wm1000 – new mill for massive logs! - wood-mizer · through the fedex prp program, due to ups...
TRANSCRIPT
8180 W. 10th StreetIndianapolis , IN 46214
ALSO IN THIS ISSUE:• Ohio Valley Veneer• ReSharp news• Resaw Sales Event ends August 31
Come see your favorite equipment in action at our 17,000 square foot showroom located in Indianapolis. Call us for details.
• An Edger Pays for Itself in Both Time
Saved and Money Earned
SPECIAL FEATURE – WM1000• New mill for MASSIVE logs• Goby Walnut runs the WM1000• WM1000 showcased at Ligna
Wood-Mizer has released the new industrial-grade WM1000. Developed both to break down up to 67” diameter logs and to saw high value logs where the thin-kerf blade and wide cutting ensures maximum resale value.
Jim Evans, Owner of Far West Forest Products in California has been running a WM1000 for several months and said, “The WM1000 is what all of us cutting big logs, one piece doors, wide counter tops, crotches, and burls have been waiting for. This will save our backs, man hours, and valuable lumber – I am truly amazed at how true it cuts with very little waste.”
The new sawmill can be purchased with or without a log bed, and the rails can be extended to any length for cutting multiple or long logs. The ride-a-long control platform and operator console is mounted on the head, allowing the operator to closely observe and control the cutting process. The WM1000 comes standard with Wood-Mizer’s Setworks system, which enables the operator to pre-set the required board thickness. Variable forward and reverse speed allow the operator to adjust cutting speed to suit the size and species being cut.
The WM1000 uses 2”-3” wide thin-kerf blades to reduce waste and maximize recovery. Hydraulic blade tensioning ensures accurate cutting with a smooth fi nish, whether the user is halving, quartering, or producing slabs for further processing.
Art Blumenkron, owner of Goby Walnut and Western Hardwoods, located in Portland, Oregon, recently installed a WM1000 and commented: “Our fi nish on the slabs is much better than [our previous mill] and we yield an extra slab on every log… We also plan to use the WM1000 for a large re-saw and for parting out logs to be cut on our smaller sawmill.”
WM1000 – New mill for MASSIVE logs!
Our entire line is designed to reduce capital costs, labor costs, material costs, energy costs, and maintenance costs, while producing lumber with amazing effectiveness.
• Sawmill Systems
• Headrigs
• Resaws
• Edgers
• Transfer Tables
• Conveyors
• Log Decks
WoodmizerIndustrial.com
Throat capacity Width (distance between rollers) 67" (1700 mm)Height above the blade 39" (980 mm) Power Options 460 V, 3 phase power requirement 50 HP (37 kW) Electric 30 HP (22 kW) Electric
Head Drive Power Feed 1.5 HP (1.1 kW) ElectricHead up/down 1 HP (0.75 kW) ElectricBlade Guide motors 2x 1/3 HP (0.25 kW) Electric Material Parameters Minimum log diameter 12" (300 mm)Maximum log diameter 67" (1700 mm) Maximum log length Unlimited, based on rail lengthMinimum cut width 8" (200 mm)Maximum cut width 67" (1700 mm)Minimum cut height 4" (100 mm)Maximum cut height 67" (1700 mm)* Bed confi guration will affect material parameters.
Starting Price $54,495
Specifi cations
To learn more about Goby Walnut and Western Hardwoods’ experience with the WM1000, see the next page.
Scan this QR code with your smartphone to watch
a video on the WM1000.
800.553.01822
Equipment Extra
A Word from Goby Walnut and Western Hardwoods on the WM1000After running the new WM1000, Art Blumenkron said, “We recently cut a 15’ long, 48” diameter walnut log and were amazed to fi nd that the thickness of the slabs didn’t vary by more than 1/32” over the whole 15’. Our fi nish on the slabs is much better than [our previous sawmill], and we yield an extra slab on every log. Another consideration is time…it takes only 5 minutes to complete a cut on a large slab... the WM1000 is quiet enough to hold a conversation while cutting and is rock solid. We also plan to use the WM1000 for a large re-saw and for parting out logs to be cut on our smaller sawmill.” Goby is a 35-year-old company that special-izes in salvaging dead and dying trees from around the Northwest and Northern California. Trees come from residential property, forests, golf courses, and farms. Black walnut trees, which can be particularly large in Oregon, are the primary target, though the company also processes maple, oak and elm trees.
WM1000 at LignaThe WM1000 recently was showcased at the prestigious Ligna equipment expo in Hannover, Germany.
Wood-Mizer is now offering ReSharp shipping return labels through the FedEx PRP program, due to UPS discontinu-ing the ARS shipping label services. If you still have ARS labels, you can use those until December 31, 2011. After
that, you will either need to use the FedEx PRP labels that Wood-Mizer will now be shipping, or you can go online to
UPS and print your own RS label.
Another way ReSharp is working to save you money is offering a 10% discount on all Auto Replace blades.* That’s right! When you have a blade that cannot be
sharpened and are on auto replace program, you will receive a 10% discount on that replacement blade.
Call for more detals.
With FedEx PRP, ReSharp is just around the corner
Available in U.S. only
800.244.4600re-sharp.com
Owner Art Blumenkron bought the company from founder Gary Goby in 2007. He subsequently moved the operation from Albany to Portland and has built Goby into a prosperous business that specializes in large slabs of hardwood used to make high end furniture, musical instruments, gunstocks and more.
NEW!Use FedEx
labels to return
your blades for
sharpening
WoodmizerIndustrial.com 3
In 2005, Ed Robbins, owner of Ohio Valley Veneer was auctioning off a mill and downsizing, until he hit upon what he calls the key to turning a struggling mill into a “profi t center”.
After 6 years of struggling, he was ready to try anything that would help his Piketon, Ohio facility become profi table. He put the circle mill up for auction and made a decision to install a Wood-Mizer LT300 (now the WM3000) thin-kerf headrig. Ed’s lead sawyer Walt Vanhoy had this to say, “I thought he was joking… I had always run the big mills, and I didn’t think it would work.”
But with a thin-kerf headrig installed at the Piketon mill, exclusively sawing high-grade walnut logs, margins increased and profi tability returned. Ed’s electric bill dropped to less than a third of what he had been paying. Being able to produce more product from fewer logs
cut down on trucking costs and increased the profi t per log. And the thin-kerf blades were much cheaper to replace and sharpen than his old circular blade.
“As soon as I bought the Wood-Mizer, it’s been a profi t center ever since. There’s a spot for the
Wood-Mizer [head-rig]. And that is sawing that high dollar product, where you’re giving up a little volume, but you’re making it up with your margins.”
So what does Walt, Ed’s lead sawyer think about his employer’s “crazy” decision now? He now says, “This is what’s got us through the reces-sion. …We were making lumber and making money when everyone else was shutting down. For sawing the high dollar lumber, in my opinion, these mills are the only way to go.”
Ed Robbins now has a total of three Wood-Mizer headrigs and plans on continuing to invest in
thin-kerf sawmills as he expands his business into sawing African mahogany and walnut. His advice to his sons, who want to get started in this business, is, “I tell them I’d put in a WM3000 feeding a band resaw. You’ll be effi cient, your overhead’s going to be down... To me, that is a perfect setup, especially in this market.”
Customer Corner
Ohio Valley VeneerStruggling sawmill fi nds key to success
800.522.5760 WoodmizerBlades.com
• Extensive fl ex life allowing multiple sharpenings
• Largest selection of widths, thicknesses and profi les
• Custom lengths to fi t all brands of thin-kerf sawmills
• Ideal for resawing applications
• Quality cut and high feed rates
• Computerized set for accuracy
• Consistent grind
• Stellite® Tip Technology
• Longer run times• Withstands
multiple sharpening
• Saws abrasive and exotic wood
PROF
IL
E GROUND TOOTHPROF
IL
E GROUND TOOTH
Top Quality Blades with Precision Ground Technology Available in 13°, 10°, 9°, 7°, and 4°.
Resaw AdRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRReeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeessssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssaa
FIFIFIFFIFIFIFFFF NANANANANANANANANANNAN L LLL L LLL MOMOMOMOMOMOMOMOMOMOMM NTNTNTNTNTNTNTNTNTNTNNTN H H H H H HH HHHH TOTOTOTOTOTOTOTOTOTOT S S S S SSSS SSSAVAVAVAVAVAVAVAVAVVA E!E!E!E!E!EE!E!E!E! O O O OOO OOOOFFFFFFFFFFFFFFFFFFFFFFERERREREREREREREERERER E E EEE EENDNDNDNDNDNDNDNDNNDNDDS S S SS SSS AUAUAUAUAUAUAUAUAAUGUGUGUGUGUGUGUUG STSTSTSTSSTSTSTSTSTST 3 3 33 33331.1.1.1.1.1.1.1
HR1000 with six heads
ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
Shown with optional merry-go-round.
800.553.0182WoodmizerIndustrial.com
See it in action!In this video, Ed Robbins shares his story and shows us his operation. You can watch the video on our website or by scanning the code with your smartphone. Let Ed share his experiences with you!
RESAWSALES EVENT FULL LINE AVAILABLE CALL FOR DETAILS
800.553.01822
Equipment Extra
A Word from Goby Walnut and Western Hardwoods on the WM1000After running the new WM1000, Art Blumenkron said, “We recently cut a 15’ long, 48” diameter walnut log and were amazed to fi nd that the thickness of the slabs didn’t vary by more than 1/32” over the whole 15’. Our fi nish on the slabs is much better than [our previous sawmill], and we yield an extra slab on every log. Another consideration is time…it takes only 5 minutes to complete a cut on a large slab... the WM1000 is quiet enough to hold a conversation while cutting and is rock solid. We also plan to use the WM1000 for a large re-saw and for parting out logs to be cut on our smaller sawmill.” Goby is a 35-year-old company that special-izes in salvaging dead and dying trees from around the Northwest and Northern California. Trees come from residential property, forests, golf courses, and farms. Black walnut trees, which can be particularly large in Oregon, are the primary target, though the company also processes maple, oak and elm trees.
WM1000 at LignaThe WM1000 recently was showcased at the prestigious Ligna equipment expo in Hannover, Germany.
Wood-Mizer is now offering ReSharp shipping return labels through the FedEx PRP program, due to UPS discontinu-ing the ARS shipping label services. If you still have ARS labels, you can use those until December 31, 2011. After
that, you will either need to use the FedEx PRP labels that Wood-Mizer will now be shipping, or you can go online to
UPS and print your own RS label.
Another way ReSharp is working to save you money is offering a 10% discount on all Auto Replace blades.* That’s right! When you have a blade that cannot be
sharpened and are on auto replace program, you will receive a 10% discount on that replacement blade.
Call for more detals.
With FedEx PRP, ReSharp is just around the corner
Available in U.S. only
800.244.4600re-sharp.com
Owner Art Blumenkron bought the company from founder Gary Goby in 2007. He subsequently moved the operation from Albany to Portland and has built Goby into a prosperous business that specializes in large slabs of hardwood used to make high end furniture, musical instruments, gunstocks and more.
NEW!Use FedEx
labels to return
your blades for
sharpening
WoodmizerIndustrial.com 3
In 2005, Ed Robbins, owner of Ohio Valley Veneer was auctioning off a mill and downsizing, until he hit upon what he calls the key to turning a struggling mill into a “profi t center”.
After 6 years of struggling, he was ready to try anything that would help his Piketon, Ohio facility become profi table. He put the circle mill up for auction and made a decision to install a Wood-Mizer LT300 (now the WM3000) thin-kerf headrig. Ed’s lead sawyer Walt Vanhoy had this to say, “I thought he was joking… I had always run the big mills, and I didn’t think it would work.”
But with a thin-kerf headrig installed at the Piketon mill, exclusively sawing high-grade walnut logs, margins increased and profi tability returned. Ed’s electric bill dropped to less than a third of what he had been paying. Being able to produce more product from fewer logs
cut down on trucking costs and increased the profi t per log. And the thin-kerf blades were much cheaper to replace and sharpen than his old circular blade.
“As soon as I bought the Wood-Mizer, it’s been a profi t center ever since. There’s a spot for the
Wood-Mizer [head-rig]. And that is sawing that high dollar product, where you’re giving up a little volume, but you’re making it up with your margins.”
So what does Walt, Ed’s lead sawyer think about his employer’s “crazy” decision now? He now says, “This is what’s got us through the reces-sion. …We were making lumber and making money when everyone else was shutting down. For sawing the high dollar lumber, in my opinion, these mills are the only way to go.”
Ed Robbins now has a total of three Wood-Mizer headrigs and plans on continuing to invest in
thin-kerf sawmills as he expands his business into sawing African mahogany and walnut. His advice to his sons, who want to get started in this business, is, “I tell them I’d put in a WM3000 feeding a band resaw. You’ll be effi cient, your overhead’s going to be down... To me, that is a perfect setup, especially in this market.”
Customer Corner
Ohio Valley VeneerStruggling sawmill fi nds key to success
800.522.5760 WoodmizerBlades.com
• Extensive fl ex life allowing multiple sharpenings
• Largest selection of widths, thicknesses and profi les
• Custom lengths to fi t all brands of thin-kerf sawmills
• Ideal for resawing applications
• Quality cut and high feed rates
• Computerized set for accuracy
• Consistent grind
• Stellite® Tip Technology
• Longer run times• Withstands
multiple sharpening
• Saws abrasive and exotic wood
PROF
IL
E GROUND TOOTHPROF
IL
E GROUND TOOTH
Top Quality Blades with Precision Ground Technology Available in 13°, 10°, 9°, 7°, and 4°.
Resaw AdRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRReeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeessssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssaa
FIFIFIFFIFIFIFFFF NANANANANANANANANANNAN L LLL L LLL MOMOMOMOMOMOMOMOMOMOMM NTNTNTNTNTNTNTNTNTNTNNTN H H H H H HH HHHH TOTOTOTOTOTOTOTOTOTOT S S S S SSSS SSSAVAVAVAVAVAVAVAVAVVA E!E!E!E!E!EE!E!E!E! O O O OOO OOOOFFFFFFFFFFFFFFFFFFFFFFERERREREREREREREERERER E E EEE EENDNDNDNDNDNDNDNDNNDNDDS S S SS SSS AUAUAUAUAUAUAUAUAAUGUGUGUGUGUGUGUUG STSTSTSTSSTSTSTSTSTST 3 3 33 33331.1.1.1.1.1.1.1
HR1000 with six heads
ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
Shown with optional merry-go-round.
800.553.0182WoodmizerIndustrial.com
See it in action!In this video, Ed Robbins shares his story and shows us his operation. You can watch the video on our website or by scanning the code with your smartphone. Let Ed share his experiences with you!
RESAWSALES EVENT FULL LINE AVAILABLE CALL FOR DETAILS
8180 W. 10th StreetIndianapolis , IN 46214
ALSO IN THIS ISSUE:• Ohio Valley Veneer• ReSharp news• Resaw Sales Event ends August 31
Come see your favorite equipment in action at our 17,000 square foot showroom located in Indianapolis. Call us for details.
• An Edger Pays for Itself in Both Time
Saved and Money Earned
SPECIAL FEATURE – WM1000• New mill for MASSIVE logs• Goby Walnut runs the WM1000• WM1000 showcased at Ligna
Wood-Mizer has released the new industrial-grade WM1000. Developed both to break down up to 67” diameter logs and to saw high value logs where the thin-kerf blade and wide cutting ensures maximum resale value.
Jim Evans, Owner of Far West Forest Products in California has been running a WM1000 for several months and said, “The WM1000 is what all of us cutting big logs, one piece doors, wide counter tops, crotches, and burls have been waiting for. This will save our backs, man hours, and valuable lumber – I am truly amazed at how true it cuts with very little waste.”
The new sawmill can be purchased with or without a log bed, and the rails can be extended to any length for cutting multiple or long logs. The ride-a-long control platform and operator console is mounted on the head, allowing the operator to closely observe and control the cutting process. The WM1000 comes standard with Wood-Mizer’s Setworks system, which enables the operator to pre-set the required board thickness. Variable forward and reverse speed allow the operator to adjust cutting speed to suit the size and species being cut.
The WM1000 uses 2”-3” wide thin-kerf blades to reduce waste and maximize recovery. Hydraulic blade tensioning ensures accurate cutting with a smooth fi nish, whether the user is halving, quartering, or producing slabs for further processing.
Art Blumenkron, owner of Goby Walnut and Western Hardwoods, located in Portland, Oregon, recently installed a WM1000 and commented: “Our fi nish on the slabs is much better than [our previous mill] and we yield an extra slab on every log… We also plan to use the WM1000 for a large re-saw and for parting out logs to be cut on our smaller sawmill.”
WM1000 – New mill for MASSIVE logs!
Our entire line is designed to reduce capital costs, labor costs, material costs, energy costs, and maintenance costs, while producing lumber with amazing effectiveness.
• Sawmill Systems
• Headrigs
• Resaws
• Edgers
• Transfer Tables
• Conveyors
• Log Decks
WoodmizerIndustrial.com
Throat capacity Width (distance between rollers) 67" (1700 mm)Height above the blade 39" (980 mm) Power Options 460 V, 3 phase power requirement 50 HP (37 kW) Electric 30 HP (22 kW) Electric
Head Drive Power Feed 1.5 HP (1.1 kW) ElectricHead up/down 1 HP (0.75 kW) ElectricBlade Guide motors 2x 1/3 HP (0.25 kW) Electric Material Parameters Minimum log diameter 12" (300 mm)Maximum log diameter 67" (1700 mm) Maximum log length Unlimited, based on rail lengthMinimum cut width 8" (200 mm)Maximum cut width 67" (1700 mm)Minimum cut height 4" (100 mm)Maximum cut height 67" (1700 mm)* Bed confi guration will affect material parameters.
Starting Price $54,495
Specifi cations
To learn more about Goby Walnut and Western Hardwoods’ experience with the WM1000, see the next page.
Scan this QR code with your smartphone to watch
a video on the WM1000.