wildsi 3 open access dsi scenarios - dsmz.de...leibniz-institut • dsmz-deutsche sammlung von...

Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH

WiLDSI 3 open access DSI scenarios “Science-based solutions for Digital Sequence Information (DSI) in preparation for COP 15” „Wissenschaftsbasierte Lösungsansätze für Digitale Sequenzinformation (DSI)“

Dr. Amber Hartman Scholz, Deputy to the Director Dr. Jens Freitag, Head of Managing Office


The story begins with a registered collection


0

20

40

60

80

100

120

140

Waiting list No answer Answer Bounced email

2017

2018

2019

We wrote to every country in the ABS-CH


Survey of academic research projects after 2014

• Short survey of 20 institutes involved in biodiversity research

• 40 projects • 23 countries • Average:

• 3 year project length • 65,000 Eur


The Nagoya Protocol and CBD cause delays in biodiversity research

0

2

4

6

8

10

12

14M

onth

s

Country of origin Nagoya Protocol Country

CBD Country

Time to permit


1. Global health, biodiversity, other public goods are very

rarely given „simplified measures“ (Art.8) by Parties

2. Scientific reality: lots of organisms have cosmopolitan

distribution. Jurisdiction shopping frustrates everyone.

3. Lack of capacity in provider countries

4. A 2-tier system could bring paralysis

either Nagoya-like or very easy

Learning from Nagoya


2 years ago…

Source: https://www.onthisday.com/photos/julis-caesar-crosses-the-rubicon


Source: https://www.onthisday.com/photos/julis-caesar-crosses-the-rubicon

So why cross the Rubicon?


1. Sequence data are important & growing

PLoS Biol. 2015 Jul; 13(7): e1002195. doi: 10.1371/journal.pbio.1002195

https://dx.doi.org/10.1371/journal.pbio.1002195


Christian R. Boehm, and Ralph Bock Plant Physiol. 2018;179:794-802 ©2019 by American Society of Plant Biologists

2. DSI can reduce but not replace physical GR Biological properties and existing technical capacities for synthetic biology of plastids

compared to bacteria, yeast and the plant nucleus.

Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Porter TM, Hajibabaei M (2018) Over 2.5 million COI sequences in GenBank and growing. PLOS ONE 13(9): e0200177. https://doi.org/10.1371/journal.pone.0200177

3. Biodiversity needs DSI: we have to fill in the map


4. We are students of history:

we expect a horse trade

2010: Nagoya & Aichi

2020: DSI & post-2020 Framework


Crash course on DSI infrastructure

Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures

The INSDC is the core infrastructure for NSD (DSI)

~$50 USD mil./year -Free to all users -No registration


99.9% of NSD databases depend on INSDC

The rest use INSDC unique id’s

95% directly link to or download NSD from the INSDC

99.9% of public NSD databases rely on the INSDC


Half of INSDC is out of geographical scope

52% of NSD comes from 4 countries (3 free access, China unclear)


~37% of INSDC is out of material scope


Key lessons learned from CBD database study

Companies download

entire INSDC

monthly

43% no country tag

Beyond INSDC: ~5x more users (>50 million)


WiLDSI goals: a new DSI ABS system should be....

1. Compatible with free, open access INSDC

2. Integrated and NOT a stand-alone system (e.g., blockchain)

3. Administratively nimble or invisible for scientists

4. Ideally compatible with other international fora

5. Income-generating without explicit public sector funds

6. Acknowledge the demands of the developing world

7. Stop being „DSI“ and become something else


If the solution has to be bilateral….. (A) Nagoya plus

???


(A) Nagoya plus

ABS-CH

IRCC or Country tag

?

?

?

? ?

?


Key components of (A) Nagoya plus

1. DSI Handling: stable, verifiable, online objects that can be linked via ABS-CH • IRCCs with standardized terms & conditions • Alternative: Country tags linked to BS instructions • Other forms of PIC/MAT invalid for DSI Party forfeits BS

2. Benefit sharing: Bilateral, Nagoya-like


(B) Country Tag


Country tag

(B) Country Tag

New use policy Open + click Can use policy extend

here too?


How could a click work?


INSDC use policy has changed little since 2002

1. …uniform policy of free and unrestricted access to all of the data records their databases contain.

2. The INSD will not attach statements to records that restrict access to the data, limit the use of the information in these records, or prohibit certain types of publications based on these records. Specifically, no use restrictions or licensing requirements will be included in any sequence data records...

3. All database records submitted to the INSD will remain permanently accessible as part of the scientific record...

4. ..information displayed on the Web sites maintained by the INSD is fully disclosed to the public…

Science 298 (5597): 1333 15 Nov 2002 http://www.insdc.org/policy.html


Key components of (B) Country Tag

1. Country tag becomes mandatory during submission • INSDC curates, needs additional funding

2. INSDC use policy would change • Benefit sharing obligations for commercial use • Annual contribution • Acknowledged through „click“ acceptance

3. Open access remains 4. Distribution of funds proportional to country tag in

database


(C) De-coupled


(C) De-coupled

For legal certainty,

contribute here!


Key components of (C) De-coupled

1. All non-human (biodiversity-based) DSI is in • No tracing, tracking, scoping necessary • Easily used by other international fora

2. Because no tracing necessary, monetary BS triggered at market entry

3. No change from INSDC required 4. BS mechanism is voluntary but provides legal certainty

• NP already creates obligations. Voluntary mechanism provides certainty.

5. Fund distribution based on application (like GEF)


Add-on options

1. Extend MLS to physical GR • Especially publicly availalable GR in ex situ collections

2. Needs-based targeting: INSDC mirror sites?

• Learn from the CGIAR model

3. Alternative to country-tag could be a single data tag (like PAT)


Additional monetary mechanisms compatible with open access

1. Innovative finance:

• Micro-levy (on sequencing machines?) (e.g. UNITAID)

• Certification scheme (voluntary) (e.g., RED label)

• PPP with grants, loans, equity investment (e.g. GAVI)

2. Sector-dependent royalties (patent pools, CHs)

3. Open-access publishing fee


WiLDSI Steering Committee

Dr. Carmen Richerzhagen DLR/DIE

Dr. Amber H. Scholz DSMZ

Prof. Dr. Esther van Zimmeren Uni Antwerp

Dr. Jens Freitag IPK Gaterseleben Dr. Guy Cochrane

EMBL-EBI

Prof. Dr. Claudia Seitz Uni Bonn

Thomas Greiber BfN

Dr. Jean Carlos Rodriguez DIE Fabian Rohden

DSMZ (former) Dr. Upneet Hillebrand

DSMZ

Torsten Thiele IASS

Marliese von den Driesch BLE

Legal expertise

Financial expertise

Regulatory expertise (external advisors)

Database expertise

Development expertise Scientific expertise


Thank you! [email protected]

Dr. Hilke Marie Püschner

Prof. Dr. Jörg Overmann


Quantifying non-monetary benefits


NSD usage by international scientists

4 target countries for interviews (36 so far) • Colombia (10), South Africa (11), Brazil (10), India (5)

Results: • Everyone generates sequence data • Have knowledge on origin of the material • All rely on sequencing; “very critical” for their work • NSD is submitted to INSDC before publication

Requirement Accession Number • Databases used: Genbank, ENA (INSDC), JGI, iBOL, TAIR, MtGEA • NSD shared with others • Common condition: co-authorship


There are 10-15 million total users of INSDC. They live in every country in the world.

Costs: $3-5 per user 50% of users live in countries that do not contribute to NSD infrastructure costs ~$25 Mil.


These countries use more DSI than they provide


Strategy suggestion: Integrate DSI and its importance for

biodiversity into the post-2020 Framework


Hot of the press: Post-2020 goals overlook genetic diversity


Timeline

• Research (6 months) • Sept: Discuss ideas, assign sub-contracts • Nov: Integrate results • Feb: finalize scenarios

• Scientific community input (4 months) • Jan. 21-22: German scientific stakeholder workshop • March 10-11: EU scientific stakeholder workshop • April (TBD): follow-up stakeholder workshop

• Socialize ideas (6 months) • March: release project summary report • April: Science Policy Forum article submitted (for July) • May-July: SBI, OEWG3 Side events


Identify regulations/ authorities

ABS clearing house

ABS case No

Yes

other permits

Research & Development

Yes No

Permits

Reporting

Project

Identify regulations/ authorities

PIC MAT

MTAs

Sampling

Procedure to comply with CBD and NP

Overmann and Scholz. Trends in Microbiology. Volume 25, ISSUE 2, 2017


DSI Scenarios we eliminated


Pop quiz: What does this mean? AACCGTCTACGGCCCGATCTCCCTGCACCCTGGCCCCACCCTTCCAAATGCGGCATATCCAGT

A separate database for CBD stuff? No! A complete dataset is needed to understand new biodiversity!

Sikorski, Overmann. BioSpektrum. July 2017.

Coverage

100

75

50

25

0

Prop

ortio

n of

unk

now

n or

hyp

othe

tical

gen

es (%

)

high

Median: 2527 Species/Phylum

low

Median: 12 Species/Phylum

none

4 Phyla (P, A, F, B)

29 Phyla (R) 85 Phyla


Blockchain or external tracing system? The existing data infrastucture could not be used

„A bitcoin outside of blockchain is worthless, a sequence outside of blockchain is still a sequence.“

wildsi 3 open access dsi scenarios - dsmz.de...leibniz-institut • dsmz-deutsche sammlung von...

Documents