1,
hmo1) and, as a control, disruption of a conserved known regulator of
Start in S. cerevisiae (sfp1). We also characterized two large size mutants,
namely swi4 and a heterozygous deletion of CLN3, which is an essential
G1 cyclin in C. albicans [53]. The critical cell size of the four small sized
mutants ahr1, hog1, hmo1 and sfp1 was markedly reduced as compared to
the wt parental strain (Fig 1D), whereas Start was delayed in the
CLN3/cln3 and swi4 strains. These results demonstrate that the
transcription factors Ahr1 and Hmo1, and the MAPK Hog1 are novel bona
![Page 93: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/93.jpg)
73
fide repressors of Start in C. albicans, and suggested that aspects of the
Start machinery have diverged between C. albicans and S. cerevisiae.
Basal activity of the HOG MAPK pathway delays Start
We generated a new hog1 homozygous deletion mutant in C. albicans to
confirm the small size phenotype (Fig 2A). The hog1 mutant strain had a
median cell volume that was 20% smaller than its congenic parental
strain, at 44 and 55 fL respectively. To ascertain that this effect was
mediated at Start, we evaluated two hallmarks of Start, namely bud
emergence and the onset of SBF-dependent transcription as a function of
cell size in synchronous G1 phase cells obtained by elutriation. As
assessed by median size of cultures in which 25% of cells had a visible
bud, the hog1 mutant passed Start at 41 fL, whereas the parental wt
control culture passed Start at 55 fL (Fig 2B). Importantly, in the same
experiment, the onset of G1/S transcription was accelerated in the hog1
strain as judged by the peak in expression of the two representative G1
transcripts, RNR1 and PCL2 (Fig 2C and 2D). These results demonstrated
that the Hog1 protein kinase normally acts to delay the onset of Start.
We then tested whether other main elements of the HOG pathway, namely
the MAPKK Pbs2, the phosphorelay proteins Ssk1 and Ypd1, and the two-
component transducer Sln1, were also required for normal cell size
homeostasis (Fig 2E–2G). Disruption of the upstream negative regulators
(Ypd1 and Sln1) caused a large size whereas mutation of the core MAPK
module (Ssk1, Pbs2 and Hog1) caused a small size phenotype. As the
cultures for these experiments were grown in constant normo-osmotic
conditions, we inferred that the effect of the HOG module on cell size was
unrelated to its canonical role in the osmotic stress response. Consistent
with this interpretation, mutation of the known osmotic stress effectors of
the HOG pathway in C. albicans, namely the glycerol biosynthetic genes
GPD1, GPD2 and RHR2 [54, 55], did not cause a cell size defect (S3 Fig).
![Page 94: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/94.jpg)
74
To address whether basal activity of the HOG MAPK module might be
required for size control, we tested the effect of phosphorylation site
mutants known to block signal transmission. Mutation of the activating
phosphorylation sites on either Hog1 (Thr174 and Tyr176) or Pbs2 (Ser355
and Thr359) to non-phosphorylatable residues phenocopied the small size
of hog1 and pbs2 deletion mutants, respectively (Fig 2H). These results
demonstrated that a basal level of Hog1 and Pbs2 activity was required for
Start repression under non-stress conditions.
To examine the possible role of the HOG pathway in communicating
nutrient status to the Start machinery, the effects of different carbon
sources on cell size were assessed in hog1 and wt strains. Cell size was
reduced on poor carbon sources in the hog1 strain to the same extent as
the wt strain, suggesting that the HOG module was not required for carbon
source-mediated regulation of cell size (S4 Fig). These results demonstrate
that the HOG module relays a stress- and carbon source-independent
signal for size control to the Start machinery in C. albicans.
Previous genome-wide screens in S. cerevisiae failed to uncover a role for
the HOG pathway in size control [23, 30–32]. To confirm these results, cell
size distributions of HOG pathway mutants in S. cerevisiae (hog1, pbs2,
ssk1, ssk2, opy2 and sho1 strains) were assessed in rich medium. None of
the S. cerevisiae mutants had any discernable size defect as compared to a
parental wt strain (S5 Fig).
Hog1 acts upstream of the SBF transcription factor complex
Cln3-dependent activation of the Swi4-Swi6 transcriptional complex drives
G1/S progression in both S. cerevisiae and C. albicans [56–59] and we
confirmed that CLN3/cln3, swi6 and swi4 mutants all exhibited large size
and a G1 phase delay (Figs 1D and S2E). To examine the functional
relationship between the HOG pathway and these canonical Start
![Page 95: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/95.jpg)
75
regulators, we characterized their genetic interactions by size epistasis. We
observed that the small size of a hog1 mutant strain was partially epistatic
to the large size of the heterozygous CLN3/cln3 mutant (Fig 3A),
suggesting that the HOG pathway may function in parallel to Cln3. In
contrast, a hog1 swi4 double mutant strain had a large size comparable to
that of a swi4 mutant, suggesting that Hog1 acts genetically upstream of
Swi4 to inhibit Start (Fig 3B). In support of this finding, co-
immunoprecipitation assays revealed that Hog1 physically interacted with
Swi4 in a rapamycin-sensitive manner and that the Hog1-Swi4 interaction
was insensitive to osmotic stress (Fig 3C). In C. albicans, the Nrm1
inhibitor is known to interact with the SBF complex to repress the G1/S
transition [51], and consistently a nrm1 mutant exhibited a reduced cell
size (Fig 3D). We found that a nrm1 hog1 double mutant had a smaller
size than either of the nrm1 or hog1 single mutants, suggesting that Nrm1
and Hog1 act in parallel pathways to inhibit G1/S transcription (Fig 3D).
Collectively, these genetic and biochemical results identified Hog1 as a new
regulator of SBF in C. albicans, and suggested that Hog1 may transmit
signals from the TOR growth control network to the G1/S machinery.
The Ptc1 and Ptc2 phosphatases control Start via Hog1
MAPK activity is antagonized by the action of serine/threonine (Ser/Thr)
phosphatases, tyrosine (Tyr) phosphatases, and dual specificity
phosphatases that are able to dephosphorylate both Ser/Thr and Tyr
residues [60]. In S. cerevisiae, after adaptation to osmotic stress,
components of the HOG pathway are dephosphorylated by Tyr
phosphatases and type 2C Ser/Thr phosphatases [60, 61]. In C. albicans,
recent work has identified the two Tyr phosphatases Ptp2 and Ptp3 as
modulators of the basal activity of Hog1 [62]. A prediction of the HOG-
dependent size control model is that disruption of the phosphatases that
modulate Hog1 basal activity should cause a large cell size. However, none
of the Tyr-phosphatase single mutants ptp1, ptp2 or ptp3, nor a ptp2 ptp3
![Page 96: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/96.jpg)
76
double mutant exhibited a noticeable cell size defect (Fig 4A). In contrast,
deletion of the type 2C Ser/Thr phosphatase Ptc2 conferred a median size
of 84.9 fL, which was 24% larger than the parental wt control size of 68 fL,
while a ptc1 ptc2 double mutant strain had an even larger size of 90.5 fL
(Fig 4B). To confirm that the large size phenotype of the ptc mutants was
mediated directly via effects on Start, we evaluated the critical cell size of
both ptc2 and ptc1 ptc2 mutants in elutriated G1 cells. Whereas wt control
cells passed Start at 49 fL, the critical cell size of the ptc2 and ptc1 ptc2
mutant strains was increased by 59% to 78 fL and 87% to 92 fL,
respectively (Fig 4C). To determine whether Hog1 is an effector of Ptc1 and
Ptc2 at Start, we examined the epistatic relationship between the hog1 and
ptc1 ptc2 mutations. The size of the hog1 ptc1 ptc2 triple mutant was
identical to that of hog1 single mutant, indicating that Hog1 functions
downstream of Ptc1 and Ptc2 for the control of cell size (Fig 4D). These
data suggested that Ptc1 and Ptc2 phosphatases may modulate the
phosphorylation state of Hog1 to govern the timing of Start onset and
critical cell size.
Hog1 activates ribosome biosynthetic gene transcription and inhibits
G1/S transcription
To explore the role of Hog1 at Start, we assessed genome-wide
transcriptional profiles using custom microarrays. G1 phase cells for hog1
mutant and wt strains were collected by centrifugal elutriation, followed by
microarray analysis of extracted total RNA. Gene set enrichment analysis
(GSEA) of transcriptional profiles [63, 64] revealed that the hog1 strain was
defective in expression of genes that function in protein translation,
including members of the 48S/43S translation initiation complex,
structural components of the small and large subunits of the ribosome,
and tRNA-charging components (Fig 5A and S4 Table). Transcription of
genes that function in mitochondrial transport, the tricarboxylic acid cycle,
protein degradation by the 26S proteasome and respiration were also
![Page 97: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/97.jpg)
77
downregulated in a hog1 deletion. Conversely, the G1/S transcriptional
program [56] was hyperactivated in a hog1 mutant, consistent with the
above results for RNR1 and PCL2. These results suggested that Hog1
activates multiple processes that underpin cellular growth in addition to
its role as a negative regulator of the G1/S transcriptional program.
It has been previously reported that Hog1 in S. cerevisiae and its ortholog
p38 in humans directly bind and activate downstream transcriptional
target genes [65–70]. In S. cerevisiae, Hog1 thus associates with DNA at
stress-responsive genes and is required for recruitment of general
transcription factors, chromatin modifying activities and RNA Pol II [66,
69, 71, 72]. However, although mechanisms of Hog1-dependent
transcription have been investigated under osmotic stress conditions in C.
albicans, the function of this kinase in normal growth conditions in the
absence of stress has not been explored. In order to assess whether Hog1
might directly regulate gene expression relevant to cell size control in C.
albicans, we profiled the genome-wide localization of Hog1 in G1 phase
cells obtained by centrifugal elutriation from TAP-tagged Hog1 and
untagged control strains. Hog1 binding sites in the genome were
determined in duplicate by chromatin immunoprecipitation and
microarray analysis (ChIP-chip). These experiments revealed that Hog1TAP
was significantly enriched at 276 intergenic regions and 300 ORFs when
compared to the untagged control (S5 Table). The ORF and promoter
targets of Hog1 were strongly represented for translation and Ribi genes
(Fig 5B), in accord with the above expression profiles. These data
suggested that Hog1 may directly activate expression of the Ribi regulon
and other translation-associated genes. The strong enrichment for Hog1 at
translation and Ribi loci suggested that Hog1 may be required for maximal
translational capacity as G1 phase cells approach Start. Consistently, we
observed that a hog1 mutant exhibited increased sensitivity to the protein
translation inhibitor cycloheximide as compared to a wt strain (Fig 5C).
![Page 98: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/98.jpg)
78
These results suggested that Hog1 may directly activate ribosome
biogenesis and protein translation as cells approach Start.
Hog1 is required for Sfp1-dependent gene expression and recruitment
to target promoters
Based on the conserved role of the Sfp1 transcription factor and the kinase
Sch9 in ribosome biogenesis and cell size control in C. albicans, we
examined genetic interactions between these factors and the HOG
pathway. To identify potential epistatic interactions, we overexpressed
SCH9 or SFP1 in a hog1 strain. The overexpression of SFP1 but not SCH9
restored the hog1 strain to a near wt cell size distribution (Fig 6A). These
results suggested that Sfp1 might act downstream of Hog1. Consistent
with this interpretation, we found that the gene expression defects of six
Ribi and translation genes (RPS12, RPS28B, RPS32, EIF4E and TIF6) in a
hog1 strain were rescued by the overexpression of SFP1 (Fig 6B).
Given the apparent genetic relationship between Hog1 and Sfp1, we
examined whether the two proteins might physically interact. We evaluated
the interaction at endogenous levels using a chromosomal HA-tagged Sfp1
allele and polyclonal antibodies that recognize Pbs2 and Hog1. Capture of
Sfp1HA from cell lysates followed by antibody detection revealed that Sfp1
interacted with both Pbs2 and Hog1 (Fig 6C). Notably, the Sfp1 interaction
with both Hog1 and Pbs2 was abolished by either osmotic stress or
rapamycin (Fig 6C). These results suggested that the timing of Start may
be governed in part by modulation of the Hog1-Sfp1 interaction by stress
and nutrient signals.
We then examined whether Sfp1 might play an analogous role in Start
control in C. albicans as in S. cerevisiae. As described above, an sfp1
deletion strain was extremely small and passed Start at only 42% of wt
size (Figs 1D and S2A). Consistently, transcriptional profiles of a strain
![Page 99: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/99.jpg)
79
bearing a tetracycline-regulated allele of SFP1 demonstrated that
expression of the Ribi regulon was partially Sfp1-dependent (S6A Fig). We
also found that an sfp1 strain was as sensitive to the protein translation
inhibitor cycloheximide as a hog1 strain (S6B Fig). These data
demonstrated that Sfp1 is a transcriptional activator of Ribi genes and a
negative regulator of Start in C. albicans.
The finding that both Hog1 and Sfp1 controlled the expression of Ribi
genes, together with the finding that Hog1 acted upstream of Sfp1, led us
to hypothesize that Hog1 might be required for the recruitment of Sfp1 to
its target genes. To test this hypothesis, we used ChIP-qPCR to measure in
vivo promoter occupancy of Sfp1HA at eight representative Ribi and RP
genes that were also bound by Hog1. While Sfp1 was detected at each of
these promoters in a wt strain the ChIP signals were abrogated in the hog1
mutant strain (Fig 6D). From these data, we concluded that Sfp1 regulates
the Ribi regulon in a Hog1-dependent manner, and that the HOG module
lies at the interface of the G1/S transcriptional and growth control
machineries in C. albicans
![Page 100: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/100.jpg)
80
2.2.4 - Discussion
This genetic analysis of size control in C. albicans represents the first
detailed characterization of the mechanisms underlying regulation of
growth and division in a pathogenic fungus. As is the case for other
species that have been examined to date, cell size in C. albicans is a
complex trait that depends on diverse biological processes and many genes
[23, 30–32, 34, 36]. Of particular note, our screen and subsequent
molecular genetic analysis uncovered a novel function for Hog1 as a
critical nexus of the growth and division machineries. The HOG module
thus represents a direct linkage between cell growth and division (Fig 7).
Conservation and divergence of cell size control mechanisms
Inactivation of genes that control ribosome biogenesis and protein
translation in C. albicans resulted in a small cell size, consistent with the
notion that the rate of ribosome biogenesis is a component of the critical
size threshold [1, 24]. In particular, mutation of the key conserved Ribi
regulators Sch9 and Sfp1 dramatically reduced cell size in C. albicans.
Previous studies have shown that several RP and Ribi trans-regulatory
factors have been evolutionarily rewired in C. albicans compared to S.
cerevisiae [48]. Consistently, we found that deletion of CBF1, which
encodes a master transcriptional regulator of RP genes in C. albicans but
not S. cerevisiae, also caused a small size phenotype. Our analysis also
unexpectedly revealed that size regulators may switch between positive
and negative functions between the two yeasts. For example, mutation of
the conserved transcription factor Dot6 that controls rRNA and Ribi
expression caused a strong Whi phenotype in C. albicans, in contrast to
the Lge phenotype conferred in S. cerevisiae [28]. These results illustrate
the evolutionary plasticity of size control mechanisms at the
transcriptional level.
![Page 101: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/101.jpg)
81
In C. albicans, the G1/S phase cell cycle machinery remains only partially
characterized but nevertheless appears to exhibit disparities compared to
S. cerevisiae. For instance, despite conservation of SBF and Cln3 function
[59, 73], the G1/S repressor Whi5 [16, 19] and the G1/S activator Bck2
[74] appear to have been lost in C. albicans. In S. cerevisiae, cells lacking
cln3 are viable and able to pass Start due to the redundant role of Bck2
[74], whereas in C. albicans Cln3 is essential, presumably due to the
absence of a Bck2 equivalent [75]. Nrm1 also appears to have replaced
Whi5 as it interacts physically with the SBF complex and acts genetically
as a repressor of the G1/S transition in C. albicans [51]. Consistently, we
observe that nrm1 mutant exhibits a reduced cell size as a consequence of
accelerated passage through Start. In addition, the promoters of genes that
display a peak of expression during the G1/S transition lack the SCB cis-
regulatory element recognized by the SBF complex in S. cerevisiae and are
instead enriched in MCB-like motifs [56].
Control of Start by the HOG network
Our systematic size screen uncovered a new stress-independent role of the
HOG signaling network in coordinating cell growth and division. Hog1 and
its metazoan counterparts, the p38 MAPK family, respond to various
stresses in fungi [76] and metazoans [77]. In contrast to these stress-
dependent functions, our data suggests that the basal level activity of the
module is required to delay the G1/S transition under non-stressed
homeostatic growth conditions. This function of the HOG module appears
specific to C. albicans as compared to S. cerevisiae. However, the p38
MAPK family is implicated in size control in metazoan species. In the fruit
fly D. melanogaster loss of p38β causes small cell and organism size [78],
while in mice inactivation of the two Hog1 paralogs p38γ and p38δ alters
both cell and organ size, including in the heart and the liver [79, 80].
Recent elegant work in human cells has shown that p38 MAPK activity
enforces size homeostasis by controlling the length of G1 phase in
![Page 102: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/102.jpg)
82
proportion to cell size [81]. In S. pombe, there are two critical cell size
thresholds at both G1/S and G2/M phases [1, 5]. Previous studies have
shown that the p38/Hog1 homolog in S. pombe, Sty1, controls mitotic
commitment and cell size in a nutrient-dependent manner [34, 82–84].
Deletion of STY1 resulted in a large cell size phenotype which is in
accordance with its role as a positive regulator of mitotic onset [83]. These
observations suggest the overall role of Hog1 in size control is conserved
and that C. albicans may be a suitable yeast model to dissect the
mechanisms whereby Hog1 links growth to cell cycle commitment. In
particular, we show that the entire HOG module is required for cell size
control in C. albicans, and further demonstrate a unique role for the type
2C phosphatases Ptc1 and Ptc2 in size control. In contrast, modulation of
the basal activity of Hog1 by the tyrosine phosphatases Ptp2 and Ptp3 in
response to a reduction of TOR activity is required for the separate
response of hyphal elongation [62]. The mechanisms whereby the same
MAPK module can specifically respond to stress, nutrient and cell size
remains to be resolved.
A key question raised by our study is the nature of the signal(s) sensed by
the HOG network that mediate the coupling of growth to division. Deletion
of the upstream negative regulators of the HOG module, Ypd1 and Sln1,
caused an increase in cell size, consistent with the negative regulation of
Start by the entire HOG network. Previous studies have suggested that
Sln1 histidine phosphotransferase activity is required for cell wall
biogenesis in both S. cerevisiae and C. albicans [85, 86]. Interestingly, we
also found that disruption of the beta-1,3-glucan synthase subunit Gsc1
also caused a reduced size in C. albicans [53]. We speculate that
accumulation of cell wall materials, such as glucans, and/or cell wall
mechanical proprieties may be sensed through basal activity of the HOG
module in order to link growth rate to division. This model is analogous to
that postulated in bacteria, whereby the enzymes that synthesize cell wall
![Page 103: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/103.jpg)
83
peptidoglycan help establish cell size control by maintaining cell width
[87]. In support of this notion, perturbation of the cell wall leads to a G1
phase cell cycle arrest in S. cerevisiae via the PKC/Slt2 signalling network
[32, 88, 89].
Finally, in addition to its role in size control in C. albicans, other stress-
independent functions have been attributed to the HOG pathway in
different fungi. In Aspergillus fumigatus and A. nidulans, Hog1 controls
growth [90], conidial germination [91] and sexual development [92, 93]. In
Cryptococcus neoformans, Hog1 is required for mating and, together with
the PKA pathway, contributes to the modulation of cellular response to
glucose availability [94, 95]. Future efforts on the mechanisms by which
Hog1 control these processes will lend further insights into how this
central MAPK conduit transmits multiple different signals.
The HOG network lies at the nexus of growth and cell cycle control
The nature of the linkage between growth to division represents a
longstanding general problem in cell biology. The complex genetics of size
control, reflected in the 66 genes identified in this study that directly or
indirectly affect size, confounds the notion of a simple model of size control
[2]. Our analysis of Hog1 interactions with the known growth and division
machineries nevertheless suggests that the HOG module may directly link
growth and division to establish the size threshold at Start. We
demonstrated that the HOG module acts genetically upstream of Sfp1 to
activate Ribi and translation-related genes, and specifically that Hog1 is
required for the expression of many genes implicated in ribosome
biogenesis and the recruitment of Sfp1 to the relevant promoters. We also
demonstrated that Hog1 and its upstream kinase Pbs2 both physically
interact with Sfp1, and that Hog1 localizes to many ribosome biogenesis
promoters, consistent with a direct regulatory mechanism. These data
suggest that basal activity of the HOG module help set ribosome
![Page 104: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/104.jpg)
84
biogenesis and protein synthesis rates. The HOG module also exhibits
strong genetic interactions with the SBF transcriptional machinery since
the loss of SBF function is epistatic to HOG module mutations and Hog1
physically interacts with SBF. The HOG module is therefore ideally
positioned to communicate the activity of the growth machinery to the cell
cycle machinery. We speculate that under conditions of rapid growth,
Hog1 and/or other components of the HOG module may be sequestered
away from SBF, thereby delaying the onset of G1/S transcription. In the
absence of Hog1 basal activity, this balance is set to a default state, in
which SBF is activated prematurely for a given rate of growth. Taken
together, these observations suggest a model whereby the HOG module
directly links growth to cell cycle commitment (Fig 7). The control of SBF
by the HOG module appears to operate in parallel to Cln3, Nrm1 and
nutrient conditions, suggesting that multiple signals are integrated at the
level of SBF, perhaps to optimize adaptation to different conditions [2].
Further analysis of the functional relationships between the HOG module
and the numerous other genes that affect size in C. albicans should
provide further insights into the linkage between growth and division.
Plasticity of the global size control network and organism fitness
It has been argued that optimization of organism size is a dominant
evolutionary force because fitness depends exquisitely on adaptation to a
particular size niche [96]. The strong link between size and fitness has
been elegantly demonstrated through the artificial evolution of E. coli
strains adapted to different growth rates [3]. Comparison of the size
phenomes of the opportunistic pathogen C. albicans and the saprophytic
yeasts S. cerevisiae and S. pombe reveals many variations in the growth
and cell cycle machineries that presumably reflect the different lifestyles of
these yeasts. Intriguingly, one third of the size regulators identified in our
focused C. albicans reverse-genetic screens have been previously identified
as virulence determinants for this pathogen, similar to our previous study
![Page 105: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/105.jpg)
85
of genes that are haploinsufficient for cell size in C. albicans [53]. We
speculate that cell size may be an important virulence trait. Other fungal
pathogens such as Histoplasma capsulatum, Paracoccidioides brasiliensis,
C. neoformans and Mucor circinelloides also exploit cell size as a virulence
determinant [97] to access specific niches in the host and/or to escape
from host immune cells. In C. albicans, the recently discovered gray cell
type is characterized by a small size, a propensity to cause cutaneous
infections, and reduced colonization of internal organs [98, 99].
Conversely, the response of the host immune system appears to sense C.
albicans size to mitigate tissue damage at the site of infection [100]. The
evident scope and plasticity of the global size control network provides
fertile ground for adaptive mechanisms to optimize organism size and
fitness.
![Page 106: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/106.jpg)
86
2.2.5 - Methods
Strains, mutant collections and growth conditions
C. albicans strains were cultured at 30°C in yeast-peptone-dextrose (YPD)
medium supplemented with uridine (2% Bacto peptone, 1% yeast extract,
2% w/v dextrose, and 50 mg/ml uridine). Alternative carbon sources
(glycerol and ethanol) were used at 2% w/v. Wt and mutant strains used in
this study together with diagnostic PCR primers are listed in S7 Table. The
kinase [41] and the transcriptional factor [42] mutant collections used for
cell size screens were acquired from the genetic stock center
(http://www.fgsc.net). The transcriptional regulator [45] mutant collection
was kindly provided by Dr. Dominique Sanglard (University of Lausanne).
Growth assay curves were performed in triplicate in 96-well plate format
using a Sunrise plate-reader (Tecan) at 30°C under constant agitation with
OD595 readings taken every 10 min for 24h. TAP and HA tags were
introduced into genomic loci as previously described [101]. Overexpression
constructs were generated with the CIp-Act-cyc plasmid which was
linearized with the StuI restriction enzyme for integrative transformation
[102].
Cell size determination
Cell volume distributions, referred to as cell size, were analyzed on a Z2-
Coulter Counter (Beckman). C. albicans cells were grown overnight in YPD
at 30°C, diluted 1000-fold into fresh YPD and grown for 5h at 30°C to an
early log phase density of 5x106–107 cells/ml. For the tetracycline
repressible mutants, all strains and the wt parental strain CAI-4 were
grown overnight in YPD supplemented with the antibiotic doxycycline
(40μg/ml) to achieve transcriptional repression. We note that high
concentration of doxycycline (100 μg/ml) cause a modest small size
![Page 107: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/107.jpg)
87
phenotype in C. albicans but the screen concentration of 40 μg/ml
doxycycline did not cause an alteration in cell size. 100 μl of log phase (or
10 μl of stationary phase) culture was diluted in 10 ml of Isoton II
electrolyte solution, sonicated three times for 10s and the distribution
measured at least 3 times in 3 different independent experiments on a Z2-
Coulter Counter. Size distributions were normalized to cell counts in each
of 256 size bins and size reported as the peak mode value for the
distribution. Data analysis and clustering of size distributions were
performed using custom R scripts (S1 File).
Centrifugal elutriation
The critical cell size at Start was determined by plotting budding index as
a function of size in synchronous G1 phase fractions obtained using a JE-
5.0 elutriation rotor with 40 ml chamber in a J6-Mi centrifuge (Beckman,
Fullerton, CA) as described previously [103]. C. albicans G1 phase cells
were released in fresh YPD medium and fractions were harvested at an
interval of 10 min to monitor bud index. For the hog1 mutant strain,
additional size fractions were collected to assess transcript levels of the
RNR1, PCL2 and ACT1 as cells progressed through G1 phase at
progressively larger sizes.
Gene expression profiles and quantitative real-time PCR
Overnight cultures of hog1 mutant and wt strains were diluted to an
OD595 of 0.1 in 1 L fresh YPD-uridine media, grown at 30°C to an OD595
of 0.8 and separated into size fractions by elutriation at 16°C. A total of
108 G1 phase cells were harvested, released into fresh YPD medium and
grown for 15 min prior to harvesting by centrifugation and stored at -80°C.
Total RNA was extracted using an RNAeasy purification kit (Qiagen) and
glass bead lysis in a Biospec Mini 24 bead-beater. Total RNA was eluted,
![Page 108: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/108.jpg)
88
assessed for integrity on an Agilent 2100 Bioanalyzer prior to cDNA
labeling, microarray hybridization and analysis [104]. The GSEA Pre-
Ranked tool (http://www.broadinstitute.org/gsea/) was used to determine
statistical significance of correlations between the transcriptome of the
hog1 mutant with a ranked gene list [105] or GO biological process terms
as described by Sellam et al. [105]. Data were visualized using the
Cytoscape [106] and EnrichmentMap plugin [107]. Gene expression data
are available at GEO with the accession number GSE126732. For
quantitative real-time PCR (qPCR), cells were grown as for the microarray
experiment. cDNA synthesis and qPCR procedure were performed as
previously described [108].
Promoter localization by ChIP-chip and ChIP-qPCR
ChIP analyses were performed as described using a custom Agilent
microarray containing 14400 (8300 intergenic and 6100 intragenic) 60-
mer oligonucleotides that covered all intergenic regions, ORFs and different
categories of non-coding RNAs (tRNAs, snoRNAs, snRNAs and rRNA [101].
A total of 107 G1 phase cells were harvested from log phase cultures by
centrifugal elutriation and released into fresh YPD medium for 15 min.
Arrays were scanned with a GenePix 4000B Axon scanner, and GenePix
Pro software 4.1 was used for quantification of spot intensities and
normalization. Hog1 genomic occupancy was determined in duplicate
ChIP-chip experiments, which were averaged and thresholded using a
cutoff of two standard deviations (SDs) above the mean of log ratios (giving
a 2-fold enrichment cutoff). ChIP-chip data are available at GEO with the
accession number GSE126732. For ChIP analysis of HA-tagged Sfp1, qPCR
was performed using an iQ 96-well PCR system for 40 amplification cycles
and QuantiTect SYBR Green PCR master mix (Qiagen) using 1 ng of
captured DNA and total genomic DNA extracted from the whole cell
extract. The coding sequence of the C. albicans ACT1 gene was used as a
![Page 109: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/109.jpg)
89
reference for background in all experiments. Values were calculated as the
mean of triplicate experiments.
Protein immunoprecipitation and immunoblot
Cultures of epitope-tagged strains were grown to OD595 of 1.0–1.5 in YPD
and either treated or not with rapamycin (0.2 μg/ml) or NaCl (0.5 M) for 30
min. Cells were harvested by centrifugation and lysed by glass beads in
IP150 buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM MgCl2, 0.1%
Nonidet P-40) supplemented with Complete Mini protease inhibitor cocktail
tablet (Roche Applied Science) and 1 mM phenylmethylsulfonyl fluoride
(PMSF). 1 mg of total protein from clarified lysates was incubated with 50
μl of monoclonal mouse anti-HA (12CA5) antibody (Roche Applied Science),
or 20 μl anti-Pbs2 rabbit polyclonal antibody or 20μl anti-Hog1 rabbit
polyclonal antibody (Santa Cruz) and captured on 40 μl Protein A-
Sepharose beads (GE) at 4°C overnight. Beads were washed three times
with IP150 buffer, boiled in SDS-PAGE buffer, and resolved by 4–20%
gradient SDS-PAGE. Proteins were transferred onto activated
polyvinylidene difluoride (PVDF) membrane and detected by rabbit anti-HA
(1:1000) antibody (QED Biosciences) and IRDye680 secondary antibody
(LI-COR).
![Page 110: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/110.jpg)
90
2.2.6 - Acknowledgments
We are grateful to the Fungal Genetics Stock Center (FGSC), Dominique
Sanglard (University of Lausanne), Catherine Bachewich (Concordia
University), Ana Traven (Monash University), Joachim Ernst (Heinrich-
Heine-Universität), Janet Quinn (Newcastle University), Haoping Liu
(University of California) and Daniel Kornitzer (Technion) for providing
strains.
![Page 111: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/111.jpg)
91
2.2.7 - References
1. Jorgensen P, Tyers M. How cells coordinate growth and division. Curr
Biol. 2004;14(23):R1014–27. pmid:15589139. 2. Kafri M, Metzl-Raz E, Jonas F, Barkai N. Rethinking cell growth
models. FEMS Yeast Res. 2016;16(7). pmid:27650704. 3. Lenski RE, Travisano M. Dynamics of adaptation and diversification:
a 10,000-generation experiment with bacterial populations. Proc Natl Acad Sci U S A. 1994;91(15):6808–14. pmid:8041701; PubMed Central PMCID:
PMCPMC44287. 4. Kafri M, Metzl-Raz E, Jona G, Barkai N. The Cost of Protein
Production. Cell Rep. 2016;14(1):22–31. pmid:26725116; PubMed Central PMCID: PMCPMC4709330.
5. Turner JJ, Ewald JC, Skotheim JM. Cell size control in yeast. Curr Biol. 2012;22(9):R350–9. pmid:22575477; PubMed Central PMCID:
PMCPMC3350643. 6. Cook M, Tyers M. Size control goes global. Curr Opin Biotechnol. 2007;18(4):341–50. pmid:17768045.
7. Ginzberg MB, Chang N, D'Souza H, Patel N, Kafri R, Kirschner MW.
Cell size sensing in animal cells coordinates anabolic growth rates and cell cycle progression to maintain cell size uniformity. Elife. 2018;7. pmid:29889021; PubMed Central PMCID: PMCPMC6031432.
8. Guertin DA, Sabatini DM. Cell Size Control. eLS: John Wiley & Sons, Ltd; 2001.
9. Zhao ZL, Song N, Huang QY, Liu YP, Zhao HR. [Clinicopathologic
features of lung pleomorphic (spindle/giant cell) carcinoma—a report of 17 cases]. Ai Zheng. 2007;26(2):183–8. pmid:17298750.
10. Russell P, Nurse P. Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell. 1987;49(4):559–67.
pmid:3032459. 11. Sudbery PE, Goodey AR, Carter BL. Genes which control cell
proliferation in the yeast Saccharomyces cerevisiae. Nature. 1980;288(5789):401–4. pmid:7001255.
12. Nurse P. Genetic control of cell size at cell division in yeast. Nature. 1975;256(5518):547–51. Epub 1975/08/14. pmid:1165770.
![Page 112: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/112.jpg)
92
13. Nash R, Tokiwa G, Anand S, Erickson K, Futcher AB. The WHI1+
gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. EMBO J. 1988;7(13):4335–46. pmid:2907481; PubMed Central PMCID: PMC455150.
14. Cross FR. DAF1, a mutant gene affecting size control, pheromone
arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol Cell Biol. 1988;8(11):4675–84. pmid:3062366; PubMed Central PMCID: PMCPMC365557.
15. Tyers M. Cell cycle goes global. Curr Opin Cell Biol. 2004;16(6):602–13. pmid:15530770.
16. Costanzo M, Nishikawa JL, Tang X, Millman JS, Schub O,
Breitkreuz K, et al. CDK activity antagonizes Whi5, an inhibitor of G1/S transcription in yeast. Cell. 2004;117(7):899–913. pmid:15210111.
17. de Bruin RA, Kalashnikova TI, Chahwan C, McDonald WH, Wohlschlegel J, Yates J 3rd, et al. Constraining G1-specific transcription to late G1 phase: the MBF-associated corepressor Nrm1 acts via negative
feedback. Mol Cell. 2006;23(4):483–96. pmid:16916637.
18. Travesa A, Kalashnikova TI, de Bruin RA, Cass SR, Chahwan C, Lee DE, et al. Repression of G1/S transcription is mediated via interaction of the GTB motifs of Nrm1 and Whi5 with Swi6. Mol Cell Biol.
2013;33(8):1476–86. pmid:23382076; PubMed Central PMCID: PMCPMC3624247.
19. de Bruin RA, McDonald WH, Kalashnikova TI, Yates J 3rd, Wittenberg C. Cln3 activates G1-specific transcription via phosphorylation
of the SBF bound repressor Whi5. Cell. 2004;117(7):887–98. pmid:15210110.
20. Schaefer JB, Breeden LL. RB from a bud's eye view. Cell. 2004;117(7):849–50. pmid:15210104.
21. Ginzberg MB, Kafri R, Kirschner M. Cell biology. On being the right (cell) size. Science. 2015;348(6236):1245075. pmid:25977557; PubMed
Central PMCID: PMCPMC4533982.
22. Schmoller KM, Skotheim JM. The Biosynthetic Basis of Cell Size Control. Trends Cell Biol. 2015;25(12):793–802. Epub 2015/11/18. pmid:26573465.
![Page 113: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/113.jpg)
93
23. Jorgensen P, Nishikawa JL, Breitkreutz BJ, Tyers M. Systematic identification of pathways that couple cell growth and division in yeast.
Science. 2002;297(5580):395–400. pmid:12089449. 24. Jorgensen P, Rupes I, Sharom JR, Schneper L, Broach JR, Tyers M.
A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size. Genes Dev. 2004;18(20):2491–
505. pmid:15466158; PubMed Central PMCID: PMC529537. 25. Lempiainen H, Uotila A, Urban J, Dohnal I, Ammerer G, Loewith R,
et al. Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR signaling. Mol Cell. 2009;33(6):704–16. pmid:19328065.
26. Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, et al. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene
expression. Proc Natl Acad Sci U S A. 2004;101(40):14315–22. pmid:15353587; PubMed Central PMCID: PMCPMC521938.
27. Singh J, Tyers M. A Rab escort protein integrates the secretion system with TOR signaling and ribosome biogenesis. Genes Dev. 2009;23(16):1944–58. pmid:19684114; PubMed Central PMCID:
PMC2725937.
28. Huber A, French SL, Tekotte H, Yerlikaya S, Stahl M, Perepelkina MP, et al. Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the histone deacetylase complex RPD3L. EMBO J. 2011;30(15):3052–64.
pmid:21730963; PubMed Central PMCID: PMCPMC3160192.
29. Davie E, Petersen J. Environmental control of cell size at division. Curr Opin Cell Biol. 2012;24(6):838–44. pmid:22947494.
30. Zhang J, Schneider C, Ottmers L, Rodriguez R, Day A, Markwardt J, et al. Genomic scale mutant hunt identifies cell size homeostasis genes in S. cerevisiae. Curr Biol. 2002;12(23):1992–2001. pmid:12477387.
31. Dungrawala H, Hua H, Wright J, Abraham L, Kasemsri T, McDowell
A, et al. Identification of new cell size control genes in S. cerevisiae. Cell Div. 2012;7(1):24. pmid:23234503; PubMed Central PMCID: PMC3541103.
32. Soifer I, Barkai N. Systematic identification of cell size regulators in budding yeast. Mol Syst Biol. 2014;10:761. pmid:25411401; PubMed
Central PMCID: PMC4299602. 33. Ferrezuelo F, Colomina N, Palmisano A, Gari E, Gallego C, Csikasz-
Nagy A, et al. The critical size is set at a single-cell level by growth rate to
![Page 114: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/114.jpg)
94
attain homeostasis and adaptation. Nat Commun. 2012;3:1012. pmid:22910358.
34. Navarro FJ, Nurse P. A systematic screen reveals new elements acting at the G2/M cell cycle control. Genome Biol. 2012;13(5):R36.
pmid:22624651; PubMed Central PMCID: PMC3446289.
35. Moris N, Shrivastava J, Jeffery L, Li JJ, Hayles J, Nurse P. A genome-wide screen to identify genes controlling the rate of entry into mitosis in fission yeast. Cell Cycle. 2016;15(22):3121–30. pmid:27736299;
PubMed Central PMCID: PMCPMC5134717. 36. Bjorklund M, Taipale M, Varjosalo M, Saharinen J, Lahdenpera J,
Taipale J. Identification of pathways regulating cell size and cell-cycle progression by RNAi. Nature. 2006;439(7079):1009–13. pmid:16496002.
37. Berman J, Sudbery PE. Candida Albicans: a molecular revolution built on lessons from budding yeast. Nat Rev Genet. 2002;3(12):918–30.
pmid:12459722. 38. Odds FC. Candida infections: an overview. Crit Rev Microbiol.
1987;15(1):1–5. pmid:3319417.
39. Lavoie H, Hogues H, Whiteway M. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi. Curr Opin Microbiol. 2009;12(6):655–63. pmid:19875326; PubMed Central
PMCID: PMCPMC3838361.
40. Sellam A, Askew C, Epp E, Lavoie H, Whiteway M, Nantel A. Genome-wide mapping of the coactivator Ada2p yields insight into the functional roles of SAGA/ADA complex in Candida albicans. Mol Biol Cell.
2009;20(9):2389–400. Epub 2009/03/13. pmid:19279142; PubMed Central PMCID: PMC2675619.
41. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP. An extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog.
2010;6(2):e1000752. Epub 2010/02/09. pmid:20140194. 42. Homann OR, Dea J, Noble SM, Johnson AD. A phenotypic profile of
the Candida albicans regulatory network. PLoS Genet. 2009;5(12):e1000783. Epub 2009/12/31. pmid:20041210.
43. Sandai D, Yin Z, Selway L, Stead D, Walker J, Leach MD, et al. The evolutionary rewiring of ubiquitination targets has reprogrammed the
regulation of carbon assimilation in the pathogenic yeast Candida
![Page 115: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/115.jpg)
95
albicans. MBio. 2012;3(6). pmid:23232717; PubMed Central PMCID: PMC3520108.
44. Noble SM, Johnson AD. Genetics of Candida albicans, a diploid human fungal pathogen. Annu Rev Genet. 2007;41:193–211.
pmid:17614788.
45. Vandeputte P, Pradervand S, Ischer F, Coste AT, Ferrari S, Harshman K, et al. Identification and functional characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host
response in Candida albicans. Eukaryot Cell. 2012;11(7):916–31. Epub 2012/05/15. pmid:22581526; PubMed Central PMCID: PMC3416494.
46. Sudbery P. Cell biology. When wee meets whi. Science. 2002;297(5580):351–2. pmid:12130772.
47. Noble SM, French S, Kohn LA, Chen V, Johnson AD. Systematic screens of a Candida albicans homozygous deletion library decouple
morphogenetic switching and pathogenicity. Nat Genet. 2010;42(7):590–8. Epub 2010/06/15. pmid:20543849; PubMed Central PMCID: PMCPMC2893244.
48. Hogues H, Lavoie H, Sellam A, Mangos M, Roemer T, Purisima E, et
al. Transcription factor substitution during the evolution of fungal ribosome regulation. Mol Cell. 2008;29(5):552–62. Epub 2008/03/18. pmid:18342603; PubMed Central PMCID: PMC3838363.
49. Lavoie H, Hogues H, Mallick J, Sellam A, Nantel A, Whiteway M.
Evolutionary tinkering with conserved components of a transcriptional regulatory network. PLoS Biol. 2010;8(3):e1000329. pmid:20231876; PubMed Central PMCID: PMC2834713.
50. Tyson CB, Lord PG, Wheals AE. Dependency of size of Saccharomyces cerevisiae cells on growth rate. J Bacteriol.
1979;138(1):92–8. pmid:374379; PubMed Central PMCID: PMC218242.
51. Ofir A, Hofmann K, Weindling E, Gildor T, Barker KS, Rogers PD, et al. Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene expression and DNA replication stress response. Mol Microbiol.
2012;84(4):778–94. pmid:22463761; PubMed Central PMCID: PMC3345080.
52. Zhu C, Byers KJ, McCord RP, Shi Z, Berger MF, Newburger DE, et al. High-resolution DNA-binding specificity analysis of yeast transcription
factors. Genome Res. 2009;19(4):556–66. Epub 2009/01/23. pmid:19158363; PubMed Central PMCID: PMCPMC2665775.
![Page 116: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/116.jpg)
96
53. Chaillot J, Cook MA, Corbeil J, Sellam A. Genome-Wide Screen for
Haploinsufficient Cell Size Genes in the Opportunistic Yeast Candida albicans. G3 (Bethesda). 2017;7(2):355–60. Epub 2017/01/04. pmid:28040776; PubMed Central PMCID: PMCPMC5295585.
54. Kayingo G, Wong B. The MAP kinase Hog1p differentially regulates
stress-induced production and accumulation of glycerol and D-arabitol in Candida albicans. Microbiology. 2005;151(Pt 9):2987–99. pmid:16151209.
55. San Jose C, Monge RA, Perez-Diaz R, Pla J, Nombela C. The mitogen-activated protein kinase homolog HOG1 gene controls glycerol accumulation in the pathogenic fungus Candida albicans. J Bacteriol.
1996;178(19):5850–2. pmid:8824643; PubMed Central PMCID: PMC178437.
56. Cote P, Hogues H, Whiteway M. Transcriptional analysis of the Candida albicans cell cycle. Mol Biol Cell. 2009;20(14):3363–73.
pmid:19477921; PubMed Central PMCID: PMC2710843. 57. Hussein B, Huang H, Glory A, Osmani A, Kaminskyj S, Nantel A, et
al. G1/S transcription factor orthologues Swi4p and Swi6p are important but not essential for cell proliferation and influence hyphal development in
the fungal pathogen Candida albicans. Eukaryot Cell. 2011;10(3):384–97. pmid:21257795; PubMed Central PMCID: PMC3067467.
58. Wittenberg C, Reed SI. Cell cycle-dependent transcription in yeast: promoters, transcription factors, and transcriptomes. Oncogene.
2005;24(17):2746–55. pmid:15838511. 59. Bachewich C, Whiteway M. Cyclin Cln3p links G1 progression to
hyphal and pseudohyphal development in Candida albicans. Eukaryot Cell. 2005;4(1):95–102. pmid:15643065; PubMed Central PMCID: PMC544164.
60. Saito H, Tatebayashi K. Regulation of the osmoregulatory HOG
MAPK cascade in yeast. J Biochem. 2004;136(3):267–72. pmid:15598881. 61. Brewster JL, Gustin MC. Hog1: 20 years of discovery and impact.
Sci Signal. 2014;7(343):re7. pmid:25227612.
62. Su C, Lu Y, Liu H. Reduced TOR signaling sustains hyphal development in Candida albicans by lowering Hog1 basal activity. Mol Biol Cell. 2013;24(3):385–97. pmid:23171549; PubMed Central PMCID:
PMC3564525.
![Page 117: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/117.jpg)
97
63. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based
approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–50. pmid:16199517; PubMed Central PMCID: PMC1239896.
64. Sellam A, Tebbji F, Whiteway M, Nantel A. A novel role for the
transcription factor Cwt1p as a negative regulator of nitrosative stress in Candida albicans. PLoS One. 2012;7(8):e43956. pmid:22952822; PubMed Central PMCID: PMC3430608.
65. Proft M, Mas G, de Nadal E, Vendrell A, Noriega N, Struhl K, et al. The stress-activated Hog1 kinase is a selective transcriptional elongation
factor for genes responding to osmotic stress. Mol Cell. 2006;23(2):241–50. pmid:16857590.
66. Proft M, Struhl K. Hog1 kinase converts the Sko1-Cyc8-Tup1 repressor complex into an activator that recruits SAGA and SWI/SNF in
response to osmotic stress. Mol Cell. 2002;9(6):1307–17. pmid:12086627. 67. Pokholok DK, Zeitlinger J, Hannett NM, Reynolds DB, Young RA.
Activated signal transduction kinases frequently occupy target genes. Science. 2006;313(5786):533–6. pmid:16873666.
68. Alepuz PM, Jovanovic A, Reiser V, Ammerer G. Stress-induced map kinase Hog1 is part of transcription activation complexes. Mol Cell.
2001;7(4):767–77. pmid:11336700.
69. Alepuz PM, de Nadal E, Zapater M, Ammerer G, Posas F. Osmostress-induced transcription by Hot1 depends on a Hog1-mediated recruitment of the RNA Pol II. EMBO J. 2003;22(10):2433–42.
pmid:12743037; PubMed Central PMCID: PMC156001. 70. Simone C, Forcales SV, Hill DA, Imbalzano AN, Latella L, Puri PL.
p38 pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat Genet. 2004;36(7):738–43. pmid:15208625.
71. Zapater M, Sohrmann M, Peter M, Posas F, de Nadal E. Selective requirement for SAGA in Hog1-mediated gene expression depending on the
severity of the external osmostress conditions. Mol Cell Biol. 2007;27(11):3900–10. pmid:17403898; PubMed Central PMCID:
PMC1900016. 72. Nadal-Ribelles M, Conde N, Flores O, Gonzalez-Vallinas J, Eyras E,
Orozco M, et al. Hog1 bypasses stress-mediated down-regulation of transcription by RNA polymerase II redistribution and chromatin
![Page 118: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/118.jpg)
98
remodeling. Genome Biol. 2012;13(11):R106. pmid:23158682; PubMed Central PMCID: PMC3580498.
73. Chapa y Lazo B, Bates S, Sudbery P. The G1 cyclin Cln3 regulates morphogenesis in Candida albicans. Eukaryot Cell. 2005;4(1):90–4.
pmid:15643064; PubMed Central PMCID: PMC544163.
74. Wijnen H, Futcher B. Genetic analysis of the shared role of CLN3 and BCK2 at the G(1)-S transition in Saccharomyces cerevisiae. Genetics. 1999;153(3):1131–43. pmid:10545447; PubMed Central PMCID:
PMC1460821. 75. O'Meara TR, Veri AO, Ketela T, Jiang B, Roemer T, Cowen LE.
Global analysis of fungal morphology exposes mechanisms of host cell escape. Nat Commun. 2015;6:6741. pmid:25824284; PubMed Central
PMCID: PMCPMC4382923. 76. Krantz M, Becit E, Hohmann S. Comparative genomics of the HOG-
signalling system in fungi. Curr Genet. 2006;49(3):137–51. pmid:16468042.
77. Saito H, Posas F. Response to hyperosmotic stress. Genetics. 2012;192(2):289–318. pmid:23028184; PubMed Central PMCID:
PMC3454867. 78. Cully M, Genevet A, Warne P, Treins C, Liu T, Bastien J, et al. A role
for p38 stress-activated protein kinase in regulation of cell growth via TORC1. Mol Cell Biol. 2010;30(2):481–95. pmid:19917724; PubMed
Central PMCID: PMC2798466. 79. Gonzalez-Teran B, Lopez JA, Rodriguez E, Leiva L, Martinez-
Martinez S, Bernal JA, et al. p38gamma and delta promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation. Nat Commun. 2016;7:10477. pmid:26795633.
80. Tormos AM, Arduini A, Talens-Visconti R, del Barco Barrantes I,
Nebreda AR, Sastre J. Liver-specific p38alpha deficiency causes reduced cell growth and cytokinesis failure during chronic biliary cirrhosis in mice. Hepatology. 2013;57(5):1950–61. pmid:23354775.
81. Liu S, Ginzberg MB, Patel N, Hild M, Leung B, Li Z, et al. Size
uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length. Elife. 2018;7. pmid:29595474; PubMed Central PMCID: PMCPMC5876018.
![Page 119: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/119.jpg)
99
82. Shiozaki K, Russell P. Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature.
1995;378(6558):739–43. pmid:7501024. 83. Petersen J, Nurse P. TOR signalling regulates mitotic commitment
through the stress MAP kinase pathway and the Polo and Cdc2 kinases. Nat Cell Biol. 2007;9(11):1263–72. pmid:17952063.
84. Millar JB, Buck V, Wilkinson MG. Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at
division in fission yeast. Genes Dev. 1995;9(17):2117–30. pmid:7657164. 85. Kruppa M, Jabra-Rizk MA, Meiller TF, Calderone R. The histidine
kinases of Candida albicans: regulation of cell wall mannan biosynthesis. FEMS Yeast Res. 2004;4(4–5):409–16. pmid:14734021.
86. Rauceo JM, Blankenship JR, Fanning S, Hamaker JJ, Deneault JS, Smith FJ, et al. Regulation of the Candida albicans cell wall damage
response by transcription factor Sko1 and PAS kinase Psk1. Mol Biol Cell. 2008;19(7):2741–51. pmid:18434592; PubMed Central PMCID: PMCPMC2441657.
87. Chien AC, Hill NS, Levin PA. Cell size control in bacteria. Current
Biology. 2012;22(9):R340–9. pmid:22575476; PubMed Central PMCID: PMCPMC3350639.
88. Kono K, Al-Zain A, Schroeder L, Nakanishi M, Ikui AE. Plasma membrane/cell wall perturbation activates a novel cell cycle checkpoint
during G1 in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A. 2016;113(25):6910–5. pmid:27274080; PubMed Central PMCID: PMCPMC4922162.
89. Levin DE. Regulation of cell wall biogenesis in Saccharomyces cerevisiae: the cell wall integrity signaling pathway. Genetics.
2011;189(4):1145–75. pmid:22174182; PubMed Central PMCID: PMCPMC3241422.
90. Du C, Sarfati J, Latge JP, Calderone R. The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus.
Med Mycol. 2006;44(3):211–8. Epub 2006/05/17. pmid:16702099.
91. Xue T, Nguyen CK, Romans A, May GS. A mitogen-activated protein kinase that senses nitrogen regulates conidial germination and growth in Aspergillus fumigatus. Eukaryot Cell. 2004;3(2):557–60. Epub
2004/04/13. pmid:15075285; PubMed Central PMCID: PMCPMC387654.
![Page 120: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/120.jpg)
100
92. Kawasaki L, Sanchez O, Shiozaki K, Aguirre J. SakA MAP kinase is involved in stress signal transduction, sexual development and spore
viability in Aspergillus nidulans. Mol Microbiol. 2002;45(4):1153–63. Epub 2002/08/16. pmid:12180932.
93. Jaimes-Arroyo R, Lara-Rojas F, Bayram O, Valerius O, Braus GH, Aguirre J. The SrkA Kinase Is Part of the SakA Mitogen-Activated Protein
Kinase Interactome and Regulates Stress Responses and Development in Aspergillus nidulans. Eukaryot Cell. 2015;14(5):495–510. Epub 2015/03/31. pmid:25820520; PubMed Central PMCID: PMCPMC4421008.
94. Bahn YS, Kojima K, Cox GM, Heitman J. Specialization of the HOG pathway and its impact on differentiation and virulence of Cryptococcus
neoformans. Mol Biol Cell. 2005;16(5):2285–300. Epub 2005/02/25. pmid:15728721; PubMed Central PMCID: PMCPMC1087235.
95. Banerjee D, Bloom AL, Panepinto JC. Opposing PKA and Hog1 signals control the post-transcriptional response to glucose availability in
Cryptococcus neoformans. Mol Microbiol. 2016;102(2):306–20. Epub 2016/07/09. pmid:27387858; PubMed Central PMCID: PMCPMC5055444.
96. Bonner J. Why Size Matters: From Bacteria to Blue Whales. Princeton University Press ed2006.
97. Wang L, Lin X. Morphogenesis in fungal pathogenicity: shape, size, and surface. PLoS Pathog. 2012;8(12):e1003027. Epub 2012/12/14. pmid:23236274 PubMed Central PMCID: PMC3516537.
98. Tao L, Du H, Guan G, Dai Y, Nobile CJ, Liang W, et al. Discovery of
a "white-gray-opaque" tristable phenotypic switching system in candida albicans: roles of non-genetic diversity in host adaptation. PLoS Biol. 2014;12(4):e1001830. pmid:24691005; PubMed Central PMCID:
PMCPMC3972085. 99. Sellam A, Whiteway M. Recent advances on Candida albicans
biology and virulence [version 1; referees: 2 approved]. 2016;5(2582). pmid:27853524
100. Branzk N, Lubojemska A, Hardison SE, Wang Q, Gutierrez MG, Brown GD, et al. Neutrophils sense microbe size and selectively release
neutrophil extracellular traps in response to large pathogens. Nat Immunol. 2014;15(11):1017–25. pmid:25217981; PubMed Central PMCID:
PMC4236687. 101. Lavoie H, Sellam A, Askew C, Nantel A, Whiteway M. A toolbox for
epitope-tagging and genome-wide location analysis in Candida albicans.
![Page 121: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/121.jpg)
101
BMC Genomics. 2008;9:578. Epub 2008/12/06. pmid:19055720; PubMed Central PMCID: PMC2607300.
102. Blackwell C, Russell CL, Argimon S, Brown AJ, Brown JD. Protein A-tagging for purification of native macromolecular complexes from
Candida albicans. Yeast. 2003;20(15):1235–41. pmid:14618561.
103. Tyers M, Tokiwa G, Futcher B. Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 1993;12(5):1955–68. pmid:8387915; PubMed
Central PMCID: PMC413417. 104. Sellam A, Tebbji F, Nantel A. Role of Ndt80p in sterol metabolism
regulation and azole resistance in Candida albicans. Eukaryot Cell. 2009;8(8):1174–83. Epub 2009/06/23. doi: EC.00074-09 [pii]
pmid:19542309. 105. Sellam A, van het Hoog M, Tebbji F, Beaurepaire C, Whiteway M,
Nantel A. Modeling the transcriptional regulatory network that controls the early hypoxic response in Candida albicans. Eukaryot Cell. 2014;13(5):675–90. pmid:24681685; PubMed Central PMCID:
PMC4060469.
106. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, et al. A travel guide to Cytoscape plugins. Nat Methods. 2012;9(11):1069–76. pmid:23132118; PubMed Central PMCID: PMC3649846.
107. Merico D, Isserlin R, Stueker O, Emili A, Bader GD. Enrichment
map: a network-based method for gene-set enrichment visualization and interpretation. PLoS One. 2010;5(11):e13984. pmid:21085593; PubMed Central PMCID: PMC2981572.
108. Garcia C, Tebbji F, Daigneault M, Liu NN, Kohler JR, Allen-Vercoe E, et al. The Human Gut Microbial Metabolome Modulates Fungal Growth
via the TOR Signaling Pathway. mSphere. 2017;2(6). pmid:29242837; PubMed Central PMCID: PMCPMC5729221.
![Page 122: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/122.jpg)
102
2.2.8 - Figures
Fig 1. The cell size phenome of C. albicans.
Clustergrams of size profiles of two different systematic mutant collections
of C. albicans. (A) a set of 81 kinases [41] and (B) a set of 166 transcription
factors [42]. For each strain, the cell volume distribution in femtoliters (fL)
was measured over 256 size bins with a Beckman Coulter Z2 Channelizer.
Hierarchical clustering was used to self-organize the datasets. Red asterisk
in the clustergrams indicates size distribution of wt strains. Sections of the
clusters corresponding to small and large size mutants are magnified. (C)
Overlap between C. albicans size and virulence phenotypes. Avirulent
mutant phenotypes were obtained from CGD based on decreased
competitive fitness in mice and/or reduced invasion and damage to host
cells. (D) Size regulators in C. albicans act at Start. Early G1-phase cells of
![Page 123: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/123.jpg)
103
different size mutant and wt (SN250 [47]) strains were isolated by
centrifugal elutriation, released into fresh YPD medium and monitored for
bud emergence and cell size at 10 min intervals until the entire population
was composed of budded cells. Budding index was determined as the
percentage of budded cells in each sample for at least 200 cells.
![Page 124: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/124.jpg)
104
Table 1. Candidate Start regulators in C. albicans.
![Page 125: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/125.jpg)
105
Fig 2. Basal activity of HOG pathway is required for normal Start
onset and cell size homeostasis.
(A) Confirmation of the Whi phenotype in a newly generated hog1 deletion
mutant. Size distributions (i.e., % of cells in each size bin of the Coulter Z2
Channelizer) of a wt (SN148), hog1 and hog1 strain complemented with
wild type HOG1 (hog1-pHOG1 are shown. (B-D) Acceleration of Start in a
hog1 strain. (B) Elutriated G1 phase daughter cells were released into
![Page 126: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/126.jpg)
106
fresh media and fractions were collected at intervals of 10 min. Bud
emergence was assessed in each size fraction. (C-D) Expression of G1/S
transcripts. RNR1 and PCL2 transcript levels in elutriated cell fractions
relative to pre-elutriated asynchronous cells were assessed by quantitative
real-time PCR and normalized to ACT1 levels. (E-F) Size distributions of
different mutant strains for the HOG pathway in C. albicans. (G) Schematic
of the canonical HOG pathway in C. albicans and summary of size for each
mutant strain expressed as mean percentage of reduction or increase of
size as compared to the paternal wt strain of each mutant ± standard
deviation (four biological replicates). The ssk2 strain exhibited constitutive
filamentation that precluded size determination (ND = not determined). (H)
Mutation of the two activating phosphorylation sites on Hog1 (T174A and
Y176F, termed AF) and Pbs2 (S355D and T359D, termed DD) confers a
small size phenotype.
![Page 127: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/127.jpg)
107
Fig 3. Genetic interactions between the HOG pathway and the G1/S
transcriptional machinery.
(A) Additive effect of hog1 and Cln3/cln3 mutations on cell size. The wt
strain was in the SN148-Arg+ parental background. (B) A swi4 mutation is
epistatic to a hog1 mutation for cell size. The wt strain was in the SN250
background. (C) Co-immunoprecipitation assays for Hog1 and Swi4.
Cultures were treated or not as indicated with rapamycin (0.5 μg/ml or
![Page 128: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/128.jpg)
108
NaCl (0.5 M) for 30 min. (D) Additive effect of hog1 and nrm1 mutations on
cell size. The wt strain was in the SN250 background.
![Page 129: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/129.jpg)
109
Fig 4. Ptc1 and Ptc2 control Start via Hog1.
(A) Size distributions of a wt strain and ptc1, ptc2 and ptc1 ptc2 deletion
mutants. (B) Size distributions of a wt strain, a ptp2 single mutant, and a
ptp2 ptp3 double mutant. (C) Start is delayed in ptc mutants. Elutriated
G1 phase daughter cells were released into fresh media and monitored for
bud emergence as a function of size. (D) The small cell size of a hog1
mutant is epistatic to the large size of a ptc1 ptc2 double mutant.
![Page 130: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/130.jpg)
110
Fig 5. A Hog1-dependent transcriptional program in G1 phase cells.
(A) GSEA analysis of differentially expressed genes in a hog1 mutant
relative to a congenic wt strain. Cells were synchronized in G1 phase by
centrifugal elutriation and released in fresh YPD medium for 15 min and
analyzed for gene expression profiles by DNA microarrays. Up-regulated
(red circles) and down-regulated (blue circles) transcripts are shown for the
indicated processes. The diameter of the circle reflects the number of
![Page 131: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/131.jpg)
111
modulated gene transcripts in each gene set. Known functional
connections between related processes are indicated (green lines). Images
were generated in Cytoscape with the Enrichment Map plug-in. (B)
Genome-wide promoter occupancy of Hog1 in G1 phase cells. Gene
categories bound by Hog1 were determined by GO term enrichment. p-
values were calculated using hypergeometric distribution. (C) Growth rate
and cycloheximide (CHX; 200 μg/ml) sensitivity of wt and hog1 mutant
strains. Relative growth rate was calculated as time to reach half maximal
OD600 for each culture normalized to the value for the untreated WT
control strain, which was 24 h of growth in SC medium at 30°C. Doubling
times were calculated during the exponential phase of each strain treated
or not with cycloheximide (200 μg/ml) and represented as a percentage
relative to the value of the untreated WT control strain. Results are the
mean of three replicates. Bars show the means +/- standard errors of the
means.
![Page 132: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/132.jpg)
112
Fig 6. Hog1-dependent recruitment of Sfp1 to promoter DNA.
(A) Size distributions of wt (wt-pAct), hog1 (hog1/hog1), SFP1-
overexpression (wt/pAct-SFP1) and hog1 SFP1-overexpression
(hog1/hog1/pAct-SFP1) strains. (B) Increased SFP1 dosage restores
expression of representative Ribi and RP transcripts in a hog1 mutant
strain. Relative expression levels of the six transcripts were assessed by
real-time qPCR as normalized to ACT1. Values are the mean from two
independent experiments. (C) Sfp1 interactions with Pbs2 and Hog1. Anti-
HA immunoprecipitates from a strain bearing an integrated SFP1HA allele
grown in the absence or presence of NaCl (0.5 M) or rapamycin (0.5 μg/ml)
were probed with anti-HA, anti-Hog1 or anti-Pbs2 antibodies. (D) Reduced
Sfp1 localization to Ribi gene promoters in a hog1 mutant strain. Values
are the mean from three independent ChIP-qPCR experiments for each
indicated promoter.
![Page 133: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/133.jpg)
113
Fig 7. Architecture of the Start machinery in C. albicans. Hog1
inhibits the SBF G1/S transcription factor complex and in parallel controls
Sfp1 occupancy of Ribi gene promoters, and thereby directly links growth
and division. The activity of Hog1 is modulated by the phosphatases Ptc1
and Ptc2 to govern the timing of Start onset. Parallel Start pathways
revealed by genetic interactions with Hog1, as well as other prominent size
control genes in C. albicans revealed by size screens, are also indicated.
Other potential size regulators for which gene inactivation led to small and
large size phenotypes are indicated in red and green, respectively.
![Page 134: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/134.jpg)
114
Chapitre 3 - Integration of growth and cell size via
the TOR pathway and the Dot6 transcription
factor in Candida albicans.
3.1 - Résumé
Chez les espèces eucaryotes, l'homéostasie de la taille semble être exercée
à un point de contrôle en fin de phase G1 appelée START chez les levures
et le Point de Restriction chez les métazoaires. L’atteinte d’une taille seuil à
START permet d’associer la croissance cellulaire à la division et établit
ainsi l'homéostasie de la taille sur le long terme. Nos recherches
précédentes ont montré que des centaines de gènes modifient fortement la
taille cellulaire chez la levure opportuniste Candida albicans, mais
étonnamment, peu de gènes nécessaires pour la régulation de la taille chez
C. albicans sont conservés chez S. cerevisiae. Ici, nous avons étudié l’un
des nouveaux régulateurs de la taille chez C. albicans, le facteur de
transcription Dot6. Nos données ont démontré que Dot6 est un régulateur
négatif de START et agit également comme activateur de la transcription
des gènes de la biogenèse des ribosomes (Ribi). L'épistasie génétique a
révélé que Dot6 interagit avec le régulateur de transcription principal de la
machinerie G1, le complexe SBF, mais pas avec les régulateurs de la taille
cellulaire et les régulateurs de Ribi Sch9, Sfp1 et p38/Hog1. Dot6 est
nécessaire pour la modulation de la taille de la cellule suivant la source de
carbone disponible et il est régulé au niveau de la localisation nucléaire
par la voie TOR. Nos résultats soutiennent un modèle dans lequel Dot6
agit comme une plaque tournante intégrant directement les signaux de
croissance via la voie TOR afin de contrôler l'engagement du cycle
cellulaire.
![Page 135: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/135.jpg)
115
3.2 - Article
Integration of growth and cell size via the TOR pathway and the Dot6
transcription factor in Candida albicans
Julien Chaillot*, Faiza Tebbji*, Jaideep Malick†,1 and Adnane Sellam*,‡,2
Genetics February 1, 2019 vol. 211 no. 2 637-650;
https://doi.org/10.1534/genetics.118.301872
* CHU de Québec Research Center (CHUQ), Université Laval, Quebec City,
QC, Canada
† Department of Biology, Concordia University, Montréal, Quebec, Canada
‡ Department of Microbiology, Infectious Disease and Immunology,
Faculty of Medicine, Université Laval, Quebec City, QC, Canada
1 Present address: Department of Molecular Genetics, University of
Toronto, Toronto, Ontario, Canada.
2 Corresponding author: Université Laval, CHU de Québec Research Center
(CHUL), RC-0709, 2705 Laurier Blvd, Quebec, QC, Canada G1V 4G2. Tel:
(1) 418 525 4444 ext. 46259. E-mails: [email protected].
Running title: Cell size control by Dot6
Keywords: Cell size, Ribosome biogenesis, Cell growth, Cell division,
Transcriptional rewiring
![Page 136: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/136.jpg)
116
3.2.1 - Abstract
In most species, size homeostasis appears to be exerted in late G1 phase
as cells commit to division, called Start in yeast and the Restriction Point
in metazoans. This size threshold couples cell growth to division, and,
thereby, establishes long-term size homeostasis. Our former investigations
have shown that hundreds of genes markedly altered cell size under
homeostatic growth conditions in the opportunistic yeast Candida
albicans, but surprisingly only few of these overlapped with size control
genes in the budding yeast Saccharomyces cerevisiae Here, we investigated
one of the divergent potent size regulators in C. albicans, the Myb-like HTH
transcription factor Dot6. Our data demonstrated that Dot6 is a negative
regulator of Start, and also acts as a transcriptional activator of ribosome
biogenesis (Ribi) genes. Genetic epistasis uncovered that Dot6 interacted
with the master transcriptional regulator of the G1 machinery, SBF
complex, but not with the Ribi and cell size regulators Sch9, Sfp1, and
p38/Hog1. Dot6 was required for carbon-source modulation of cell size,
and it is regulated at the level of nuclear localization by the TOR pathway.
Our findings support a model where Dot6 acts as a hub that integrates
growth cues directly via the TOR pathway to control the commitment to
mitotic division at G1.
![Page 137: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/137.jpg)
117
3.2.2 - Introduction
In a eukaryotic organism, cell size homeostasis is maintained through a
balanced coordination between cell growth and division. In the last half
century, a major focus of cell biology has been the study of cell division,
but how eukaryotic cells couple growth to division to maintain a
homeostatic size remains poorly understood. In most eukaryotic
organisms, reaching a critical cell size appears to be crucial for
commitment to cell division in late G1 phase, called Start in yeast and the
Restriction Point in metazoans (Turner et al. 2012). Start is dynamically
regulated by nutrient status, pheromones, and stress, and facilitates
adaptation to changing environmental conditions in microorganisms to
maximize their fitness (Lenski and Travisano 1994; Kafri et al. 2016).
Different genome-wide genetic analyses have been accomplished in
different model organisms to uncover the genetic determinism of Start and
cell size control in eukaryotes. Screens of Saccharomyces cerevisiae
mutants has identified many ribosome biogenesis (Ribi) genes as small size
mutants (whi) (Jorgensen et al. 2002; Dungrawala et al. 2012; Soifer and
Barkai 2014), and revealed two master regulators of Ribi gene expression—
the transcription factor Sfp1 and the AGC family kinase Sch9—as the
smallest mutants (Jorgensen et al. 2004). These observations lead to the
hypothesis that the rate of ribosome biogenesis is a critical element of the
metric that dictates cell size (Jorgensen and Tyers 2004; Schmoller and
Skotheim 2015). Sfp1 and Sch9 are critical effectors of the TOR pathway
and form part of a dynamic, nutrient-responsive network that controls the
expression of Ribi genes and ribosomal protein genes (Jorgensen et al.
2004; Marion et al. 2004; Urban et al. 2007; Lempiäinen et al. 2009). Sch9
is phosphorylated and activated by TOR, and, in turn, inactivates a cohort
of transcriptional repressors of RP genes called Dot6, Tod6, and Stb3
(Huber et al. 2011).
![Page 138: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/138.jpg)
118
Candida albicans is a diploid ascomycete yeast that is an important
commensal and opportunistic pathogen in humans. While C. albicans and
S. cerevisiae colonize different niches, common biological features are
shared between the two yeasts, including the morphological trait of
budding, and core cell cycle and growth regulatory mechanisms (Berman
2006; Côte et al. 2009). C. albicans has served as an important
evolutionary milestone with which to assess evolutionary conservation of
biological mechanism, and recent evidence suggests a surprising extent of
rewiring of central signaling, transcriptional, and metabolic networks as
compared to S. cerevisiae (Lavoie et al. 2009; Blankenship et al. 2010; Li
and Johnson 2010; Sandai et al. 2012). To assess the conservation of the
size control network, we performed recently a quantitative genome-wide
analysis of a systematic collection of gene deletion strains in C. albicans
(Sellam et al. 2016; Chaillot et al. 2017). Our screens uncovered that cell
size in C. albicans is a complex trait that depends on diverse biological
processes such as ribosome biogenesis, mitochondrial functions, cell cycle
control, and metabolism. In addition to conserved mechanisms and
regulators previously identified in S. cerevisiae and metazoans, we
uncovered many novel regulatory circuits that govern critical cell size at
Start specifically in C. albicans. In particular, we delineated a novel stress-
independent function of the p38/HOG MAPK pathway as a critical
regulator of both growth and division, and poised to exert these functions
in a nutrient-sensitive manner (Sellam et al. 2016). Interestingly, some of
the size genes identified were required for fungal virulence, suggesting that
cell size homeostasis may be elemental to C. albicans fitness inside the
host.
An unexpectedly potent negative Start regulator that emerges from our
systematic screen was Dot6, which encodes a Myb-like HTH transcription
factor that binds to the PAC (Polymerase A and C) motif GATGAG (Enfert
![Page 139: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/139.jpg)
119
and Hube 2007; Zhu et al. 2009; Sellam et al. 2016; Chaillot et al. 2017).
dot6 was among the smallest mutant identified by our screen. C. albicans
Dot6 is the ortholog of two redundant transcriptional repressors of rRNA
and Ribi gene expression called Dot6 and Tod6 in S. cerevisiae, which are
antagonized by Sch9, and which cause only a minor large-size phenotype
when deleted together (Huber et al. 2011). Here, we show that the C.
albicans Dot6 is a potent size regulator that governs critical cell size at
Start, and, in an opposite role to that in S. cerevisiae, Dot6 acts as a
transcriptional activator of Ribi genes. We also showed that the TOR
pathway relays nutrient-dependent signal for size control to the Start
machinery via Dot6. Genetic interactions with deletions of different known
Start regulators revealed epistatic interaction with the master
transcriptional regulator of the G1-S transition, SBF complex (Swi4-Swi6),
but not with SCH9, SFP1, or HOG1. These data emphasize the
evolutionary divergence between C. albicans and S. cerevisiae, and
consolidate the role of Tor1-Dot6 network as a key cell size control
mechanism in C. albicans.
![Page 140: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/140.jpg)
120
3.2.3 - Materials and Methods
Growth conditions and strains
The strains used in this study are listed in Supplemental Material, Table
S1. C. albicans strains were generated and propagated using standard
yeast genetics methods. For general propagation and maintenance
conditions, the strains were cultured at 30°C in yeast-peptone-dextrose
(YPD) medium supplemented with uridine (2% Bacto-peptone, 1% yeast
extract, 2% dextrose, and 50 µg/ml uridine) or in Synthetic Complete
medium (SC; 0.67% yeast nitrogen base with ammonium sulfate, 2%
glucose, and 0.079% complete supplement mixture). To assess the size of
hyphal cells, both wild type (WT) (SFY87) and dot6 mutant cells were
grown at 37°C in YPD supplemented with 10% fetal bovine serum (FBS) for
3 hr.
The DOT6-Δ[1555–1803] truncated mutant was generated by inserting a
STOP codon using CRISPR-Cas9 mutagenesis system (Vyas et al. 2015).
Guide RNA (gRNA) was generated by annealing the Dot6-gRNA-Top and
Dot6-gRNA-Bottom primers. Repair template was created using Dot6-
STOP-Top and Dot6-STOP-Bottom primers (Table S2). The C. albicans
SC5314 strain was cotransformed with the linearized plasmid pV1093
containing Dot6-gRNA with the repair template using lithium acetate
transformation procedure and selected in Nourseothricin (Jena
Bioscience). DOT6 truncation was confirmed by sequencing.
For the complementation assay in S. cerevisiae, the complete ORF of C.
albicans DOT6 was amplified using XbaI-Dot6Ca-F and HindIII-Dot6Ca-R
primers, and the resulting PCR fragments were cloned into the yeast
pAG415GPD-ccdB plasmid (Susan Lindquist laboratory). The S. cerevisiae
WT (Y2092) and dot6 tod6 (Y3707) strains were then transformed with
![Page 141: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/141.jpg)
121
either the empty pAG415GPD-ccdB or pAG415GPD-CaDOT6-ccdB
plasmids using a standard lithium-acetate-based procedure (Chen et al.
1992).
Cell size assessment
Cell size distributions were obtained using the Z2-Coulter Counter
(Beckman, Fullerton, CA). C. albicans cells were grown overnight in YPD at
30°C, diluted 1000-fold into fresh YPD or SC media and grown for 4 hr at
30°C to an early log phase density of 5 × 106–107 cells/ml. A fraction of
100 µl of log phase culture was diluted in 10 ml of Isoton II electrolyte
solution, sonicated three times for 10 sec, and the distribution measured
at least three times on a Z2-Coulter Counter. Size distributions were
normalized to cell counts in each of 256 size bins, and size is reported as
the peak median value for the distribution. Data analysis and clustering of
size distributions were performed using custom R scripts (Sellam et al.
2016).
Start characterization
The critical cell size at Start was determined by plotting budding index as
a function of size in synchronous G1 phase fractions obtained using a JE-
5.0 elutriation rotor with a 40 ml chamber in a J6-Mi centrifuge (Beckman)
as described previously (Tyers et al. 1993). C. albicans G1 phase cells were
released in fresh YPD medium, and fractions were harvested at intervals of
10 mins to monitor bud index. For the dot6 mutant and the WT strains,
additional size fractions were collected to assess transcript levels of the
RNR1, PCL2, and ACT1 using qPCR (quantitative real time PCR) as cells
progressed through G1 phase at progressively larger sizes.
Growth assays
![Page 142: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/142.jpg)
122
C. albicans cells were resuspended in fresh SC at an OD600 of 0.05. A
total volume of 99 μl cells was added to each well of a flat-bottom 96-well
plate in addition to 1 μl of the corresponding stock solution of either
rapamycin or cycloheximide (Sigma). Growth assay curves were performed
in triplicate in 96-well plate format using a Sunrise plate-reader (Tecan) at
30° under constant agitation.
In vivo GFP reporter assays
The GFP reporter assay was performed by replacing the ORF of PNO1
(Orf19.7618) by GFP coding sequence (Schaub et al. 2006) in its actual
chromatin environment. pPNO1-GFP-F1/PNO1-GFP-R1 and pPNO1mut-
GFP-F1/PNO1-GFP-R1 primer pairs were used to generate pPNO1-GFP
and pPNO1-mut-GFP PCR cassettes that contains an intact (GATGAG) and
a shuffled (ATGGAG) PAC motif, respectively. These cassettes were
integrated into the WT (SN152) strain and isogenic strain deleted for DOT6
(DSY4169-B). GFP fluorescence was quantitatively assessed by flow
cytometry (BD FACSCanto) using 106 exponentially growing cells. Each
sample was measured three times.
Cellular localization of Dot6
A DOT6/dot6 heterozygous strain was GFP-tagged in vivo at the C-terminal
region with a GFP-Arg4 PCR product as previously described (Gola et al.
2003). Transformants were selected on SC minus Arginine plates, and
correct integration of the GFP tag was checked by PCR and sequencing
(Table S2). Live-cell microscopy of Dot6-GFP was performed with a Leica
DMI6000B inverted confocal microscope (Leica) and a C9100-13 camera
CCD camera (Hamamatsu). The effect of TOR activity on Dot6-GFP
localization was assessed as following: cells grown on SC medium were
![Page 143: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/143.jpg)
123
exposed to rapamycin (100 ng/ml) for 30 min, washed once with PBS
buffer, and immediately visualized. C. albicans vacuoles were stained using
the CellTracker Blue CMAC dye (ThermoFisher) following the
manufacturer’s recommended procedure.
Size genetic epistasis
dot6 mutant was subjected to epistatic analysis with deletions of known
Start regulators (Sellam et al. 2016) (Table S1). Gene deletion was
performed as previously described (Gola et al. 2003). The complete set of
primers used to generate deletion cassettes and to confirm gene deletions
are listed in Table S2. Size distribution of at least, two independent double
mutants were determined. Epistasis was noted only if size distributions of
a single and double mutant overlapped.
Microarray transcriptional profiling
Overnight cultures of dot6 mutant and WT strains were diluted to an
OD600 of 0.1 in 1 liter fresh YPD-uridine medium, grown at 30° to an
OD600 of 0.8, and separated into size fractions using the Beckman JE-5.0
elutriation system at 16°C. A total of 108 unbudded G1 phase cells were
harvested, released into fresh YPD medium, and grown for 10 min prior to
harvesting by centrifugation and storage at −80°. Total RNA was extracted
using an RNAeasy purification kit (Qiagen) and glass bead lysis in a
Biospec Mini 24 bead-beater. Total RNA was eluted, and assessed for
integrity on an Agilent 2100 Bioanalyzer prior to cDNA labeling, microarray
hybridization, and analysis (Sellam et al. 2009). The GSEA PreRanked tool
(http://www.broadinstitute.org/gsea/) was used to determine statistical
significance of correlations between the transcriptome of the dot6 mutant
with a ranked gene list or GO biological process terms as described by
![Page 144: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/144.jpg)
124
Sellam et al. (2014). Data were visualized using the Cytoscape (Saito et al.
2012) and EnrichmentMap plugin (Merico et al. 2010).
Expression analysis by qPCR
For qPCR experiments, cell cultures and RNA extractions were performed
as described for the microarray experiment. cDNA was synthesized from 1
µg of total RNA using the SuperScipt III Reverse Transcription kit
(ThermoFisher). The mixture was incubated at 25°C for 10 min, 37°C for
120 min, and 85°C for 5 min; 2 U/µl of RNAse H (NEB) was then added to
remove RNA and samples were incubated at 37°C for 20 min. qPCR was
performed using an iQ5 96-well PCR system (Bio-Rad) for 40 amplification
cycles with QuantiTect SYBR Green PCR master mix (Qiagen). The
reactions were incubated at 50°C for 2 min, 95°C for 2 min, and cycled 40
times at 95°C, 15 sec; 56°C, 30 sec; 72°C, 1 min. Fold-enrichment of each
tested transcript was estimated using the comparative ΔΔCt method as
described by Guillemette et al. (2004). To evaluate the gene expression
level, the results were normalized using Ct values obtained from Actin
(ACT1, C1_13700W_A). Primer sequences used for this analysis are
summarized in Table S2.
Western blot analysis
A DOT6/dot6 heterozygous strain was Myc-tagged in vivo at the C-terminal
region with a Myc-Arg4 PCR product as previously described (Lavoie et al.
2008). Transformants were selected on SC minus Arginine plates, and
correct integration of the Myc-tag was checked by PCR and sequencing.
The C. albicans Dot6-Myc strain was grown to midlog phase in SC
medium. Cells at a final OD600 of 1 were treated with 100 ng/ml
rapamycin and incubated for 15, 30, 60, or 120 min at 30°C. Cells were
harvested by centrifugation and lysed by bead beating in IP150 buffer [50
![Page 145: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/145.jpg)
125
mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM Mg, 0.1% Nonidet P-40]
supplemented with Complete Mini protease inhibitor mixture tablet (Roche
Applied Science) and 1 mM phenylmethyl-sulfonyl fluoride (PMSF). The
lysates were then cleared by centrifugation, and protein concentration was
estimated using the DC protein quantification assay (Bio-Rad); 60 μg of
total protein was boiled with SDS-PAGE loading buffer and resolved by 4–
20% gradient SDS-PAGE. Proteins were transferred onto a nitrocellulose
membrane and analyzed by Western blotting using either 910E mouse c-
Myc (1:200; Santa Cruz) or beta actin (1:5000; GenScript) antibodies.
Data availability
Strains and plasmids are available upon request. Supplemental files
contain two figures (Figures S1 and S2) and five tables (Tables S1–S5)
and are available at FigShare (DOI: 10.6084/m9.figshare.7008170). Gene
expression data are available at GEO with the accession number
GSE119089. Supplemental material available at Figshare:
https://doi.org/10.6084/m9.figshare.7008170.v3.
![Page 146: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/146.jpg)
126
3.2.4 - Results
Dot6 is a negative regulator of START in C. albicans
We have previously shown that the transcription factor Dot6 was required
for cell size control in C. albicans (Sellam et al. 2016). A dot6 mutant had a
median size that was 21% (41 fL) smaller than its congenic parental (52 fL)
or the complemented strains (51 fL) (Figure 1A). Inactivation of DOT6
resulted in only a minor growth defect with a doubling time comparable to
the WT and the complemented strains during the log phase, suggesting
that the size reduction of dot6 is not a growth rate-associated phenotype
(Figure 1B). To ascertain that this effect was mediated at Start, we
evaluated two hallmarks of Start, namely bud emergence and the onset of
SBF-dependent transcription, as a function of cell size in synchronous G1
phase cells obtained by elutriation. As assessed by median size of cultures
for which 90% of cells had a visible bud, the dot6 mutant passed Start
after growth to 26 fL, whereas a parental WT control culture became 90%
budded at a much larger size of 61 fL (Figure 1C). Importantly, in the
same experiment, the onset G1/S transcription was accelerated in the dot6
strain as judged by the peak in expression of the two representative G1-
transcripts, the ribonucleotide reductase large subunit, RNR1, and the
cyclin PCL2 (Figure 1D). These results unequivocally demonstrated that
Dot6 regulates the cell size threshold at Start in C. albicans.
The effect of DOT6 inactivation was also assessed on the size of C. albicans
cells growing as invasive hyphae. While dot6 mutant was able to undergo
the yeast-to-hyphae transition, the size of hyphal cells was significantly
reduced as compared to the WT strain (Figure 1, E and F).
Opposite to C. albicans, inactivation of both DOT6 and its paralog TOD6 in
S. cerevisiae resulted in a slight size increase (Huber et al. 2011). To test if
the C. albicans Dot6 was functional in S. cerevisiae, we expressed CaDOT6
![Page 147: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/147.jpg)
127
in the double mutant dot6 tod6 of the budding yeast. The obtained
transformants had a large size distribution comparable to dot6 tod6,
suggesting that the C. albicans Dot6 is not functional in S. cerevisiae
(Figure 1G). These data, together with the contrasting size phenotype of
mutants in both yeasts, suggest that S. cerevisiae Dot6/Tod6 and C.
albicans Dot6 are functionally divergent.
Dot6 interacts genetically with the SBF transcription factor complex
As cell size is a quantitative value, absolute changes in size between single
and double mutants can be used to reveal genetic interactions between
different genes to construct a cell size genetic interaction network
(Jorgensen et al. 2002; Costanzo et al. 2004; de Bruin et al. 2004). To
elucidate connections between Dot6 and previously identified Start
regulators in C. albicans (Sellam et al. 2016), both DOT6 alleles were
deleted in different small size mutants including sch9, sfp1, and hog1, as
well as the SBF large size mutant, swi4. Inactivating DOT6 in either sch9,
sfp1, or hog1 resulted in cells with smaller size as compared to their
congenic strains suggesting that Dot6, Sfp1, Sch9, and the p38 kinase
Hog1 act in different Start pathways (Figure 2, A–C). Furthermore,
inactivation of DOT6 in the swi4 mutant resulted in a large size
comparable to that of swi4 mutant, indicating that Dot6 acts via SBF
complex to control Start (Figure 2D). SWI4 deletion is also epistatic to
DOT6 regarding the growth rate in liquid YPD medium, confirming that
both Dot6 and Swi4 act in a common pathway (Figure 2E). Given the
absence of epistatic interaction between Dot6 and the known conserved
Ribi and size regulators Sch9, Sfp1, and Hog1, our data uncovered a novel
uncharacterized pathway that control the critical cell size threshold in C.
albicans (Figure 2F).
Dot6 is a positive regulator of ribosome biogenesis genes
![Page 148: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/148.jpg)
128
Dot6 and its paralog Tod6 are both Myb-like transcription factors that
repress Ribi genes in the budding yeast (Lippman and Broach 2009; Huber
et al. 2011). To investigate the role of Dot6 in Start control in C. albicans,
we performed genome-wide transcriptional profiling by microarray. G1-
cells of both dot6 mutants and the parental WT strain were collected by
centrifugal elutriation and their transcriptomes were characterized. Gene
Set Enrichment Analysis (GSEA) was used to correlate the dot6 transcript
profile with C. albicans genome annotations and gene lists from other
transcriptional profiles experiments (Subramanian et al. 2005; Sellam et
al. 2012) (Table S3). dot6 mutant was unable to activate properly genes
with functions mainly associated with protein translation, including
ribosome biogenesis and structural constituents of the ribosome (Figure
3A). This suggest that, in contrast to the role of its ortholog in S.
cerevisiae, Dot6 in C. albicans is an activator of Ribi. Analysis of the
promoter region of the transcript downregulated in dot6 (transcript with
1.5-fold reduction using 5% FDR—Tables S4 and S5) showed the
occurrence of the PAC motif bound by Dot6 in all promoters of genes
related to Ribi (Figure 3B). Furthermore, transcripts downregulated in
dot6 exhibited correlation with the set of genes downregulated in the
presence of the TOR complex inhibitor, rapamycin (Bastidas et al. 2009).
This suggest that the evolutionary conserved Ribi transcription control by
TOR is mediated fully or partially through Dot6. In support of the role of
Dot6 in transcriptional control of Ribi genes, and, thus, translation, a dot6
mutant exhibited an increased sensitivity to the protein translation
inhibitor cycloheximide as compared to WT and revertant strains (Figure
3C).
The transcriptional programs characterizing the cell cycle G1/S transition
in C. albicans (Côte et al. 2009) were hyperactivated in a dot6 mutant,
which further supports the role of Dot6 as a negative regulator of G1/S
transcription and Start (Figure 3A). Interestingly, dot6-upregulated
transcripts showed a significant correlation with those activated in the
![Page 149: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/149.jpg)
129
deletion mutant of the negative regulator of Start in C. albicans, Nrm1 (Ofir
et al. 2012; Sellam et al. 2016).
We used a GFP reporter assay to validate the role of the Dot6-binding PAC
elements in Ribi transcriptional regulation. We mutated the PAC motif of
the PNO1 genes encoding an essential protein required for rRNA
processing (Tone and Toh 2002), and replaced the PNO1 ORF by GFP. GFP
activity was reduced by 70% when the PAC motif was mutated (pPNO1-
mut) as compared to the intact WT pPNO1-GFP construct (Figure 3D). A
similar trend was observed when pPNO1-GFP was expressed in the dot6
mutant, reinforcing the fact that Dot6 recognize the PAC motif in C.
albicans.
Dot6 localization is regulated by the TOR signalling pathway
TOR is a central signaling circuit that controls cellular growth in response
to environmental nutrient status and stress in eukaryotes. In S. cerevisiae,
the transcription factor Sfp1 and the AGC kinase Sch9 are critical effectors
of the TOR pathway and form part of a dynamic, nutrient-responsive
network that controls the expression of Ribi genes, ribosomal protein
genes and cell size (Jorgensen et al. 2004; Urban et al. 2007; Lempiäinen
et al. 2009). In S. cerevisiae, both sch9 and sfp1 mutants are impervious to
carbon source effects on Start (Jorgensen et al. 2004). In C. albicans, while
sfp1 and sch9 mutants have the expected small size phenotype (Sellam et
al. 2016), they still retain the ability to respond to carbon source shifts,
unlike their S. cerevisiae counterparts (Figure S1). This suggests that the
Sfp1-Sch9 regulatory circuit had rewired, and is unlikely to rely on the
nutrient status of the cell to Start control in C. albicans.
To assess whether the nutrient-sensitive TOR pathway communicates the
nutrient status to Dot6, we first tested whether altering TOR activity by
rapamycin could alter the subcellular localization of the Dot6-GFP fusion.
![Page 150: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/150.jpg)
130
In the absence of rapamycin, Dot6-GFP was localized exclusively in the
nucleus, in agreement with its role as a transcriptional activator under a
nutrient-rich environment (Figure 4, A–C). A weak GFP signal was also
observed in the nucleolus and the vacuole. When cells were treated with
rapamycin, Dot6-GFP was rapidly relocalized to the vacuole, and only a
small fraction remain in the nucleus (Figure 4, D–F). The vacuolar
localization of the Dot6-GFP was confirmed by its colocalization with the
CellTracker Blue-stained vacuoles (Figure S2). These data suggest that the
TOR pathway regulates the transcriptional function of Dot6. We also
exanimated the effect of modulating TOR activity on the protein level of
Dot6 using western blot. The level of Dot6 was significantly reduced in
cells exposed to rapamycin, suggesting that, in addition to the control of
Dot6 cellular localization, the TOR pathway also modulates the stability of
Dot6 (Figure 4G).
To assess whether the control of Dot6 activity by TOR impacts the cell size
of C. albicans, we examined genetic interactions between TOR1 and DOT6
by size epistasis. As TOR1 is an essential gene in C. albicans, we first tried
to delete one allele in dot6 homozygous mutant. However, all attempts to
generate such mutant were unsuccessful, suggesting a haplo-essentiality
of TOR1 in dot6 mutant background. Subsequently, we analyzed genetic
interaction of TOR1 and DOT6 using the complex haploinsufficiency (CHI)
concept by deleting one allele of each gene, and measured the size
distribution of the obtained mutant. While both DOT6/dot6 and
TOR1/Tor1 mutants had no discernable size defect, the TOR1/tor1
DOT6/dot6 strain exhibited a cell size distribution similar to that of
dot6/dot6, suggesting that DOT6 is epistatic to TOR1 (Figure 4H).
Similarly, DOT6 was also epistatic to TOR1 with respect to their sensitivity
toward rapamycin (Figure 4I). These data demonstrate that the TOR
pathway controls cell size through Dot6.
![Page 151: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/151.jpg)
131
Dot6 is required for carbon-source modulation of cell size
The effect of different carbon sources on the size distribution of WT and
the dot6 mutant was assessed. While the cell size of WT and the revertant
strains was reduced by 12% (47.6 ± 0.5 fL) when grown under the poor
carbon source, glycerol, as compared to glucose (54.2 ± 0.5 fL), dot6 size
remain unchanged regardless of carbon source (Figure 4, J and K). A
similar finding was obtained when comparing cells growing on the
nonfermentable carbon source, ethanol (data not shown). These results
demonstrate that the transcription factor Dot6 is required for nutrient
modulation of cell size.
To check whether Dot6 localization is modulated by carbon sources, the
subcellular localization of the Dot6-GFP fusion was tested in cells that
grew in poor (glycerol), or in the absence of, carbon sources. Neither the
absence nor the quality of the carbon source altered the nuclear
localization of Dot6 (data not shown). This suggests that Dot6 governs the
carbon-source modulation of cell size through a mechanism that is
independent of its cellular relocalization.
The CTG-clade specific acidic domain of Dot6 is required for size
control in response to nonfermentable carbon sources
Our analysis unexpectedly reveals that Dot6 switched between activator
and repressor transcriptional regulator of Ribi between C. albicans and S.
cerevisiae, respectively. Sequence examination of C. albicans Dot6 protein
revealed a C-terminal aspartate-rich domain that is similar to acidic
activation domains of transcriptional activators. This Dot6 D-rich domain
was found specifically in C. albicans and other related species of the CTG
clade, and was absent in Dot6 orthologs in S. cerevisiae and other
ascomycetes (Figure 5A). To check whether the presence of this acidic
domain correlates with its function as transcriptional activator in C.
albicans, we deleted this D-rich domain using the CRISPR-Cas9
![Page 152: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/152.jpg)
132
mutagenesis tool. Size distribution of the truncated DOT6-Δ[1555–1803]
strain was indistinguishable from that of the WT parental strain when cells
grew on YP with glucose (YPD) (Figure 5B) or other fermentable sugars
(YP-fructose, YP-galactose, YP-sucrose, and YP-mannose; data not shown).
The ability of DOT6-Δ[1555–1803] to activate two Ribi transcripts (DBP7
and KRE33) in YP-glucose was preserved, which suggests that this domain
is dispensable for the size control and gene expression activation functions
in response to fermentable carbon sources (Figure 5C). When C. albicans
cells were grown on nonfermentable carbon sources such as glycerol,
ethanol, or lactate, the DOT6-Δ[1555–1803] mutant exhibited a reduced
size as compared to the WT strain (Figure 5D). The two Ribi transcripts
DBP7 and KRE33 were downregulated in the DOT6-Δ[1555–1803] mutant
as compared to WT when cells utilized either glycerol or lactate as carbon
sources (Figure 5E). This suggest that the D-rich domain of Dot6 is
required to activate Ribi genes and adjust cell size under conditions of
respiratory growth.
![Page 153: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/153.jpg)
133
3.2.5 - Discussion
Although both C. albicans and S. cerevisiae share the core cell cycle and
growth regulatory machineries, our previous investigations uncovered a
limited overlap of the cell size phenome between the two fungi (Sellam et
al. 2016; Chaillot et al. 2017). This finding is corroborated by recent
evidence showing an extensive degree of rewiring and plasticity of both
transcriptional regulatory circuits and signaling pathways across many
cellular and metabolic processes between the two yeasts (Homann et al.
2009; Lavoie et al. 2009, 2010; Blankenship et al. 2010; Li and Johnson
2010; Childers et al. 2016). The plasticity of the global size network
underscores the evolutionary impact of cell size as an adaptive mechanism
to optimize fitness. Indeed, many size genes in C. albicans were linked to
virulence, which suggests that cell size is an important biological trait that
contributes to the adaptation of fungal pathogens to their different niches
(Sellam et al. 2016; Chaillot et al. 2017). So far, the requirement of Dot6
for the fitness of C. albicans inside its host has not yet been tested;
however, inactivation of DOT6 led to the alteration of sensitivity toward
antifungals (Vandeputte et al. 2012). Moreover, while dot6 mutant was
able to form invasive filaments, the size of hyphae cells was significantly
reduced, which might impact the invasiveness of host tissues and organs
(Figure 1, E and F). This reinforces the fact that control of cell size
homeostasis is an important attribute for C. albicans to persist inside its
host.
We found that Dot6 is a major regulator of cell size in C. albicans as
compared to S. cerevisiae, emphasizing an evolutionary drift regarding the
contribution of this transcription factor in size modulation. The potency of
the C. albicans Dot6 in size control could be attributed to different facts.
First, and in contrast to its role in S. cerevisiae, Dot6 is an activator of Ribi
genes. This might explain the small size of dot6 in C. albicans given the
![Page 154: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/154.jpg)
134
fact that inactivation of transcriptional activators of Ribi genes such as
Sfp1 and Sch9 in either S. cerevisiae or C. albicans led to the acceleration
of Start, and, consequently, to a whi phenotype (Jorgensen et al. 2002;
Dungrawala et al. 2012; Soifer and Barkai 2014; Sellam et al. 2016;
Chaillot et al. 2017). Second, in C. albicans, Dot6 had an expanded genetic
connectivity with both the critical SBF complex, which controls the G1/S
transition, and also with the TOR growth and Ribi machineries, which
might explain the influential role of Dot6 in size control.
Our findings support a model whereby Dot6 acts as a hub that might
integrate directly growth cues via the TOR pathway to control the
commitment to mitotic division at G1. This regulatory behavior is similar
to the p38/HOG1 pathway that controls the Ribi regulon through the
master transcriptional regulator, Sfp1, and acts upstream of the SBF
transcription factor complex to control division (Sellam et al. 2016).
Meanwhile, our genetic interaction analysis showed that the dot6 hog1
double mutant had an additive small size phenotype, suggesting that both
Dot6 and Hog1 act in parallel. This finding emphasizes that, in C. albicans,
multiple signals are integrated at the level of G1 machinery to optimize
adaptation to different conditions. Contrary to the p38/HOG pathway,
Dot6 was required for size adjustment in response to glycerol, suggesting
that this transcription factor provides a nexus for integrating carbon
nutrient status to the ribosome synthesis and Start machineries (Figure
6).
Compared to other hemi-ascomycetes, Candida species of the CTG-clade
possess a Dot6 with a C-terminal D-rich domain that resembles the acidic
activation domains found in many transcriptional activators. We have
shown that deletion of the D-rich domain had no impact on C. albicans
cells size or the transcription of Ribi genes when cells grew in media with
fermentable carbon sources. However, in the presence of a nonfermentable
![Page 155: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/155.jpg)
135
carbon source, the D-rich domain was required for both size homeostasis
and Ribi transcription. These data suggest that the D-rich domain of Dot6
might function as a transcriptional activation domain of Ribi genes to
promote growth, and, consequently, set a homeostatic cell size when C.
albicans cells undergo respiratory growth. Previous investigations had
shown that D-rich domains play multiple roles in gene transcription
regulation through DNA mimicry to modulate mRNA processing and the
activity of the general transcription machinery (Chou and Wang 2015). For
instance, the D-rich domain of Taf1 exerts an inhibitory effect on
transcription by competing with the TFIIA complex in binding TBP (TATA-
box binding protein). For Dot6, the D-rich domain might behave similarly
by competing with other transcriptional regulators that coordinate the
transcription of Ribi with respiratory metabolism. A plausible
interpretation of the small size of the truncated DOT6-Δ[1555–1803] strain
is that Ribi promoters are modulated by a transcriptional repressor under
respiratory growth, and, in the absence of the D-rich competitor domain,
Ribi are repressed, which, in turn, might lead to Start acceleration and the
whi phenotype.
How Dot6 switches its function from a transcriptional Ribi repressor in S.
cerevisiae to an activator in C. albicans is an intriguing question. Under
respiratory growth conditions, this might be explained by the fact that the
potential D-rich activation domain was lost in S. cerevisiae, as discussed
above. However, under fermentative growth, the D-rich domain was
dispensable for size control and Ribi activation. For their repressive activity
at the Ribi gene promoters in S. cerevisiae, both Dot6 and Tod6 recruit the
histone deacetylase Rpd3L to establish a repressive chromatin state
(Huber et al. 2011). Instead of a repressive chromatin-modifying complex,
C. albicans Dot6 might recruit an activator that might impose its Ribi-
activating function. However, so far, no such chromatin-modifying
activator complex has been identified in C. albicans. Future studies are
![Page 156: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/156.jpg)
136
needed to characterize the contribution of chromatin remodelling and
modification complexes to Ribi transcription in this opportunistic yeast.
![Page 157: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/157.jpg)
137
3.2.6 - Acknowledgments
We are grateful to James Broach (Princeton University), Robbie Loewith
(Université de Genève), Julia Köhler (Harvard Medical School), and
Dominique Sanglard [Le Centre Hospitalier Universitaire Vaudois (CHUV)-
Université Lausanne] for providing strains. We would like to thank
Christian Landry and Aléxandre Dubé [Université Laval-L’Institut de
biologie intégrative et des systèmes (IBIS)] for sharing the pAG415GPD-
ccdB plasmids. This work was supported by grants from the Natural
Sciences and Engineering Research Council of Canada (#06625), the
Canadian Foundation for Innovation and the Fonds de Recherche du
Québec-Santé. J.C. was supported by a Université Laval Faculty of
Medicine and Centre Hospitalier Universitaire de Québec (CHUQ)
foundation Ph.D. scholarships. A.S. was supported by a Fonds de
Recherche du Québec-Santé (FRQS) J1 salary award.
![Page 158: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/158.jpg)
138
3.2.7 - References
Bastidas R. J., Heitman J., Cardenas M. E., 2009 The protein kinase
Tor1 regulates adhesin gene expression in Candida albicans. PLoS Pathog.
5: e1000294. doi:10.1371/journal.ppat.1000294
Berman J., 2006 Morphogenesis and cell cycle progression in Candida
albicans. Curr. Opin. Microbiol. 9: 595–601.
doi:10.1016/j.mib.2006.10.007
Blankenship J. R., Fanning S., Hamaker J. J., Mitchell A. P., 2010 An
extensive circuitry for cell wall regulation in Candida albicans. PLoS
Pathog. 6: e1000752. doi:10.1371/journal.ppat.1000752
Chaillot J., Cook M. A., Corbeil J., Sellam A., 2017 Genome-wide screen
for haploinsufficient cell size genes in the opportunistic yeast Candida
albicans. G3 (Bethesda) 7: 355–360. doi:10.1534/g3.116.037986
Chen D. C., Yang B. C., Kuo T. T., 1992 One-step transformation of yeast
in stationary phase. Curr. Genet. 21: 83–84. doi:10.1007/BF00318659
Childers D. S., Raziunaite I., Mol Avelar G., Mackie J., Budge S., et al.,
2016 The rewiring of ubiquitination targets in a pathogenic yeast
promotes metabolic flexibility, host colonization and virulence. PLoS
Pathog. 12: e1005566. doi:10.1371/journal.ppat.1005566
Chou C. C., Wang A. H., 2015 Structural D/E-rich repeats play multiple
roles especially in gene regulation through DNA/RNA mimicry. Mol.
Biosyst. 11: 2144–2151. doi:10.1039/C5MB00206K
Costanzo M., Nishikawa J. L., Tang X., Millman J. S., Schub O., et al.,
2004 CDK activity antagonizes Whi5, an inhibitor of G1/S transcription
in yeast. Cell 117: 899–913. doi:10.1016/j.cell.2004.05.024
Côte P., Hogues H., Whiteway M., 2009 Transcriptional analysis of the
Candida albicans cell cycle. Mol. Biol. Cell 20: 3363–3373.
doi:10.1091/mbc.e09-03-0210
de Bruin R. A., McDonald W. H., Kalashnikova T. I., Yates J. III.,
Wittenberg C., 2004 Cln3 activates G1-specific transcription via
phosphorylation of the SBF bound repressor Whi5. Cell 117: 887–898.
doi:10.1016/j.cell.2004.05.025
![Page 159: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/159.jpg)
139
Dungrawala H., Hua H., Wright J., Abraham L., Kasemsri T., et al., 2012
Identification of new cell size control genes in S. cerevisiae. Cell Div. 7: 24.
doi:10.1186/1747-1028-7-24
Enfert C., Hube B., 2007 Candida: Comparative and Functional
Genomics. Caister Academic Press, Wymondham, Norfolk, UK.
Gola S., Martin R., Walther A., Dunkler A., Wendland J., 2003 New
modules for PCR-based gene targeting in Candida albicans: rapid and
efficient gene targeting using 100 bp of flanking homology region. Yeast 20:
1339–1347. doi:10.1002/yea.1044
Guillemette T., Sellam A., Simoneau P., 2004 Analysis of a nonribosomal
peptide synthetase gene from Alternaria brassicae and flanking genomic
sequences. Curr. Genet. 45: 214–224. doi:10.1007/s00294-003-0479-z
Homann O. R., Dea J., Noble S. M., Johnson A. D., 2009 A phenotypic
profile of the Candida albicans regulatory network. PLoS Genet. 5:
e1000783. doi:10.1371/journal.pgen.1000783
Huber A., French S. L., Tekotte H., Yerlikaya S., Stahl M., et al., 2011
Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the
histone deacetylase complex RPD3L. EMBO J. 30: 3052–3064.
doi:10.1038/emboj.2011.221
Jorgensen P., Tyers M., 2004 How cells coordinate growth and division.
Curr. Biol. 14: R1014–R1027. doi:10.1016/j.cub.2004.11.027
Jorgensen P., Nishikawa J. L., Breitkreutz B. J., Tyers M., 2002
Systematic identification of pathways that couple cell growth and division
in yeast. Science 297: 395–400. doi:10.1126/science.1070850
Jorgensen P., Rupes I., Sharom J. R., Schneper L., Broach J. R., et al.,
2004 A dynamic transcriptional network communicates growth potential
to ribosome synthesis and critical cell size. Genes Dev. 18: 2491–2505.
doi:10.1101/gad.1228804
Kafri M., Metzl-Raz E., Jona G., Barkai N., 2016 The cost of protein
production. Cell Rep. 14: 22–31. doi:10.1016/j.celrep.2015.12.015
Lavoie H., Sellam A., Askew C., Nantel A., Whiteway M., 2008 A toolbox
for epitope-tagging and genome-wide location analysis in Candida
albicans. BMC Genomics 9: 578. doi:10.1186/1471-2164-9-578
![Page 160: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/160.jpg)
140
Lavoie H., Hogues H., Whiteway M., 2009 Rearrangements of the
transcriptional regulatory networks of metabolic pathways in fungi. Curr.
Opin. Microbiol. 12: 655–663. doi:10.1016/j.mib.2009.09.015
Lavoie H., Hogues H., Mallick J., Sellam A., Nantel A., et al., 2010
Evolutionary tinkering with conserved components of a transcriptional
regulatory network. PLoS Biol. 8: e1000329.
doi:10.1371/journal.pbio.1000329
Lempiäinen H., Uotila A., Urban J., Dohnal I., Ammerer G., et al., 2009
Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR
signaling. Mol. Cell 33: 704–716. doi:10.1016/j.molcel.2009.01.034
Lenski R. E., Travisano M., 1994 Dynamics of adaptation and
diversification: a 10,000-generation experiment with bacterial populations.
Proc. Natl. Acad. Sci. USA 91: 6808–6814. doi:10.1073/pnas.91.15.6808
Li H., Johnson A. D., 2010 Evolution of transcription networks–lessons
from yeasts. Curr. Biol. 20: R746–R753. doi:10.1016/j.cub.2010.06.056
Lippman S. I., Broach J. R., 2009 Protein kinase A and TORC1 activate
genes for ribosomal biogenesis by inactivating repressors encoded by Dot6
and its homolog Tod6. Proc. Natl. Acad. Sci. USA 106: 19928–19933.
doi:10.1073/pnas.0907027106
Marion R. M., Regev A., Segal E., Barash Y., Koller D., et al., 2004 Sfp1 is
a stress- and nutrient-sensitive regulator of ribosomal protein gene
expression. Proc. Natl. Acad. Sci. USA 101: 14315–14322.
doi:10.1073/pnas.0405353101
Merico D., Isserlin R., Stueker O., Emili A., Bader G. D., 2010
Enrichment map: a network-based method for gene-set enrichment
visualization and interpretation. PLoS One 5: e13984.
doi:10.1371/journal.pone.0013984
Ofir A., Hofmann K., Weindling E., Gildor T., Barker K. S., et al., 2012
Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene
expression and DNA replication stress response. Mol. Microbiol. 84: 778–
794. doi:10.1111/j.1365-2958.2012.08056.x
Saito R., Smoot M. E., Ono K., Ruscheinski J., Wang P. L., et al., 2012 A
travel guide to Cytoscape plugins. Nat. Methods 9: 1069–1076.
doi:10.1038/nmeth.2212
![Page 161: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/161.jpg)
141
Sandai D., Yin Z., Selway L., Stead D., Walker J., et al., 2012 The
evolutionary rewiring of ubiquitination targets has reprogrammed the
regulation of carbon assimilation in the pathogenic yeast Candida
albicans. MBio 3: pii: e00495-12. doi:10.1128/mBio.00495-12
Schaub Y., Dunkler A., Walther A., Wendland J., 2006 New pFA-
cassettes for PCR-based gene manipulation in Candida albicans. J. Basic
Microbiol. 46: 416–429. doi:10.1002/jobm.200510133
Schmoller K. M., Skotheim J. M., 2015 The biosynthetic basis of cell size
control. Trends Cell Biol. 25: 793–802. doi:10.1016/j.tcb.2015.10.006
Sellam A., Tebbji F., Nantel A., 2009 Role of Ndt80p in sterol metabolism
regulation and azole resistance in Candida albicans. Eukaryot. Cell 8:
1174–1183. doi:10.1128/EC.00074-09
Sellam A., Tebbji F., Whiteway M., Nantel A., 2012 A novel role for the
transcription factor Cwt1p as a negative regulator of nitrosative stress in
Candida albicans. PLoS One 7: e43956.
doi:10.1371/journal.pone.0043956
Sellam A., van het Hoog M., Tebbji F., Beaurepaire C., Whiteway M., et al.,
2014 Modeling the transcriptional regulatory network that controls the
early hypoxic response in Candida albicans. Eukaryot. Cell 13: 675–690.
doi:10.1128/EC.00292-13
Sellam A., Chaillot J., Mallick J., Tebbji F., Richard Albert J., et al., 2016
A systematic cell size screen uncovers coupling of growth to division by the
p38/HOG network in Candida albicans. bioRxiv.
https://doi.org/10.1101/094144
Soifer I., Barkai N., 2014 Systematic identification of cell size regulators
in budding yeast. Mol. Syst. Biol. 10: 761. doi:10.15252/msb.20145345
Subramanian A., Tamayo P., Mootha V. K., Mukherjee S., Ebert B. L., et
al., 2005 Gene set enrichment analysis: a knowledge-based approach for
interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA
102: 15545–15550. doi:10.1073/pnas.0506580102
Tone Y., Toh E. A., 2002 Nob1p is required for biogenesis of the 26S
proteasome and degraded upon its maturation in Saccharomyces
cerevisiae. Genes Dev. 16: 3142–3157. doi:10.1101/gad.1025602
↵
![Page 162: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/162.jpg)
142
Turner J. J., Ewald J. C., Skotheim J. M., 2012 Cell size control in yeast.
Curr. Biol. 22: R350–R359. doi:10.1016/j.cub.2012.02.041
Tyers M., Tokiwa G., Futcher B., 1993 Comparison of the Saccharomyces
cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2
and other cyclins. EMBO J. 12: 1955–1968. doi:10.1002/j.1460-
2075.1993.tb05845.x
Urban J., Soulard A., Huber A., Lippman S., Mukhopadhyay D., et al.,
2007 Sch9 is a major target of TORC1 in Saccharomyces cerevisiae. Mol.
Cell 26: 663–674. doi:10.1016/j.molcel.2007.04.020
Vandeputte P., Pradervand S., Ischer F., Coste A. T., Ferrari S., et al., 2012
Identification and functional characterization of Rca1, a transcription
factor involved in both antifungal susceptibility and host response in
Candida albicans. Eukaryot. Cell 11: 916–931. doi:10.1128/EC.00134-12
Vyas V. K., Barrasa M. I., Fink G. R., 2015 A Candida albicans CRISPR
system permits genetic engineering of essential genes and gene families.
Sci. Adv. 1: e1500248. doi:10.1126/sciadv.1500248
Zhu C., Byers K. J., McCord R. P., Shi Z., Berger M. F., et al., 2009 High-
resolution DNA-binding specificity analysis of yeast transcription factors.
Genome Res. 19: 556–566. doi:10.1101/gr.090233.108
![Page 163: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/163.jpg)
143
3.2.8 - Figures
Figure 1. Dot6 is required for Start onset and cell size homeostasis.
(A) Size distributions of the WT (SFY87), dot6 mutant, and the revertant
strains. The median sizes of each strain are indicated in parentheses. (B)
Growth of the WT (SFY87), dot6 mutant, and the revertant (dot6 p-DOT6)
strains in YPD medium at 30°C as determined by cell counts using the Z2-
Coulter Counter. Results are the mean of three replicates. Doubling-times
![Page 164: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/164.jpg)
144
during the exponential phase of the growth for each strain are indicated in
parentheses. (C and D) Start characterization of dot6. (C) Elutriated G1
phase daughter cells were released into fresh YPD medium and assessed
for bud emergence as a function of size and G1/S transcription (D). RNR1
and PCL2 transcript levels were assessed by quantitative real-time PCR
and normalized to ACT1 levels. (E and F) Dot6 is required for size
homeostasis of hyphal cells. Fluorescence micrographs of both WT (SFY87)
and dot6 mutant on YPD supplemented with 10% fetal bovine serum (FBS)
at 37°C for 3 hr and stained with calcofluor white (E). Bar, 10 µm. (F)
Length of at least 20 hyphal cells of both WT (SFY87) and dot6 mutant.
Bars represent the means ± SEs of the means. * P < 0.0003 using a two-
tailed t-test. (G) C. albicans DOT6 (CaDOT6) failed to complement size
defect of the S. cerevisiae dot6 tod6 double mutant. Size distributions of
the S. cerevisiae WT (Y2092) and dot6 tod6 (Y3707) strains expressing, or
not, CaDOT6.
![Page 165: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/165.jpg)
145
Figure 2. DOT6 size epistasis. Evaluation of size epistasis between dot6
and different potent Start mutations. DOT6 was inactivated in sch9 (A),
sfp1 (B), hog1 (C), and swi4 (D) mutants, and the resulted double mutant
strains were analyzed for cell size distribution. (E) SWI4 deletion is
epistatic to DOT6 regarding the growth rate. Cells were grown in YPD
medium at 30°C under agitation, and cells were counted using the Z2-
Coulter Counter. Results are the mean of three replicates. (F) Summary of
DOT6 genetic interactions with the C. albicans Start machinery.
![Page 166: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/166.jpg)
146
Figure 3. Dot6 is a positive regulator of ribosome biogenesis genes. (A)
GSEA analysis of differentially expressed genes in a dot6 mutant relative to
the WT strain (SFY87). Cells were synchronized in G1 phase by centrifugal
elutriation, released in fresh SC medium for 10 min, and analyzed for gene
expression profiles by DNA microarrays. Correlations of dot6 upregulated
(red circles) and downregulated (blue circles) transcripts are shown for
![Page 167: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/167.jpg)
147
biological processes, gene lists in different C. albicans mutants and
experiments. The diameter of the circle reflects the number of modulated
gene transcripts in each gene set. Known functional connections between
related processes are indicated (green lines). Images were generated in
Cytoscape with the Enrichment Map plug-in. (B) Occurrence of the PAC
motif in the promoters of Dot6-modulated Ribi genes. The 400 bp sequence
upstream the start codon of downregulated genes in dot6 (transcript with
1.5-fold reduction using 5% FDR) were scanned for the GATGAG motif. (C)
Effect of the translation inhibitor cycloheximide on the growth of the WT
(SFY87), dot6 mutant, and the revertant (dot6 p-DOT6) strains. Strains
were grown on in SC medium at 30°C for 24 hr. Relative growth was
calculated as fraction of OD600 of cycloheximide-treated cells relatively to
the nontreated controls. Results are the mean of three replicates. (D) GFP
reporter assay to confirm that the transcription at the PNO1 (Orf19.7618)
locus is driven by the Dot6 PAC-binding element. The pPNO1-GFP reporter
strain was constructed by replacing one copy of the PNO1 ORF by the GFP
ORF. Mutation in the PAC motif of the pPNO1-mut strain was introduced
by PCR using the forward primer pPNO1mut-GFP-F. GFP fluorescence was
measured by flow cytometry, and results are presented as relative mean
GFP fluorescence as compared to pPNO1-GFP construct in the WT strain.
Bars show the means ± SEM. NS, not significant (P > 0.15).
![Page 168: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/168.jpg)
148
Figure 4. Dot6 localization is regulated by the TOR signaling pathway.
(A–F) Dot6-GFP fluorescence was visualized using confocal microscopy in
cells treated (D–F) or not (A–C) with the TOR pathway inhibitor,
rapamycin. Exponentially grown cells in SC medium were treated with 100
ng/ml rapamycin for 1 hr. Nuclear and mitochondrial DNA were
demarcated by DAPI staining (B and E). Red arrows indicate Dot6-GFP
florescence in nucleolar regions. Bar, 5 µm. (G) Level of Dot6 in
![Page 169: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/169.jpg)
149
exponentially grown cells in SC medium treated or not with 100 ng/ml
rapamycin for 15, 30, 60, and 120 min. Vector control corresponds to the
untagged strain. (H and I) DOT6 and TOR1 genetic interaction for cell size
and growth in the presence of rapamycin based on complex
haploinsufficiency concept. (H) Size distributions of the WT (SN250), the
heterozygous (DOT6/dot6), and homozygous (dot6/dot6) dot6 mutants, the
heterozygous TOR1/tor1 strain and the double heterozygous mutant
TOR1/tor1 DOT6/dot6. (I) DOT6 is epistatic to TOR1 with respect to their
sensitivity toward rapamycin. Strains were grown on in SC medium at
30°C for 24 hr. Relative growth was calculated as fraction of OD600 of
rapamycin-treated cells relatively to the nontreated controls. Results are
the mean of three replicates. (J and K) Dot6 is required for carbon-source
modulation of cell size. (J) Cell size distribution of the WT and dot6 mutant
strains grown in medium with either glucose or glycerol as the sole source
of carbon. (K) Median size of the WT (SFY87), dot6 mutant and the
revertant strains growing in synthetic glucose or glycerol medium. Results
are the mean of three independent replicates.
![Page 170: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/170.jpg)
150
Figure 5. The CTG-clade specific acidic domain of Dot6 is required for
size control in response to nonfermentable carbon sources. (A) The C-
terminal D-rich domain of Dot6 is conserved in the CTG clade species C.
albicans (Ca), C. parapsilosis (Cp) and C. dubliniensis (Cd), but not in S.
cerevisiae (Sc) and C. glabrata (Cg). Identical residues are indicated with
asterisks. Conserved and semiconserved substitutions are denoted by
colons and periods, respectively. (B) Cell size distribution of the WT
(SC5314) and the truncated DOT6-Δ[1555–1803] strains. (C) Transcript
levels of Ribi genes, including DBP7 and KRE33, were evaluated in both
WT (SC5314) and the truncated DOT6-Δ[1555–1803] strains. Transcript
levels were calculated using the comparative CT method using the ACT1
![Page 171: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/171.jpg)
151
gene as a reference. Results are the mean of three replicates. For each
transcript, fold changes in the WT and the truncated strains were not
statistically significant (t-test). NS, not significant. (D) Median size of the
WT (SC5314), dot6, and the truncated DOT6-Δ[1555–1803] strains growing
in YP-glucose, YP-glycerol, YP-ethanol, and YP-lactate media. Results are
the mean of three independent replicates. * P < 0.02; ** P < 0.01; (E)
Transcript levels of Ribi genes, DBP7, and KRE33 in both WT (SC5314) and
the truncated DOT6-Δ[1555–1803] strains growing in fermentable (glucose)
and nonfermentable carbon sources (glycerol and lactate). Values
represent transcript levels of DBP7 and KRE33 in cells growing in glycerol
or lactate normalized to that of cells growing in glucose. Results are the
mean of three replicates.
![Page 172: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/172.jpg)
152
Figure 6. Schematic model of connections between Dot6 and Start
control machinery in C. albicans.
![Page 173: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/173.jpg)
153
Figure S1
![Page 174: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/174.jpg)
154
Figure S2
![Page 175: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/175.jpg)
155
Chapitre 4 - Caractérisation d’un nouveau
régulateur de la taille : Ahr1
4.1 - Le mutant ahr1 présente un phénotype de petite taille
Dans nos criblages présentés dans les Chapitres 1 et 2, nous avons
identifié le mutant ahr1 comme un mutant de petite taille. Ahr1 est un
facteur de transcription à doigt de zinc. Ce facteur de transcription a un
rôle dans dans la transition phénotypique (White/Opaque), dans le
métabolisme des acides aminés et dans l’activation des gènes codants pour
des adhésines, qui ont un rôle critique dans la formation des biofilms et
l’attachement aux cellules de l’hôte (Askew et al. 2011; Wang, Song, et al.
2011; Vylkova and Lorenz 2017). Le mutant de délétion ahr1 présente une
virulence atténuée (Askew et al. 2011). L’analyse de séquence suggère
qu’Ahr1 est un gène spécifique du clade CTG.
Cultivé en milieu riche et en phase exponentielle, le mutant ahr1 a un
volume d’environ 40 fL, alors que la souche de référence a un volume de
50 fL, il y a donc une diminution de la taille cellulaire de 20% (Figure 14).
Nous avons créé une souche dans laquelle nous avons intégré le gène
sauvage AHR1 dans le mutant de délétion ahr1 (ahr1 p-AHR1). Cette
souche a une taille comparable à la souche sauvage, ce qui prouve que le
phénotype de petite taille du mutant ahr1 est bien une conséquence de la
délétion du gène ahr1 suggérant que Ahr1 est un régulateur de la taille
cellulaire (Figure 14).
![Page 176: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/176.jpg)
156
Figure 14 - Distribution de la taille du mutant ahr1, du révertant et de la souche sauvage.
Nous avons réalisé une courbe de croissance afin de tester si le défaut de
taille est dû à un défaut de croissance qui pourrait provoquer une
accumulation de cellules en G1 et donc une population de plus petite
taille. Le mutant ahr1 n’a pas de défaut de croissance comparé à la souche
sauvage (Figure 15), donc le phénotype de petite taille n’est pas la
conséquence d’un défaut de croissance.
![Page 177: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/177.jpg)
157
Figure 15 - Courbes de croissance du mutant ahr1 et du WT.
Enfin, nous avons testé si le mutant ahr1 a un défaut de taille en forme
hyphe. Pour cela, nous avons mesuré la distance entre deux septums. La
distance entre deux septums est plus petite dans le mutant ahr1 par
rapport à la souche sauvage (Figure 16). Ahr1 est donc un régulateur de
la taille cellulaire sous forme levuriforme et filamenteuse.
![Page 178: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/178.jpg)
158
Figure 16 - Taille des hyphes du mutant ahr1 et du révertant.
4.2 - Ahr1 est un régulateur négatif de START
Nous avons testé si le défaut de taille du mutant ahr1 résulte d’une
dérégulation de START. Pour cela nous avons isolé des cellules en phase
G1 par élutriation et nous les avons relâchées dans un milieu frais. Nous
avons déterminé le pourcentage de cellules avec un bourgeon, marqueur
d’entrée en phase S, en fonction de la taille. Pour la souche sauvage, 50%
des cellules ont un bourgeon à une taille de 50 fL. Pour le mutant ahr1,
50% des cellules ont un bourgeon à une taille de 20 fL (Figure 17). Ceci
suggère que START est accéléré dans le mutant, par rapport à la souche
sauvage, ce qui est cohérant avec le phénotype de petite taille du mutant
ahr1.
![Page 179: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/179.jpg)
159
Figure 17 - Budding index du mutant ahr1 et du WT
Pour appuyer ce résultat, nous avons également réalisé une RT-qPCR sur
des cellules synchronisées en phase G1 pour quantifier l’expression des
gènes RNR1 et PCL2, des gènes marqueurs de la transition G1/S, en
fonction de la taille. Ces deux gènes ont un pic d’expression à une taille
plus petite chez le mutant ahr1 (25 fL) par rapport au WT (50 fL) (Figure
18).
Figure 18 - Expression de RNR1 et PCL2 en fonction de la taille
![Page 180: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/180.jpg)
160
Le bourgeonnement ainsi que l’expression des gènes RNR1 et PCL2
montrent que START est accéléré dans le mutant. Ceci suggère qu’Ahr1 est
un régulateur négatif de START.
4.3 - Ahr1 interagit génétiquement et physiquement avec
Sch9
Pour savoir dans quelle voie de régulation se trouve Ahr1, nous avons
étudié les interactions génétiques entre Ahr1 et différents régulateurs de
START. Nous avons surexprimé Ahr1 dans différents mutants de délétion
de START (hog1, sch9, dot6, nrm1 et sfp1) afin de rechercher de l’épistasie.
Sch9 est une AGC kinase ayant un rôle dans la traduction, la virulence et
la filamentation (Liu et al. 2010). Le mutant sch9 a un phénotype de petite
taille (phénotype conservé avec S. cerevisiae) et quand nous surexprimons
AHR1 dans ce mutant de délétion, le phénotype sauvage de taille est
restauré (Figure 19). La surexpression d’AHR1 dans la souche sauvage n’a
aucun effet sur la taille. Ces résultats suggèrent qu’Ahr1 agit en aval de
Sch9.
![Page 181: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/181.jpg)
161
Figure 19 – Intéraction génétique entre SCH9 et AHR1. Distribution de la taille des
mutants ahr1, sch9 et le mutant de surexpression de Ahr1 dans le mutant sch9.
Comme nous avons mis en évidence une interaction génétique entre SCH9
et AHR1, nous avons testé s’il y a une interaction physique par Co-
immunoprécipitation. Sch9 et Ahr1 interagissent physiquement et cette
interaction n’est pas perdue en présence de la rapamycine, un inhibiteur
de la voie TOR. Ceci suggère que l’interaction est indépendante de TOR
(Figure 20). Cependant, l’intéraction détectée peut être indirecte, une
confirmation par une autre technique est nécessaire. Les interactions
génétiques et physiques suggèrent que Sch9 contrôle la fonction d’Ahr1.
![Page 182: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/182.jpg)
162
Figure 20 – Coimmunoprécipitation entre Ahr1 et Sch9. Les cellules ont été traitées avec
0,5µg/mL de rapamycine.
4.4 - Ahr1 régule la croissance suivant les acides aminés
disponibles
Afin de comprendre le rôle d’Ahr1 dans la régulation de START, nous
avons analysé le profil transcriptionnel du mutant ahr1 et de la souche
sauvage synchronisés. Pour cela, les cellules en phase G1 ont été
collectées par élutriation, relâchées dans un milieu frais, cultivées pendant
15 minutes et le transcriptome a été analysé. Nous avons utilisé la
méthode GSEA (Gene Set Enrichment Analysis) pour identifier les
processus biologiques enrichis dans les gènes réprimés et surexprimés.
Les gènes régulant le métabolisme des acides aminés, de la protéolyse, de
la glycolyse et de la traduction sont réprimés dans le mutant ahr1
(représentés en bleu) (Figure 21).
![Page 183: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/183.jpg)
163
Figure 21 - Analyse transcriptionnelle du mutant ahr1 synchronisée en phase G1/S. Les
points bleus représentent les gènes réprimés dans le mutant ahr1.
Des liens entre Ahr1 et le métabolisme ont été précédemment observés
(Askew et al. 2011; Vylkova and Lorenz 2017). Pour comprendre le lien
entre Ahr1, le métabolisme des acides aminés et la régulation de la taille,
nous avons testé la croissance du mutant ahr1 dans un milieu minimum
(MM) en faisant varier l’acide aminé disponible dans le milieu (Figure 22).
![Page 184: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/184.jpg)
164
Figure 22 - Temps de doublement des mutants ahr1 et sch9 cultivés sur différents acides
aminés. * p-value < 0.05 ; ** p-value < 0.01 ; NS = Non significatif. Trois réplicats ont été
réalisés.
Le mutant ahr1 a des défauts de croissance, comparé à la souche sauvage,
quand le seul acide aminé disponible est l’arginine, la glutamine, la serine
l’alanine, ou la proline (Figure 22).
Nous avons déterminé la taille cellulaire des souches cultivées sur les
différents acides aminés et nous avons tracés une courbe de la taille
cellulaire en fonction du temps de doublement (Figure 23). Pour la souche
WT, on observe une corrélation entre la taille cellulaire et le temps de
doublement : la taille cellulaire est plus grande quand le taux de
doublement est faible. Pour le mutant ahr1, la corrélation entre la taille et
le temps de doublement est partiellement perdue. Cultivé sur l’asparagine,
![Page 185: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/185.jpg)
165
la sérine et la proline, le mutant a une plus grande taille que la souche
sauvage. Sur les autres acides aminés testés (glutamine, alanine, valine,
proline et sulfate d’ammonium), le mutant ahr1 a une petite taille comparé
à la souche sauvage (Figure 23). Ces résultats suggèrent qu’Ahr1 est
nécessaire pour le contrôle de la croissance et de la régulation de la taille
cellulaire dépendamment des acides aminés disponibles dans le milieu.
Figure 23 - Taille cellulaire en fonction du temps de doublement du mutant ahr1.
Nous avons également analysé la distribution de la taille du mutant ahr1
en faisant varier les sources de carbone dans le milieu (glucose, glycérol,
maltose). Nous n’avons observé aucun défaut de croissance pour le mutant
ahr1. Ceci indique qu’Ahr1 a un rôle dans la régulation de la croissance et
de la taille en réponse aux sources d’azote disponible dans le milieu, et
non les sources de carbone.
4.5 - La localisation d’Ahr1 est régulée par la voie TOR
![Page 186: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/186.jpg)
166
Nous avons montré que Sch9 est un effecteur d’Ahr1. Il est connu que
Sch9 est régulé par la voie TOR chez S. cerevisiae et C. albicans
(Chowdhury and Kohler 2015). Pour tester s’il existe un lien fonctionnel
entre la voie TOR et Ahr1, nous avons analysé la localisation cellulaire
d’Ahr1 fusionné à la GFP, en absence et en présence d’un inhibiteur de la
voie TOR, la rapamycine (Figure 24). Nos résultats montrent que la
protéine Ahr1 est localisée dans le noyau en conditions de croissance
optimale. En présence de rapamycine, Ahr1 est délocalisé dans le
cytoplasme. Ceci suggère que la voie TOR contrôle la fonction d’Ahr1 en
relocalisant Ahr1 dans le cytoplasme, ce qui permettrait d’inhiber son
activité de facteur de transcription.
![Page 187: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/187.jpg)
167
Figure 24 – A) Photos de microscopie d’une souche exprimant Ahr1-GFP sans et avec
Rapamycine (100ng/mL). B) Quantification du signal de la GFP dans le noyau (N) et le
cytoplasme (C). Le ratio N/C diminue suite au traitement à la rapamycine.
![Page 188: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/188.jpg)
168
4.6 - Discussion
Malgré les ressemblances physiologiques entre S. cerevisiae et C. albicans,
de nombreux gènes orthologues ont des fonctions différentes entre les
deux espèces. Précédemment, nous avons mis en évidence que la
régulation de la taille cellulaire est un processus plastique au cours de
l’évolution et nous avons identifié des nouveaux régulateurs de la taille
cellulaire (Chapitres 1 et 2). Parmi les nouveaux régulateurs, nous avons
identifié le facteur de transcription à doigt de zinc Ahr1 comme un
régulateur de la taille. Nous avons montré qu’Ahr1 régule la taille en
modulant START.
La voie TOR est un régulateur important de la croissance cellulaire
(Loewith and Hall 2011) et de nombreux régulateurs de START sont dans
la voie TOR, comme Sfp1, Sch9 et Dot6 (Jorgensen and Tyers 2004; Huber
et al. 2011). Ici, nous avons trouvé des interactions génétiques et
physiques entre Ahr1 et Sch9. De plus, nous avons montré que l’inhibition
de l’activité de la voie TOR par la rapamycine permet la délocalisation la
protéine Ahr1. Ces résultats suggèrent que la voie TOR régule la taille
cellulaire via Ahr1 (Figure 25).
![Page 189: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/189.jpg)
169
Figure 25 – Modèle de la régulation de START chez C.albicans. La voie TOR-Sch9
contrôle START via Ahr1. Ahr1 est dans une voie parallèle des régulateurs de la
transcription des gènes RiBi Dot6 et Sfp1.
La voie TOR est également nécessaire pour contrôler la croissance en
réponse aux acides aminés disponibles dans le milieu (Kim and Guan
2011). Nous avons montré qu’Ahr1 est nécessaire pour la croissance et la
régulation de la taille quand les cellules sont cultivées sur certains acides
aminés. En effet, le mutant ahr1 a une petite taille quand il est cultivé en
milieu riche mais il a une grande taille quand il est cultivé en présence de
sérine, de proline ou d’asparagine comme seule source d’acide aminé. Le
défaut de croissance du mutant ahr1 pourrait être expliqué par les défauts
du métabolisme des acides aminés (Figure 22) (Askew et al. 2011; Vylkova
and Lorenz 2017). Ceci pourrait provoquer une diminution d’acides aminés
disponibles pour la traduction et donc provoquer des défauts de synthèse
des protéines. Nous n’avons pas trouvé de défaut de croissance en faisant
varier les sources de carbones, ce qui montre qu’Ahr1 contrôle la
croissance suivant les sources d’azotes disponibles dans le milieu et non
les sources de carbones. Pris ensemble, ces résultats suggèrent qu’Ahr1
![Page 190: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/190.jpg)
170
régule START en réponse aux acides aminés disponibles dans le milieu de
culture.
Plusieurs traits de virulences sont altérés dans le mutant ahr1.
Premièrement, le mutant ahr1 a un phénotype de petite taille. Il semble
qu’il y ait une taille cellulaire optimale dans laquelle les processus
métaboliques et les échanges avec le milieu extérieur sont optimaux
(Miettinen et al. 2017). La petite taille du mutant pourrait être un
désavantage pour la survie dans l’hôte. Deuxièmement, les mutants
auxotrophes pour certains acides aminés ne sont pas virulents, ce qui
suggère que la levure utilise des acides aminés disponibles dans l’hôte
pendant l’infection (Kingsbury and McCusker 2010; Miramon and Lorenz
2017). Les défauts de croissance du mutant ahr1 sur certains acides
aminés pourraient expliquer l’atténuation de la virulence du mutant
(Askew et al. 2011). Troisièmement, la filamentation est un processus
important dans la virulence de C. albicans (Lo et al. 1997; Saville et al.
2003). Le mutant ahr1 a la capacité de former des hyphes mais la taille des
hyphes est significativement réduite. Enfin, Ahr1 a un rôle dans
l’activation des gènes codants pour des adhésines, qui ont un rôle critique
dans la formation des biofilms et l’attachement aux cellules de l’hôte
(Askew et al. 2011).
![Page 191: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/191.jpg)
171
4.7 - Matériels et Méthodes
Conditions de culture
Les cellules ont été cultivées en milieu YPD (2% de peptones, 1% d’extrait
de levure, 2% de glucose et 50 µg/mL d’uridine) ou en milieu Synthetic
Complex (0.67% « yeast nitrogen base » avec du sulfate d’ammonium, 2%
de glucose et 0.079% de mix d’acides aminés).
L’effet des acides aminés sur la croissance et la taille a été testé sur un
milieu minimum (MM) contenant 2% de glucose, 0,17% de « yeast nitrogen
base » et 10 mM de l’acide aminé testé.
Courbes de croissance
Les cellules ont été mis en suspension à une DO600 de 0,1 puis 100 µL
ont été déposés dans une plaque 96 puits. La croissance a été mesurée par
un lecteur de plaque Sunrise™ (Tecan) à une DO600, à 30°C toutes les 10
minutes.
Interactions génétiques
L’ORF d’Ahr1 (orf19.7381) a été cloné dans le plasmide CIp-Act-cyc
(Tableau 2) (Blackwell et al. 2003). Le plasmide a été linéarisé par l’enzyme
de restriction StuI pour la transfection intégrative dans le mutant ahr1 et
les différents mutants de délétion de START pour étudier l’épistasie.
Microscopie
Ahr1 a été étiqueté dans sa région C-Terminale par la GFP (Gola et al.
2003). La visualisation de la localisation d’Ahr1-GFP a été réalisée par un
microscope confocal inversé Leica DMI6000B et une caméra CCD C9100
(Hamamatsu).
Les cellules ont été traitées à la rapamycine (100ng/mL) pendant 60
minutes et lavées une fois avec du tampon PBS. Le noyau a été marqué au
DAPI.
![Page 192: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/192.jpg)
172
Détermination de la taille critique
La taille cellulaire à START a été déterminée en traçant le pourcentage de
cellule en bourgeonnement en fonction de la taille sur des cellules
synchronisées en phase G1 obtenues en utilisant un rotor d'élutriation JE-
5.0. Des cellules en phase G1 ont été libérées dans du milieu YPD et les
fractions ont été récoltées à intervalle de 10 minutes pour surveiller le
bourgeonnement. Les niveaux de transcription des gènes RNR1, PCL2 et
ACT1 ont été évalués par qPCR.
Puces à ADN
Des cultures sur la nuit des souches ahr1 et WT ont été diluées à une
DO600 de 0,1 dans 1 L de milieu YPD, cultivées à 30°C à une DO600 de
0,8 et séparées en fonction de la taille en utilisant le système d’élutriation
Beckman JE-5.0 à 16°C. Un total de 108 cellules en phase G1 ont été
récoltées, libérées dans un milieu YPD frais et cultivées pendant 10min
avant la récolte par centrifugation et stockées à -80 ° C. L'ARN total a été
extrait à l'aide d'un kit de purification RNAeasy (Qiagen). L’ARN total a été
élué, son intégrité a été évaluée sur un bioanalyseur Agilent 2100 avant le
marquage à l’ADNc, l’hybridation de puces à ADN et l’analyse comme
décrit précédemment (Sellam, Askew, et al. 2010).
Co-Immunoprécipitation
Les cultures de souches étiquetées par un épitope ont été cultivées à une
DO600 de 1,0 à 1,5 dans du YPD et ont été traitées ou non avec la
rapamycine (0,2 µg / ml) pendant 30 min. Les cellules ont été récoltées par
centrifugation et lysées par des billes de verre dans un tampon IP150 (Tris-
HCl 50 mM (pH 7,4), NaCl 150 mM, MgCl2 2 mM, Nonidet P-40 à 0,1%)
complété par des inhibiteurs de protéases Complète Mini (Roche Applied
Science) et 1 mM le fluorure de phénylméthylsulfonyle (PMSF).
![Page 193: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/193.jpg)
173
1 mg de protéine totale provenant de lysats a été incubé avec des anticorps
monoclonal anti-HA ou des anticorps monoclonals anti-Myc et capturé sur
des billes de 40 μl de protéine A-Sepharose à 4°C pendant une nuit. Les
billes ont été lavées trois fois avec du tampon IP150, bouilli dans du
tampon SDS-PAGE, et séparé sur un gradient 4–20% de SDS-PAGE. Les
protéines ont été transférées sur une membrane de polyvinylidène
difluorure (PVDF) activée et détectées par anticorps anti-HA.
Tableau 1 – Oligonucléotides utilisées dans cette étude
Clonage Ahr1 dans
CIp-Act1-F
CGAAGCTTATGGCAAAGAAGAAACTAAATTCAAC
Clonage Ahr1 dans
CIp-Act1-R
CGACGCGTTTAATCACTTACTGGGTGAATGTAG
qRnr1F GACTATCTACCATGCTGCTGTTG
qRnR1R GGTGCAACCAACAAGGAGTT
qPcl2F CCACTGAAGAGAAACCAGCA
qPcl2R TGGCATTGGCAGGTAATAGA
qAct1F GAAGCCCAATCCAAAAGA
qAct1R CTTCTGGAGCAACTCTCAATTC
Ahr1-GFP-F GCTATATGGACCCAGAACTAAAATCACAATTTCATCATTGCTTTAC
CTGGACTGTACGCTACATTCACCCAGTAAGTGATGGTGCTGGCG
CAGGTGCTTC
Ahr1-GFP-R ACGTCAAAGCTAACGGTAGTAAAAATATATCTATATCTCAAAGCG
TGGAAATATATTCCCACTCGTCCAAAGTATATAGATCTGATATCA
TCGATGAATTCGAG
Tableau 2 – Souches utilisées dans cette étude
Souche Génotype Référence
DAY286 ura3::imm434/ura3::imm434 (Vandeputte et al.
![Page 194: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/194.jpg)
174
iro1/iro1::imm434
his1::hisG/his1::hisG arg4/arg4
ARG4:URA3:arg4::hisG/arg4::hisG
his1::hisG
/his1::hisG
2012)
ahr1/ahr1 ura3::imm434/ura3::imm434
iro1/iro1::imm434 his1::hisG/his1::hisG
arg4/arg4 ahr1∆::URA3/ahr1∆::ARG4
(Vandeputte et al.
2012)
SN148 arg4/arg4 leu2/leu2 his1/his1
ura3::1 imm434/ura3::1 imm434
(Noble and
Johnson 2005)
JC230(AHR1-GFP) arg4/arg4 leu2/leu2 his1/his1
ura3::1 imm434/ura3::1 imm434
AHR1-GFP ::URA3
Cette étude
CAS4 (sch9/sch9) ura3::imm434/ura3::imm434
iro1/iro1::imm434
sch9::hisG/sch9::hisG
(Stichternoth et
al. 2011)
JC74 SN148 CIpAct1-AHR1-URA3 Cette étude
JC148
(sch9/CIpAct1-
AHR1)
ura3::imm434/ura3::imm434
iro1/iro1::imm434
sch9::hisG/sch9::hisG CIpAct1-
AHR1-URA3
Cette étude
![Page 195: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/195.jpg)
175
Chapitre 5 - Discussion générale et perspectives
La régulation de la taille cellulaire est un processus très étudié chez les
levures (S. pombe, S. cerevisiae), les bactéries (E. coli, Salmonella, Bacillus),
les métazoaires (Mus musculus, Drosophila melanogaster, l’Homme) et les
archéobactéries (Jorgensen et al. 2002; Navarro and Nurse 2012;
Yamamoto et al. 2014; Lobner-Olesen et al. 1989; Chien, Hill, and Levin
2012; Logsdon et al. 2017). Cependant, les mécanismes régulant
l’homéostasie de la taille restent mal connus.
Plusieurs modèles permettant d’expliquer la régulation de la taille ont été
proposés, comme le modèle de senseur (« Sizer »), dans lequel la cellule doit
atteindre une taille seuil avant de se diviser. Chez les levures comme S.
cerevisiae et C. albicans, c’est le point de contrôle START qui permettrait à
la cellule de contrôler la taille sur le long terme. En effet, la cellule doit
atteindre une taille seuil, à START en fin de phase G1, avant d’engager la
phase S et le reste du cycle cellulaire.
Chez d’autres levures, comme S. pombe, la régulation de la taille semble se
faire en phase G2/M par un mécanisme d’incrémentation (« Adder »)
(Keifenheim et al. 2017). Chez les bactéries et les archéobactéries, il
semble également qu’une régulation par incrémentation permette de
réguler la taille (Taheri-Araghi et al. 2015). Cette stratégie consiste à
ajouter le même volume entre chaque division cellulaire. Certaines études
suggèrent que cette stratégie est également utilisée par S. cerevisiae. Cette
levure pourrait donc utiliser les mécanismes d’incrémentation et de START
afin d’assurer l’homéostasie de la taille sur le long terme (Soifer, Robert,
and Amir 2016).
La régulation de la taille n’a jamais été étudiée chez des levures
pathogènes, mais seulement chez des saprophytes comme S. cerevisiae et
S. pombe. Des études suggèrent que la régulation de la taille pourrait jouer
![Page 196: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/196.jpg)
176
un rôle dans la virulence, le commensalisme, la dissémination et
l’échappement du système immunitaire chez les champignons pathogènes
(Wang and Lin 2012). Comprendre la régulation de la taille chez les levures
pathogènes pourrait permettre de trouver des stratégies pour lutter contre
ces levures. De plus, malgré la ressemblance physiologique et génotypique
entre S. cerevisiae et C. albicans, de nombreuses études montrent que des
gènes orthologues ont des rôles différents dans les deux espèces, ce qui
suggèrent que des processus comme la croissance, le cycle cellulaire et la
régulation de la taille peuvent être différents entre les deux espèces.
L’étude de la taille chez C. albicans pourrait donc apporter de nouvelles
informations sur le cycle cellulaire, la croissance eucaryote et de mettre en
évidence un lien entre la virulence fongique et la régulation de la taille
cellulaire.
Afin d’identifier des régulateurs de la taille cellulaire, nous avons effectué
deux criblages. Le premier criblage consistait à identifier des mutants de
délétions hétérozygotes avec un défaut de taille cellulaire (Chapitre 1).
L’utilisation de mutants hétérozygotes a permis de couvrir environ 90% du
génome de C. albicans et a l’avantage d’inclure les gènes essentiels. Ceci
est le premier criblage réalisé pour identifier des régulateurs de la taille
happloinsuffisants sur un génome complet.
Le second criblage consistait à identifier des mutants de délétions
homozygotes (Chapitre 2). Nous avons couvert environ 40% du génome de
C. albicans. Avec cette méthode, nous avons pu étudier seulement les
gènes non-essentiels et les mutants filamenteux ont été retirés de l’étude.
Les collections de mutants homozygotes utilisées sont enrichies en gènes
codants pour des facteurs de transcription et des kinases (Homann et al.
2009; Vandeputte et al. 2012; Blankenship et al. 2010; Noble et al. 2010;
Roemer et al. 2003). Des études supplémentaires sont nécessaires pour
![Page 197: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/197.jpg)
177
mieux couvrir le génome de C. albicans et pour comparer les résultats avec
S. cerevisiae de façon plus exhaustive.
5.1 - Conservation des mécanismes du contrôle de la taille
cellulaire
De nombreux mutants de petites tailles identifiés dans nos criblages sont
défectueux en gènes reliés à la traduction (export des ribosomes, protéines
ribosomales, élongation de la traduction). Les régulateurs de la biogénèse
des ribosomes et de la traduction Sfp1 et Sch9, dont la mutation confère
une petite taille chez S. cerevisiae (Jorgensen et al. 2002), ont été retrouvé
dans nos criblages, ce qui indique que la fonction de ces gènes dans la
régulation de la taille est conservée et que ces deux régulateurs ont un rôle
critique dans la traduction (Fingerman et al. 2003; Cipollina et al. 2005;
Urban et al. 2007).
Sfp1 a été décrit comme l’analogue fonctionnel de c-Myc (Cook and Tyers
2007), un facteur de transcription trouvé chez les métazoaires. c-Myc est
un régulateur de la taille cellulaire et de la biogénèse des ribosomes (van
Riggelen, Yetil, and Felsher 2010).
Sch9 est l’analogue fonctionnel de la kinase S6K humaine (Urban et al.
2007). S6K est une cible de mTORC1 chez les métazoaires et contrôle
l’initiation de la traduction (Magnuson, Ekim, and Fingar 2012). S6K est
surexprimé dans certaines formes de cancers et est associés à une
résistance aux traitements anticancéreux (Ismail et al. 2013). Certains
processus fondamentaux de la traduction semblent donc être conservés
chez les eucaryotes, des ascomycètes aux mammifères.
De nombreux mutants de grandes tailles sont défectueux en gènes du
cycle cellulaire, comme Cln3, Cdc28, Swi4 et Swi6. Ces gènes ont aussi un
![Page 198: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/198.jpg)
178
rôle dans la régulation de la taille chez S. cerevisiae (Jorgensen et al. 2002).
Nous avons également trouvé que Nrm1, qui a été proposé comme étant un
orthologue de Whi5/Nrm1 de S. cerevisiae (Ofir et al. 2012), a un
phénotype de petite taille. Nous avons montré que la petite taille du
mutant nrm1 est épistatique sur le complexe SBF (Swi4/Swi6), ce résultat
est cohérant avec les conclusions d’Ofir et al. : Nrm1 est l’homologue de
Whi5 et Nrm1 de S. cerevisiae et l’analogue fonctionnel de la protéine Rb
chez les mammifères (Ofir et al. 2012) (Figure 26).
Figure 26 – Interaction génétique entre Nrm1 et le complexe SBF. Distributions de la taille
des mutants swi4, nrm1, swi6, swi4/swi6 et swi4/swi6/nrm1.
Ces résultats montrent que l’axe Cln3/Cdc28-Whi5/Nrm1-SBF est
conservé entre C. albicans et S. cerevisiae. Cet axe de régulation est
l’analogue de l’axe Cycline D-Rb-E2F chez l’Homme (Schaefer and Breeden
2004). Même s’il y a une faible similarité de séquences entre ces protéines
de levures et humaines, le mécanisme de la transition G1/S semble
conservé chez les eucaryotes.
![Page 199: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/199.jpg)
179
5.2 - La régulation de la taille cellulaire est un processus
évolutif plastique
Nos criblages montrent que certains processus, comme la biogénèse des
ribosomes et la transition G1/S sont conservés entre S. cerevisiae et C.
albicans, ainsi qu’entre les ascomycètes et l’Homme, même si la séquence
des protéines régulatrices n’est pas conservée. Cependant, la comparaison
de nos résultats avec un criblage effectué chez S. cerevisiae révèle une
faible conservation dans les gènes contrôlant la taille cellulaire (Jorgensen
et al. 2002), ce qui indique que la régulation de la taille est un phénomène
plastique au cours de l’évolution.
Comme chez S. cerevisiae, la régulation de la taille de C. albicans fait
intervenir de nombreux processus tels que la transcription, le cycle
cellulaire, la phosphorylation, la régulation du métabolisme etc. Ce qui
montre que la régulation de la taille est un phénomène complexe. De plus,
de nombreux régulateurs de la traduction ont été identifiés dans nos
criblages, que ça soit des régulateurs d’initiation de la traduction (Sui1,
Cdc33), d’élongation de la traduction (Yef3, Ria1), des régulateurs de la
biogénèse des ribosomes (Sfp1, Sch9, Dot6, Cbf1) ou des protéines
ribosomales (Rpl13A, Rpl24) indiquant que la traduction est un processus
essentiel pour la régulation de la taille cellulaire.
Nous nous attendions à trouver des différences entre les deux levures car
de nombreux cas de « rewiring » transcriptionnel ont été décrits chez ces
organismes. S. cerevisiae et C. albicans ne vivent pas dans les mêmes
niches et sont distantes de 300 millions d’années (Hedges et al. 2015). S.
cerevisiae est une levure saprophyte et C. albicans est une levure
opportuniste. Donc ces deux levures ne rencontrent pas les mêmes stress
et n’ont pas les mêmes nutriments disponibles dans leurs milieux. Malgré
leurs ressemblances génotypiques, les levures se sont adaptées à des
![Page 200: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/200.jpg)
180
niches différentes. Ceci peut expliquer pourquoi ces deux levures ont
divergé et pourquoi la régulation de la croissance et de la division est
différente entre les deux espèces. De plus, S. cerevisiae a subi une
duplication du génome, ce qui favorise la néofonctionnalisation (Byrne and
Wolfe 2007). Parmi les nouveaux régulateurs de la taille cellulaire chez C.
albicans, nous avons identifié Hog1, Dot6 et Ahr1.
5.2.1 - Rôle de Hog1 dans le contrôle de la taille cellulaire
Nous avons identifié hog1 comme un mutant de petite taille. Hog1 est
connu pour répondre à différents stress chez les levures ainsi que chez les
métazoaires (Krantz, Becit, and Hohmann 2006; Saito and Posas 2012).
Ici, nous avons montré que Hog1 régule START en absence de stress. Une
phosphorylation basale de Hog1 est nécessaire pour la régulation de
START. Ce phénotype de taille n’a été observé ni chez le mutant hog1 de S.
cerevisiae ni chez le mutant sty1 de S pombe. Le rôle de Hog1 dans le
contrôle de la taille, en absence de stress, n’est donc pas partagé chez
toutes les levures. Hog1 est l’analogue de la p38 chez les métazoaires
(Sheikh-Hamad and Gustin 2004). Des études ont montré un rôle de la
p38 dans la régulation de la taille cellulaire chez la drosophile et l’Homme
(Cully et al. 2010; Liu et al. 2018). La p38 a un rôle dans la régulation du
cycle cellulaire, la croissance et la différenciation (Lavoie et al. 1996;
Mikule et al. 2007; Yee et al. 2004). La dérégulation de l’activité des
protéines p38 est associée à des cancers agressifs avec un faible
pronostique de guérison (Koul, Pal, and Koul 2013).
Nous avons montré que Hog1 régule à la fois la croissance via le facteur de
transcription Sfp1 et le cycle cellulaire via le complexe SBF (Swi4/Swi6).
Nos résultats montrent que Hog1 régule le recrutement de Sfp1 sur les
promoteurs des gènes de la biogénèse des ribosomes et des gènes des
protéines ribosomales afin d’activer la transcription. Hog1 se fixe
![Page 201: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/201.jpg)
181
également sur les promoteurs des gènes de la biogénèse des ribosomes,
suggérant que cette kinase régule directement la transcription de ces
gènes. De plus, nous avons montré que toute la voie HOG (Pbs2, Ssk1,
Ssk2, Ypd1 et Sln1) a un rôle dans la régulation de la taille, ainsi que les
phosphatases Ptc1 et Ptc2, qui permettent la désactivation de Hog1 par
déphosphorylation suite à un stress.
Le signal détecté par la voie HOG qui permet de contrôler la taille cellulaire
n’est pas connue. Hog1 et Sln1 (une histidine phosphotransérase
régulatrice de la voie HOG) sont nécessaires pour la biogénèse de la paroi
cellulaire (Blankenship et al. 2010; Ene et al. 2015). Nous avons identifié
le mutant gsc1 comme un mutant de petite taille. Gsc1 est nécessaire pour
la synthèse β-1,3-glucane et pour la biogénèse de la paroi cellulaire (Mio et
al. 1997). Récemment, Mancuso et al. ont découvert que Dfg5 et Dcw1, des
protéines de la paroi cellulaire, régulent le niveau basal de
phosphorylation de Hog1 en absence de stress (Mancuso et al. 2018). Ces
observations suggèrent un lien entre la synthèse de la paroi et la taille
cellulaire comme déjà observé chez les bactéries (Tropini et al. 2014;
Chien, Hill, and Levin 2012). Pour explorer le lien entre la paroi et la taille
cellulaire, il faudrait tester si les mutants dfg5 et dcw1 ont un phénotype
de taille. Une carte génétique pourrait être réalisée entre la voie HOG et les
gènes de la biogénèse de la paroi (CHS1, MNN1, GSC1). De plus, le lien
entre la paroi et la taille cellulaire pourrait être étudié en utilisant PalmC,
une molécule capable de modifier la tension membranaire (Riggi et al.
2018). La phosphorylation basale de Hog1 pourrait être étudiée dans les
mutants des gènes de la biogénèse des ribosomes et en réponse à PalmC.
La molécule PalmC pourrait être testée sur des mutants de la paroi et des
mutants de la voie HOG afin d’étudier l’impact sur START.
Les cibles de Hog1 ne sont pas connues. Pour les identifier, une approche
protéomique, comme la méthode SILAC (Stable Isotope Labelling by Amino
![Page 202: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/202.jpg)
182
Acids in Cell culture), pourrait être utilisée. Cette technique a déjà été
utilisée chez S. cerevisiae pour l’étude de Hog1 (Romanov et al. 2017). Une
analyse comparative pourrait mettre en évidence les différences de cibles
entre S. cerevisiae et C. albicans et pourrait révéler pourquoi Hog1 est un
régulateur de START chez C albicans mais pas chez S. cerevisiae. Il est
intéressant de constater que Romanov et al. ont identifié Tod6, le
paralogue de Dot6, comme substrat de Hog1 (Romanov et al. 2017).
Nous avons mis en évidence des interactions génétiques et physiques entre
Hog1 et Sfp1, ainsi qu’entre Hog1 et Swi4. Des études mécanistiques
seraient nécessaires pour savoir si Hog1 phosphoryle Sfp1 et le complexe
SBF. Si oui, il serait intéressant d’identifier les acides aminés
phosphorylés et le rôle de ces phosphorylations sur START. Des analyses
de ChIP pourraient également être effectuées sur Swi4 et Swi6 dans une
souche sauvage et un mutant hog1 afin de tester si Hog1 a un rôle dans la
localisation ou le recrutement du complexe MBF sur les promoteurs.
La voie HOG étant peu conservée entre C. albicans et l’Homme, elle est
considérée comme une cible thérapeutique potentielle pour lutter contre
les infections à levures (McCarthy et al. 2017; Perfect 2017). L’antifongique
fludioxonil a été identifié comme un modulateur de la voie HOG chez
certains champignons (Knauth and Reichenbach 2000; Shubitz et al.
2006; Kojima, Bahn, and Heitman 2006). De plus, nous avons montré que
Hog1 régule la taille cellulaire, comme la p38 chez l’Homme (Liu et al.
2018). C. albicans pourrait être utilisé comme organisme modèle pour
étudier le rôle de la voie HOG dans le contrôle de la taille cellulaire et pour
étudier les mécanismes d’action d’antifongiques ciblant la voie HOG.
5.2.2 - Rôle de Dot6 dans le contrôle de la taille cellulaire
![Page 203: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/203.jpg)
183
Nous avons identifié Dot6 comme un régulateur de la taille. Les
orthologues Dot6 et Tod6 de S. cerevisiae n’ont pas de rôle dans la
régulation de la taille (Huber et al. 2011). Nous avons montré que Dot6 est
un régulateur négatif de START. Le profil transcriptionel du mutant dot6
montre que Dot6 est un régulateur positif de la biogénèse des ribosomes,
alors que c’est un répresseur chez S. cerevisiae (Huber et al. 2011). Ceci
permet d’expliquer le phénotype de petite taille car le mutant n’est pas
capable de produire des ribosomes et provoque une accélération de START,
comme déjà observé pour les mutants sfp1 et sch9 (Jorgensen et al. 2004;
Cipollina et al. 2005). Pour comprendre les modifications qui ont fait que
Dot6 est un répresseur chez S. cerevisiae et un activateur chez C. albicans,
une étude sur les ascomycètes pourraient être réalisée. Nous avons trouvé
une séquence riche en acide aspartique dans les orthologues de Dot6 du
clade CTG (C. parapsilosis, C. dubliensis), mais absente chez S. cerevisiae
et C. glabrata. La délétion de cette séquence ne provoque pas de phénotype
de taille chez C. albicans. Il n’est pas connu si Dot6 est un répresseur ou
un activateur chez d’autres espèces comme C. glabrata, C. tropicalis, C
parapsilosis ou C. dubliensis. Créé des mutants de délétion dot6 et analysé
la taille ainsi qu’étudier le rôle de Dot6 dans le contrôle la biogénèse des
ribosomes chez ces espèces donneraient des indications sur la transition
entre activateur et répresseur. Cela permettra de voir si le changement de
fonction coïncide avec la duplication du génome subit par les espèces du
clade WGD.
Chez S. cerevisiae, quand la voie TOR est inhibée, Dot6 réprime la
transcription des gènes RiBi en recrutant le complexe RPDL3, qui est une
histone désacétylase (Huber et al. 2011; Shevchenko et al. 2008). Chez C.
albicans, il n’est pas connu par quel mécanisme Dot6 active la
transcription des gènes RiBi. Il serait intéressant d’identifier les protéines
qui interagissent avec Dot6 par chromatographie d’affinité suivie d’analyse
par spectrométrie de masse.
![Page 204: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/204.jpg)
184
Chez S. cerevisiae, Dot6 est phosphorylé par Sch9 (Huber et al. 2011).
Nous avons recherché des interactions génétiques entre Dot6 et Sch9 et
nos résultats suggèrent que les protéines sont dans des voies parallèles.
De plus, nous n’avons pas trouvé d’interaction physique entre Dot6 et
Sch9 par co-immunoprécipitation (non publié). En revanche, nous avons
mis en évidence une interaction génétique entre Tor1 et Dot6, ce qui
suggère que Dot6 est toujours dans la voie TOR comme chez S. cerevisiae.
Des tests de phosphorylation de Tor1 sur Dot6 pourraient être réalisés afin
de confirmer ou non que Dot6 est un substrat de Tor1.
Chez S. cerevisiae, les promoteurs des gènes de la biogénèse des ribosomes
sont enrichis en séquences PAC et RRPE (Hughes et al. 2000; Jorgensen
and Tyers 2004; Wade, Umbarger, and McAlear 2006) et Dot6 régule les
gènes de la biogénèse des ribosomes en se fixant sur la séquence PAC
(Huber et al. 2011). Dans les gènes de la biogénèse des ribosomes réprimés
dans le mutant dot6, la séquence PAC est présente dans les promoteurs de
ces gènes, ce qui suggère que Dot6 active ces gènes via la séquence PAC. Il
est nécessaire de confirmer que Dot6 se fixe aux promoteurs via la
séquence PAC en réalisant une expérience de retard sur gel ou en utilisant
un gène rapporteur fusionné à un promoteur contenant la séquence PAC.
Chez les mammifères et chez les champignons, des perturbations des
mitochondries provoquent des défauts de la taille cellulaire (Miettinen and
Bjorklund 2016). Comme Dot6 est un régulateur de la biogenèse des
ribosomes et que nous avons mis en évidence que des gènes de la
traduction mitochondriale sont surexprimés dans le mutant dot6, nous
avons testé si la traduction mitochondriale est perturbée chez le mutant de
dot6. Nous avons testé la doxycyline, un antibiotique de la famille des
tétracyclines qui inhibe la traduction bactérienne et la traduction
mitochondriale eucaryote (Moullan et al. 2015). La souche sauvage
diminue sa taille en réponse à la doxycycline, suggérant que l'inhibition de
![Page 205: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/205.jpg)
185
la traduction mitochondriale réduit la taille des cellules (Figure 27). La
taille du mutant dot6 ne diminue pas en présence de doxycycline, ce qui
suggère que Dot6 régule également la traduction mitochondriale. Ce
résultat préliminaire suggère que la traduction mitochondriale est
nécessaire pour la régulation de la taille cellulaire et que Dot6 est un
régulateur de la traduction mitochondriale.
Figure 27 – Effet de la doxycycline sur la taille cellulaire. ** p-value < 0,01. Trois
réplicats ont été réalisés.
5.2.3 - Rôle de Ahr1 dans le contrôle de la taille cellulaire
Nous avons identifié Ahr1, un facteur de transcription spécifique du clade
CTG, comme régulateur négatif de START. Nous avons montré des
interactions génétique et physique entre la kinase Sch9 et Ahr1. Il est
nécessaire de tester si Sch9 phosphoryle Ahr1. De plus, nos résultats
suggèrent que la voie TOR-Sch9 contrôle la fonction d’Ahr1 en régulant sa
localisation cellulaire. Des mutants non-phosphorylables d’Ahr1
![Page 206: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/206.jpg)
186
pourraient être créés pour observer la localisation cellulaire d’Ahr1 pour
tester si la localisation d’Ahr1 est régulée par phosphorylation.
Le profil transcriptionnel du mutant ahr1 montre que des gènes
nécessaires à l’élongation de la traduction sont réprimés. De plus, il a été
montré précédemment qu’Ahr1 se fixe sur les promoteurs de Cam1 et Tef4,
des facteurs d’élongation de la traduction (Askew et al. 2011). Enfin, Ahr1
se fixe à des promoteurs de gènes nécessaires au transport des acides
aminés (Askew et al. 2011). Ces observations suggèrent que le mutant
ahr1 a des défauts de synthèse des protéines. Une expérience de polysome
profiling (Chasse et al. 2017), une technique permettant d’étudier le niveau
global de traduction en analysant l’association entre les ARN messagers et
les ribosomes, pourrait être réalisée pour tester s’il y a un défaut de
traduction dans le mutant ahr1. La traduction étant un processus
important pour la régulation de START (Cook and Tyers 2007), cette
expérience permettrait de comprendre pourquoi le mutant ahr1 a un
phénotype de petite taille et a un défaut de START.
5.3 - Lien entre nutriments et taille cellulaire
Nous avons montré que Dot6 et Ahr1 sont nécessaires pour l’adaptation de
la taille cellulaire suivant les nutriments disponibles. Le mutant dot6 a des
défauts de croissance et d’adaptation de la taille quand il est cultivé sur
glycérol, le mutant ahr1 a des défauts de croissance quand il est cultivé
sur certains acides aminés. Pour mieux comprendre le lien entre taille
cellulaire et la perception des nutriments, les mêmes criblages que l’on a
réalisés pourraient être refaits en faisant varier les sources de carbones et
les sources d’azotes. Ces criblages permettraient d’identifier de nouveaux
régulateurs nécessaires pour l’adaptation de la taille suivant les
nutriments disponibles
![Page 207: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/207.jpg)
187
Nous avons montré que Dot6 et Ahr1 sont dans la voie TOR, qui est un
régulateur de la croissance en réponse aux nutriments disponibles dans le
milieu extracellulaire (Loewith and Hall 2011). La voie Ras-PKA est
également une voie importante pour la croissance et la signalisation en
réponse aux sources de carbones (Dechant and Peter 2008). Chez S.
cerevisiae, Dot6 et Tod6 sont nécessaires pour faire le lien entre la
croissance cellulaire et les nutriments disponibles (Lippman and Broach
2009). Des interactions physiques ont été mise en évidence entre Dot6 et
Tpk1 chez S. cerevisiae (Deminoff et al. 2006), une sous unité de PKA. Ceci
suggère un lien entre Dot6 et la voie Ras-PKA chez C albicans. Il serait
intéressant de tester si Dot6 et Tpk1 interagissent génétiquement et
physiquement chez C. albicans.
5.4 - Lien entre virulence et taille cellulaire
Dans nos criblages, nous avons identifié des mutants qui ont un défaut de
taille et un défaut de virulence (sch9, ahr1, hog1, ptc1, nrm1…). Il n’est pas
connu si la taille cellulaire de C. albicans est un facteur de virulence. Nous
avons vu en introduction que la variabilité de la taille chez les levures
permet l’invasion de l’hôte (pour les cellules de petites tailles) et
l’échappement au système immunitaire (pour les cellules de grandes
tailles). Concernant C. albicans, il a été montré que les neutrophiles
peuvent discriminer les pathogènes suivant leurs tailles (Branzk et al.
2014). Il a également été montré que les cellules épithéliales buccales
discriminent la forme levure et la forme hyphe de C. albicans (Moyes et al.
2010).
Quel pourrait être le lien entre la taille cellulaire et la virulence chez C.
albicans ? Il a été montré qu’il existe une taille optimale chez les cellules
de mammifères (Miettinen and Bjorklund 2016; Miettinen et al. 2017). Les
cellules de petites tailles sont plus sensibles à l’apoptose et les capacités
![Page 208: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/208.jpg)
188
de biosynthèses sont limitées. Pour les cellules de grandes tailles, le
rapport surface/volume est diminué, ce qui limite les échanges avec le
milieu extérieur et les distances intracellulaires sont plus grandes, ce qui
limite les transports moléculaires (Harris and Theriot 2018). Une mauvaise
régulation de la taille serait défavorable pour le métabolisme et donc pour
la survie de la levure.
Des études ont montré que le niveau de ploïdie de C. albicans (diploïde ou
tétraploïde) affecte la virulence (Ibrahim et al. 2005). Or, pour former des
cellules tétraploïdes, les cellules doivent fusionner. Il a été montré, chez S.
cerevisiae, que les cellules happloïdes de petites tailles sont désavantagées
pour former des cellules (Smith, Pomiankowski, and Greig 2014). Ces
études suggèrent que la régulation de la taille a un impact sur le niveau de
ploïdie de C. albicans pendant l’infection et donc sur la virulence.
Nous avons étudié deux régulateurs de la taille qui sont nécessaires pour
la virulence : Ahr1 et Hog1 (Alonso-Monge et al. 1999; Askew et al. 2011;
Cheetham et al. 2011).
Hog1 est nécessaire pour la réponse à différents stress (Smith et al. 2004;
Cheetham et al. 2007; San Jose et al. 1996; Kayingo and Wong 2005;
Arana et al. 2005). La réponse à ces stress est indispensable pour la
virulence (Walker et al. 2009; Thewes et al. 2007). De plus, le mutant hog1
est légèrement hyperfilamenteux, ce qui est également un désavantage
pour la virulence (Enjalbert et al. 2006). Ces observations expliquent
pourquoi le mutant hog1 est non-virulent dans des modèles de souris.
Le mutant ahr1 a un phénotype de petite taille. De plus, il a des défauts
d’adhésion et de formation de biofilms, ce qui peut expliquer l’atténuation
de sa virulence car la levure n’est pas capable d’adhérer aux cellules de
l’hôte. De plus, nous avons montré que cette souche n’a pas la capacité
![Page 209: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/209.jpg)
189
d’adapter sa taille quand elle est cultivée sur certains acides aminés. Ceci
est un désavantage pour la levure car elle ne peut pas optimiser sa taille
suivant l’environnement. Nous avons également montré que la taille des
hyphes du mutant ahr1 est petite. Les hyphes jouent un rôle dans
l’échappement au système immunitaire. Les levures phagocytées
produisent des hyphes ce qui mène à l’éclatement du phagocyte (Brand
2012). Ici, la petite taille des hyphes pourraient être un désavantage pour
échapper aux phagocytes ou pour envahir les tissus de l’hôte.
Il n’est pas encore connu si Dot6 est un gène nécessaire pour la virulence
dans des modèles de souris. La virulence a seulement été testée dans un
modèle d’insecte, Galleria Mellonella (Amorim-Vaz et al. 2015). On peut
émettre l’hypothèse que Dot6 est nécessaire pour le pouvoir pathogène de
C. albicans car des traits de virulence sont altérés chez le mutant dot6. En
effet, le mutant a un défaut de taille cellulaire, ce qui est défavorable pour
la survie de la cellule dans un environnement changeant, comme pendant
l’infection de l’hôte. Il forme également des hyphes de petites tailles et a
des défauts de croissance et d’adaptation de la taille suivant les sources de
carbone disponibles, ce qui est un désavantage pour la survie de la levure.
De plus, pendant l’infection de l’hôte par C. albicans des gènes permettant
l’utilisation d’un sucre alternatif sont surexprimés (Walker et al. 2009), ce
qui montre que l’adaptabilité métabolique est indispensable pour la
virulence. Pour confirmer que Dot6 est nécessaire pour la virulence, le
mutant dot6 pourrait être injecté dans des souris et observer la mortalité
des souris.
5.5 - C. albicans – Organisme modèle
Nous avons montré un rôle de Hog1 dans le contrôle de la taille cellulaire.
Les homologues de Hog1 ont également un rôle dans la régulation de la
taille chez l’Homme et la drosophile (Cully et al. 2010; Liu et al. 2018). C.
![Page 210: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/210.jpg)
190
albicans pourrait donc être un bon modèle d’étude pour comprendre le rôle
de Hog1/p38 dans la régulation de la taille.
La voie Hog/p38, ne contrôle pas seulement la taille cellulaire, mais
contrôle aussi la réponse aux stress. C. albicans pourrait être utilisée pour
comprendre comment une même voie de régulation régule différents
processus.
Nous avons trouvé d’autres gènes qui ont des homologues chez l’Homme,
comme CKB1 et CKB2 (codants pour des kinases ayant un rôle dans la
croissance). Nous avons également trouvé plusieurs gènes régulant la
transcription conservés entre C. albicans et l’Homme : MBF1, STO1, HAP1,
POP2 et CCR4. Enfin, nous avons trouvé des gènes ayant un rôle dans le
métabolisme mitochondrial conservés chez l’Homme : SUV3, SOD2, TIM23.
Il n’est pas encore connu si ces gènes ont un rôle dans la régulation de la
taille chez l’Homme. Ces gènes pourraient être ciblés chez l’Homme afin de
voir si ce sont des régulateurs de la taille chez les deux espèces.
![Page 211: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/211.jpg)
191
Conclusion
Afin d’étudier la régulation de la taille chez les champignons pathogènes,
nous avons identifié des régulateurs de la taille cellulaire chez C. albicans.
Nous avons identifié 66 mutants homozygotes ayant un défaut de taille sur
279 mutants testés. Nous avons également identifié 685 mutants
hétérozygotes ayant un défaut de taille sur 5 470 mutants testés. Nous
avons comparé nos résultats avec ceux obtenus chez S. cerevisiae et nous
avons mis en évidence que peu de gènes sont conservés et que la
régulation de la taille est un processus plastique.
Parmi les régulateurs de la taille identifiés dans nos criblages, nous avons
cherché à identifier les régulateurs de START, un point de control en fin de
phase G1 permettant l’homéostasie de la taille. Nous avons retrouvé des
régulateurs de START déjà identifié chez S. cerevisiae, comme Sfp1, Sch9,
Swi4, Swi6 et Cln3. Nous avons également identifié des nouveaux
régulateurs de START, comme Hog1, Ahr1 et Dot6.
Hog1 est connu pour réguler la réponse à différents stress. Ici, nous avons
montré que Hog1 régule la taille cellulaire en contrôlant la croissance et la
division cellulaire. Ce rôle n’a jamais été mis en évidence chez S. cerevisiae
mais semble être conservé chez les eucaryotes supérieurs. C. albicans
pourrait donc être un bon modèle d’étude de la voie HOG.
Nous avons identifié Dot6 comme un régulateur de START. Dot6 est un
activateur des gènes de la biogénèse des ribosomes. Chez S. cerevisiae,
l’homologue Dot6 est un inhibiteur des gènes de la biogénèse des
ribosomes. Nous avons donc mis en évidence deux gènes homologues dans
deux espèces mais qui ont un rôle différent dans la régulation de la
transcription.
![Page 212: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/212.jpg)
192
Enfin, nous avons identifié Ahr1, un facteur de transcription, comme un
régulateur négatif de START. Ahr1 est un gène spécifique du clade CTG et
est nécessaire pour l’utilisation des acides aminés disponibles dans le
milieu.
Parmi les nouveaux régulateurs de la taille, nous avons également identifié
des régulateurs de la réplication de l’ADN (ORC3, ORC4, MCM3, CDC54,
RFC3, PIF1, SMC4, ELG1), des régulateurs de la transition G2/M (HSL1,
CDC34), de la traduction (ASC1, SCD6, PAB1, RIA1, EFT2, CEF3) et de la
transcription des ARN Pol I et III (CDC73, RPB8, RPA49, RPB10, SPT5,
RPA12, RPC25). Certains de ces gènes sont conservés chez l’Homme.
Nos résultats ont montré que C. albicans est un organisme modèle
pertinent pour l’étude de la taille cellulaire et ont fournis de nombreuses
perspectives d’études.
![Page 213: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/213.jpg)
193
Bibliographie
Abad, C. L., and N. Safdar. 2009. 'The role of lactobacillus probiotics in the treatment or prevention of urogenital infections--a systematic review', J Chemother, 21: 243-52.
Akram, Z., A. A. Al-Kheraif, S. V. Kellesarian, F. Vohra, and F. Javed. 2018. 'Comparison of oral Candida carriage in waterpipe smokers,
cigarette smokers, and non-smokers', J Oral Sci, 60: 115-20. Almeida, A. J., C. Cunha, J. A. Carmona, B. Sampaio-Marques, A.
Carvalho, I. Malavazi, H. Y. Steensma, D. I. Johnson, C. Leao, E.
Logarinho, G. H. Goldman, A. G. Castro, P. Ludovico, and F. Rodrigues. 2009. 'Cdc42p controls yeast-cell shape and virulence of
Paracoccidioides brasiliensis', Fungal Genet Biol, 46: 919-26. Alonso-Monge, R., F. Navarro-Garcia, G. Molero, R. Diez-Orejas, M.
Gustin, J. Pla, M. Sanchez, and C. Nombela. 1999. 'Role of the
mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans', J Bacteriol, 181: 3058-68.
Alonso, M. F., N. A. R. Gow, L. P. Erwig, and J. M. Bain. 2017. 'Macrophage Migration Is Impaired within Candida albicans Biofilms', J Fungi (Basel), 3.
Amodeo, A. A., and J. M. Skotheim. 2016. 'Cell-Size Control', Cold Spring Harb Perspect Biol, 8: a019083.
Amorim-Vaz, S., E. Delarze, F. Ischer, D. Sanglard, and A. T. Coste. 2015. 'Examining the virulence of Candida albicans transcription factor
mutants using Galleria mellonella and mouse infection models', Front Microbiol, 6: 367.
Arana, D. M., C. Nombela, R. Alonso-Monge, and J. Pla. 2005. 'The Pbs2 MAP kinase kinase is essential for the oxidative-stress response in the fungal pathogen Candida albicans', Microbiology, 151: 1033-49.
Askew, C., A. Sellam, E. Epp, H. Hogues, A. Mullick, A. Nantel, and M. Whiteway. 2009. 'Transcriptional regulation of carbohydrate
metabolism in the human pathogen Candida albicans', PLoS Pathog, 5: e1000612.
Askew, C., A. Sellam, E. Epp, J. Mallick, H. Hogues, A. Mullick, A. Nantel,
and M. Whiteway. 2011. 'The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion', Mol Microbiol, 79: 940-53.
Averous, J., and C. G. Proud. 2006. 'When translation meets
transformation: the mTOR story', Oncogene, 25: 6423-35. Barnett, J. A. 2004. 'A history of research on yeasts 8: taxonomy', Yeast,
21: 1141-93. Basco, R. D., M. D. Segal, and S. I. Reed. 1995. 'Negative regulation of G1
and G2 by S-phase cyclins of Saccharomyces cerevisiae', Mol Cell Biol, 15: 5030-42.
![Page 214: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/214.jpg)
194
Bassetti, M., E. Righi, P. Montravers, and O. A. Cornely. 2018. 'What has changed in the treatment of invasive candidiasis? A look at the past
10 years and ahead', J Antimicrob Chemother, 73: i14-i25. Bastidas, R. J., J. Heitman, and M. E. Cardenas. 2009. 'The protein kinase
Tor1 regulates adhesin gene expression in Candida albicans', PLoS Pathog, 5: e1000294.
Bennett, R. J., and A. D. Johnson. 2005. 'Mating in Candida albicans and
the search for a sexual cycle', Annu Rev Microbiol, 59: 233-55. Bensen, E. S., A. Clemente-Blanco, K. R. Finley, J. Correa-Bordes, and J.
Berman. 2005. 'The mitotic cyclins Clb2p and Clb4p affect morphogenesis in Candida albicans', Mol Biol Cell, 16: 3387-400.
Berman, J. 2006. 'Morphogenesis and cell cycle progression in Candida albicans', Curr Opin Microbiol, 9: 595-601.
Berman, J., and P. E. Sudbery. 2002. 'Candida Albicans: a molecular
revolution built on lessons from budding yeast', Nat Rev Genet, 3: 918-30.
Bille, J., O. Marchetti, and T. Calandra. 2005. 'Changing face of health-care associated fungal infections', Curr Opin Infect Dis, 18: 314-9.
Blackwell, C., C. L. Russell, S. Argimon, A. J. Brown, and J. D. Brown. 2003. 'Protein A-tagging for purification of native macromolecular complexes from Candida albicans', Yeast, 20: 1235-41.
Blagosklonny, M. V., and A. B. Pardee. 2002. 'The restriction point of the cell cycle', Cell Cycle, 1: 103-10.
Blankenship, J. R., S. Fanning, J. J. Hamaker, and A. P. Mitchell. 2010. 'An extensive circuitry for cell wall regulation in Candida albicans', PLoS Pathog, 6: e1000752.
Blumberg, H., and P. Silver. 1991. 'A split zinc-finger protein is required for normal yeast growth', Gene, 107: 101-10.
Brand, A. 2012. 'Hyphal growth in human fungal pathogens and its role in virulence', Int J Microbiol, 2012: 517529.
Branzk, N., A. Lubojemska, S. E. Hardison, Q. Wang, M. G. Gutierrez, G. D. Brown, and V. Papayannopoulos. 2014. 'Neutrophils sense microbe size and selectively release neutrophil extracellular traps in
response to large pathogens', Nat Immunol, 15: 1017-25. Braunsdorf, C., and S. LeibundGut-Landmann. 2018. 'Modulation of the
Fungal-Host Interaction by the Intra-Species Diversity of C. albicans', Pathogens, 7.
Brown, V., J. Sabina, and M. Johnston. 2009. 'Specialized sugar sensing in diverse fungi', Curr Biol, 19: 436-41.
Butler, G., M. D. Rasmussen, M. F. Lin, M. A. Santos, S. Sakthikumar, C.
A. Munro, E. Rheinbay, M. Grabherr, A. Forche, J. L. Reedy, I. Agrafioti, M. B. Arnaud, S. Bates, A. J. Brown, S. Brunke, M. C.
Costanzo, D. A. Fitzpatrick, P. W. de Groot, D. Harris, L. L. Hoyer, B. Hube, F. M. Klis, C. Kodira, N. Lennard, M. E. Logue, R. Martin, A. M. Neiman, E. Nikolaou, M. A. Quail, J. Quinn, M. C. Santos, F. F.
Schmitzberger, G. Sherlock, P. Shah, K. A. Silverstein, M. S.
![Page 215: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/215.jpg)
195
Skrzypek, D. Soll, R. Staggs, I. Stansfield, M. P. Stumpf, P. E. Sudbery, T. Srikantha, Q. Zeng, J. Berman, M. Berriman, J.
Heitman, N. A. Gow, M. C. Lorenz, B. W. Birren, M. Kellis, and C. A. Cuomo. 2009. 'Evolution of pathogenicity and sexual reproduction in eight Candida genomes', Nature, 459: 657-62.
Byrne, K. P., and K. H. Wolfe. 2007. 'Consistent patterns of rate asymmetry and gene loss indicate widespread neofunctionalization
of yeast genes after whole-genome duplication', Genetics, 175: 1341-50.
Chandler-Brown, D., K. M. Schmoller, Y. Winetraub, and J. M. Skotheim.
2017. 'The Adder Phenomenon Emerges from Independent Control of Pre- and Post-Start Phases of the Budding Yeast Cell Cycle', Curr Biol, 27: 2774-83 e3.
Chapa y Lazo, B., S. Bates, and P. Sudbery. 2005. 'The G1 cyclin Cln3
regulates morphogenesis in Candida albicans', Eukaryot Cell, 4: 90-4.
Charvin, G., C. Oikonomou, E. D. Siggia, and F. R. Cross. 2010. 'Origin of
irreversibility of cell cycle start in budding yeast', PLoS Biol, 8: e1000284.
Chasse, H., S. Boulben, V. Costache, P. Cormier, and J. Morales. 2017. 'Analysis of translation using polysome profiling', Nucleic Acids Res,
45: e15. Cheetham, J., D. M. MacCallum, K. S. Doris, A. da Silva Dantas, S.
Scorfield, F. Odds, D. A. Smith, and J. Quinn. 2011. 'MAPKKK-
independent regulation of the Hog1 stress-activated protein kinase in Candida albicans', J Biol Chem, 286: 42002-16.
Cheetham, J., D. A. Smith, A. da Silva Dantas, K. S. Doris, M. J. Patterson, C. R. Bruce, and J. Quinn. 2007. 'A single MAPKKK regulates the Hog1 MAPK pathway in the pathogenic fungus
Candida albicans', Mol Biol Cell, 18: 4603-14. Chien, A. C., N. S. Hill, and P. A. Levin. 2012. 'Cell size control in bacteria',
Curr Biol, 22: R340-9. Cho, R. J., M. J. Campbell, E. A. Winzeler, L. Steinmetz, A. Conway, L.
Wodicka, T. G. Wolfsberg, A. E. Gabrielian, D. Landsman, D. J.
Lockhart, and R. W. Davis. 1998. 'A genome-wide transcriptional analysis of the mitotic cell cycle', Mol Cell, 2: 65-73.
Chowdhury, T., and J. R. Kohler. 2015. 'Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans', Mol Microbiol, 98: 384-402.
Chung, J., C. J. Kuo, G. R. Crabtree, and J. Blenis. 1992. 'Rapamycin-FKBP specifically blocks growth-dependent activation of and
signaling by the 70 kd S6 protein kinases', Cell, 69: 1227-36. Cipollina, C., L. Alberghina, D. Porro, and M. Vai. 2005. 'SFP1 is involved
in cell size modulation in respiro-fermentative growth conditions', Yeast, 22: 385-99.
![Page 216: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/216.jpg)
196
Claypool, J. A., S. L. French, K. Johzuka, K. Eliason, L. Vu, J. A. Dodd, A. L. Beyer, and M. Nomura. 2004. 'Tor pathway regulates Rrn3p-
dependent recruitment of yeast RNA polymerase I to the promoter but does not participate in alteration of the number of active genes', Mol Biol Cell, 15: 946-56.
Conlon, I. J., G. A. Dunn, A. W. Mudge, and M. C. Raff. 2001. 'Extracellular control of cell size', Nat Cell Biol, 3: 918-21.
Conlon, I., and M. Raff. 1999. 'Size control in animal development', Cell, 96: 235-44.
———. 2003. 'Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression', J Biol, 2: 7.
Cook, M., and M. Tyers. 2007. 'Size control goes global', Curr Opin Biotechnol, 18: 341-50.
Costanzo, M., J. L. Nishikawa, X. Tang, J. S. Millman, O. Schub, K.
Breitkreuz, D. Dewar, I. Rupes, B. Andrews, and M. Tyers. 2004. 'CDK activity antagonizes Whi5, an inhibitor of G1/S transcription
in yeast', Cell, 117: 899-913. Cote, P., H. Hogues, and M. Whiteway. 2009. 'Transcriptional analysis of
the Candida albicans cell cycle', Mol Biol Cell, 20: 3363-73.
Coudreuse, D., and P. Nurse. 2010. 'Driving the cell cycle with a minimal CDK control network', Nature, 468: 1074-9.
Cully, M., A. Genevet, P. Warne, C. Treins, T. Liu, J. Bastien, B. Baum, N. Tapon, S. J. Leevers, and J. Downward. 2010. 'A role for p38 stress-
activated protein kinase in regulation of cell growth via TORC1', Mol Cell Biol, 30: 481-95.
Dalal, C. K., I. A. Zuleta, K. F. Mitchell, D. R. Andes, H. El-Samad, and A.
D. Johnson. 2016. 'Transcriptional rewiring over evolutionary timescales changes quantitative and qualitative properties of gene
expression', Elife, 5. de Bruin, R. A., T. I. Kalashnikova, C. Chahwan, W. H. McDonald, J.
Wohlschlegel, J. Yates, 3rd, P. Russell, and C. Wittenberg. 2006.
'Constraining G1-specific transcription to late G1 phase: the MBF-associated corepressor Nrm1 acts via negative feedback', Mol Cell, 23: 483-96.
de Bruin, R. A., W. H. McDonald, T. I. Kalashnikova, J. Yates, 3rd, and C.
Wittenberg. 2004. 'Cln3 activates G1-specific transcription via phosphorylation of the SBF bound repressor Whi5', Cell, 117: 887-98.
De Virgilio, C., and R. Loewith. 2006. 'The TOR signalling network from yeast to man', Int J Biochem Cell Biol, 38: 1476-81.
Dechant, R., and M. Peter. 2008. 'Nutrient signals driving cell growth', Curr Opin Cell Biol, 20: 678-87.
Deforet, M., D. van Ditmarsch, and J. B. Xavier. 2015. 'Cell-Size Homeostasis and the Incremental Rule in a Bacterial Pathogen', Biophys J, 109: 521-8.
![Page 217: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/217.jpg)
197
Deminoff, S. J., S. C. Howard, A. Hester, S. Warner, and P. K. Herman. 2006. 'Using substrate-binding variants of the cAMP-dependent
protein kinase to identify novel targets and a kinase domain important for substrate interactions in Saccharomyces cerevisiae', Genetics, 173: 1909-17.
Deng, L., and J. B. Moseley. 2013. 'Compartmentalized nodes control mitotic entry signaling in fission yeast', Mol Biol Cell, 24: 1872-81.
Dirick, L., T. Bohm, and K. Nasmyth. 1995. 'Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae', EMBO J, 14: 4803-13.
Doncic, A., and J. M. Skotheim. 2013. 'Feedforward regulation ensures stability and rapid reversibility of a cellular state', Mol Cell, 50: 856-
68. Dorsey, S., S. Tollis, J. Cheng, L. Black, S. Notley, M. Tyers, and C. A.
Royer. 2018. 'G1/S Transcription Factor Copy Number Is a Growth-Dependent Determinant of Cell Cycle Commitment in Yeast', Cell Syst, 6: 539-54 e11.
Edelmann, A., M. Kruger, and J. Schmid. 2005. 'Genetic relationship between human and animal isolates of Candida albicans', J Clin Microbiol, 43: 6164-6.
Edgar, B. A. 2006. 'How flies get their size: genetics meets physiology', Nat Rev Genet, 7: 907-16.
Edmond, M. B., S. E. Wallace, D. K. McClish, M. A. Pfaller, R. N. Jones,
and R. P. Wenzel. 1999. 'Nosocomial bloodstream infections in United States hospitals: a three-year analysis', Clin Infect Dis, 29: 239-44.
Ene, I. V., L. A. Walker, M. Schiavone, K. K. Lee, H. Martin-Yken, E. Dague, N. A. Gow, C. A. Munro, and A. J. Brown. 2015. 'Cell Wall
Remodeling Enzymes Modulate Fungal Cell Wall Elasticity and Osmotic Stress Resistance', MBio, 6: e00986.
Enjalbert, B., D. A. Smith, M. J. Cornell, I. Alam, S. Nicholls, A. J. Brown,
and J. Quinn. 2006. 'Role of the Hog1 stress-activated protein kinase in the global transcriptional response to stress in the fungal
pathogen Candida albicans', Mol Biol Cell, 17: 1018-32. Eser, U., M. Falleur-Fettig, A. Johnson, and J. M. Skotheim. 2011.
'Commitment to a cellular transition precedes genome-wide transcriptional change', Mol Cell, 43: 515-27.
Eun, Y. J., P. Y. Ho, M. Kim, S. LaRussa, L. Robert, L. D. Renner, A.
Schmid, E. Garner, and A. Amir. 2018. 'Archaeal cells share common size control with bacteria despite noisier growth and
division', Nat Microbiol, 3: 148-54. Feldman, R. M., C. C. Correll, K. B. Kaplan, and R. J. Deshaies. 1997. 'A
complex of Cdc4p, Skp1p, and Cdc53p/cullin catalyzes
ubiquitination of the phosphorylated CDK inhibitor Sic1p', Cell, 91: 221-30.
![Page 218: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/218.jpg)
198
Ferrezuelo, F., N. Colomina, B. Futcher, and M. Aldea. 2010. 'The transcriptional network activated by Cln3 cyclin at the G1-to-S
transition of the yeast cell cycle', Genome Biol, 11: R67. Fidel, P. L., Jr. 2004. 'History and new insights into host defense against
vaginal candidiasis', Trends Microbiol, 12: 220-7.
Fingerman, I., V. Nagaraj, D. Norris, and A. K. Vershon. 2003. 'Sfp1 plays a key role in yeast ribosome biogenesis', Eukaryot Cell, 2: 1061-8.
Fitzpatrick, D. A., P. O'Gaora, K. P. Byrne, and G. Butler. 2010. 'Analysis of gene evolution and metabolic pathways using the Candida Gene
Order Browser', BMC Genomics, 11: 290. Forche, A., G. Cromie, A. C. Gerstein, N. V. Solis, T. Pisithkul, W. Srifa, E.
Jeffery, D. Abbey, S. G. Filler, A. M. Dudley, and J. Berman. 2018.
'Rapid Phenotypic and Genotypic Diversification After Exposure to the Oral Host Niche in Candida albicans', Genetics, 209: 725-41.
Gadal, O., S. Labarre, C. Boschiero, and P. Thuriaux. 2002. 'Hmo1, an HMG-box protein, belongs to the yeast ribosomal DNA transcription system', EMBO J, 21: 5498-507.
Garcia-Rodas, R., A. Casadevall, J. L. Rodriguez-Tudela, M. Cuenca-Estrella, and O. Zaragoza. 2011. 'Cryptococcus neoformans capsular
enlargement and cellular gigantism during Galleria mellonella infection', PLoS One, 6: e24485.
Garcia, C., A. Burgain, J. Chaillot, E. Pic, I. Khemiri, and A. Sellam. 2018. 'A phenotypic small-molecule screen identifies halogenated salicylanilides as inhibitors of fungal morphogenesis, biofilm
formation and host cell invasion', Sci Rep, 8: 11559. Geymonat, M., A. Spanos, G. P. Wells, S. J. Smerdon, and S. G. Sedgwick.
2004. 'Clb6/Cdc28 and Cdc14 regulate phosphorylation status and cellular localization of Swi6', Mol Cell Biol, 24: 2277-85.
Ginzberg, M. B., R. Kafri, and M. Kirschner. 2015. 'Cell biology. On being
the right (cell) size', Science, 348: 1245075. Gola, S., R. Martin, A. Walther, A. Dunkler, and J. Wendland. 2003. 'New
modules for PCR-based gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking homology region', Yeast, 20: 1339-47.
Gould, K. L., and P. Nurse. 1989. 'Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis', Nature, 342:
39-45. Gow, N. A. R., and B. Yadav. 2017. 'Microbe Profile: Candida albicans: a
shape-changing, opportunistic pathogenic fungus of humans', Microbiology, 163: 1145-47.
Green, C. B., G. Cheng, J. Chandra, P. Mukherjee, M. A. Ghannoum, and
L. L. Hoyer. 2004. 'RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of
oral candidiasis and in model biofilms', Microbiology, 150: 267-75.
![Page 219: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/219.jpg)
199
Grewal, S. S., L. Li, A. Orian, R. N. Eisenman, and B. A. Edgar. 2005. 'Myc-dependent regulation of ribosomal RNA synthesis during
Drosophila development', Nat Cell Biol, 7: 295-302. Guthrie, S. 2007. 'Patterning and axon guidance of cranial motor neurons',
Nat Rev Neurosci, 8: 859-71.
Haase, S. B., and C. Wittenberg. 2014. 'Topology and control of the cell-cycle-regulated transcriptional circuitry', Genetics, 196: 65-90.
Harris, L. K., and J. A. Theriot. 2018. 'Surface Area to Volume Ratio: A Natural Variable for Bacterial Morphogenesis', Trends Microbiol, 26:
815-32. Hartwell, L. H., J. Culotti, J. R. Pringle, and B. J. Reid. 1974. 'Genetic
control of the cell division cycle in yeast', Science, 183: 46-51.
Hedges, S. B., J. Marin, M. Suleski, M. Paymer, and S. Kumar. 2015. 'Tree of life reveals clock-like speciation and diversification', Mol Biol Evol, 32: 835-45.
Holden, H. M., J. B. Thoden, D. J. Timson, and R. J. Reece. 2004.
'Galactokinase: structure, function and role in type II galactosemia', Cell Mol Life Sci, 61: 2471-84.
Holmes, A. R., S. Tsao, S. W. Ong, E. Lamping, K. Niimi, B. C. Monk, M.
Niimi, A. Kaneko, B. R. Holland, J. Schmid, and R. D. Cannon. 2006. 'Heterozygosity and functional allelic variation in the Candida
albicans efflux pump genes CDR1 and CDR2', Mol Microbiol, 62: 170-86.
Homann, O. R., J. Dea, S. M. Noble, and A. D. Johnson. 2009. 'A
phenotypic profile of the Candida albicans regulatory network', PLoS Genet, 5: e1000783.
Huber, A., S. L. French, H. Tekotte, S. Yerlikaya, M. Stahl, M. P. Perepelkina, M. Tyers, J. Rougemont, A. L. Beyer, and R. Loewith.
2011. 'Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the histone deacetylase complex RPD3L', EMBO J, 30: 3052-64.
Hughes, J. D., P. W. Estep, S. Tavazoie, and G. M. Church. 2000.
'Computational identification of cis-regulatory elements associated with groups of functionally related genes in Saccharomyces
cerevisiae', J Mol Biol, 296: 1205-14. Hull, C. M., and A. D. Johnson. 1999. 'Identification of a mating type-like
locus in the asexual pathogenic yeast Candida albicans', Science,
285: 1271-5. Hussein, B., H. Huang, A. Glory, A. Osmani, S. Kaminskyj, A. Nantel, and
C. Bachewich. 2011. 'G1/S transcription factor orthologues Swi4p and Swi6p are important but not essential for cell proliferation and influence hyphal development in the fungal pathogen Candida
albicans', Eukaryot Cell, 10: 384-97. Ibrahim, A. S., B. B. Magee, D. C. Sheppard, M. Yang, S. Kauffman, J.
Becker, J. E. Edwards, Jr., and P. T. Magee. 2005. 'Effects of ploidy and mating type on virulence of Candida albicans', Infect Immun, 73:
7366-74.
![Page 220: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/220.jpg)
200
Irle, T., and E. Schierenberg. 2002. 'Developmental potential of fused Caenorhabditis elegans oocytes: generation of giant and twin
embryos', Dev Genes Evol, 212: 257-66. Ismail, H. M., O. Myronova, Y. Tsuchiya, A. Niewiarowski, I. Tsaneva, and
I. Gout. 2013. 'Identification of the general transcription factor Yin
Yang 1 as a novel and specific binding partner for S6 kinase 2', Cell Signal, 25: 1054-63.
Jia, Y., B. Rothermel, J. Thornton, and R. A. Butow. 1997. 'A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in
a signaling pathway from mitochondria to the nucleus', Mol Cell Biol, 17: 1110-7.
Jones, T., N. A. Federspiel, H. Chibana, J. Dungan, S. Kalman, B. B.
Magee, G. Newport, Y. R. Thorstenson, N. Agabian, P. T. Magee, R. W. Davis, and S. Scherer. 2004. 'The diploid genome sequence of
Candida albicans', Proc Natl Acad Sci U S A, 101: 7329-34. Jorgensen, P., J. L. Nishikawa, B. J. Breitkreutz, and M. Tyers. 2002.
'Systematic identification of pathways that couple cell growth and
division in yeast', Science, 297: 395-400. Jorgensen, P., I. Rupes, J. R. Sharom, L. Schneper, J. R. Broach, and M.
Tyers. 2004. 'A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size', Genes Dev, 18: 2491-505.
Jorgensen, P., and M. Tyers. 2004. 'How cells coordinate growth and division', Curr Biol, 14: R1014-27.
Jurden, L., M. Buchanan, G. Kelsberg, and S. Safranek. 2012. 'Clinical inquiries. Can probiotics safely prevent recurrent vaginitis?', J Fam Pract, 61: 357, 68.
Kastora, S. L., C. Herrero-de-Dios, G. M. Avelar, C. A. Munro, and A. J. P.
Brown. 2017. 'Sfp1 and Rtg3 reciprocally modulate carbon source-conditional stress adaptation in the pathogenic yeast Candida albicans', Mol Microbiol, 105: 620-36.
Kayingo, G., and B. Wong. 2005. 'The MAP kinase Hog1p differentially regulates stress-induced production and accumulation of glycerol
and D-arabitol in Candida albicans', Microbiology, 151: 2987-99. Keifenheim, D., X. M. Sun, E. D'Souza, M. J. Ohira, M. Magner, M. B.
Mayhew, S. Marguerat, and N. Rhind. 2017. 'Size-Dependent Expression of the Mitotic Activator Cdc25 Suggests a Mechanism of Size Control in Fission Yeast', Curr Biol, 27: 1491-97 e4.
Kim, J., and K. L. Guan. 2011. 'Amino acid signaling in TOR activation', Annu Rev Biochem, 80: 1001-32.
Kingsbury, J. M., and J. H. McCusker. 2010. 'Cytocidal amino acid starvation of Saccharomyces cerevisiae and Candida albicans acetolactate synthase (ilv2{Delta}) mutants is influenced by the
carbon source and rapamycin', Microbiology, 156: 929-39. Knauth, P., and H. Reichenbach. 2000. 'On the mechanism of action of the
myxobacterial fungicide ambruticin', J Antibiot (Tokyo), 53: 1182-90.
![Page 221: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/221.jpg)
201
Kojima, K., Y. S. Bahn, and J. Heitman. 2006. 'Calcineurin, Mpk1 and Hog1 MAPK pathways independently control fludioxonil antifungal
sensitivity in Cryptococcus neoformans', Microbiology, 152: 591-604. Koul, H. K., M. Pal, and S. Koul. 2013. 'Role of p38 MAP Kinase Signal
Transduction in Solid Tumors', Genes Cancer, 4: 342-59.
Krantz, M., E. Becit, and S. Hohmann. 2006. 'Comparative genomics of the HOG-signalling system in fungi', Curr Genet, 49: 137-51.
Lalla, R. V., L. L. Patton, and A. Dongari-Bagtzoglou. 2013. 'Oral candidiasis: pathogenesis, clinical presentation, diagnosis and
treatment strategies', J Calif Dent Assoc, 41: 263-8. Laplante, M., and D. M. Sabatini. 2012. 'mTOR signaling in growth control
and disease', Cell, 149: 274-93.
Lavoie, H., H. Hogues, J. Mallick, A. Sellam, A. Nantel, and M. Whiteway. 2010. 'Evolutionary tinkering with conserved components of a
transcriptional regulatory network', PLoS Biol, 8: e1000329. Lavoie, J. N., G. L'Allemain, A. Brunet, R. Muller, and J. Pouyssegur.
1996. 'Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway', J Biol Chem, 271: 20608-16.
Lee, J., R. D. Moir, and I. M. Willis. 2009. 'Regulation of RNA polymerase III transcription involves SCH9-dependent and SCH9-independent
branches of the target of rapamycin (TOR) pathway', J Biol Chem, 284: 12604-8.
Li, C. H., M. Cervantes, D. J. Springer, T. Boekhout, R. M. Ruiz-Vazquez, S. R. Torres-Martinez, J. Heitman, and S. C. Lee. 2011. 'Sporangiospore size dimorphism is linked to virulence of Mucor
circinelloides', PLoS Pathog, 7: e1002086. Lindås, Ann-Christin, and Rolf Bernander. 2013. 'The cell cycle of
archaea', Nature Reviews Microbiology, 11: 627. Lippman, S. I., and J. R. Broach. 2009. 'Protein kinase A and TORC1
activate genes for ribosomal biogenesis by inactivating repressors
encoded by Dot6 and its homolog Tod6', Proc Natl Acad Sci U S A, 106: 19928-33.
Liu, S., M. B. Ginzberg, N. Patel, M. Hild, B. Leung, Z. Li, Y. C. Chen, N. Chang, Y. Wang, C. Tan, S. Diena, W. Trimble, L. Wasserman, J. L. Jenkins, M. W. Kirschner, and R. Kafri. 2018. 'Size uniformity of
animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length', Elife, 7.
Liu, W., J. Zhao, X. Li, Y. Li, and L. Jiang. 2010. 'The protein kinase CaSch9p is required for the cell growth, filamentation and virulence in the human fungal pathogen Candida albicans', FEMS Yeast Res,
10: 462-70. Lloyd, A. C. 2013. 'The regulation of cell size', Cell, 154: 1194-205.
Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. 'Nonfilamentous C. albicans mutants are
avirulent', Cell, 90: 939-49.
![Page 222: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/222.jpg)
202
Lobner-Olesen, A., K. Skarstad, F. G. Hansen, K. von Meyenburg, and E. Boye. 1989. 'The DnaA protein determines the initiation mass of
Escherichia coli K-12', Cell, 57: 881-9. Loewith, R., and M. N. Hall. 2011. 'Target of rapamycin (TOR) in nutrient
signaling and growth control', Genetics, 189: 1177-201.
Loewith, R., E. Jacinto, S. Wullschleger, A. Lorberg, J. L. Crespo, D. Bonenfant, W. Oppliger, P. Jenoe, and M. N. Hall. 2002. 'Two TOR
complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control', Mol Cell, 10: 457-68.
Logsdon, M. M., P. Y. Ho, K. Papavinasasundaram, K. Richardson, M. Cokol, C. M. Sassetti, A. Amir, and B. B. Aldridge. 2017. 'A Parallel Adder Coordinates Mycobacterial Cell-Cycle Progression and Cell-
Size Homeostasis in the Context of Asymmetric Growth and Organization', Curr Biol, 27: 3367-74 e7.
Lopez-Martinez, R. 2010. 'Candidosis, a new challenge', Clin Dermatol, 28: 178-84.
Lozano, E., A. G. Saez, A. J. Flemming, A. Cunha, and A. M. Leroi. 2006.
'Regulation of growth by ploidy in Caenorhabditis elegans', Curr Biol, 16: 493-8.
Lutkenhaus, J. 2008. 'Min oscillation in bacteria', Adv Exp Med Biol, 641: 49-61.
Ma, X. M., and J. Blenis. 2009. 'Molecular mechanisms of mTOR-mediated translational control', Nat Rev Mol Cell Biol, 10: 307-18.
Magnuson, B., B. Ekim, and D. C. Fingar. 2012. 'Regulation and function
of ribosomal protein S6 kinase (S6K) within mTOR signalling networks', Biochem J, 441: 1-21.
Malavia, D., L. E. Lehtovirta-Morley, O. Alamir, E. Weiss, N. A. R. Gow, B. Hube, and D. Wilson. 2017. 'Zinc Limitation Induces a Hyper-Adherent Goliath Phenotype in Candida albicans', Front Microbiol, 8:
2238. Malinverni, C., M. Cremaschi, F. D'Adda, G. Cassina, and P. Seghizzi.
1985. '[Epidemiology of ischemic cardiopathy in a large iron foundry]', G Ital Med Lav, 7: 81-8.
Mancuso, R., J. Chinnici, C. Tsou, S. Busarajan, R. Munnangi, and A. Maddi. 2018. 'Functions of Candida albicans cell wall glycosidases Dfg5p and Dcw1p in biofilm formation and HOG MAPK pathway',
PeerJ, 6: e5685. Marchetti, O., J. Bille, U. Fluckiger, P. Eggimann, C. Ruef, J. Garbino, T.
Calandra, M. P. Glauser, M. G. Tauber, D. Pittet, and Switzerland Fungal Infection Network of. 2004. 'Epidemiology of candidemia in Swiss tertiary care hospitals: secular trends, 1991-2000', Clin Infect Dis, 38: 311-20.
Marion, R. M., A. Regev, E. Segal, Y. Barash, D. Koller, N. Friedman, and
E. K. O'Shea. 2004. 'Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression', Proc Natl Acad Sci U S A, 101: 14315-22.
![Page 223: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/223.jpg)
203
Marshall, W. F., K. D. Young, M. Swaffer, E. Wood, P. Nurse, A. Kimura, J. Frankel, J. Wallingford, V. Walbot, X. Qu, and A. H. Roeder. 2012.
'What determines cell size?', BMC Biol, 10: 101. Martchenko, M., A. Levitin, H. Hogues, A. Nantel, and M. Whiteway. 2007.
'Transcriptional rewiring of fungal galactose-metabolism circuitry',
Curr Biol, 17: 1007-13. Martin, S. G., and M. Berthelot-Grosjean. 2009. 'Polar gradients of the
DYRK-family kinase Pom1 couple cell length with the cell cycle', Nature, 459: 852-6.
Mazzi, S., L. Lordier, N. Debili, H. Raslova, and W. Vainchenker. 2018. 'Megakaryocyte and polyploidization', Exp Hematol, 57: 1-13.
McCarthy, M. W., D. P. Kontoyiannis, O. A. Cornely, J. R. Perfect, and T. J.
Walsh. 2017. 'Novel Agents and Drug Targets to Meet the Challenges of Resistant Fungi', J Infect Dis, 216: S474-S83.
Miettinen, T. P., and M. Bjorklund. 2016. 'Cellular Allometry of Mitochondrial Functionality Establishes the Optimal Cell Size', Dev Cell, 39: 370-82.
Miettinen, T. P., M. J. Caldez, P. Kaldis, and M. Bjorklund. 2017. 'Cell size control - a mechanism for maintaining fitness and function',
Bioessays, 39. Mikule, K., B. Delaval, P. Kaldis, A. Jurcyzk, P. Hergert, and S. Doxsey.
2007. 'Loss of centrosome integrity induces p38-p53-p21-dependent G1-S arrest', Nat Cell Biol, 9: 160-70.
Miller, M. G., and A. D. Johnson. 2002. 'White-opaque switching in Candida albicans is controlled by mating-type locus homeodomain proteins and allows efficient mating', Cell, 110: 293-302.
Mio, T., M. Adachi-Shimizu, Y. Tachibana, H. Tabuchi, S. B. Inoue, T. Yabe, T. Yamada-Okabe, M. Arisawa, T. Watanabe, and H. Yamada-
Okabe. 1997. 'Cloning of the Candida albicans homolog of Saccharomyces cerevisiae GSC1/FKS1 and its involvement in beta-1,3-glucan synthesis', J Bacteriol, 179: 4096-105.
Miramon, P., and M. C. Lorenz. 2017. 'A feast for Candida: Metabolic plasticity confers an edge for virulence', PLoS Pathog, 13: e1006144.
Monds, R. D., T. K. Lee, A. Colavin, T. Ursell, S. Quan, T. F. Cooper, and K. C. Huang. 2014. 'Systematic perturbation of cytoskeletal function reveals a linear scaling relationship between cell geometry and
fitness', Cell Rep, 9: 1528-37. Montagne, J., M. J. Stewart, H. Stocker, E. Hafen, S. C. Kozma, and G.
Thomas. 1999. 'Drosophila S6 kinase: a regulator of cell size', Science, 285: 2126-9.
Moosa, M. Y., J. D. Sobel, H. Elhalis, W. Du, and R. A. Akins. 2004. 'Fungicidal activity of fluconazole against Candida albicans in a synthetic vagina-simulative medium', Antimicrob Agents Chemother, 48: 161-7.
![Page 224: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/224.jpg)
204
Moseley, J. B., A. Mayeux, A. Paoletti, and P. Nurse. 2009. 'A spatial gradient coordinates cell size and mitotic entry in fission yeast',
Nature, 459: 857-60. Moullan, N., L. Mouchiroud, X. Wang, D. Ryu, E. G. Williams, A. Mottis, V.
Jovaisaite, M. V. Frochaux, P. M. Quiros, B. Deplancke, R. H.
Houtkooper, and J. Auwerx. 2015. 'Tetracyclines Disturb Mitochondrial Function across Eukaryotic Models: A Call for Caution
in Biomedical Research', Cell Rep. Moyes, D. L., M. Runglall, C. Murciano, C. Shen, D. Nayar, S. Thavaraj, A.
Kohli, A. Islam, H. Mora-Montes, S. J. Challacombe, and J. R.
Naglik. 2010. 'A biphasic innate immune MAPK response discriminates between the yeast and hyphal forms of Candida
albicans in epithelial cells', Cell Host Microbe, 8: 225-35. Nash, P., X. Tang, S. Orlicky, Q. Chen, F. B. Gertler, M. D. Mendenhall, F.
Sicheri, T. Pawson, and M. Tyers. 2001. 'Multisite phosphorylation of
a CDK inhibitor sets a threshold for the onset of DNA replication', Nature, 414: 514-21.
Navarro, F. J., and P. Nurse. 2012. 'A systematic screen reveals new elements acting at the G2/M cell cycle control', Genome Biol, 13:
R36. Nobile, C. J., and A. P. Mitchell. 2005. 'Regulation of cell-surface genes
and biofilm formation by the C. albicans transcription factor Bcr1p',
Curr Biol, 15: 1150-5. Noble, S. M., S. French, L. A. Kohn, V. Chen, and A. D. Johnson. 2010.
'Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity', Nat Genet, 42: 590-8.
Noble, S. M., and A. D. Johnson. 2005. 'Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen
Candida albicans', Eukaryot Cell, 4: 298-309. Nurse, P. 1990. 'Universal control mechanism regulating onset of M-
phase', Nature, 344: 503-8. Odds, F. C., A. J. Brown, and N. A. Gow. 2004. 'Candida albicans genome
sequence: a platform for genomics in the absence of genetics', Genome Biol, 5: 230.
Ofir, A., K. Hofmann, E. Weindling, T. Gildor, K. S. Barker, P. D. Rogers,
and D. Kornitzer. 2012. 'Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene expression and DNA replication stress
response', Mol Microbiol, 84: 778-94. Okagaki, L. H., A. K. Strain, J. N. Nielsen, C. Charlier, N. J. Baltes, F.
Chretien, J. Heitman, F. Dromer, and K. Nielsen. 2010.
'Cryptococcal cell morphology affects host cell interactions and pathogenicity', PLoS Pathog, 6: e1000953.
Olaiya, A. F., and S. J. Sogin. 1979. 'Ploidy determination of Canadida albicans', J Bacteriol, 140: 1043-9.
![Page 225: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/225.jpg)
205
Palacios, P., M. Vicente, and M. Sanchez. 1996. 'Dependency of Escherichia coli cell-division size, and independency of nucleoid
segregation on the mode and level of ftsZ expression', Mol Microbiol, 20: 1093-8.
Pan, K. Z., T. E. Saunders, I. Flor-Parra, M. Howard, and F. Chang. 2014.
'Cortical regulation of cell size by a sizer cdr2p', Elife, 3: e02040. Pande, K., C. Chen, and S. M. Noble. 2013. 'Passage through the
mammalian gut triggers a phenotypic switch that promotes Candida albicans commensalism', Nat Genet, 45: 1088-91.
Pappas, P. G. 2006. 'Invasive candidiasis', Infect Dis Clin North Am, 20: 485-506.
Pappas, P. G., C. A. Kauffman, D. R. Andes, C. J. Clancy, K. A. Marr, L.
Ostrosky-Zeichner, A. C. Reboli, M. G. Schuster, J. A. Vazquez, T. J. Walsh, T. E. Zaoutis, and J. D. Sobel. 2016. 'Clinical Practice
Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases Society of America', Clin Infect Dis, 62: e1-50.
Perfect, J. R. 2017. 'The antifungal pipeline: a reality check', Nat Rev Drug Discov, 16: 603-16.
Pfaller, M. A., D. J. Diekema, A. L. Colombo, C. Kibbler, K. P. Ng, D. L.
Gibbs, and V. A. Newell. 2006. 'Candida rugosa, an emerging fungal pathogen with resistance to azoles: geographic and temporal trends
from the ARTEMIS DISK antifungal surveillance program', J Clin Microbiol, 44: 3578-82.
Pierce, C. G., T. Vila, J. A. Romo, D. Montelongo-Jauregui, G. Wall, A. Ramasubramanian, and J. L. Lopez-Ribot. 2017. 'The Candida albicans Biofilm Matrix: Composition, Structure and Function', J Fungi (Basel), 3.
Pluta, K., O. Lefebvre, N. C. Martin, W. J. Smagowicz, D. R. Stanford, S. R.
Ellis, A. K. Hopper, A. Sentenac, and M. Boguta. 2001. 'Maf1p, a negative effector of RNA polymerase III in Saccharomyces cerevisiae', Mol Cell Biol, 21: 5031-40.
Popolo, L., M. Vanoni, and L. Alberghina. 1982. 'Control of the yeast cell cycle by protein synthesis', Exp Cell Res, 142: 69-78.
Ramage, G., S. P. Saville, D. P. Thomas, and J. L. Lopez-Ribot. 2005. 'Candida biofilms: an update', Eukaryot Cell, 4: 633-8.
Rathmell, J. C., M. G. Vander Heiden, M. H. Harris, K. A. Frauwirth, and C. B. Thompson. 2000. 'In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size
or viability', Mol Cell, 6: 683-92. Reinke, A., S. Anderson, J. M. McCaffery, J. Yates, 3rd, S. Aronova, S.
Chu, S. Fairclough, C. Iverson, K. P. Wedaman, and T. Powers. 2004. 'TOR complex 1 includes a novel component, Tco89p (YPL180w), and cooperates with Ssd1p to maintain cellular integrity
in Saccharomyces cerevisiae', J Biol Chem, 279: 14752-62. Riggi, M., K. Niewola-Staszkowska, N. Chiaruttini, A. Colom, B. Kusmider,
V. Mercier, S. Soleimanpour, M. Stahl, S. Matile, A. Roux, and R.
![Page 226: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/226.jpg)
206
Loewith. 2018. 'Decrease in plasma membrane tension triggers PtdIns(4,5)P2 phase separation to inactivate TORC2', Nat Cell Biol, 20: 1043-51.
Robert, L. 2015. 'Size sensors in bacteria, cell cycle control, and size control', Front Microbiol, 6: 515.
Roemer, T., B. Jiang, J. Davison, T. Ketela, K. Veillette, A. Breton, F. Tandia, A. Linteau, S. Sillaots, C. Marta, N. Martel, S. Veronneau, S.
Lemieux, S. Kauffman, J. Becker, R. Storms, C. Boone, and H. Bussey. 2003. 'Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery', Mol Microbiol, 50: 167-81.
Rohde, J. R., R. Bastidas, R. Puria, and M. E. Cardenas. 2008. 'Nutritional
control via Tor signaling in Saccharomyces cerevisiae', Curr Opin Microbiol, 11: 153-60.
Romanov, N., D. M. Hollenstein, M. Janschitz, G. Ammerer, D. Anrather, and W. Reiter. 2017. 'Identifying protein kinase-specific effectors of
the osmostress response in yeast', Sci Signal, 10. Rothfield, L., A. Taghbalout, and Y. L. Shih. 2005. 'Spatial control of
bacterial division-site placement', Nat Rev Microbiol, 3: 959-68.
Russell, P., and P. Nurse. 1987. 'Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog', Cell, 49: 559-67.
Saito, H., and F. Posas. 2012. 'Response to hyperosmotic stress', Genetics, 192: 289-318.
San Jose, C., R. A. Monge, R. Perez-Diaz, J. Pla, and C. Nombela. 1996. 'The mitogen-activated protein kinase homolog HOG1 gene controls glycerol accumulation in the pathogenic fungus Candida albicans', J Bacteriol, 178: 5850-2.
Santos, M. A., T. Ueda, K. Watanabe, and M. F. Tuite. 1997. 'The non-
standard genetic code of Candida spp.: an evolving genetic code or a novel mechanism for adaptation?', Mol Microbiol, 26: 423-31.
Satoh, K., K. Makimura, Y. Hasumi, Y. Nishiyama, K. Uchida, and H. Yamaguchi. 2009. 'Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a
Japanese hospital', Microbiol Immunol, 53: 41-4. Satpati, S., K. Manohar, N. Acharya, and A. Dixit. 2017. 'Comparative
molecular dynamics studies of heterozygous open reading frames of DNA polymerase eta (eta) in pathogenic yeast Candida albicans', Sci Rep, 7: 41087.
Saucedo, L. J., and B. A. Edgar. 2002. 'Why size matters: altering cell size', Curr Opin Genet Dev, 12: 565-71.
Savage-Dunn, C., L. L. Maduzia, C. M. Zimmerman, A. F. Roberts, S. Cohen, R. Tokarz, and R. W. Padgett. 2003. 'Genetic screen for small
body size mutants in C. elegans reveals many TGFbeta pathway components', Genesis, 35: 239-47.
Saville, S. P., A. L. Lazzell, C. Monteagudo, and J. L. Lopez-Ribot. 2003.
'Engineered control of cell morphology in vivo reveals distinct roles
![Page 227: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/227.jpg)
207
for yeast and filamentous forms of Candida albicans during infection', Eukaryot Cell, 2: 1053-60.
Sawant, B., and T. Khan. 2017. 'Recent advances in delivery of antifungal agents for therapeutic management of candidiasis', Biomed Pharmacother, 96: 1478-90.
Schaechter, M., O. Maaloe, and N. O. Kjeldgaard. 1958. 'Dependency on medium and temperature of cell size and chemical composition
during balanced grown of Salmonella typhimurium', J Gen Microbiol, 19: 592-606.
Schaefer, J. B., and L. L. Breeden. 2004. 'RB from a bud's eye view', Cell, 117: 849-50.
Schmoller, K. M., J. J. Turner, M. Koivomagi, and J. M. Skotheim. 2015. 'Dilution of the cell cycle inhibitor Whi5 controls budding-yeast cell size', Nature, 526: 268-72.
Schneider, B. L., Q. H. Yang, and A. B. Futcher. 1996. 'Linkage of replication to start by the Cdk inhibitor Sic1', Science, 272: 560-2.
Schneider, B. L., J. Zhang, J. Markwardt, G. Tokiwa, T. Volpe, S. Honey, and B. Futcher. 2004. 'Growth rate and cell size modulate the synthesis of, and requirement for, G1-phase cyclins at start', Mol Cell Biol, 24: 10802-13.
Schonherr, F. A., F. Sparber, F. R. Kirchner, E. Guiducci, K. Trautwein-
Weidner, A. Gladiator, N. Sertour, U. Hetzel, G. T. T. Le, N. Pavelka, C. d'Enfert, M. E. Bougnoux, C. F. Corti, and S. LeibundGut-
Landmann. 2017. 'The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity', Mucosal Immunol, 10: 1335-50.
Schulz, H. N., T. Brinkhoff, T. G. Ferdelman, M. H. Marine, A. Teske, and
B. B. Jorgensen. 1999. 'Dense populations of a giant sulfur bacterium in Namibian shelf sediments', Science, 284: 493-5.
Schulz, H. N., and B. B. Jorgensen. 2001. 'Big bacteria', Annu Rev Microbiol, 55: 105-37.
Schwob, E., T. Bohm, M. D. Mendenhall, and K. Nasmyth. 1994. 'The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae', Cell, 79: 233-44.
Seider, K., A. Heyken, A. Luttich, P. Miramon, and B. Hube. 2010. 'Interaction of pathogenic yeasts with phagocytes: survival,
persistence and escape', Curr Opin Microbiol, 13: 392-400. Sellam, A., T. Al-Niemi, K. McInnerney, S. Brumfield, A. Nantel, and P. A.
Suci. 2009. 'A Candida albicans early stage biofilm detachment
event in rich medium', BMC Microbiol, 9: 25. Sellam, A., C. Askew, E. Epp, F. Tebbji, A. Mullick, M. Whiteway, and A.
Nantel. 2010. 'Role of transcription factor CaNdt80p in cell separation, hyphal growth, and virulence in Candida albicans', Eukaryot Cell, 9: 634-44.
![Page 228: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/228.jpg)
208
Sellam, A., H. Hogues, C. Askew, F. Tebbji, M. van Het Hoog, H. Lavoie, C. A. Kumamoto, M. Whiteway, and A. Nantel. 2010. 'Experimental
annotation of the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays', Genome Biol, 11: R71.
Sheikh-Hamad, D., and M. C. Gustin. 2004. 'MAP kinases and the adaptive response to hypertonicity: functional preservation from
yeast to mammals', Am J Physiol Renal Physiol, 287: F1102-10. Shevchenko, A., A. Roguev, D. Schaft, L. Buchanan, B. Habermann, C.
Sakalar, H. Thomas, N. J. Krogan, A. Shevchenko, and A. F. Stewart.
2008. 'Chromatin Central: towards the comparative proteome by accurate mapping of the yeast proteomic environment', Genome Biol, 9: R167.
Shubitz, L. F., J. N. Galgiani, Z. Q. Tian, Z. Zhong, P. Timmermans, and L. Katz. 2006. 'Efficacy of ambruticin analogs in a murine model of
coccidioidomycosis', Antimicrob Agents Chemother, 50: 3467-9. Silverman, J. F., W. J. Pories, and J. F. Caro. 1989. 'Liver pathology in
diabetes mellitus and morbid obesity. Clinical, pathological, and biochemical considerations', Pathol Annu, 24 Pt 1: 275-302.
Simon, I., J. Barnett, N. Hannett, C. T. Harbison, N. J. Rinaldi, T. L. Volkert, J. J. Wyrick, J. Zeitlinger, D. K. Gifford, T. S. Jaakkola, and R. A. Young. 2001. 'Serial regulation of transcriptional regulators in
the yeast cell cycle', Cell, 106: 697-708. Skotheim, J. M., S. Di Talia, E. D. Siggia, and F. R. Cross. 2008. 'Positive
feedback of G1 cyclins ensures coherent cell cycle entry', Nature, 454: 291-6.
Slutsky, B., M. Staebell, J. Anderson, L. Risen, M. Pfaller, and D. R. Soll.
1987. '"White-opaque transition": a second high-frequency switching system in Candida albicans', J Bacteriol, 169: 189-97.
Smith, C., A. Pomiankowski, and D. Greig. 2014. 'Size and competitive mating success in the yeast Saccharomyces cerevisiae', Behav Ecol, 25: 320-27.
Smith, D. A., S. Nicholls, B. A. Morgan, A. J. Brown, and J. Quinn. 2004. 'A conserved stress-activated protein kinase regulates a core stress
response in the human pathogen Candida albicans', Mol Biol Cell, 15: 4179-90.
Sobel, J. D. 2007. 'Vulvovaginal candidosis', Lancet, 369: 1961-71. Soifer, I., and N. Barkai. 2014. 'Systematic identification of cell size
regulators in budding yeast', Mol Syst Biol, 10: 761.
Soifer, I., L. Robert, and A. Amir. 2016. 'Single-Cell Analysis of Growth in Budding Yeast and Bacteria Reveals a Common Size Regulation
Strategy', Curr Biol, 26: 356-61. Soll, D. R. 1992. 'High-frequency switching in Candida albicans', Clin
Microbiol Rev, 5: 183-203. Stichternoth, C., A. Fraund, E. Setiadi, L. Giasson, A. Vecchiarelli, and J.
F. Ernst. 2011. 'Sch9 kinase integrates hypoxia and CO2 sensing to
![Page 229: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/229.jpg)
209
suppress hyphal morphogenesis in Candida albicans', Eukaryot Cell, 10: 502-11.
Stuart, D., and C. Wittenberg. 1995. 'CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells', Genes Dev, 9: 2780-94.
Sturgill, T. W., A. Cohen, M. Diefenbacher, M. Trautwein, D. E. Martin, and M. N. Hall. 2008. 'TOR1 and TOR2 have distinct locations in live
cells', Eukaryot Cell, 7: 1819-30. Sudbery, P. E. 2011. 'Growth of Candida albicans hyphae', Nat Rev
Microbiol, 9: 737-48. Sveiczer, A., and A. Horvath. 2017. 'How do fission yeast cells grow and
connect growth to the mitotic cycle?', Curr Genet, 63: 165-73. Taberner, F. J., I. Quilis, and J. C. Igual. 2009. 'Spatial regulation of the
start repressor Whi5', Cell Cycle, 8: 3010-8.
Taheri-Araghi, S., S. Bradde, J. T. Sauls, N. S. Hill, P. A. Levin, J. Paulsson, M. Vergassola, and S. Jun. 2015. 'Cell-size control and
homeostasis in bacteria', Curr Biol, 25: 385-91. Tao, L., H. Du, G. Guan, Y. Dai, C. J. Nobile, W. Liang, C. Cao, Q. Zhang,
J. Zhong, and G. Huang. 2014. 'Discovery of a "white-gray-opaque" tristable phenotypic switching system in candida albicans: roles of non-genetic diversity in host adaptation', PLoS Biol, 12: e1001830.
Thewes, S., M. Kretschmar, H. Park, M. Schaller, S. G. Filler, and B. Hube. 2007. 'In vivo and ex vivo comparative transcriptional profiling of
invasive and non-invasive Candida albicans isolates identifies genes associated with tissue invasion', Mol Microbiol, 63: 1606-28.
Tropini, C., T. K. Lee, J. Hsin, S. M. Desmarais, T. Ursell, R. D. Monds,
and K. C. Huang. 2014. 'Principles of bacterial cell-size determination revealed by cell-wall synthesis perturbations', Cell Rep, 9: 1520-7.
Trueba, F. J., and C. L. Woldringh. 1980. 'Changes in cell diameter during
the division cycle of Escherichia coli', J Bacteriol, 142: 869-78. Tumaneng, K., R. C. Russell, and K. L. Guan. 2012. 'Organ size control by
Hippo and TOR pathways', Curr Biol, 22: R368-79.
Turner, J. J., J. C. Ewald, and J. M. Skotheim. 2012. 'Cell size control in yeast', Curr Biol, 22: R350-9.
Tyers, M. 1996. 'The cyclin-dependent kinase inhibitor p40SIC1 imposes the requirement for Cln G1 cyclin function at Start', Proc Natl Acad Sci U S A, 93: 7772-6.
Tyers, M., G. Tokiwa, and B. Futcher. 1993. 'Comparison of the
Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins', EMBO J, 12: 1955-68.
Urban, J., A. Soulard, A. Huber, S. Lippman, D. Mukhopadhyay, O.
Deloche, V. Wanke, D. Anrather, G. Ammerer, H. Riezman, J. R. Broach, C. De Virgilio, M. N. Hall, and R. Loewith. 2007. 'Sch9 is a
major target of TORC1 in Saccharomyces cerevisiae', Mol Cell, 26: 663-74.
![Page 230: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/230.jpg)
210
van Riggelen, J., A. Yetil, and D. W. Felsher. 2010. 'MYC as a regulator of ribosome biogenesis and protein synthesis', Nat Rev Cancer, 10:
301-9. Vandeputte, P., S. Pradervand, F. Ischer, A. T. Coste, S. Ferrari, K.
Harshman, and D. Sanglard. 2012. 'Identification and functional
characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans',
Eukaryot Cell, 11: 916-31. Varsano, G., Y. Wang, and M. Wu. 2017. 'Probing Mammalian Cell Size
Homeostasis by Channel-Assisted Cell Reshaping', Cell Rep, 20: 397-
410. Verges, E., N. Colomina, E. Gari, C. Gallego, and M. Aldea. 2007. 'Cyclin
Cln3 is retained at the ER and released by the J chaperone Ydj1 in late G1 to trigger cell cycle entry', Mol Cell, 26: 649-62.
Verma, R., R. M. Feldman, and R. J. Deshaies. 1997. 'SIC1 is ubiquitinated in vitro by a pathway that requires CDC4, CDC34, and cyclin/CDK activities', Mol Biol Cell, 8: 1427-37.
Vylkova, S., and M. C. Lorenz. 2017. 'Phagosomal Neutralization by the Fungal Pathogen Candida albicans Induces Macrophage Pyroptosis',
Infect Immun, 85. Wade, C. H., M. A. Umbarger, and M. A. McAlear. 2006. 'The budding
yeast rRNA and ribosome biosynthesis (RRB) regulon contains over
200 genes', Yeast, 23: 293-306. Walker, L. A., D. M. Maccallum, G. Bertram, N. A. Gow, F. C. Odds, and A.
J. Brown. 2009. 'Genome-wide analysis of Candida albicans gene expression patterns during infection of the mammalian kidney', Fungal Genet Biol, 46: 210-9.
Wang, H., W. Song, G. Huang, Z. Zhou, Y. Ding, and J. Chen. 2011. 'Candida albicans Zcf37, a zinc finger protein, is required for
stabilization of the white state', FEBS Lett, 585: 797-802. Wang, L., and X. Lin. 2012. 'Morphogenesis in fungal pathogenicity: shape,
size, and surface', PLoS Pathog, 8: e1003027. Wang, R., C. P. Dillon, L. Z. Shi, S. Milasta, R. Carter, D. Finkelstein, L. L.
McCormick, P. Fitzgerald, H. Chi, J. Munger, and D. R. Green. 2011.
'The transcription factor Myc controls metabolic reprogramming upon T lymphocyte activation', Immunity, 35: 871-82.
Warner, J. R. 1999. 'The economics of ribosome biosynthesis in yeast', Trends Biochem Sci, 24: 437-40.
Watanabe, N., T. Ishihara, and Y. Ohshima. 2007. 'Mutants carrying two sma mutations are super small in the nematode C. elegans', Genes Cells, 12: 603-9.
Wedaman, K. P., A. Reinke, S. Anderson, J. Yates, 3rd, J. M. McCaffery, and T. Powers. 2003. 'Tor kinases are in distinct membrane-
associated protein complexes in Saccharomyces cerevisiae', Mol Biol Cell, 14: 1204-20.
Wells, W. A. 2002. 'Does size matter?', J Cell Biol, 158: 1156-9.
![Page 231: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/231.jpg)
211
Wertheimer, N. B., N. Stone, and J. Berman. 2016. 'Ploidy dynamics and evolvability in fungi', Philos Trans R Soc Lond B Biol Sci, 371.
Wijnen, H., and B. Futcher. 1999. 'Genetic analysis of the shared role of CLN3 and BCK2 at the G(1)-S transition in Saccharomyces cerevisiae', Genetics, 153: 1131-43.
Wisplinghoff, H., T. Bischoff, S. M. Tallent, H. Seifert, R. P. Wenzel, and M. B. Edmond. 2004. 'Nosocomial bloodstream infections in US
hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study', Clin Infect Dis, 39: 309-17.
Wong, J. M., and D. J. Jenkins. 2007. 'Carbohydrate digestibility and metabolic effects', J Nutr, 137: 2539S-46S.
Wood, E., and P. Nurse. 2015. 'Sizing up to divide: mitotic cell-size control
in fission yeast', Annu Rev Cell Dev Biol, 31: 11-29. Wu, W., C. Pujol, S. R. Lockhart, and D. R. Soll. 2005. 'Chromosome loss
followed by duplication is the major mechanism of spontaneous mating-type locus homozygosis in Candida albicans', Genetics, 169:
1311-27. Yamamoto, K., V. Gandin, M. Sasaki, S. McCracken, W. Li, J. L. Silvester,
A. J. Elia, F. Wang, Y. Wakutani, R. Alexandrova, Y. D. Oo, P. J.
Mullen, S. Inoue, M. Itsumi, V. Lapin, J. Haight, A. Wakeham, A. Shahinian, M. Ikura, I. Topisirovic, N. Sonenberg, and T. W. Mak. 2014. 'Largen: a molecular regulator of mammalian cell size control',
Mol Cell, 53: 904-15. Yang, X., K. Y. Lau, V. Sevim, and C. Tang. 2013. 'Design principles of the
yeast G1/S switch', PLoS Biol, 11: e1001673. Yee, A. S., E. K. Paulson, M. A. McDevitt, K. Rieger-Christ, I.
Summerhayes, S. P. Berasi, J. Kim, C. Y. Huang, and X. Zhang. 2004. 'The HBP1 transcriptional repressor and the p38 MAP kinase: unlikely partners in G1 regulation and tumor suppression', Gene,
336: 1-13. Young, K. D. 2006. 'The selective value of bacterial shape', Microbiol Mol
Biol Rev, 70: 660-703. Zaragoza, O., R. Garcia-Rodas, J. D. Nosanchuk, M. Cuenca-Estrella, J. L.
Rodriguez-Tudela, and A. Casadevall. 2010. 'Fungal cell gigantism during mammalian infection', PLoS Pathog, 6: e1000945.
Zetterberg, A., O. Larsson, and K. G. Wiman. 1995. 'What is the restriction
point?', Curr Opin Cell Biol, 7: 835-42. Zhang, H., J. P. Stallock, J. C. Ng, C. Reinhard, and T. P. Neufeld. 2000.
'Regulation of cellular growth by the Drosophila target of rapamycin dTOR', Genes Dev, 14: 2712-24.
![Page 232: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/232.jpg)
212
Annexe 1 - The monoterpene carvacrol generates
endoplasmic reticulum stress in the pathogenic
fungus Candida albicans
Résumé
Le carvacrol, un monoterpène constituant de l’origan et du thym, est
connu pour avoir un fort pouvoir antifongique contre la levure pathogène
Candida albicans. Ce monoterpène a été le sujet d’un grand nombre
d’études sur ses effets pharmacologiques ainsi que sur ses effets
antifongiques et antibactériens. Cependant, son mécanisme d’action n’est
pas encore compris. Dans cette étude, nous avons utilisé une approche de
chemogénomique afin de comprendre le mécanisme d’action du carvacrol
associé à ses propriétés antifongiques. Nos résultats démontrent que les
levures nécessitent la voie UPR (Unfolded Protein Response) pour résister
au carvacrol. Dans notre test de fitness sur le génome complet de
Saccharomyces cerevisiae, les mutants les plus sensibles sont le facteur de
transcription Hac1 et l’endonucléase Ire1. Ire1 est nécessaire pour
l’activation de Hac1 en clivant un intron non conventionnel de la région 3’
de l’ARNm de HAC1.
La microscopie confocale a révélé que le carvacrol affecte la morphologie et
l’intégrité du réticulum endoplasmique. Le profil transcriptionnel de la
levure pathogène C. albicans traité par du carvacrol montre l’activation de
l’UPR. L’activité d’Ire1 est détectée par l’épissage de l’ARNm Hac1 chez C.
albicans traité au carvacrol. De plus, le carvacrol augmente l’activité
antifongique de la caspofongine et des inducteurs de l’UPR (dithiothreitol
et tunicamycine) contre C. albicans. Cette étude démontre que le carvacrol
agit en altérant l’intégrité du réticulum endosplasmique, menant à un
stress du réticulum et l’activation de la voie UPR pour restaurer
l’homéostasie de la conformation des protéines.
![Page 233: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/233.jpg)
213
Article
The monoterpene carvacrol generates endoplasmic reticulum stress in
the pathogenic fungus Candida albicans
Chaillot J1, Tebbji F1, Remmal A2, Boone C3, Brown GW4, Bellaoui M5,
Sellam A6
Antimicrob Agents Chemother. 2015 Aug; 59(8): 4584–4592. Published
online 2015 Jul 16. Prepublished online 2015 May 26. doi:
10.1128/AAC.00551-15
1 Infectious Diseases Research Centre (CRI), CHU de Québec Research
Center (CHUQ), Université Laval, Quebec City, Quebec, Canada.
2 Laboratoire de Biotechnologie, Faculty of Science of Fes, Sidi Mohammed
Ben Abdallah University, Atlas Fes, Morocco.
3 Department of Molecular Genetics, University of Toronto, Toronto,
Ontario, Canada Donnelly Centre, University of Toronto, Toronto, Ontario,
Canada.
4 Donnelly Centre, University of Toronto, Toronto, Ontario, Canada
Department of Biochemistry, University of Toronto, Toronto, Ontario,
Canada.
5 Medical Biology Unit, Faculty of Medicine and Pharmacy of Oujda,
University Mohammed the First, Oujda, Morocco [email protected]
6 Infectious Diseases Research Centre (CRI), CHU de Québec Research
Center (CHUQ), Université Laval, Quebec City, Quebec, Canada
Department of Microbiology, Infectious Disease and Immunology, Faculty
of Medicine, Université Laval, Quebec City, Quebec, Canada
[email protected] [email protected].
J.C. and F.T. contributed equally to this article.
![Page 234: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/234.jpg)
214
Abstract
The monoterpene carvacrol, the major component of oregano and thyme
oils, is known to exert potent antifungal activity against the pathogenic
yeast Candida albicans. This monoterpene has been the subject of a
considerable number of investigations that uncovered extensive
pharmacological properties, including antifungal and antibacterial effects.
However, its mechanism of action remains elusive. Here, we used
integrative chemogenomic approaches, including genome-scale chemical-
genetic and transcriptional profiling, to uncover the mechanism of action
of carvacrol associated with its antifungal property. Our results clearly
demonstrated that fungal cells require the unfolded protein response (UPR)
signaling pathway to resist carvacrol. The mutants most sensitive to
carvacrol in our genome-wide competitive fitness assay in the yeast
Saccharomyces cerevisiae expressed mutations of the transcription factor
Hac1 and the endonuclease Ire1, which is required for Hac1 activation by
removing a nonconventional intron from the 3′ region of HAC1 mRNA.
Confocal fluorescence live-cell imaging revealed that carvacrol affects the
morphology and the integrity of the endoplasmic reticulum (ER).
Transcriptional profiling of pathogenic yeast C. albicans cells treated with
carvacrol demonstrated a bona fide UPR transcriptional signature. Ire1
activity detected by the splicing of HAC1 mRNA in C. albicans was
activated by carvacrol. Furthermore, carvacrol was found to potentiate
antifungal activity of the echinocandin antifungal caspofungin and UPR
inducers dithiothreitol and tunicamycin against C. albicans. This
comprehensive chemogenomic investigation demonstrated that carvacrol
exerts its antifungal activity by altering ER integrity, leading to ER stress
and the activation of the UPR to restore protein-folding homeostasis.
![Page 235: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/235.jpg)
215
Introduction
Fungal pathogens represent a serious risk to the growing population of
immunocompromised individuals resulting from the increasing success of
organ and bone marrow transplantation, immune-suppressive cancer
chemotherapy, premature births, and the AIDS pandemic. Candida
albicans is a diploid ascomycete yeast that is an important commensal and
opportunistic pathogen in humans. Systemic infections resulting from C.
albicans are on the rise and are associated with mortality rates of 50% or
greater despite currently available antifungal therapy (1,–3). Current
therapeutic options are limited to treatment with three longstanding
antifungal classes, the polyenes, azoles, and echinocandins (4). These
compounds target the specific fungal biological process of ergosterol
metabolism (azoles and polyenes) and cell wall β-1,3-glucan synthesis
(echinocandins). However, these drugs have serious side effects such as
nephrotoxicity and/or create complications such as resistance due to their
fungistatic rather than fungicidal characteristics (4,–6). There is, thus, an
urgent need for new strategies to identify novel protein targets and
bioactive molecules for antifungal therapeutic intervention.
Plants are an interesting reservoir of secondary metabolites with an
attractive and broad spectrum of antimicrobial properties. Carvacrol is a
monoterpene phenol and a major component of essential oil extract from
oregano and other plants belonging to the Labiatae family (7). This
monoterpene is considered nontoxic to humans and is commonly used as
a flavoring substance. Carvacrol has been the subject of a considerable
number of investigations that uncovered extensive pharmacological
proprieties, including antifungal and antibacterial effects (8). Previous
investigations demonstrated that carvacrol is one of the potent
monoterpenes against C. albicans, impeding the growth of different
morphological forms, including yeast, hyphae, and the highly drug-
![Page 236: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/236.jpg)
216
resistant biofilm (9,–11). Recent studies have shown that the
monoterpenes carvacrol and eugenol, but not thymol, synergize with the
azole antifungal fluconazole and inhibit planktonic growth and biofilm in
clinical resistant strains (12). Interestingly, carvacrol has been proved to
be an effective treatment against vaginal candidiasis in an
immunosuppressed rat model (13).
Despite the growing interest in using carvacrol in antifungal therapy, the
mechanism of action (MoA) of this phytomolecule and other antimicrobial
monoterpenes or sesquiterpenes remains unclear. Prior investigations
suggested that carvacrol acts as a membrane-disrupting agent by targeting
and binding ergosterol (11, 14, 15). Transcription profiling in the model
yeast Saccharomyces cerevisiae exposed to carvacrol revealed a
transcriptional signature similar to that experienced under calcium stress
(16), suggesting that the antifungal activity of carvacrol is probably the
consequence of the perturbation of Ca+ or H+ ion homeostasis. In the
current study, we have used state-of-the-art chemical genomic
approaches, including chemical-genetic profiling using the complete pool
of bar-coded S. cerevisiae haploid deletion strains, in addition to genome-
wide transcriptional profiling to accurately determine the MoA of carvacrol
that is relevant to its antifungal activity. Similar chemogenomic
approaches have been successfully used to confirm the known MoA of
clinically approved antifungals such as fluconazole and also to uncover the
MoA of novel antifungal compounds (17,–19). We demonstrate that
carvacrol acts as an antifungal by causing endoplasmic reticulum (ER)
stress and by inducing the unfolded protein response (UPR).
![Page 237: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/237.jpg)
217
Materials and methods
Inhibition and synergism assay.
A growth assay of Candida cells treated with carvacrol was performed in a
96-well plate using the Sunrise plate reader (Tecan). C. albicans clinical
strain SC5314 (20) and ire1, mkc1, and bck1 mutants were grown
overnight in yeast extract-peptone-dextrose (YPD) medium at 30°C in a
shaking incubator. Candida cells were then resuspended in fresh YPD at
an optical density at 595 nm (OD595) of 0.05. A total volume of 99 μl of
cells was added to each well in the 96-well plate in addition to 1 μl of the
corresponding stock solution of carvacrol (W224511; Sigma). The plates
were incubated at 30°C under agitation, and OD readings were taken every
10 min over 20 h. Samples were done in triplicate, and the average was
used for analysis. C. albicans ire1/ire1, mkc1/mkc1, and bck1/bck1
mutants were from the kinase collection of A. Mitchell (Carnegie Mellon
University) (21). Carvacrol and other monoterpenes used in this study were
dissolved in dimethyl sulfoxide (DMSO). As a control, an equal volume of
DMSO was added (1% [vol/vol] final concentration). The MIC was
determined by the first well with a growth reduction of 10% as referred to
OD595 values in the presence of the tested compounds compared to
untreated cells.
For the spot serial dilution assay, the S. cerevisiae wild-type (WT) strain
BY4741 and the indicated deletion mutant strains were grown in YPD
overnight at 30°C. Cells were diluted to a concentration of 107 cells/ml,
and then 10-fold serial dilutions of the indicated strains were spotted on
media containing the indicated compounds. Plates were incubated at 30°C
for 2 days.
Carvacrol synergistic interactions with tunicamycin (T7765; Sigma),
dithiothreitol (DTT) (BP172; Fisher), fluconazole (F8929; Sigma),
![Page 238: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/238.jpg)
218
caspofungin (SML0425; Sigma), and amphotericin B (A488; Sigma) were
tested as described by Epp et al. (22). The fractional inhibitory
concentration (FIC) index was determined as follows: (MIC of carvacrol in
combination/MIC of carvacrol alone) plus (MIC of a drug in
combination/MIC of a drug alone). Tunicamycin, amphotericin B, and
fluconazole were dissolved in DMSO and added from stock solutions of 10,
30, and 300 mg/ml, respectively. Caspofungin was dissolved in water to a
stock concentration of 10 mg/ml.
RNA extractions and microarray profiling.
Cultures of C. albicans strain SC5314 were inoculated from a fresh colony
and grown overnight in YPD at 30°C. Cultures were then diluted to an
OD595 of 0.05 in 100 ml of fresh YPD and grown at the same initial
temperature until an OD595 of 0.8. The culture was divided into two
volumes of 50 ml; one sample was maintained as the control where DMSO
was added, and the other treated with 0.2 mM carvacrol or 0.3 mM thymol
(MIC of each monoterpene). Candida cells were exposed to carvacrol for 5
and 30 min and to thymol for 30 min. Cells were then centrifuged 2 min at
3,500 rpm, the supernatants were removed, and the samples were quick-
frozen and stored at −80°C. RNA was extracted using the Qiagen RNeasy
kit as described previously by Sellam et al. (23). RNA quality and integrity
were checked using an Agilent 2100 bioanalyzer. cDNA labeling and
microarray experiments were performed as described by Nantel et al. (24).
Briefly, 18 μg of total RNA was reverse transcribed using 9 ng of
oligo(dT)21 in the presence of Cy3 or Cy5-dCTP (GE Healthcare) and 400 U
of SuperScript III reverse transcriptase (Life Technologies) at 42°C for 3 h.
After cDNA synthesis, template RNA was removed by adding 2.5 units
RNase H (Promega) and 1 mg RNase A (Pharmacia) followed by incubation
for 15 min at 37°C. The labeled cDNAs were purified with a QIAquick PCR
purification kit (Qiagen). DNA microarrays were processed and analyzed as
![Page 239: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/239.jpg)
219
previously described by Nantel et al. (24). Data handling and analysis were
carried out using Genespring v.7.3 (Agilent Technologies, Palo Alto, CA).
Statistical analysis used Welch's t test with a false-discovery rate (FDR) of
5% and 1.5-fold enrichment cutoff. Hierarchical clustering of the
expression profiling data was performed using Genespring v.7.3. Gene
ontology (GO) annotation was performed using the Cytoscape (25) plug-in
BiNGO (26).
Haploid deletion chemical-genetic profiling.
Screens of the haploid deletion pool were performed as described by
Parsons et al. (18) with 0.64 mM carvacrol. Enrichment of GO terms was
performed using Gene Ontology Finder (http://www.yeastgenome.org/cgi-
bin/GO/goTermFinder.pl). The P value was calculated using a
hypergeometric distribution.
HAC1 mRNA splicing assay.
The HAC1 splicing assay was performed by reverse transcription-PCR (RT-
PCR). RNAs were extracted from C. albicans cells challenged with
tunicamycin (4.7 μM), either alone or in combination with carvacrol (0.2
mM) as described for microarray experiments. cDNAs were obtained using
Superscript II reverse transcriptase (Life Technologies) as recommended by
the supplier. The obtained cDNA was used as a template to amplify the
spliced and unspliced forms of HAC1 using the primer pair
TGAGGATGAACACCAAGAAGAA (forward primer) and
TCAAAGTCCAACTGAAATGAT (reverse primer). The PCR products were
resolved on 1.5% agarose gel.
Evaluation of ER integrity by confocal microscopy.
![Page 240: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/240.jpg)
220
The S. cerevisiae Sec61-green fluorescent protein (GFP) strain used for
fluorescence microscopy is from the Yeast-GFP clone collection (27). An
overnight culture was diluted in YPD supplemented with 1 mM carvacrol
to an OD595 of 0.05 and grown for four generations at 30°C under
agitation. Images of fluorescence microscopy were acquired with a 63×,
1.3-numerical-aperture (NA) objective on a Leica DMI6000B inverted
microscope connected to a Hamamatsu C9100-13 camera.
![Page 241: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/241.jpg)
221
Results
Chemogenomic fitness assay identifies key UPR regulators as required
for carvacrol tolerance.
Chemical-genetic profiling is a powerful tool that has been widely used to
uncover the MoA of many bioactive compounds (28). In order to determine
the MoA of the monoterpene carvacrol, we used S. cerevisiae haploid
deletion chemical-genetic profiling (HCGP) to identify gene deletions that
confer sensitivity to carvacrol (Table 1; see also Table S1 in the
supplemental material). GO terms associated with carvacrol-sensitive
strains were determined, and relevant functional categories are
summarized in Fig. 1A. The GO terms ER-mediated UPR and tryptophan
amino acid biosynthesis were significantly enriched in the HCGP profile.
Strains with mutations of the endonuclease Ire1 (ire1; Z-score = 3.03) and
the transcription factor Hac1 (hac1; Z-score = 2.83), which are conserved
components of the eukaryotic UPR signaling (29), were the most sensitive
strains to carvacrol (Table 1). In response to ER stress, the endonuclease
Ire1 mediates the splicing of a nonconventional intron from the 3′ region of
HAC1 mRNA, which in turn activates the UPR transcriptional program to
restore protein-folding homeostasis (30, 31). Strains with mutations of the
cell wall integrity (CWI) signaling pathway, including the mitogen-activated
protein kinase kinase kinase (MAPKKK) Bck1, the MAPK Slt2, and the
transcription factor Swi6, were also hypersensitive to carvacrol. Previous
investigations demonstrated that, in addition to its role in cell wall
maintenance, the CWI pathway is also required for ER stress response and
protein-folding homeostasis (32, 33). These data suggest that the UPR
pathway is required for cells to tolerate carvacrol.
The two mutants of the UPR pathway, the ire1 and hac1 mutants, and the
mutant of tryptophan biosynthesis, the aro2 mutant, were selected, and
their sensitivity to carvacrol was confirmed using serial dilution assay (Fig.
![Page 242: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/242.jpg)
222
1B). The three mutants were also tested for their sensitivity to four other
monoterpenes: eugenol, isopulegol, and the two enantiomers l-(−)-carvone
and d-(+)-carvone (Fig. 1B). As shown in Fig. 1C, the aro2 mutant was
sensitive to the four-tested monoterpenes. However, ire1 and hac1 mutants
were sensitive only to carvacrol, suggesting that tolerance of the other
monoterpenes does not require the UPR pathway (Fig. 1B). Taken together,
these data suggest that UPR pathway signaling is specifically required for
the tolerance of carvacrol.
Carvacrol disrupts the morphology and the integrity of ER.
The UPR pathway requirement for carvacrol tolerance supports the
hypothesis that carvacrol might act as an ER stressor, perhaps by altering
ER integrity and/or its protein-folding capacity. To check if the UPR
requirement is related to a direct effect of carvacrol on cellular organization
of ER, we have used a Sec61-GFP fusion as an ER marker (34). Sec61 is
an essential ER translocation channel required for protein import to ER
and localizes to nuclear ER (nER) and cortical ER (cER). ER organization
as judged by Sec61-GFP fluorescence was assessed in cells treated with
0.8 mM carvacrol and in untreated cells. The control cells exhibited a clear
and well-defined ER distribution with nER surrounding the nucleus, cER
at the periphery of the cell adjacent to plasma membrane, and few
cytoplasmic ER tubes (Fig. 2A). However, in cells challenged with
carvacrol, the ER became fragmented, and the GFP signal was diffuse in
the cytoplasm. The nER structure was partially or completely disrupted in
some cells (Fig. 2B). Cells treated with carvacrol accumulated cytoplasmic
foci, likely representing collapsed ER (Fig. 2B). Taken together, these
observations indicate that carvacrol disrupts ER organization.
UPR pathway is required for carvacrol tolerance in the pathogenic
yeast C. albicans.
![Page 243: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/243.jpg)
223
Carvacrol has been widely investigated for its antifungal activity mainly
against the pathogenic yeast C. albicans (9,–11). To check whether the
conserved eukaryotic UPR signaling pathway is also required for carvacrol
tolerance in C. albicans, sensitivity of ire1, mkc1 (Mkc1 is the ortholog of
Slt2), and bck1 homozygous mutants to carvacrol was assessed. Our data
revealed that all tested mutants had increased sensitivity to carvacrol
compared to their parental strains (Fig. 3). Consistent with the HCGP
assay in S. cerevisiae, these data demonstrate that C. albicans UPR is also
required for tolerance of carvacrol.
Genome-wide transcriptional profiling reveals that carvacrol induces
the unfolded protein response in C. albicans.
We undertook microarray transcriptional profiling to uncover cellular
responses to carvacrol. The C. albicans clinical strain SC5314 was treated
with 0.2 mM (MIC of carvacrol) carvacrol for 5 or 30 min. Using a
statistical significance analysis with an estimated FDR of 5%, in addition
to a 1.5-fold cutoff, 499 and 317 transcripts were differentially expressed
after 5 min and 30 min exposure to carvacrol, respectively (see Table S2 in
the supplemental material). GO term enrichment analysis of upregulated
transcripts demonstrated that carvacrol activates genes involved in
proteolysis, amino acid metabolism, phospholipid translocation, response
to oxidative stress, and DNA repair mechanisms (Fig. 4A and B; see also
Table S3 in the supplemental material). Transcripts related to GO terms
ribosome biogenesis, glycosylation, sugar transport, drug export, and
nuclear import were repressed. The carvacrol transcriptional signature in
C. albicans was reminiscent of the unfolded protein stress response
expressed in eukaryotic organisms (35, 36). In response to UPR inducers
such as DTT or tunicamycin, C. albicans and other fungi, including S.
cerevisiae, Aspergillus niger, and Aspergillus fumigatus, activate genes
![Page 244: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/244.jpg)
224
involved in vesicle trafficking, protein folding, amino acid metabolism,
proteolysis, glycosylation, lipid metabolism, and cell wall biogenesis (35,
37,–39). All these UPR-associated GO terms are represented in our data
set (Fig. 4 and Table 2; see also Table S3 in the supplemental
material). In agreement with the HCGP assay, our data suggest that
carvacrol generates ER stress and induces UPR response in C. albicans.
In order to assess whether the UPR response uncovered here is specific to
carvacrol, the transcriptional profile of C. albicans cells challenged with
thymol, a monoterpene structurally related to carvacrol, was evaluated.
Thymol is a positional isomer of carvacrol and has a phenolic hydroxyl at a
different position on the phenolic ring. As shown in Fig. 4C, hierarchical
clustering distinguished clearly the transcriptional signature exhibited by
cells treated with carvacrol from that displayed by cells exposed to thymol
(see Table S2 in the supplemental material). We conclude that the
mechanism of action of carvacrol is different from that of thymol.
Carvacrol induces unconventional splicing of the transcription factor
Hac1.
Our data demonstrated that Ire1 and Hac1, key players of UPR signaling,
were required for fungal tolerance of carvacrol. This prompted us to assess
whether the UPR signaling pathway is activated following exposure to
carvacrol. The activation of the UPR was assayed by detecting the splicing
of HAC1 mRNA using RT-PCR (40). As shown in Fig. 5A, Candida cells
treated with carvacrol displayed UPR activation as evidenced by increased
splicing of HAC1 mRNA.
In contrast to what was previously reported with the UPR inducers
tunicamycin and DTT (37), the nonspliced form of HAC1 (nsHAC1)
predominated over the spliced form (sHAC1) following treatment with
![Page 245: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/245.jpg)
225
carvacrol. Since the HAC1 mRNA splicing factor ire1 was one of the most
sensitive mutants to carvacrol, we wanted to check whether carvacrol itself
directly compromised Ire1 activity. Therefore, we assessed the splicing of
HAC1 mRNA in response to tunicamycin, a well-known UPR stressor,
alone or in combination with carvacrol. As shown in Fig. 5B, cells treated
with tunicamycin alone or in combination with carvacrol for 15 min were
able to splice the cryptic intron at the 3′ region of HAC1, suggesting that
Ire1 activity was not compromised by carvacrol. Interestingly, after 60 min,
cells treated with tunicamycin exhibited predominantly the unspliced form
of HAC1, possibly reflecting an adaptive response, while cells treated with
tunicamycin and carvacrol had exclusively the spliced form of HAC1. This
finding suggests that carvacrol exacerbates the effect of tunicamycin on
HAC1 splicing and sustained UPR signaling.
Synergistic interaction of carvacrol with ER stressors and
caspofungin.
Drug combination treatments are powerful strategies that have been used
to increase the efficacy and reduce the toxicity of preexisting single-drug
therapies. Synergistic action can result from complementary action of the
synergized drugs, which target different parts along the same biological
pathway or protein (41). A well-known example in anticancer therapy is
the combination of aplidin and cytarabine, which target the same apoptotic
pathway (42). In C. albicans, combination of the azole fluconazole with
either ketoconazole or terbinafine, each targeting the ergosterol
biosynthesis pathway, led to a synergistic antifungal activity (43). Here, we
wanted to test whether other well-known UPR inducers and ER stressors,
such as the reducing agent DTT and the N-linked glycosylation inhibitor
tunicamycin, potentiate the antifungal activity of carvacrol. As shown in
Table 3, combination of carvacrol with DTT or tunicamycin resulted in a
potent antifungal synergy in the C. albicans clinical strain SC5314, while
![Page 246: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/246.jpg)
226
either compound alone had minor inhibitory effect. We also confirmed the
synergistic interaction of carvacrol with the antifungal fluconazole as
reported previously (12) and uncovered a potent synergism with the
echinocandin caspofungin (Table 3). However, carvacrol did not synergize
with the polyene antifungal amphotericin B.
![Page 247: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/247.jpg)
227
Discussion
In the current investigation, we have used state-of-the-art chemogenomic
approaches to uncover the MoA of the monoterpene carvacrol in the
pathogenic yeast C. albicans. UPR is a cytoprotective response that is
engaged as a consequence of the accumulation of unfolded or misfolded
proteins following stress affecting the ER. Our chemical-genetic profiling
assay, supported by the transcriptional profiling data, led to the
hypothesis that carvacrol might target and compromise ER integrity and
perturb protein-folding capacity, which in turn activates the UPR pathway.
Cellular investigation of the ER demonstrated clearly that carvacrol
affected the integrity and the organization of nER and cER. In accordance
with this result, many S. cerevisiae mutants that exhibited defective ER
morphology or organization express a constitutive UPR response and
depend tightly on it for their survival (34). Thus, our results demonstrated
that carvacrol exerts its antifungal activity by disrupting ER integrity,
which in turn causes ER stress and leads to Ire1-mediated UPR to restore
protein-folding homeostasis in C. albicans. In our HCGP assay, deletion of
genes involved in different trafficking pathways such as ER-to-Golgi
(trs85), Golgi-to-ER (ypt6), and intra-Golgi transport (cog6) were also
required for carvacrol tolerance. This supposes that, in addition to ER,
carvacrol might target other intracellular vesicular trafficking. Another
possible explanation, and taking into consideration that ER is the main
cellular membrane source for many trafficking systems (44, 45), is that
disrupting ER by carvacrol might result in a collapse of the ER-dependent
cellular vesicle trafficking network.
While previous studies suggested that carvacrol exerts its antifungal
activity by disrupting calcium homeostasis (16), ergosterol biosynthesis
(14), and the plasma membrane (15), our HCGP and transcriptional
profiling results were not supportive of such MoAs. These presumed MoAs
![Page 248: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/248.jpg)
228
might be an indirect consequence of ER stress triggered by carvacrol. In
fact, calcium in the cell is stored in the ER, and many studies report that
calcium homeostasis is significantly perturbed under UPR and ER stress
(46,–49). In fungi, the ER is also the site for the synthesis of ergosterol and
lipids as well as cell wall components (50). Thus, ER perturbations might
disturb many aspects of membrane biology, such as permeability and
ergosterol or other lipid content.
Mutants uncovered by the HCGP assay often reflect mechanisms that
buffer the impact of the target compromised by a bioactive compound (17).
Our HCGP assay showed that, in addition to UPR signaling mutants,
deletion of genes involved in tryptophan biosynthesis, including trp1, trp2,
trp3, trp4, aro1, and aro2, resulted in a hypersensitivity to carvacrol.
Interestingly, recent investigations showed that the monoterpene eugenol
interferes with aromatic amino acid uptake, including tryptophan in S.
cerevisiae (51). This suggests that, in addition to targeting ER, carvacrol
might also interfere with tryptophan uptake.
The newly revisited MoA of carvacrol uncovered in this study was exploited
to predict and validate complementary synergistic drug interactions with
other ER stressors and with well-known antifungals. Overall, our data
suggest that pharmacological perturbation of ER function results in
increased sensitivity to fluconazole and caspofungin. In agreement with
this, Epp et al. demonstrated that compromising ER function genetically
(mutation of the ARF protein, Age3) or pharmacologically (by brefeldin A,
an inhibitor of the retrograde Golgi-to-ER transport and UPR inducer)
resulted in a potentiation of the activity of many azoles as well as the
echinocandins against C. albicans and other human fungal pathogens (22).
Interestingly, our HAC1 splicing assay reflected synergistic interaction of
carvacrol and the UPR stressor, tunicamycin. Addition of the two
![Page 249: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/249.jpg)
229
compounds caused complete splicing of the HAC1 mRNA, while treating
cells with each compound separately resulted in incomplete splicing.
Acknowledgments
We are grateful to Aaron Mitchel (Carnegie Mellon University) and
Christian Landry (IBIS, Université Laval) for providing mutants used in
this work. We thank J. C. Lévesque for technical assistance. M.B. is
grateful to A. Azzouzi for helping to set up the Medical Biology Unit at the
Faculty of Medicine and Pharmacy of Oujda.
This work was supported by the Faculty of Medicine, Université Laval, and
CHUQ Startup funding to A.S. J.C. received a Faculty of Medicine Ph.D.
scholarship (Université Laval). A.S. is supported by the Natural Sciences
and Engineering Research Council of Canada (NSERC) Discovery Grant
(06625). A.S. is a recipient of the Fonds de Recherche du Québec-Santé
(FRQS) J1 salary award. G.W.B. is supported by grants from the Canadian
Institutes of Health Research (MOP-84305 and MOP-79368).
![Page 250: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/250.jpg)
230
References
1. Pfaller MA, Diekema DJ. 2007. Epidemiology of invasive candidiasis: a
persistent public health problem. Clin Microbiol Rev 20:133–163. doi:10.1128/CMR.00029-06.
2. Gudlaugsson O, Gillespie S, Lee K, Vande Berg J, Hu J, Messer S, Herwaldt L, Pfaller M, Diekema D. 2003. Attributable mortality of nosocomial candidemia, revisited. Clin Infect Dis 37:1172–1177.
doi:10.1086/378745.
3. Pappas PG, Kauffman CA, Andes D, Benjamin DK Jr, Calandra TF, Edwards JE Jr, Filler SG, Fisher JF, Kullberg BJ, Ostrosky-Zeichner L, Reboli AC, Rex JH, Walsh TJ, Sobel JD., Infectious Diseases Society of
America. 2009. Clinical practice guidelines for the management of candidiasis: 2009 update by the Infectious Diseases Society of America.
Clin Infect Dis 48:503–535. doi:10.1086/596757. 4. Shapiro RS, Robbins N, Cowen LE. 2011. Regulatory circuitry governing
fungal development, drug resistance, and disease. Microbiol Mol Biol Rev 75:213–267. doi:10.1128/MMBR.00045-10.
5. Perlin DS. 2007. Resistance to echinocandin-class antifungal drugs. Drug Resist Updat 10:121–130. doi:10.1016/j.drup.2007.04.002.
6. Akins RA. 2005. An update on antifungal targets and mechanisms of resistance in Candida albicans. Med Mycol 43:285–318.
doi:10.1080/13693780500138971. 7. Buchbauer G, Ilic A. 2013. Biological activities of selected mono- and
sesquiterpenes: possible uses in medicine, p 4109–4159. In Ramawat KG, Ḿerillon J-M. (ed), Natural products. Springer, Berlin, Germany.
8. Baser KH. 2008. Biological and pharmacological activities of carvacrol and carvacrol bearing essential oils. Curr Pharm Des 14:3106–3119.
doi:10.2174/138161208786404227.
9. Raut JS, Shinde RB, Chauhan NM, Karuppayil SM. 2013. Terpenoids of plant origin inhibit morphogenesis, adhesion, and biofilm formation by Candida albicans. Biofouling 29:87–96.
doi:10.1080/08927014.2012.749398. 10. Inouye S, Takahashi M, Abe S. 2009. Inhibitory activity of hydrosols,
herbal teas and related essential oils against filament formation and the
![Page 251: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/251.jpg)
231
growth of Candida albicans. Nihon Ishinkin Gakkai Zasshi 50:243–251. doi:10.3314/jjmm.50.243.
11. Lima IO, de Oliveira Pereira F, de Oliveira WA, de Oliveira Lima E, Menezes EA, Cunha FA, de Fátima Formiga Melo Diniz M. 2013.
Antifungal activity and mode of action of carvacrol against Candida albicans strains. J Essential Oil Res 25:138–142.
doi:10.1080/10412905.2012.754728. 12. Doke SK, Raut JS, Dhawale S, Karuppayil SM. 2014. Sensitization of
Candida albicans biofilms to fluconazole by terpenoids of plant origin. J Gen Appl Microbiol 60:163–168. doi:10.2323/jgam.60.163.
13. Chami F, Chami N, Bennis S, Trouillas J, Remmal A. 2004. Evaluation of carvacrol and eugenol as prophylaxis and treatment of vaginal
candidiasis in an immunosuppressed rat model. J Antimicrob Chemother 54:909–914. doi:10.1093/jac/dkh436.
14. Ahmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan LA, Manzoor N. 2011. Fungicidal activity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur J Clin
Microbiol Infect Dis 30:41–50. doi:10.1007/s10096-010-1050-8.
15. Chami N, Bennis S, Chami F, Aboussekhra A, Remmal A. 2005. Study of anticandidal activity of carvacrol and eugenol in vitro and in vivo. Oral Microbiol Immunol 20:106–111. doi:10.1111/j.1399-302X.2004.00202.x.
16. Rao A, Zhang Y, Muend S, Rao R. 2010. Mechanism of antifungal
activity of terpenoid phenols resembles calcium stress and inhibition of the TOR pathway. Antimicrob Agents Chemother 54:5062–5069. doi:10.1128/AAC.01050-10.
17. Ho CH, Piotrowski J, Dixon SJ, Baryshnikova A, Costanzo M, Boone C. 2011. Combining functional genomics and chemical biology to identify
targets of bioactive compounds. Curr Opin Chem Biol 15:66–78. doi:10.1016/j.cbpa.2010.10.023.
18. Parsons AB, Lopez A, Givoni IE, Williams DE, Gray CA, Porter J, Chua G, Sopko R, Brost RL, Ho CH, Wang J, Ketela T, Brenner C, Brill JA,
Fernandez GE, Lorenz TC, Payne GS, Ishihara S, Ohya Y, Andrews B, Hughes TR, Frey BJ, Graham TR, Andersen RJ, Boone C. 2006. Exploring
the mode-of-action of bioactive compounds by chemical-genetic profiling in yeast. Cell 126:611–625. doi:10.1016/j.cell.2006.06.040.
19. Hoepfner D, Helliwell SB, Sadlish H, Schuierer S, Filipuzzi I, Brachat S, Bhullar B, Plikat U, Abraham Y, Altorfer M, Aust T, Baeriswyl L, Cerino
![Page 252: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/252.jpg)
232
R, Chang L, Estoppey D, Eichenberger J, Frederiksen M, Hartmann N, Hohendahl A, Knapp B, Krastel P, Melin N, Nigsch F, Oakeley EJ, Petitjean
V, Petersen F, Riedl R, Schmitt EK, Staedtler F, Studer C, Tallarico JA, Wetzel S, Fishman MC, Porter JA, Movva NR. 2014. High-resolution chemical dissection of a model eukaryote reveals targets, pathways and
gene functions. Microbiol Res 169:107–120. doi:10.1016/j.micres.2013.11.004.
20. Gillum AM, Tsay EY, Kirsch DR. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by
complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182. doi:10.1007/BF00328721.
21. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP. 2010. An extensive circuitry for cell wall regulation in Candida albicans. PLoS
Pathog 6:e1000752. doi:10.1371/journal.ppat.1000752. 22. Epp E, Vanier G, Harcus D, Lee AY, Jansen G, Hallett M, Sheppard
DC, Thomas DY, Munro CA, Mullick A, Whiteway M. 2010. Reverse genetics in Candida albicans predicts ARF cycling is essential for drug
resistance and virulence. PLoS Pathog 6:e1000753. doi:10.1371/journal.ppat.1000753.
23. Sellam A, Hogues H, Askew C, Tebbji F, van Het Hoog M, Lavoie H, Kumamoto CA, Whiteway M, Nantel A. 2010. Experimental annotation of
the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays. Genome Biol 11:R71. doi:10.1186/gb-2010-11-7-r71.
24. Nantel A, Rigby T, Hogues H, Whiteway M. 2006. Microarrays for studying pathogenicity in Candida Albicans, p 181–205. In Kavanagh K,
editor. (ed), Medical mycology: cellular and molecular techniques. John Wiley & Sons, Ltd., Chichester, UK.
25. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, Pico AR, Bader GD, Ideker T. 2012. A travel guide to Cytoscape plugins. Nat
Methods 9:1069–1076. doi:10.1038/nmeth.2212. 26. Maere S, Heymans K, Kuiper M. 2005. BiNGO: a Cytoscape plugin to
assess overrepresentation of gene ontology categories in biological networks. Bioinformatics 21:3448–3449.
doi:10.1093/bioinformatics/bti551. 27. Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, Weissman JS,
O'Shea EK. 2003. Global analysis of protein localization in budding yeast. Nature 425:686–691. doi:10.1038/nature02026.
![Page 253: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/253.jpg)
233
28. Smith AM, Ammar R, Nislow C, Giaever G. 2010. A survey of yeast
genomic assays for drug and target discovery. Pharmacol Ther 127:156–164. doi:10.1016/j.pharmthera.2010.04.012.
29. Hetz C. 2012. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 13:89–102.
doi:10.1038/nrm3270. 30. Chapman RE, Walter P. 1997. Translational attenuation mediated by
an mRNA intron. Curr Biol 7:850–859. doi:10.1016/S0960-9822(06)00373-3.
31. Kaufman RJ. 1999. Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and
translational controls. Genes Dev 13:1211–1233. doi:10.1101/gad.13.10.1211.
32. Chen Y, Feldman DE, Deng C, Brown JA, De Giacomo AF, Gaw AF, Shi G, Le QT, Brown JM, Koong AC. 2005. Identification of mitogen-activated protein kinase signaling pathways that confer resistance to endoplasmic
reticulum stress in Saccharomyces cerevisiae. Mol Cancer Res 3:669–677. doi:10.1158/1541-7786.MCR-05-0181.
33. Levin DE. 2011. Regulation of cell wall biogenesis in Saccharomyces cerevisiae: the cell wall integrity signaling pathway. Genetics 189:1145–
1175. doi:10.1534/genetics.111.128264.
34. Manford AG, Stefan CJ, Yuan HL, Macgurn JA, Emr SD. 2012. ER-to-plasma membrane tethering proteins regulate cell signaling and ER morphology. Dev Cell 23:1129–1140. doi:10.1016/j.devcel.2012.11.004.
35. Back SH, Schroder M, Lee K, Zhang K, Kaufman RJ. 2005. ER stress signaling by regulated splicing: IRE1/HAC1/XBP1. Methods 35:395–416.
doi:10.1016/j.ymeth.2005.03.001.
36. Arensdorf AM, Diedrichs D, Rutkowski DT. 2013. Regulation of the transcriptome by ER stress: non-canonical mechanisms and physiological consequences. Front Genet 4:256. doi:10.3389/fgene.2013.00256.
37. Wimalasena TT, Enjalbert B, Guillemette T, Plumridge A, Budge S, Yin
Z, Brown AJ, Archer DB. 2008. Impact of the unfolded protein response upon genome-wide expression patterns, and the role of Hac1 in the polarized growth, of Candida albicans. Fungal Genet Biol 45:1235–1247.
doi:10.1016/j.fgb.2008.06.001.
![Page 254: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/254.jpg)
234
38. Guillemette T, van Peij N, Goosen T, Lanthaler K, Robson GD, van den Hondel CA, Stam H, Archer DB. 2007. Genomic analysis of the secretion
stress response in the enzyme-producing cell factory Aspergillus niger. BMC Genomics 8:158. doi:10.1186/1471-2164-8-158.
39. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, Walter P. 2000. Functional and genomic analyses reveal an essential coordination
between the unfolded protein response and ER-associated degradation. Cell 101:249–258. doi:10.1016/S0092-8674(00)80835-1.
40. Guillemette T, Ram AF, Carvalho ND, Joubert A, Simoneau P, Archer DB. 2011. Methods for investigating the UPR in filamentous fungi. Methods Enzymol 490:1–29. doi:10.1016/B978-0-12-385114-7.00001-5.
41. Sun X, Vilar S, Tatonetti NP. 2013. High-throughput methods for
combinatorial drug discovery. Sci Transl Med 5:205rv201. doi:10.1126/scitranslmed.3006667.
42. Humeniuk R, Menon LG, Mishra PJ, Saydam G, Longo-Sorbello GS, Elisseyeff Y, Lewis LD, Aracil M, Jimeno J, Bertino JR, Banerjee D. 2007. Aplidin synergizes with cytosine arabinoside: functional relevance of
mitochondria in Aplidin-induced cytotoxicity. Leukemia 21:2399–2405. doi:10.1038/sj.leu.2404911.
43. Spitzer M, Griffiths E, Blakely KM, Wildenhain J, Ejim L, Rossi L, De Pascale G, Curak J, Brown E, Tyers M, Wright GD. 2011. Cross-species
discovery of syncretic drug combinations that potentiate the antifungal fluconazole. Mol Syst Biol 7:499. doi:10.1038/msb.2011.31.
44. Viotti C, Kruger F, Krebs M, Neubert C, Fink F, Lupanga U, Scheuring D, Boutte Y, Frescatada-Rosa M, Wolfenstetter S, Sauer N, Hillmer S,
Grebe M, Schumacher K. 2013. The endoplasmic reticulum is the main membrane source for biogenesis of the lytic vacuole in Arabidopsis. Plant Cell 25:3434–3449. doi:10.1105/tpc.113.114827.
45. Mullins C. 2005. The biogenesis of cellular organelles. Springer, New
York, NY. 46. Zhang K, Kaufman RJ. 2004. Signaling the unfolded protein response
from the endoplasmic reticulum. J Biol Chem 279:25935–25938. doi:10.1074/jbc.R400008200.
47. Tessitore A, del P Martin M, Sano R, Ma Y, Mann L, Ingrassia A, Laywell ED, Steindler DA, Hendershot LM, d'Azzo A. 2004. GM1-
ganglioside-mediated activation of the unfolded protein response causes
![Page 255: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/255.jpg)
235
neuronal death in a neurodegenerative gangliosidosis. Mol Cell 15:753–766. doi:10.1016/j.molcel.2004.08.029.
48. Torres M, Encina G, Soto C, Hetz C. 2011. Abnormal calcium homeostasis and protein folding stress at the ER: a common factor in
familial and infectious prion disorders. Commun Integr Biol 4:258–261. doi:10.4161/cib.4.3.15019.
49. Hoyer-Hansen M, Jaattela M. 2007. Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death
Differ 14:1576–1582. doi:10.1038/sj.cdd.4402200. 50. Parks LW, Casey WM. 1995. Physiological implications of sterol
biosynthesis in yeast. Annu Rev Microbiol 49:95–116. doi:10.1146/annurev.mi.49.100195.000523.
51. Darvishi E, Omidi M, Bushehri AA, Golshani A, Smith ML. 2013. The antifungal eugenol perturbs dual aromatic and branched-chain amino acid
permeases in the cytoplasmic membrane of yeast. PLoS One 8:e76028. doi:10.1371/journal.pone.0076028.
52. Merico D, Isserlin R, Stueker O, Emili A, Bader GD. 2010. Enrichment map: a network-based method for gene-set enrichment visualization and
interpretation. PLoS One 5:e13984. doi:10.1371/journal.pone.0013984.
![Page 256: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/256.jpg)
236
Figures
Figure 1 - Chemical-genetic profiling using HCGP assay identified key
UPR regulators as required for carvacrol tolerance. (A) GO term
enrichment of carvacrol sensitive mutants. The P value was calculated
using the hypergeometric distribution. (B, C) Individual confirmations of
the chemical-genetic screen by spot serial dilution assay. A total of three
deletion mutants, the ire1, hac1, and aro2 mutants, were selected and
spotted on YPD with DMSO (control), YPD containing 0.8 mM or 1 mM
carvacrol (B) or 1.74 mM eugenol, 2.16 mM isopulegol, 2.22 mM l-(−)-
carvone (vol/vol), or 2.22 mM d-(+)-carvone (C). Plates were incubated at
30°C for 2 days.
![Page 257: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/257.jpg)
237
Figure 2 - Carvacrol disrupts the morphology and the integrity of ER.
Sec61-GFP fusion was used as an ER marker. (A) Fluorescence
micrographs of Sec61 localization in control cells treated with DMSO.
Cortical (cER) and nuclear ERs (nER) are labeled. (B) Reorganization of
Sec61 localization in cells treated with 0.8 mM carvacrol. Bars, 4 μm.
![Page 258: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/258.jpg)
238
Figure 3 - The UPR pathway is important for carvacrol tolerance in
the pathogenic yeast C. albicans. Growth assays of C. albicans bck1
(A), ire1 (B), and mkc1 (C) mutants and the WT strain SC5314 challenged
with 1 mM carvacrol. Cells were grown in YPD at 30°C, and OD595
readings were taken every 10 min. MIC values for each mutant and WT
strain are indicated.
![Page 259: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/259.jpg)
239
Figure 4 - Genome-wide transcriptional profiling reveals that the
monoterpene carvacrol induces the UPR in C. albicans. GO analysis of
transcripts differentially regulated in C. albicans cells treated with
carvacrol for 5 min (A) or 30 min (B) using BiNGO software (26). Results
were charted using Cytoscape (25) and the Enrichment Map plug-in (52).
(C) Heat map and two-dimensional hierarchical clustering of the
transcriptional profiles of carvacrol- and thymol-treated cells. Upregulated
and downregulated genes are indicated by red and green, respectively.
Molecular structures of carvacrol and thymol are shown to emphasize the
unique difference, which is the position of the hydroxyl group.
![Page 260: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/260.jpg)
240
Figure 5 - Carvacrol induces splicing of the transcription factor gene
HAC1 mRNA. (A) Effect of carvacrol on HAC1 mRNA splicing in WT C.
albicans. Cells were treated with carvacrol and at the indicated time
samples were harvested and splicing of HAC1 was assessed using RT-PCR.
nsHAC1, nonspliced HAC1; sHAC1, spliced HAC1. (B) Effect of
tunicamycin on HAC1 splicing in the presence or absence of carvacrol.
Cells were treated with tunicamycin (Tm) or with tunicamycin and
carvacrol (Tm + Crv) and sampled at the indicated times to asses HAC1
splicing. As a control, splicing of HAC1 mRNA was also monitored in
nontreated cells (Ctrl).
![Page 261: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/261.jpg)
241
Table 1 - Chemical-genetic profiling of carvacrola
aIdentification by HCGP assay of gene deletion mutants that confer
sensitivity to carvacrol. Fitness defect scores were calculated based on bar
code microarray hybridization, and the top 22 sensitive deletion strains
sorted by Z-score are shown.
![Page 262: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/262.jpg)
242
Table 2 - Different manually curated GO terms related to the unfolded
protein response and their associated transcripts that are activated in
response to carvacrol
![Page 263: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/263.jpg)
243
Table 3 - Synergistic interaction of carvacrol with ER stressors and
the antifungals caspofungin and fluconazole
aCRV, carvacrol; FCZ, fluconazole; TNC, tunicamycin; DTT, dithiothreitol;
CSP, caspofungin; AmpB, amphotericin B.
bThe MIC values for the individual drugs in a combination are separated
by a slash.
![Page 264: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/264.jpg)
244
Annexe 2 - pH-dependant antifungal activity of
valproic acid against the Human fungal pathogen
Candida albicans
Résumé
L’utilisation des antifongiques est limitée par leur toxicité, l’émergence des
résistances et par leur faible activité en milieu acide comme dans les
muqueuses vaginales. Dans cette étude, nous montrons que l’acide
valproïque (VPA), un médicament antipsychotique, a un fort effet
antifongique contre les souches sensibles et résistantes de Candida
albicans dans des conditions de pH similaires à ceux rencontrées dans le
vagin. Le VPA a également un effet sur les biofilms et atténue les
dommages causés aux cellules épithéliales vaginales par C. albicans. Nous
avons également montré une synergie entre le VPA et la terbinafine. Nous
avons réalisé un criblage chemogénomique pour identifier les processus
biologique à la base de la sensibilité au VPA et nous avons trouvé que les
gènes liés aux vacuoles sont requis pour la tolérance au VPA. La
microscopie confocale a révélé une altération des vacuoles, ce qui supporte
le modèle dans lequel les vacuoles contribuent à l’activité antifongique du
VPA. Cette étude suggère que le VPA pourrait être utilisé comme
antifongique contre les candidoses vaginales.
![Page 265: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/265.jpg)
245
Article
pH-dependant antifungal activity of valproic acid against the human
fungal pathogen Candida albicans
Julien Chaillot1, Faiza Tebbji1, Carlos García1, Hugo Wurtele2,3, René
Pelletier4 and Adnane Sellam1,5*
Front Microbiol. 2017 Oct 9;8:1956. doi: 10.3389/fmicb.2017.01956.
eCollection 2017.
1Infectious Diseases Research Centre-CRI, Research Center of the CHU
de Québec, Université Laval, Quebec, QC, Canada
2Maisonneuve-Rosemont Hospital Research Center, Montreal, QC,
Canada
3Department of Medicine, Université de Montréal, Montreal, QC, Canada
4Medical Microbiology and Infectious Diseases, Research Center of the
CHU de Québec, Quebec, QC, Canada
5Department of Microbiology, Infectious Disease and Immunology,
Faculty of Medicine, University Laval, Quebec, QC, Canada
![Page 266: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/266.jpg)
246
Abstract
Current antifungal drugs suffer from limitations including toxicity, the
emergence of resistance and decreased efficacy at low pH that are typical
of human vaginal surfaces. Here, we have shown that the antipsychotic
drug valproic acid (VPA) exhibited a strong antifungal activity against both
sensitive and resistant Candida albicans in pH condition similar to that
encountered in vagina. VPA exerted a strong anti-biofilm activity and
attenuated damage of vaginal epithelial cells caused by C. albicans. We
also showed that VPA synergizes with the allylamine antifungal,
Terbinafine. We undertook a chemogenetic screen to delineate biological
processes that underlies VPA-sensitivity in C. albicans and found that
vacuole-related genes were required to tolerate VPA. Confocal fluorescence
live-cell imaging revealed that VPA alters vacuole integrity and support a
model where alteration of vacuoles contributes to the antifungal activity.
Taken together, this study suggests that VPA could be used as an effective
antifungal against vulvovaginal candidiasis.
Keywords: Candida albicans, valproic acid, antifungal, vacuole,
vulvovaginal candidiasis
![Page 267: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/267.jpg)
247
Introduction
Candida albicans is the major human fungal pathogens and also a
component of the normal human flora, colonizing primarily mucosal
surfaces, gastrointestinal and genitourinary tracts, and skin (Berman and
Sudbery, 2002). Although many infections involve unpleasant but non-life-
threatening colonization of various surface of mucosal membranes,
immunosuppressed patients can fall prey to serious mucosal infections,
such as oropharyngeal candidiasis in HIV patients and newborns, and
lethal systemic infections (Odds, 1987). C. albicans followed by C. glabrata
are natural components of the vaginal fungal microbiota and,
opportunistically, the leading causative agents of vulvovaginal candidiasis
(VVC). VVC affects 70–75% of childbearing women at least once, and 40–
50% of them will experience recurrence (Sobel, 2007).
Topical azoles-based antifungal formulations (e.g., fluconazole,
clotrimazole, miconazole, or butoconazole) such as vaginal suppositories,
tablets, and cream are widely used to treat VVC. However, their efficiency
is questioned especially for C. glabrata who is intrinsically resistant to
azoles. Furthermore, VVC are often caused by C. albicans azole-resistant
strains (Sobel, 2007; Marchaim et al., 2012). Importantly, antifungals used
for VVC treatments had to fulfill the constraint of remaining effective at
acidic pH (4–4.5), which is the normal pH of human vaginal surfaces.
Recent studies had proven that the acidic pH increases the minimal
inhibitory concentrations (MICs) of several antifungals including azoles,
amphothericin B, ciclopirox olamine, flucytosine, and caspofungin for C.
albicans (Danby et al., 2012). Pai and Jones reported a similar finding in
C. glabrata where MICs of triazoles were increased in pH 6 as compared to
pH 7.4 (Pai and Jones, 2004). Taken together, these data demonstrate that
in addition to the complications related to the acquired or the intrinsic-
resistance to conventional antifungals, reduction of antifungal potency at
![Page 268: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/268.jpg)
248
acidic pH can further complicate the treatments of VVC. Due to the fact
that the antifungal discovery pipelines of pharmaceutical companies are
almost dry, there is an urgent need to identify novel low pH-effective
antifungal molecules for VVC therapeutic intervention.
Valproic acid (VPA), is a branched short-chain fatty acid well-known as a
class I/II histone deacetylase inhibitor (HDACi) (Gottlicher et al., 2001;
Phiel et al., 2001). VPA is widely prescribed as antipsychotic to treat
epilepsy, bipolar disorder, and uncontrolled seizures (Privitera et al.,
2006). The antifungal properties of VPA has been previously reported
against different opportunistic fungi causing infections of the central
nervous system (Galgoczy et al., 2012; Homa et al., 2015). Despite the
growing interest on VPA as antifungal, its precise mechanism of action
remains not clear. Recent investigations in the budding yeast
Saccharomyces cerevisiae have shown that VPA induces apoptosis and
inhibits both cell-cycle at the G1-S transition and the activation of the cell
wall integrity pathway, Stl2 MAP kinase (Mitsui et al., 2005; Desfosses-
Baron et al., 2016). VPA was also shown to cause inositol depletion which
in turn led to vacuolar ATPase perturbation (Ju and Greenberg, 2003;
Deranieh et al., 2015). In Schizosaccharomyce pombe, VPA acts as an
HDACi and disturbs different cellular processes including calcium
homeostasis, cell wall integrity, and membrane trafficking (Miyatake et al.,
2007; Zhang et al., 2013).
We have recently shown that low pH strongly potentiates VPA
antimicrobial activity against the model yeast S. cerevisiae (Desfosses-
Baron et al., 2016). Here, we investigated the in vitro susceptibility of both
planktonic and sessile cells of different sensitive and resistant clinical
isolates of the opportunistic yeast C. albicans to VPA using conditions
mimicking the vaginal environment. The effect of VPA on the ability of C.
albicans to cause damage to vaginal epithelial cells were investigated. Drug
![Page 269: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/269.jpg)
249
synergy between VPA and 11 standard antifungal agents were also
explored. In attempt to gain insight into the mechanism of action
associated with the antifungal activity of VPA a genetic screen was
undertaken to uncover mutations conferring hypersensitivity to VPA.
![Page 270: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/270.jpg)
250
Materials and methods
Fungal strains, media, and chemicals
The fungal clinical and laboratory strains used in this study are listed in
the Tables S1, S2, respectively. C. albicans and other yeast strains were
routinely maintained at 30°C on YPD (1% yeast extract, 2% peptone, 2%
dextrose, with 50 mg/ml uridine) or synthetic complete (SC; 0.67% yeast
nitrogen base with ammonium sulfate, 2.0% glucose, and 0.079%
complete supplement mixture) or RPMI (RPMI-1640 with 0.3 g/L-
glutamine) media. Acidic pHs used for VPA susceptibility were obtained
using hydrochloric acid.
Valproic acid (VPA; Sigma-P4543) was dissolved in sterile water (50
mg/ml). Standard antifungals used for VPA-synergy assessment are:
Fluconazole (FCZ; Sigma-F8929), Caspofungin (CSP; Sigma-SML0425),
Voriconazole (VCZ; Sigma-PZ0005), Amphothericin B (AMB; Sigma-A488),
Itraconazole (ITZ; Sigma-I6657), Clotrimazole (CTZ; Sigma-C6019),
Teroconazole (TCZ; Toronto Research Chemicals-T110600), Miconazole
(MCZ; Sigma-PHR1618), Terbinafine (TRB; Sigma-T8826), Nystatin (NST;
Sigma-N4014), and Micafungin (MCF; McKesson Canada-205666).
Antifungals were prepared using DMSO for Amphothericin B (30 mg/ml),
Fluconazole (300 mg/ml), Terbinafine (10 mg/ml), Clotrimazole (9 mg/ml),
Nystatine (5 mg/ml), Miconazole (30 mg/ml), Terconazole (1 mg/ml); water
for caspofungin (10 mg/ml), Voriconazole (10 mg/ml), Micafungin (10
mg/ml), and chloroform for Itraconazole (50 mg/ml).
VPA susceptibility and time-kill assays
![Page 271: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/271.jpg)
251
The pH-dependant effect of VPA on C. albicans was evaluated as follows:
The reference clinical strain SC5314 was grown overnight in YPD medium
at 30°C in a shaking incubator. Cells were then resuspended in fresh SC
at an optical density at 595 nm (OD595nm) of 0.05. The pHs of SC media
were adjusted using sodium hydroxide or hydrochloric acid for alkaline
and acidic pHs, respectively. A total volume of 99 μl C. albicans cells was
added to each well of a flat-bottom 96-well plate in addition to 1 μl of the
corresponding stock solution of VPA. Plates were incubated in a Sunrise-
Tecan plate reader at 30°C with agitation and OD595nm readings were
taken every 10 min over 24 h. Experiments were performed in triplicate,
and average values were used for analysis. VPA effect on other fungal
species at acidic pH was performed in a similar fashion.
The Minimal Inhibitor Concentration (MIC) was determined following the
CLSI recommendations (CLSI, 2008). Briefly, 50 μl of VPA or standard
antifungals at two-fold the final concentration prepared in RPMI was
serially diluted in flat-bottom 96-well plates (Costar-Corning) and
combined with 50 μl of an-overnight culture of C. albicans and other
yeasts at 104 cell/ml. Plates were incubated at 30°C with shaking and
OD595nm readings were taken after 24 h using the Sunrise-Tecan plate
reader. The MIC was determined as the first well with growth reduction of
>10% based on OD595nm values in the presence of VPA or conventional
antifungals as compared to untreated control cells. Time-kill was
performed as described by Sanglard et al. (2003). Briefly, C. albicans
SC5314 strain cultures were grown in RPMI pH 4.5 at 30°C under shaking
in the presence of different concentration of VPA for defined time periods
(6, 24, and 48 h). Fractions of cultures were removed at each exposition
time and the colony forming units (CFU) counts were ensured by serial
dilution in YPD-agar.
Synergism assay
![Page 272: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/272.jpg)
252
Evaluation of synergistic interactions between VPA and standard
antifungals was performed using RPMI-1640 medium buffered at pH 4.5.
Synergism was assessed by calculating the fractional inhibitory
concentration (FIC) index as described by Epp et al. (2010). The FIC index
was calculated as follows: (MIC of VPA in combination/MIC of VPA alone)
plus (MIC of a standard antifungal in combination/MIC of a standard
antifungal alone).
Biofilm formation and XTT reduction assay
Biofilm formation and XTT (2,3-bis(2-methoxy-4-nitro-5-sulfo- phenyl)-2H-
tetrazolium-5-carboxanilide) assays were carried out as previously
described by Askew et al. (2011). Overnight YPD cultures were washed
three times with PBS and resuspended in fresh RPMI supplemented with
L-glutamine (0.3 g/l) to an OD595nm of 1. C. albicans yeast cells were
allowed to adhere to the surface of 96-well polystyrene plate for 3 h at
37°C in a rocking incubator. Non-attached cells were washed from each
well three times with PBS and fresh RPMI supplemented with VPA was
added for 24 h at 37°C for biofilm formation. The plates were then washed
and fresh RPMI supplemented with 100 μl of XTT-menadione (0.5 mg/ml
XTT in PBS and 1 mM menadione in acetone) was added. After 3 h
incubation on the dark at 37°C, 80 μl of the resulting colored
supernatants were used for colorimetric reading (OD490nm) to assess
metabolic activity of biofilms. A minimum of four replicates were at least
performed.
Vaginal epithelial cell damage assay
Damage of vaginal epithelial cells was assessed using the lactate
dehydrogenase (LDH) cytoxicity detection kit (Sigma) based on the release
![Page 273: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/273.jpg)
253
of LDH in the surrounding medium following the manufacturer's protocol.
VK2/E6E7 (ATCC- CRL-2616) vaginal epithelial cell line was grown on a
keratinocyte-serum free medium (supplemented with 0.1 ng/ml
recombinant epidermal growth factor and 50 μg/ml bovine pituitary
extract) as a monolayer to 95% confluency on a 96-well culture plate and
incubated at 37°C with 5% CO2. VK2/E6E7 cells were infected with 2 ×
104 of C. albicans SC5314 blastospores for 24 h. A total of 100 μl
supernatant was removed from each experiment and LDH activity in this
supernatant was determined by measuring the absorbance at 490 nm
(OD490nm). LDH activity were calculated as the mean of, at least, three
independent biological replicates.
Genetic screen for VPA-sensitive mutants
A total of 2371 mutants from the transcription factors (Homann et al.,
2009) (365 strains), transcriptional regulators (Vandeputte et al., 2012)
(509 strains), kinases (Blankenship et al., 2010) (165 strains), and
generalist collections (Noble et al., 2010) (1,332 strains) were screened for
VPA-sensitivity. These mutant libraries were obtained from the Fungal
Genetics Stock Center (FGSC). With the exception of the kinase collection
where genes were disrupted by transposon insertions, mutants of the other
collections were created through gene deletion of the complete ORF. In
most cases and for each gene, at least two independent transformants
were screened. Mutant strains were grown overnight in SC with pH 4.5 on
flat-bottom 96-well and were plated on SC-agar pH 4.5 medium with or
without VPA (50 μg/ml) using a 96-well blot-replicator. Mutants exhibiting
more than 2-fold growth reduction based on colony diameter were
compiled together in a 96-well plate and their sensitivity were confirmed to
different concentration of VPA (10, 50, and 100 μg/ml) following the same
procedure. Mutant strain with established VPA sensitivity were
individually reconfirmed by serial dilution spot assay. A complete listing of
![Page 274: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/274.jpg)
254
VPA-sensitive mutants is shown in Table S3. The overrepresentation of
specific GO terms associated with the function of gene required for VPA
tolerance was determined with GO Term Finder using a hypergeometric
distribution with multiple hypothesis correction
(http://www.candidagenome.org/cgi-bin/GO/goTermFinder) (Inglis et al.,
2012). Descriptions related to gene function in Table S3 were extracted
from CGD (Candida Genome Database) database (Inglis et al., 2012).
Confocal microscopy and vacuole integrity
C. albicans vacuole integrity was assessed using the lipophilic vacuole
membrane dye MDY-64 (Molecular probes, Fisher Scientific) following the
manufacturer's recommended procedure. Briefly, cells were grown
overnight on RPMI liquid medium with pH 4.5 at 30°C. Cells were pelleted
and washed twice with fresh RPMI pH 4.5 and resuspended in the same
medium at an OD595 of 0.1. VPA was added at different concentrations
(10, 50, and 100 μg/ml). Cells were incubated for 2 h at 30°C under
agitation. Aliquots were taken from VPA-treated and non-treated cultures
and the MDY-64 was added at a final concentration of 10 μM. Cells were
incubated at room temperature for 3 min prior to confocal microscopy
visualization. Images were acquired with a 1.3-numerical-aperture (NA)
63x objective on a Leica DMI6000B inverted microscope connected to a
Hamamatsu C9100-13 camera.
Pan1-green fluorescent protein (GFP), End3-GFP and LIFEACT-GFP (Epp
et al., 2013) were visualized using confocal microscopy as follow: an
overnight culture was diluted in SC supplemented with 10 or 50 μg/ml
VPA to an OD595nm of 0.05 and grown for four generations at 30°C under
agitation. Cells were imaged as described for the vacuole staining
experiments.
![Page 275: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/275.jpg)
255
Results
Antifungal activity of VPA is pH-dependant
Antifungal activity of VPA on C. albicans was evaluated by monitoring
OD595nm of cultures exposed for 24 h to increased concentration of VPA
in SC media at different pHs. VPA exerted an inhibitory effect that was
exaggerated in acidic pH (Figure1A). Antifungal activity of VPA was also
assessed in other clinically relevant Candida species including C. glabrata,
C. tropicalis, C. parapsilosis, and C. krusei in addition to the yeast S.
cerevisiae. The obtained data demonstrates that VPA inhibited the growth
of all tested fungal species, with C. albicans exhibiting higher sensitivity at
elevated VPA concentrations (>216 μg/ml) (Figure1B). Thus, VPA is a
potent antifungal compound against C. albicans at acidic pH.
To test whether VPA had fungistatic or fungicidal activity on C. albicans at
acidic pH, time-kill curve assays were performed. Two high concentrations
of VPA which correspond to 125x (1,000 μg/ml) and 375x (3,000 μg/ml) of
the MIC for the C. albicans reference strain SC5314 (Table1) were tested.
VPA exhibited a concentration-independent fungistatic activity (Figure1C).
Lower VPA concentrations ranging from 7.8 (MIC for the SC5314 strain)
and 500 μg/ml were also tested and the obtained results demonstrates a
similar fungistatic activity (result not shown).
Antifungal activity of VPA against azole- and echinocandin-resistant
strains
Since VPA was highly potent against C. albicans, we wanted to test
whether its antifungal activity can be expanded to other clinically sensitive
and resistant strains of this yeast. Several azole-resistant strains with
different resistant mechanisms, were selected (Table S1) in addition to
![Page 276: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/276.jpg)
256
echinocandin-resistant isolates. A total of four sensitive and 11 resistant
strains (six azole- and five echinocandin-resistant strains) were examined
using broth microdilution assay as specified by CLSI at both neutral or
acidic pHs. The sensitivity of C. albicans isolates to VPA was pH-dependant
and MICs ranged from 3.5 to 15.6 μg/ml for both resistant and susceptible
strains (Table1). The range of MICs was also similar when comparing
azole-resistant and echinocandin-resistant clinical strains separately (3.5–
15.6 μg/ml). Overall, these results demonstrate that VPA may be of use to
tackle therapeutic limitations related to acquired clinical resistance of C.
albicans. Furthermore, comparable VPA-sensitivity in susceptible and
resistant strains indicates that the mechanisms that confer resistance to
azoles and echinocandins are distinct from those that may cause VPA
resistance.
Valproic acid attenuate damage of vaginal epithelial cells caused by C.
albicans
To verify whether VPA exerts protective antifungal activity during host cell
invasion, interaction of C. albicans with the human epithelial vaginal cell
line VK2/E6E7 were performed as described in the method section. C.
albicans-mediated damage of VK2/E6E7 cells were quantified based on the
LDH release. Two different concentrations of VPA (7.8 and 78 μg/ml)
corresponding to the MIC and 10x MIC for C. albicans SC5314 strain were
used. In accordance with our in vitro data, the VPA had no significant
protective effect at pH 7 (Figure 2). At pH 5, 7.8, and 78 μg/ml of VPA
prevented 55 and 100% of VK2/E6E7 damage, respectively, as compared
to the control. Intermediate protective activity was perceived at pH 6 where
28 and 52% damage reduction was obtained with 7.8 and 78 μg/ml of
VPA, respectively. In support of in vitro data, these results demonstrate
that VPA confers a protective antifungal activity during the invasion of
vaginal epithelial cells.
![Page 277: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/277.jpg)
257
VPA acts synergistically with terbinafine in both susceptible and
resistant strains
Different standard antifungals used against C. albicans and other human
fungal pathogens were screened to identify drugs that could potentiate the
anti-Candida activity of VPA. Interactions of VPA with other 11 antifungal
agents including azoles (Fluconazole, Voriconazole, Itraconazole,
clotrimazole, Terconazole, and Miconazole), polyenes (Amphothericin B and
Nystatin), echinocandins (Caspofungin and Micafungin), and the
allylamine, Terbinafine were tested. Based on the appreciation of the FIC
index in the clinical strain SC5314, VPA was found to exhibit an apparent
synergistic interaction with terbinafine (Table2; FIC index < 0.5). VPA-
terbinafine combinations were also synergistic in azole and echinocandin
resistant clinical strains (Table2).
VPA inhibits biofilm formation in both susceptible and resistant
strains
The effect of VPA on biofilm formation was evaluated using the metabolic
colorimetric assay based on the reduction of XTT at acidic and neutral
pHs. At neutral pH, no VPA anti-biofilm activity was noticed of all tested
concentrations for the C. albicans SC5314 reference strain (not shown). In
contrast, at pH 4.5, biofilm inhibition was apparent at 1.44 μg/ml of VPA
with ~5% of inhibition as compared to the control (Figure 3). The MIC of
VPA on the SC5314 strain was evaluated at 7.2 μg/ml. The effect of VPA
on biofilm formation was also tested in two azole-resistant strains (S2 and
F5) with different resistance mechanisms in addition to two echinocandin-
resistant isolates (DPL-1008 and DPL-1010). As for the SC5314 sensitive
strain, the four resistant strains exhibited a clear reduction in metabolic
activity at 1.44 μg/ml of VPA (Figure 3). The MIC values for the azole-
![Page 278: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/278.jpg)
258
resistant strains were similar (2.88 μg/ml VPA) and slightly decreased as
compared to the SC5314 susceptible strain. The two echinocandin-
resistant strains DPL-1008 and DPL-1010 were highly sensitive to VPA as
compared to other strains and their MIC was noticed at 1.44 μg/ml of
VPA. These results demonstrate that, in addition to its antifungal activity
on planktonic cells, VPA is also active on sessile forms of C. albicans at
acidic pH.
Mutants defective in vacuolar functions are hypersensitive to VPA
To gain insight into the mechanism of action of VPA associated with its
antifungal property, a comprehensive regulatory and generalist mutant
collections of C. albicans were screened for their sensitivity to VPA. Among
the 947 unique mutants that were screened, 55 were confirmed to be
hypersensitive to VPA (Table S3). To identify the functional categories that
are associated with mutations affecting VPA susceptibility, we performed
gene ontology (GO) enrichment analysis. Our data demonstrated that VPA
sensitive mutants are defective in genes related primarily to vacuole
transport (p = 1.72e-08) and organization (p = 8.86e-09) (Table 3, Table S4).
This include mutants of vacuolar protein sorting (vps15, vps34, vps64,
and ypt72), proteins associated with the retromer complex (pep7 and
pep8), and proteins required for vacuole inheritance, and organization
(cla4, pep12, vam6, vps41, and pep12). Requirement of vacuolar functions
for VPA tolerance was also reported previously in S. pombe (Zhang et al.,
2013) and S. cerevisiae (Deranieh et al., 2015) where genome-wide screens
demonstrated that retromer complex and vacuolar ATPases, respectively,
were associated with VPA sensitivity. Taken together, our chemogenetic
screen provides a rational for mechanistic investigation into the effect of
VPA on fungal vacuole.
VPA alters vacuole morphology
![Page 279: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/279.jpg)
259
Our chemogenetic screen demonstrated clearly that C. albicans sensitivity
to VPA were exaggerated in mutant of vacuolar transport, organization and
inheritance. The requirement of intact vacuolar pathways for VPA
tolerance suggests that VPA might alters the function and/or the integrity
of the vacuole. To verify this hypothesis, the integrity of C. albicans
vacuoles were assessed using the vacuole membrane marker, MDY-64, in
cells treated or not with different concentrations of VPA at pH 4.5. A
dominant fraction of non-treated cells internalized the MDY-64 dye and
exhibited well-structured vacuoles with two to four compartments
comprising discernable lumens (Figure 4A). However, cells treated with
either 10 or 50 μg/ml of VPA displayed an altered vacuole structure with a
foamy fluorescence pattern and indistinguishable lumens (Figure 4B).
These findings suggest that VPA affect the morphology and the integrity of
vacuoles in C. albicans.
VPA-induced vacuolar phenotypes are not a consequence of
endocytosis, actin filaments perturbations, or inositol depletion
Perturbation of vacuoles by VPA might be either a direct consequence
where VPA act in situ on vacuole or by impacting indirectly other process
required for proper vacuole biogenesis and organization. Indeed, vacuolar
integrity and homeostasis depends on the proper functioning of different
cellular processes including actin filaments organization (Eitzen et al.,
2002), endocytosis (Michaillat and Mayer, 2013), and the
phosphatidylinositol phosphate signaling (Michell et al., 2006). Recent
work by Deranieh et al. (2015) indicated that VPA led to cellular depletion
of inositol, which disrupts the vacuolar phosphoinositide, PI(3,5)P2
(Phosphatidylinositol 3,5-bisphosphate) homeostasis and consequently
compromise vacuole morphology. In this regard, we checked whether VPA-
mediated vacuole alteration can be bypassed by inositol supplementation
![Page 280: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/280.jpg)
260
or deprivation. Our data demonstrate that the altered vacuole phenotype
was not influenced by lack or excess of inositol (data not shown),
suggesting that the probable VPA-induced inositol depletion in C. albicans
is unlikely to account for the toxicity of this compound under our
conditions.
To check whether the vacuole alteration caused by VPA is related to a
defect in endocytosis or actin filament organization, we have used a Pan1-
and End3-GFP fusions as clathrin-coated vesicles markers, and LIFEACT-
GFP (Epp et al., 2013) to monitor actin patches and cables. VPA treatment
did not cause any apparent alteration of the organization of actin filaments
or endocytic vesicles (Figure S1). Taken together, these results support
that the direct alteration of vacuole is the cellular mechanism underlying
the antifungal activity of VPA.
![Page 281: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/281.jpg)
261
Discussion
Candida pathogenic species are adapted to survive in different acidic
environments inside their host such as the vagina, inflammatory foci like
abscesses (Park et al., 2012) and phagolysosomes of neutrophils and
macrophages (Erwig and Gow, 2016). In such acidic condition, several
studies demonstrated that the in vitro activity of standard antifungals is
compromised as evidenced by the increase of their MICs (Marr et al., 1999;
Pai and Jones, 2004; Danby et al., 2012). In the current study, we
demonstrated that the antifungal activity of the VPA, a histone deacetylase
inhibitor and the widely prescribed as antipsychotic, is potentiated at
acidic pH that resemble to that of host niches cited above. We also
demonstrated that VPA potentiates the antifungal activity of the widely
prescribed terbinafine at acidic pH. In this regard, VPA, alone or with
terbinafine, may be useful against fungal vaginosis caused primarily by C.
albicans. VPA was also found to be effective against both echinocandin-
and azole-resistant strains suggesting that this molecule represents an
alternative solution to circumvent VVC or recurrent VVC caused by C.
albicans strains that are resistant to standard antifungals. In the current
study, VPA were also potent against C. albicans biofilm in a similar fashion
as for planktonic cells and for both sensitive and clinical resistant strains.
As for vaginal bacterial pathogens, C. albicans is able to form infective
biotic biofilms on the vaginal mucosal surfaces (Harriott et al., 2010). Due
to the fact that biofilm growth is impervious to all conventional
antifungals, and since efficiency of these drugs is compromised at acidic
pH, VPA may represent thus a promising alternative for antibiofilm
therapy.
Importantly, this work supports a direct clinical repurposing of VPA as an
antifungal against VVC or recurrent VVC due to the fact that its safety
![Page 282: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/282.jpg)
262
profile has been extensively characterized in vivo over the past decades of
its clinical use in systemic forms as anticonvulsant (Lagace et al., 2004) or
anticancer (Gupta et al., 2013). VPA had also a broad therapeutic safety
margin when used topically (Choi et al., 2013). It does not cause skin
irritations such as erythema and edema and had no toxicity to different
human cells including keratinocytes, fibroblasts, and mast cells (Choi et
al., 2013). In the current work, we also find that VPA did not impair the
growth and the integrity of the vaginal epithelial cells VK2/E6E7 as judged
by the LDH cytotoxicity assay (Figure S2). While a whole animal vaginal
model is required to confirm that VPA does not cause vaginal irritations,
the aforementioned studies are supportive of a safe use of VPA topically
against VVC.
It is intriguing that the antifungal activity of VPA was acidic pH-
dependant. This could be explained by the chemical nature of VPA, which
is an eight-carbon branched-chain acid with proprieties of weak acid (pKa
4.8). Low pH is expected to decrease its ionization state and increase its
liposolubility, which in turn may facilitate the passage through the plasma
membrane and its accumulation in the cells. Future structure-guided
medicinal chemistry approach by introducing structural changes in VPA
that can lead to beneficial biological activity in a pH-independent manner
will allow expanding the potential use of this molecules form VVC and
recurrent VVC to treat oral C. albicans infections and even systemic
candidiasis.
In the current study, we undertook a chemogenetic screen to delineated
biological process that underlies VPA-sensitivity in C. albicans. This screen
enables the identification of different vacuole-related functions as being
required to tolerate VPA and provide thus a rational to examine the effect
of this molecule on fungal vacuole. Our data demonstrates clearly that VPA
antifungal activity is a consequence of the impairment of vacuole integrity
![Page 283: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/283.jpg)
263
and illuminate thus a previously unappreciated mechanism of action of
this drug. Recent work in S. cerevisiae indicates that cellular depletion of
inositol by VPA disrupts the vacuolar phosphoinositide, PI3,5P2
homeostasis which compromise the function of V-ATPase activity and
proton pumping (Deranieh et al., 2015). This V-ATPase phenotype was
rescued by supplementing the growth medium by inositol. Despite the
requirement of V-ATPases to tolerate VPA in S. cerevisiae, the authors did
not report any alteration of the vacuolar morphology by VPA as seen in our
investigation. Furthermore, the vacuole defects in C. albicans were not
recovered by adding inositol to the growth medium suggesting that VPA
may act via a different mechanism in this pathogenic yeast. Similarly, in S.
pombe, genetic screens revealed that mutant of genes operating in Golgi-
endosome membrane trafficking and vacuole retromer complex were
hypersensitive to VPA (Miyatake et al., 2007; Ma et al., 2010; Zhang et al.,
2013), however, no apparent alteration of vacuole was seen in this yeast
model.
Regardless of the exact vacuolar process that is targeted by VPA, our study
reinforces the fact that pharmacological perturbation of vacuole leads to
fungal growth inhibition and is protective for host cells. Different C.
albicans vacuolar proteins has been previously characterized and linked to
the ability to infect the host and to control different virulence traits
including biofilm formation, filamentation, and resistance to antifungals.
This include for instance vacuolar membrane and cytosolic V-ATPases
(Vma2, Vma3, and Vph1) (Patenaude et al., 2013; Rane et al., 2013, 2014),
proteins mediating vesicular trafficking to the vacuole (Pep12, Vps11, and
Vps21) (Palmer et al., 2005; Johnston et al., 2009; Palanisamy et al., 2010;
Wachtler et al., 2011) and the vacuolar calcium channel, Yvc1 (Wang et al.,
2011). This makes the vacuole an ideal therapeutic target to manage
fungal infections. However, the functional resemblance of fungal vacuoles
with their human counterpart organelle, lysosomes, raises uncertainty
![Page 284: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/284.jpg)
264
regarding their druggability. Indeed, while the two V-ATPase inhibitors
bafilomycin A1 and concanamycin A from Streptomyces, exhibit a potent
activity against C. albicans they also compromise the activity of the
mammalian V-ATPases (Olsen, 2014). Meanwhile, the fungal vacuoles had
distinctive proteins such as the V0-ATPase subunit with no apparent
human homologs that could be specifically targeted for pharmacological
interventions in the treatment of fungal infections. In this regard, we
demonstrate that VPA had no cytotoxicity on vaginal epithelial cells at
concentrations above 10 times the MIC of C. albicans suggesting that VPA-
mediated vacuole alteration is fungus-specific (Figure S2).
In conclusion, we have shown that VPA is a potent antifungal at acidic pH
and consequently an attractive therapeutic molecule against vulvovaginal
candidiasis. We have also described an unreported effect of VPA on the
structural integrity of fungal vacuoles which might be the main cause of its
cytotoxicity.
![Page 285: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/285.jpg)
265
References
Askew, C., Sellam, A., Epp, E., Mallick, J., Hogues, H., Mullick, A., et al.
(2011). The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion. Mol. Microbiol. 79, 940–953. doi: 10.1111/j.1365-2958.2010.07504.x
Berman, J., and Sudbery, P. E. (2002). Candida albicans: a molecular
revolution built on lessons from budding yeast. Nat. Rev. Genet. 3, 918–930. doi: 10.1038/nrg948
Blankenship, J. R., Fanning, S., Hamaker, J. J., and Mitchell, A. P. (2010). An extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog. 6:e1000752. doi: 10.1371/journal.ppat.1000752
Choi, S. Y., Seop, S. Y., Hyun, M. Y., Yoo, K. H., Kim, B. J., Kim, M. N., et
al. (2013). Safety evaluation of topical valproate application. Toxicol. Res. 29, 87–90. doi: 10.5487/TR.2013.29.2.087
Clinical and Laboratory Standards Institute (2008). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, Approved
Standard M27-A3, 3rd Edn. Approved Standard M27-A3 (Wayne, PA: CLSI).
Danby, C. S., Boikov, D., Rautemaa-Richardson, R., and Sobel, J. D. (2012). Effect of pH on in vitro susceptibility of Candida glabrata and Candida albicans to 11 antifungal agents and implications for clinical use.
Antimicrob. Agents Chemother. 56, 1403–1406. doi: 10.1128/AAC.05025-11
Deranieh, R. M., Shi, Y., Tarsio, M., Chen, Y., McCaffery, J. M., Kane, P. M., et al. (2015). Perturbation of the Vacuolar ATPase: A NOVEL
CONSEQUENCE OF INOSITOL DEPLETION. J. Biol. Chem. 290, 27460–27472. doi: 10.1074/jbc.M115.683706
Desfosses-Baron, K., Hammond-Martel, I., Simoneau, A., Sellam, A., Roberts, S., and Wurtele, H. (2016). Valproate inhibits MAP kinase
signalling and cell cycle progression in S. cerevisiae. Sci. Rep. 6:36013. doi: 10.1038/srep36013
Eitzen, G., Wang, L., Thorngren, N., and Wickner, W. (2002). Remodeling of organelle-bound actin is required for yeast vacuole fusion. J. Cell Biol.
158, 669–679. doi: 10.1083/jcb.200204089
![Page 286: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/286.jpg)
266
Epp, E., Nazarova, E., Regan, H., Douglas, L. M., Konopka, J. B., Vogel, J., et al. (2013). Clathrin- and Arp2/3-independent endocytosis in the fungal
pathogen Candida albicans. MBio 4:e00476–e00413. doi: 10.1128/mBio.00476-13
Epp, E., Vanier, G., Harcus, D., Lee, A. Y., Jansen, G., Hallett, M., et al. (2010). Reverse genetics in Candida albicans predicts ARF cycling is
essential for drug resistance and virulence. PLoS Pathog. 6:e1000753. doi: 10.1371/journal.ppat.1000753
Erwig, L. P., and Gow, N. A. (2016). Interactions of fungal pathogens with phagocytes. Nat. Rev. Microbiol. 14, 163–176. doi: 10.1038/nrmicro.2015.21
Galgoczy, L., Toth, L., Viragh, M., Papp, T., and Vagvolgyi, C. S. (2012). In
vitro interactions of amantadine hydrochloride, R-(-)-deprenyl hydrochloride and valproic acid sodium salt with antifungal agents against filamentous fungal species causing central nervous system infection. Acta
Biol. Hung. 63, 490–500. doi: 10.1556/ABiol.63.2012.4.8 Gottlicher, M., Minucci, S., Zhu, P., Kramer, O. H., Schimpf, A., Giavara,
S., et al. (2001). Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. EMBO J. 20, 6969–6978. doi:
10.1093/emboj/20.24.6969 Gupta, S. C., Sung, B., Prasad, S., Webb, L. J., and Aggarwal, B. B. (2013).
Cancer drug discovery by repurposing: teaching new tricks to old dogs. Trends Pharmacol. Sci. 34, 508–517. doi: 10.1016/j.tips.2013.06.005
Harriott, M. M., Lilly, E. A., Rodriguez, T. E., Fidel, P. L. Jr., and Noverr, M. C. (2010). Candida albicans forms biofilms on the vaginal mucosa.
Microbiology 156, 3635–3644. doi: 10.1099/mic.0.039354-0 Homa, M., Galgoczy, L., Toth, E., Toth, L., Papp, T., Chandrasekaran, M.,
et al. (2015). In vitro antifungal activity of antipsychotic drugs and their combinations with conventional antifungals against Scedosporium and
Pseudallescheria isolates. Med. Mycol. 53, 890–895. doi: 10.1093/mmy/myv064
Homann, O. R., Dea, J., Noble, S. M., and Johnson, A. D. (2009). A phenotypic profile of the Candida albicans regulatory network. PLoS
Genet. 5:e1000783. doi: 10.1371/journal.pgen.1000783 Inglis, D. O., Arnaud, M. B., Binkley, J., Shah, P., Skrzypek, M. S.,
Wymore, F., et al. (2012). The Candida genome database incorporates multiple Candida species: multispecies search and analysis tools with
![Page 287: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/287.jpg)
267
curated gene and protein information for Candida albicans and Candida glabrata. Nucleic Acids Res. 40, D667–D674. doi: 10.1093/nar/gkr945
Johnston, D. A., Eberle, K. E., Sturtevant, J. E., and Palmer, G. E. (2009). Role for endosomal and vacuolar GTPases in Candida albicans
pathogenesis. Infect. Immun. 77, 2343–2355. doi: 10.1128/IAI.01458-08
Ju, S., and Greenberg, M. L. (2003). Valproate disrupts regulation of inositol responsive genes and alters regulation of phospholipid biosynthesis. Mol. Microbiol. 49, 1595–1603. doi: 10.1046/j.1365-
2958.2003.03641.x Lagace, D. C., O'brien, W. T., Gurvich, N., Nachtigal, M. W., and Klein, P.
S. (2004). Valproic acid: how it works. Or not. Clin. Neurosci. Res. 4, 215–225. doi: 10.1016/j.cnr.2004.09.013
Ma, Y., Sugiura, R., Zhang, L., Zhou, X., Takeuchi, M., He, Y., et al. (2010). Isolation of a fission yeast mutant that is sensitive to valproic acid and
defective in the gene encoding Ric1, a putative component of Ypt/Rab-specific GEF for Ryh1 GTPase. Mol. Genet. Genomics 284, 161–171. doi: 10.1007/s00438-010-0550-7
Marchaim, D., Lemanek, L., Bheemreddy, S., Kaye, K. S., and Sobel, J. D.
(2012). Fluconazole-resistant Candida albicans vulvovaginitis. Obstet. Gynecol. 120, 1407–1414. doi: 10.1097/AOG.0b013e31827307b2
Marr, K. A., Rustad, T. R., Rex, J. H., and White, T. C. (1999). The trailing end point phenotype in antifungal susceptibility testing is pH dependent.
Antimicrob. Agents Chemother. 43, 1383–1386. Michaillat, L., and Mayer, A. (2013). Identification of genes affecting
vacuole membrane fragmentation in Saccharomyces cerevisiae. PLoS ONE 8:e54160. doi: 10.1371/journal.pone.0054160
Michell, R. H., Heath, V. L., Lemmon, M. A., and Dove, S. K. (2006). Phosphatidylinositol 3,5-bisphosphate: metabolism and cellular functions.
Trends Biochem. Sci. 31, 52–63. doi: 10.1016/j.tibs.2005.11.013 Mitsui, K., Nakagawa, D., Nakamura, M., Okamoto, T., and Tsurugi, K.
(2005). Valproic acid induces apoptosis dependent of Yca1p at concentrations that mildly affect the proliferation of yeast. FEBS Lett. 579,
723–727. doi: 10.1016/j.febslet.2004.12.051 Miyatake, M., Kuno, T., Kita, A., Katsura, K., Takegawa, K., Uno, S., et al.
(2007). Valproic acid affects membrane trafficking and cell-wall integrity in fission yeast. Genetics 175, 1695–1705. doi: 10.1534/genetics.107.070946
![Page 288: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/288.jpg)
268
Noble, S. M., French, S., Kohn, L. A., Chen, V., and Johnson, A. D. (2010).
Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity. Nat. Genet. 42, 590–598. doi: 10.1038/ng.605
Odds, F. C. (1987). Candida infections: an overview. Crit. Rev. Microbiol.
15, 1–5. doi: 10.3109/10408418709104444 Olsen, I. (2014). Attenuation of Candida albicans virulence with focus on
disruption of its vacuole functions. J. Oral Microbiol. 6:10.3402/jom.v6.23898. doi: 10.3402/jom.v6.23898
Pai, M. P., and Jones, A. L. (2004). Altered susceptibility of Candida glabrata bloodstream isolates to triazoles at clinically relevant pH values:
comparison of the NCCLS M27-A2, sensititre yeastone, and etest methods. Antimicrob. Agents Chemother. 48, 4441–4443. doi: 10.1128/AAC.48.11.4441-4443.2004
Palanisamy, S. K., Ramirez, M. A., Lorenz, M., and Lee, S. A. (2010). Candida albicans PEP12 is required for biofilm integrity and in vivo
virulence. Eukaryot. Cell 9, 266–277. doi: 10.1128/EC.00295-09
Palmer, G. E., Kelly, M. N., and Sturtevant, J. E. (2005). The Candida albicans vacuole is required for differentiation and efficient macrophage killing. Eukaryot. Cell 4, 1677–1686. doi: 10.1128/EC.4.10.1677-
1686.2005
Park, S. Y., Bae, D. J., Kim, M. J., Piao, M. L., and Kim, I. S. (2012). Extracellular low pH modulates phosphatidylserine-dependent phagocytosis in macrophages by increasing stabilin-1 expression. J. Biol.
Chem. 287, 11261–11271. doi: 10.1074/jbc.M111.310953 Patenaude, C., Zhang, Y., Cormack, B., Kohler, J., and Rao, R. (2013).
Essential role for vacuolar acidification in Candida albicans virulence. J. Biol. Chem. 288, 26256–26264. doi: 10.1074/jbc.M113.494815
Phiel, C. J., Zhang, F., Huang, E. Y., Guenther, M. G., Lazar, M. A., and Klein, P. S. (2001). Histone deacetylase is a direct target of valproic acid, a
potent anticonvulsant, mood stabilizer, and teratogen. J. Biol. Chem. 276, 36734–36741. doi: 10.1074/jbc.M101287200
Privitera, M. D., Welty, T. E., Ficker, D. M., Kaplan, M. J., Szaflarski, J. P., and Cavitt, J. (2006). Clinician's Guide to Antiepileptic Drug Use.
Philadelphia, PA: Lippincott Williams & Wilkins.
![Page 289: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/289.jpg)
269
Rane, H. S., Bernardo, S. M., Hayek, S. R., Binder, J. L., Parra, K. J., and Lee, S. A. (2014). The contribution of Candida albicans vacuolar ATPase
subunit V(1)B, encoded by VMA2, to stress response, autophagy, and virulence is independent of environmental pH. Eukaryot. Cell 13, 1207–1221. doi: 10.1128/EC.00135-14
Rane, H. S., Bernardo, S. M., Raines, S. M., Binder, J. L., Parra, K. J., and
Lee, S. A. (2013). Candida albicans VMA3 is necessary for V-ATPase assembly and function and contributes to secretion and filamentation. Eukaryot. Cell 12, 1369–1382. doi: 10.1128/EC.00118-13
Sanglard, D., Ischer, F., Marchetti, O., Entenza, J., and Bille, J. (2003). Calcineurin A of Candida albicans: involvement in antifungal tolerance,
cell morphogenesis and virulence. Mol. Microbiol. 48, 959–976. doi: 10.1046/j.1365-2958.2003.03495.x
Sobel, J. D. (2007). Vulvovaginal candidosis. Lancet 369, 1961–1971. doi: 10.1016/S0140-6736(07)60917-9
Vandeputte, P., Pradervand, S., Ischer, F., Coste, A. T., Ferrari, S., Harshman, K., et al. (2012). Identification and functional characterization
of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans. Eukaryot. Cell 11, 916–931. doi:
10.1128/EC.00134-12 Wachtler, B., Wilson, D., Haedicke, K., Dalle, F., and Hube, B. (2011).
From attachment to damage: defined genes of Candida albicans mediate adhesion, invasion and damage during interaction with oral epithelial
cells. PLoS ONE 6:e17046. doi: 10.1371/journal.pone.0017046 Wang, H., Liang, Y., Zhang, B., Zheng, W., Xing, L., and Li, M. (2011).
Alkaline stress triggers an immediate calcium fluctuation in Candida albicans mediated by Rim101p and Crz1p transcription factors. FEMS Yeast Res. 11, 430–439. doi: 10.1111/j.1567-1364.2011.00730.x
Zhang, L., Ma, N., Liu, Q., and Ma, Y. (2013). Genome-wide screening for
genes associated with valproic acid sensitivity in fission yeast. PLoS ONE 8:e68738. doi: 10.1371/journal.pone.0068738
![Page 290: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/290.jpg)
270
Figures
Figure 1 - In vitro antifungal activity of valproic acid is pH-
dependant. (A) Effect of different pHs on antifungal activity of VPA. The C.
albicans SC5314 strain was grown in SC medium with different pH (4.5–8)
supplemented with different concentration of VPA. SC5314 strain was
grown at 30°C and OD595nm reading was taken after 24 h of incubation.
ODs measurement for each VPA concentration is the mean of triplicate. (B)
VPA inhibit the growth of non-albicans Candida species. C. glabrata, C.
parapsilosis, C. tropicalis, C. krusei in addition to S. cerevisiae were grown
in SC medium pH 4.5 with different concentration of VPA. OD595nm
reading was taken after 24 h of incubation at 30°C under agitation. (C)
Time-kill curve demonstrating the fungistatic activity of VPA. C. albicans
SC5314 strain was exposed to two different concentrations (1,000 and
3,000 μg/ml) at different times (6, 24, and 48). CFUs were calculated as
described in the method section.
![Page 291: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/291.jpg)
271
Figure 2 - Valproic acid attenuate damage of vaginal epithelial cells
caused by C. albicans. Damage of human epithelial vaginal cell line
VK2/E6E7 infected by C. albicans SC5314 strain was assessed using LDH
release assay. For each pH, cell damage was calculated as percentage of
LDH activity of VPA-treated experiment relatively to that of the control
experiment (C. albicans invading VK2/E6E7 cells in the absence of VPA).
Results are the mean of three independent replicates.
![Page 292: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/292.jpg)
272
Figure 3 - Anti-biofilm activity of valproic acid. The effect of VPA on
biofilm formation was evaluated using the metabolic colorimetric assay
based on the reduction of XTT at pH4. Sensitive (SC5314) and azole- (S2
and F5), and echinocandin-resistant (DPL-1008 and DPL-1010) C. albicans
strains were tested. Results represent growth inhibition (%) and are the
mean of at least three independent replicates.
![Page 293: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/293.jpg)
273
Figure 4 - Valproic acid alters vacuolar morphology. C. albicans
SC5314 strains was grown in RPMI pH 4.5 in the absence (A) or presence
of 50 μg/ml of VPA (B) and stained for 3 min with the vacuole membrane
marker, MDY-64. Cells were visualized using confocal microscopy. The
white arrows indicate representatively intact vacuole lumens. Fluorescence
PMT gain were increased five times for VPA-treated cells due to low
incorporation of MDY-64. Bars, 8 μm.
![Page 294: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/294.jpg)
274
Table 1 - In vitro activity of valproic acid (MIC) on C. albicans
antifungal sensitive and resistant strains.
![Page 295: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/295.jpg)
275
Table 2 - Synergistic interaction of valproic acid with the allylamine
antifungal, terbinafine on sensitive, and azole- and echinocandin-
resistant strains.
![Page 296: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/296.jpg)
276
Table 3 - Gene function and biological process associated with VPA-
sensitivity.
Gene ontology analysis was performed using GO Term Finder.
aThe p-value was calculated using hypergeometric distribution, as
described on the GO Term Finder website (Inglis et al., 2012).
![Page 297: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/297.jpg)
277
References
Brachmann, C.B., Davies, A., Cost, G.J., Caputo, E., Li, J., Hieter, P., and
Boeke, J.D.(1998). Designer deletion strains derived from Saccharomyces
cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated
gene disruption and other applications. Yeast 14, 115-132.
Dunkel, N., Blass, J., Rogers, P.D., and Morschhauser, J. (2008a).
Mutations in the multi-drug resistance regulator MRR1, followed by loss of
heterozygosity, are the main cause of MDR1 overexpression in fluconazole-
resistant Candida albicans strains. Mol Microbiol 69, 827-840.
Dunkel, N., Liu, T.T., Barker, K.S., Homayouni, R., Morschhauser, J., and
Rogers, P.D. (2008b). A gain-of-function mutation in the transcription
factor Upc2p causes upregulation of ergosterol biosynthesis genes and
increased fluconazole resistance in a clinical Candida albicans isolate.
Eukaryot Cell 7, 1180-1190.
Espinel-Ingroff, A., Kish, C.W., Jr., Kerkering, T.M., Fromtling, R.A.,
Bartizal, K., Galgiani, J.N., Villareal, K., Pfaller, M.A., Gerarden, T.,
Rinaldi, M.G., and Et Al. (1992). Collaborative comparison of broth
macrodilution and microdilution antifungal susceptibility tests. J Clin
Microbiol 30, 3138-3145.
Fonzi, W.A., and Irwin, M.Y. (1993). Isogenic strain construction and gene
mapping in Candida albicans. Genetics 134, 717-728.
Franz, R., Kelly, S.L., Lamb, D.C., Kelly, D.E., Ruhnke, M., and
Morschhauser, J. (1998). Multiple molecular mechanisms contribute to a
stepwise development of fluconazole resistance in clinical Candida albicans
strains. Antimicrob Agents Chemother 42, 3065-3072.
![Page 298: Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction](https://reader033.vdocuments.pub/reader033/viewer/2022052801/5f165d4989f53879ac209bde/html5/thumbnails/298.jpg)
278
Franz, R., Ruhnke, M., and Morschhauser, J. (1999). Molecular aspects of
fluconazole resistance development in Candida albicans. Mycoses 42, 453-
458.
Jimenez-Ortigosa, C., Paderu, P., Motyl, M.R., and Perlin, D.S. (2014).
Enfumafungin derivative MK-3118 shows increased in vitro potency
against clinical echinocandin-resistant Candida Species and Aspergillus
species isolates. Antimicrob Agents Chemother 58, 1248-1251.
Morschhauser, J., Barker, K.S., Liu, T.T., Bla, B.W.J., Homayouni, R., and
Rogers, P.D. (2007). The transcription factor Mrr1p controls expression of
the MDR1 efflux pump and mediates multidrug resistance in Candida
albicans. PLoSPathog 3, e164.
Rudek, W. (1978). Esterase activity in Candida species. J Clin Microbiol 8,
756-759.
Saidane, S., Weber, S., De Deken, X., St-Germain, G., and Raymond, M.
(2006). PDR16-
mediated azole resistance in Candida albicans. Mol Microbiol 60, 1546-
1562.