5′-terminal nucleotide sequence of the messenger rna coding for bovine corticotropin/β-lipotropin...

Eur. J . Biochem. 113. 531-539 (1981) FEBS 1981

5’-Terrninal Nucleotide Sequence of the Messenger RNA Coding for Bovine CorticotropinlP-Lipotropin Precursor

Akira INOUE, Masahiro NAKAMURA, Shigetada NAKANISHI, Soh HIDAKA, Kin-ichiro MIURA, and Shosaku NUMA

Department of Medical Chemistry, Kyoto University Faculty of Medicine, and National Institute of Genetics

(Received August 11, 1980)

The complete 5’-terminal nucleotide sequence of the mRNA coding for the bovine common precursor of corticotropin and P-lipotropin has been determined. The 5’-32P-labelled, 21-nucleotides- long, single-stranded DNA fragment complementary to a portion of the 5’-noncoding region of the mRNA was prepared from a cDNA clone and elongated by reverse transcriptase reaction with the mRNA as template. The DNA transcript formed was sequenced by the procedure of Maxam and Gilbert, and the resultant sequence was cross-checked by two-dimensional electrophoretic analysis of the partial alkaline digest of the 5’-32P-labelled mRNA. The 5‘-terminal nucleotide residue was determined by two-dimensional thin-layer chromatography of the complete hydrolysis product of the 5’-32P-labelled mRNA. The nucleotide sequence determined, which partially overlaps the known sequence of the cloned cDNA, reveals the complete 5‘-terminal sequence of the mRNA. This, in conjunction with our previous data, defines the complete primary structure of the mRNA. The mRNA is composed of 1098 nucleotides, including an unusually long 5‘-noncoding sequence of 128 nucleotides. The presence of a ‘cap’ structure at the 5‘ terminus of the mRNA is suggested. The 5’-terminal 48 nucleotide residues of the mRNA are extremely purine-rich, having an A + G content of 83 x, whereas all pyrimidine-rich segments are located downstream from there. Because the 5‘-noncoding region of the mRNA contains three segments of potential secondary structure which partially overlap, it can exist in a number of alternative base-pairing configurations. However, its interaction with the 3’-terminal segment of 18-S rRNA at the site of maximal complementarity would fix the mRNA configuration in such a way as to bring the possible site of ribosome binding near the initiation codon.

The common precursor of the pituitary hormones corticotropin and P-lipotropin and its gene provide an attractive system for investigating the structure, evolution and regulation of hormonally controlled eukaryotic genes. Initial studies by our group with the use of a cell-free protein-synthesizing system have revealed that bovine pituitary mRNA encodes a large translation product containing the sequences of both corticotropin and fl-lipotropin [l, 21. These hormones themselves are known to include several smaller bio-

.~

Ahhreviutions. pAm, 2‘-O-methyladenosine 5‘-phosphate; pm6A, N6-methyladenosine 5’-phosphate; pm6Am, N6-methyl-2’- O-methyladenosine 5‘-phosphate; pm’G, 7-methylguanosine 5’- phosphate.

Enzymes (IUB Recommendations 1978). Endodeoxyribonucle- ase PstI (EC 3.1.23.31): endodeoxyribonuclease Hue111 (EC 3.1.23.1 7); endodeoxyribonuclease HpaII (EC 3.1.23.24); alkaline phosphatase or orthophosphoric-monoester phosphohydrolase (alkaline optimum) (EC 3.1.3.1); polynucleotide 5’-hydroxylLkinase or ATP : 5’-dephosphopolynucleotide 5’-phosphotransferase (EC 2.7.1.78); reverse transcriptase (EC 2.7.7.-); ribonuclease T2 (EC 3.1.27.1); Penicillium citrium nuclease P1 (EC 3.1.30.1).

logically active peptides, such as r-melanotropin, corticotropin-like intermediate lobe peptide, p-melanotropin and P-endorphin [3 - 61. A similar corticotropin/fl-lipotropin precursor has been demonstrated in cultured mouse pituitary tumor cells by Mains et al. [7,8] and by Roberts and Herbert [9]. We then isolated the mRNA coding for the bovine corticotropin/ P-lipotropin precursor in homogeneous form [lo] and constructed bacterial plasmids containing a nucleotide sequence complementary to the mRNA [ 1 1 1. Sequence analysis of the cloned cDNA defined the precise locations of corticotropin and P-lipotropin in the precursor protein and deduced the amino acid sequence of its remaining portion [12]. The proposed location of the translational initiation site was verified by determining the partial amino acid sequence of the amino-terminal region of the cell-free translation product encoded by the mRNA [13]. Thus, the corticotropinlp-lipotropin precursor molecule has been shown to be composed of three repetitive units, each containing a melanotropin sequence, and a signal

532 S’-Terminal Sequence of Corticotropin,’B-Lipotropin Precursor mRNA

peptide characteristic of secretory proteins. Each of the repetitive units, as well as their component peptides, is separated from one another by a pair of basic amino acid residues. This structure of the precursor protein implies that the various peptides contained in it are produced by proteolytic processing. In addition, the presence of an unusually large number of repeated nucleotide sequences in the corticotropinlb-lipotropin precursor mRNA suggests that the structural gene for the precursor protein has evolved by a series of genetic duplications [12]. Worthy of note is also our finding that the cellular level of the corticotropin/j- lipotropin precursor mRNA is depressed by gluco- corticoids, which probably act on the gene for this precursor via the glucocorticoid receptor [14,15].

Although the whole protein-coding sequence of the CorticotropinlP-lipotropin precursor mRNA, together with a portion of the 5’-noncoding sequence and the whole 3’-noncoding sequence, was determined, it seemed likely that some 5’-terminal nucleotide residues in the 5‘-noncoding region were not included in the cloned cDNA. The nucleotide sequence of the 5‘-noncoding region is important because it may contain possible recognition and binding sites for ribo- somes and initiation factors as well as signals for processing and modification of the mRNA, such as its cleavage from the precursor and ‘capping’. Further- more, the complete sequence of this region is required for identifying the structure of the gene. In the present investigation, therefore, we have analyzed the DNA sequence complementary to the 5’-terminal region of the bovine corticotropinlp-lipotropin precursor mRNA, as well as the S’-terminal sequence of the mRNA itself, to complete the knowledge of the primary structure of the mRNA.

MATERIALS AND METHODS

Preparation of Palj(Aj-Containing R N A

RNA was prepared from membrane-bound polysomes derived from neurointermediate lobes of bovine pituitaries, and poly(A)-containing RNA was isolated by oligo(dT)-cellulose chromatography as described previously [I] .

Synthesis and Sequelicing of 5’-32P-Labelled D N A Complcnzentur>~ to the 5’- Terminal Region of the mRNA

The primer used for the reverse transcription reaction was the antimessage strand of the fragment derived from the plasmid pSNAC20 between the restriction sites for HarIII and HpaII, i.e. residues -473 to -454, as described in the legend to Fig. 1. pSNAC20 was constructed by inserting the double- stranded cDNA for the bovine corticotropinlp-lipotropin precursor, synthesized in vitro, into the PstI cleavage site of the plasmid pBR322 with the use of

poly(dG) . poly(dC) homopolymeric extensions [l 11. Approximately 75 yg pSNAC20 DNA was digested with PstI and then with HpuII. The digested DNA was electrophoresed on 8.3 7; polyacrylamide slab gel in order to isolate a mixture of the PstI(-533)- HpaII(-454) fragment and the HpaII(-49) - HpII ( 3.5) fragment. The DNA extracted from the gel was 5’-end- labelled with 32P and then cleaved with HueIII. The cleavage products were electrophoresed on 7 M urea/ 20% polyacrylamide slab gel for isolation of the 5’-32P-labelled, 21-nucleotides-long antimessage strand of the HaeIII(-473) - HpaII(-454) fragment used as the primer for cDNA synthesis; this strand was clearly separated from the 19-nucleotides-long message strand. Reverse transcriptase reaction was carried out with 1.5 x lo6 counts/min of the primer DNA, 10 pg poly(A)-containing pituitary RNA as template and 55 units avian myeloblastosis virus reverse transcriptase in a total volume of 50 pl as described by Buell et al. [16]. The 5’-32P-labelled single-stranded cDNA formed was isolated by electrophoresis on 7 M urea/20 polyacrylamide slab gel. Sequence analysis of this cDNA was conducted by the method of Maxam and Gilbert [17]. The procedures used for cleavage with endodeoxyribonucleases, polyacrylamide slab gel electrophoresis, extraction from gel and 5’-end labelling of DNA were as described previously [12].

Prepurution and Analysis of the 5’-32P-Lahelled m R N A

Approximately 16 pg poly(A)-containing pituitary RNA was subjected to periodate oxidation, followed by treatment with aniline for j-elimination, according to the procedure described by Miura et al. [18]; the reaction mixture was scaled down 250-fold. The ‘decapped’ RNA was treated with bacterial alkaline phosphatase for 30 min as described previously [12]. The dephosphorylated RNA was subjected to 7 M urea/4 % polyacrylamide slab gel electrophoresis in order to purify the corticotropinlp-lipotropin precursor mRNA; prior to electrophoresis, the sample dis- solved in a loading solution containing 5 mM Tris/ borate buffer pH 8.3, 11 mM EDTA, 7 M urea, 0.1 7; xylene cyanol and 0.1 bromophenol blue was incu- bated at 50 ‘C for 5 min, and the electrophoresis buffer used was 0.1 M Tris/borate buffer pH 8.3 containing 2 mM EDTA. After the dye xylene cyanol reached the bottom of the gel, RNA bands were visualized by staining with ethidium bromide. A major RNA band (mobility relative to xylene cyanol, approximately 0.2), which migrated somewhat faster than the 18-S rRNA contained in the sample, was extracted from the gel as described by Forget et al. [19]. The purified mRNA was 5’-end-labelled with 32P by the polynucleotide 5‘-hydroxyl-kinase reaction carried out for 13 min according to the procedure of Donis-Keller el al. [20]. The labelled mRNA was purified once again by elec-

A. Inoue, M. Nakamura, S. Nakanishi, S. Hidaka, K. Miura, and S. Numa 533

Pst I HaeIII HpaII -506 -473 -454 -393

G C-kS * % 1:: 1:s T ~

-A CCG- ~

Fig. 1. Schematic representation of the priming site for reverse trunscriptase reaction. The solid lines represent the message (upper line) and the antimessage strand (lower line) of the corticotropinlp-lipotropin precursor cDNA inserted in the plasmid pSNAC20, the dashed lines the DNA sequence of the vector plasmid pBR322, and the wavy lines the poly(dG) . poly(dC) tail of 27 base pairs (including the last dG . dC pair in the PstI site). Nucleotide residues are numbered in the direction from 5' to 3' in the message strand, beginning with the first residue in the coding region for corticotropin, and the nucleotides on the 5' side of residue 1 are indicated by negative numbers [12]. Restriction sites are identified by numbers indicating the 5'-terminal nucleotide generated by cleavage. The primer used for reverse transcriptase reaction is underlined. The ATG corresponding to the initiation codon is boxed. Hyphens representing the phosphodiester bonds and 'd' representing deoxy have been omitted to save space

trophoresis as described above. The purified 5'-j2P- labelled mRNA was subjected to partial alkaline hydrolysis as described by Donis-Keller et al. [20] and then analyzed by two-dimensional polyacrylamide slab gel electrophoresis according to the method of Lockard et al. [21]. Complete enzymatic or alkaline hydrolysis of the mRNA and two-dimensional thin- layer chromatography of the hydrolysates on cellulose plates were performed as described by Miura et al. WI. Reagents

Reagents were obtained as follows : [ Y - ~ ~ P ] A T P (5500 Ci/mmol) from New England Nuclear (Boston, USA), glass-backed thin-layer cellulose plates (Avicel SF) from Funakoshi Pharmaceutical Co. (Tokyo, Japan), endodeoxyribonucleases PstI and HpaII from Boehringer (Mannheim, FRG), ribonuclease TZ from Sankyo Chemical Co. (Tokyo, Japan), Penicillium citrium nuclease PI from Yamasa Shoyu Co. (Tokyo, Japan), bacterial alkaline phosphatase from Worthing- ton Biochemical Corporation (Freehold, USA), and T4 polynucleotide 5'-hydroxyl-kinase from P-L Bio- chemicals (Milwaukee, USA). Avian myeloblastosis virus reverse transcriptase was kindly provided by Dr S. W. Beard, endodeoxyribonuclease Hue111 by Professor M. Takanami, pm7G by Dr M. Hattori, and pm6A and pm6Am by Professor M. Ikehara and Dr T. Fukui. Oligo(dT)-cellulose was prepared essen- tially as described by Gilham 1221.

De fernzina lions

Concentrations of DNA and RNA were determined by assuming the value of A: ;: at 254 nm to be 250 113. The radioactivity of 32P was determined in a toluene-based scintillator solution with a liquid scin- tillation spectrometer [l].

RESULTS

Sequence Analysis of 5'-32P-Labelled D N A Complementary to the 5'-Terminal Region of the m R N A

Single-stranded DNA complementary to the 5'-terminal region of the bovine corticotropinlb-lipotropin

precursor mRNA was synthesized with reverse transcriptase. The location of the priming site for this reaction is schematically represented in Fig. 1. The 5'-32P- labelled, 21 -nucleotides-long antimessage strand of the HaeIII-HpaII fragment was prepared from the recombinant plasmid pSNAC20 and used as the primer. The cDNA synthesized was analyzed by urea/ polyacrylamide gel electrophoresis as shown in Fig. 2. A single transcription product with a mobility corresponding to the size of approximately 69 nucleotides was observed (lane a). This product was not formed in the absence of either reverse transcriptase (lane b) or the template mRNA (lane c). These results indicate that the primer DNA used was homogeneous and that the correct priming occurred in the cDNA synthesis. Because the length of the antimessage strand between the HpaII cleavage site used and the 5' end of the cDNA inserted in pSNAC20 is 54 nucleotides (see Fig. l), the length of the reverse transcript formed suggests that approximately 15 nucleotides corresponding to the 5'-terminal sequence of the mRNA are missing in the cDNA clone.

The 5'-32P-labelled transcript of the 5'-terminal region of the mRNA was prepared on a large scale, isolated by electrophoresis and sequenced according to the procedure of Maxam and Gilbert [17]. Fig.3 shows the autoradiogram of the electrophoresis gel that exhibits the cDNA sequence corresponding to the 5'-terminal sequence of the mRNA. The data revealed a sequence that coincided precisely with that of the antimessage strand of the cDNA clone extending from residue -483 to residue -506 (end of the cDNA insert) 1121 (see Fig.1). In addition, a sequence of 14 nucleotide residues that were not included in the cDNA clone were observed. This sequence represents a cDNA extension corresponding to the 5'-terminal sequence of the mRNA. It was difficult, however, to obtain information about the last nucleotide(s) (corresponding to the 5' terminus of the mRNA) from this sequencing gel.

Sequence Analysis of the 5'-32P-Labelled m R N A Because eukaryotic mRNAs are known to contain

a 5' 'cap' structure [24], it must be removed prior to labelling of their 5' terminus with 32P. Poly(A)-con-

534 S'-Terminal Sequence of Corticotropinib-Lipotropin Precursor m R N A

Origin -

76 -

67 -

21 -

Fig. 2. Au1orcuiio~gt'~riii o/ ure" po~jwI'y/uniidi, gel electrophoresis of 5'-32P-lcihelled Dh'A c~ot?.iplivnc~ntary to the 5'-terminal region of the mRNA. Reverse transcriptasereaction wascarried out with 1.5 x lo4 coun1s:min of the 5'-3zP-labelled primer DNA, 0.25 pg poly(A)- containing pituitary RNA and 1.4 units reverse transcriptase in a total volume of 2.5 p1 (a). Control incubations without reverse transcriptaae (b) or without template RNA (c) were performed. Each sample. ah well ;IS the untreated primer (d), was electrophoresed on 7 M urea!2Oo0 polyacrylamide slab gel. The HpaII cleavage products of pSNAC20 DNA [12,23] were used as external markers; the positions of the fragment of 67 nucleotides and that of 76 nucleotides, as well aa of the untreated primer (21 nucleotides), are indicated

taining R N A isolated from the membrane-bound polysomes of bovine pituitary neurointermediate lobes was 'decapped' by oxidation of the RNA with periodate, followed by /l-elimination with aniline, and was then treated with alkaline phosphatase. The 5'-dephosphorylated R N A was subjected to urea/polyacrylamide gel electrophoresis in order to isolate the cor- ticotropinlP-lipotropin precursor mRNA. The mRNA extracted from the gel was labelled with 32P at its 5' end. Fig. 4 represents the electrophoretic analysis of the labelled mKNA. A single radioactive band was observed together with minor bands which appar- ently represented partial degradation products (lane a).

dG d A ) dG d T + d C dC

Fig 3 Autoradmgram of requente u n u l i ~ i r 01 .i -'ZP-ltihelled DIVA tomplementary 10 the 5'-rermnial legion of dic i i iRNA The 5 -32P- labelled cDNA was subjected to four sets of chemical redclion d G = dG-specific cleavage, dA > d G = cleavage at dA more than dG, dT i- dC = cleavage at dT and dC, d C = dC-specific cleavage, each sample was electrophoresed on 7 M urea120 'lo polyauyhmide gel The nucleotide sequence derived IS Shown

In a control experiment where the mRNA was subjected to the same procedure except that the prior removal of the 'cap' structure was omitted, no detectable amount of 32P was incorporated into the mRNA (lane b). These results suggest that the 5' terminus of the corticotropinlfl-lipotropin precursor mRNA is blocked by a 'cap' structure.

The 5'-32P-labelled corticotropinlfl-lipotropin precursor mRNA was prepared on a large scale and purified by electrophoresis. The labelled mRNA was subjected to partial alkaline digestion and then analyzed by two-dimensional urea/polyacrylamide gel electrophoresis. The autoradiogram of this gel, together with

A. Inoue, M. Nakamura, S. Nakanishi, S. Hidaka, K . Miura, and S. Numa 535

Origin -

18-S -

xc - a b

Fig. 4. Aurorudiogruni of ureu,polycmc.~~lu~ii~e gel elertroplioresis of the 5’-32P-lubelled mRNA. Approximately 16 pg poly(A)-containing pituitary RNA was ‘decapped’, treated with alkaline phosphatase and subjected to 7 M urea/4 7; polyacrylamide gel electrophoresis. An aliquot of the purified mRNA (approximately 25 ng) was labelled with 32P at its 5’ end in a total volume of 10 pl and then electrophoresed again as described above (a). A control experiment was carried out in the same manner, except that the ‘decapping’ procedure was omitted (b). 18-S rRNA and xylene cyanol (XC) were used as external markers

the derived sequence, is shown in Fig. 5. This method distinguishes mobility shifts due to A or C from shifts due to G or U. The data obtained are in complete agreement with the sequence derived from the cDNA analysis (see Fig.3), except that the presence of one additional nucleotide residue was disclosed by the RNA sequencing. Thus, the 5‘ terminus of the mRNA is located at residue -521 (for the numbering of nucleotide residues, see the legend to Fig. 1). Furthermore, this terminal residue was identified as A or C by com- parison with the terminal residue G of the marker RNA used. It proved useful to include an internal marker because the terminal few residues of the unknown sample were clearly identified in this manner.

The experiments represented in Fig. 6 were de- signed to determine the 5’-terminal nucleotide residue of the mRNA by two-dimensional thin-layer chromatography on cellulose plates. The purified 5’-32P- labelled mRNA was digested to completion with ribonuclease T2 (Fig. 6A), alkali (Fig. 6 B) or nuclease PI (Fig. 6C) and then chromatographed with authentic

A -

A -

G-

A - ,.

- G

U -

U -

A - ;T A ~~ G A ’

G G

Fig. 5. Autorucl‘iogrrmm of the purtiul ulkaline digest of tlie 5’-J2P- labelled m R N A analyzed by two-dimensional polyacrylamide gel electrophoresis. The purified 5‘-”P-labeIled mRNA (3.4 x lo4 countslmin) was subjected to partial alkaline hydrolysis. The rcsulting product was electrophoresed in the first dimension (1) on 10 polyacrylamide slab gel at pH 3.5 and in the second dimension (2) on 20 % polyacrylamide slab gel at pH 8.3. The partial alkaline digest of the 5’-32P-labelled RNA segment 4 of cucumber mosaic virus (CMV, strain 0) with a known nucleotide sequence (S. Hidaka, K. Miura, Y. Takanami, and S. Kubo, unpublished results) was used as an internal marker. The nucleotide sequence derived (left), together with the sequence of the marker (right), is shown. For the unknown sample, distinction between A and C or between G and U was made on the basis of the cDNA sequence given in Fig. 3 and of the analysis of the S’-terminaI residue shown in Fig.6

standards. Ribonuclease T2 or alkali treatment gave rise to a principal radioactive spot co-migrating with pAp. Several faint radioactive spots, three of which corresponded to pGp, p u p and pCp, respectively, were also observed. On the other hand, nuclease PI treatment yielded a major radioactive spot co-migrating with PA, together with several faint spots, four of which corresponded to pG, pU, pC and pAm, respectively. Furthermore, no labelled spot corresponding to pm6A or pm6Am was detectable after nuclease PI

536

A

C

5'-Terminal Sequence of Corticotropinlj-Lipotropin Precursor mRNA

B

D I

prn'Am

0 @m'A

1

T pG PGP

P"

0 PUP

Fig. 6 . Aurorrrtlio,qrntrz of ' ihr c,onplere izpdroluvsis pruducf (I / ' die 5'-3zP-lrihcllcrl rriRIYA unuljized h,v /i~o-dinzrtz.sioiiti/ rhin-kiwr c~hromaiugraphy on cellulosr plrtc,,,. The purified 5'-'*P-labelled m R N A (1.7 x lo3 counts/min each) was completely hydrolyzed with ribonuclease Tz (A). 0.3 M KOI-1 (€3) or nuclease PI (C). The solvent system used for the first dimension (1) was isobutyric acid/0.5 M N H l O H ( 5 : 3 , by vol.), and that used for the second dimension (2) was isopropanol/h M HCI (7: 3 , by vol.): ( x ) origin. The dotted circles indicate the locations of ultraviolet-ab~orbing internal markers: (A) pA, pG, pU, pC, pAp, pGp, p u p and pCp; (B) pAp, pGp, p u p and pCp; (C) PA. pC, pU, pC. pAm. pmhA and pmhAm. The locations of authentic standards chromatographed in the same system are indicated by solid circles (D)

digestion. I t i > concluded from these results that the 5'-terminal re5idue of the mRNA is an A. The appear- ance of the faint radioactive spots corresponding to G, U and C i \ probably due to partial degradation of the mRNA (5ee Fig.4, lane a), although a possible microheterogeneity of the 5' terminus of the mRNA, as reported for some other mRNA species [25], cannot be excluded.

DISClJ SSION

The results described in the present paper, in conjunction with our previous data [12], have defined the complete primary structure of the mRNA coding for the bovine corticotropinlll-lipotropin precursor. A number of features of this mRNA can be noted. The mRNA is 1098 nucleotides long, including the S'-noncoding region with 128 nucleotides, coding region with 795 nucleotides and 3'-noncoding region with 175 nucleotides, excluding the poly(A) sequence with an average length of 68 nucleotides [lo]. Furthermore,

the presence of a 'cap' structure at the 5' terminus of the mRNA is suggested. The nucleotide sequence of the 5'-noncoding region of the mRNA is presented in Fig.7. It is considerably long. as compared with the 5'-noncoding sequences of most of the other eukaryotic mRNAs studied: human, rabbit and mouse x globin, 32 - 37 nucleotides [26 - 281 ; human, rabbit and mouse a globin, 50 - 53 nucleotides [26,28 - 301 ; chicken ovalbumin, 64 nucleotides [31] ; chicken con- albumin, 76 nucleotides [32] ; mouse immunoglobulin light chain (iII), 36 nucleotides [25,33]; human preproinsulin, 59 nucleotides [34] ; rat preproinsulin I and 11, 57 nucleotides [ 3 5 ] ; silk fibroin, 67 nucleotides [36]. As pointed out previously [12], the mRNA has a high G + C content (65 x) (5'-noncoding region, 66%; coding region, 67 %; 3'-noncoding region excluding the poly(A) sequence, 56':,;), which exceeds that of total bovine DNA (3973 [37]. The S'-noncoding region of the mRNA has a remarkably low U content (7.8 "/,). The 5'-terminal portion (residues -521 to -474) is extremely purine-rich ( A + G contcnt,


-520 - 5 1 0 - 5 0 0 -490 -480 -470 -460

J~Cap”-AAGACGGCGCGACGGAAGAGAACGAAGGGAAGAAAAGUGACCGAGAGGC~UGAACAUCCUCGCCCCGG

- 4 5 0 -440 -430 -420 -41 0 -400

C G C A G C G G G A G C C G C C C G A G G C A G C U U C C C C G U G A C A G A G C ~ U C A G C ~ U G G A A G ~ -I -

Fig. 7. Nucleotide sequence of the 5’-noncoding region of the hovine corticotropinlp-lipotropin precursor rnRNA. For the numbering of nucleotide residues, see the legend to Fig. 1. The initiation codon is boxed. Sequences that exhibit complementarity to the 3’-terminal sequence of 18-S rRNA are underlined. Hyphens representing the phosphodiester bonds between residues have been omitted to save space

A G G G A

C.G

A C

U.G.C

G' Ct-440

- -AAAG.C.G

I C A . U

C .G.C I G . C . G G.C A . U

A C . G . C t - 4 0 0

A . U G.C G . C C C

G.C U.G C U U .A

C A C C G C C U

- 4 7 0 4 A C CC -41 0 U A C C

-420 G G

G p G U A

A A

B G G G A

C.G G Ct -440

A C - 4 5 0 u c ’ G cG.C

G.C G.C C.G

C A

C

L

G G G A

- 4 2 0 -410 -400 J. J.

C.G -480 C . G

- A A A G U G A ~ G A G . CG . ~ A G C U U C C C C G U G A C A G A G C & C A G C C U G C C U G G A A ~ - A . U

G . C c u

C A G C

U A G

G . C -430

- 4 7 0 - t C A

D G G G A

C.G C . G G . C t - 4 4 0 --AAAG .CAG .CCGCC. GAAG@E!--

A C U.G 1‘ GC.G

G.C - 4 8 0 4 . G G.C G.C G . C - 4 3 0 4 . G

A . U G . C

c c U . G

c u A . U G.C U . A

G C C C G.C C U

C .G AG.C -440 A . U - 4 5 0 7 G . C C . G G ’ C t - 4 0 0

- 4 fO

I C --AAAGUGACCGAG.CGCCCC . GA . U G G A A G m - 4: A . U + - 4 6 0 G ’ C + - 4 0 0 G . C G . C G . C - 4 3 0 - t C . G G

C A G.C A ’ U t - 4 6 0 C C

- 4 7 0 W A U.G G . C C C t -41 0 U A U . A c u c C

G c c C A G G c u G C U A

C C t - 4 1 0 - 4 7 0 + C A G G C C U A A A

- 4 2 0 - G G G C U A

G G A A

C Fig. 8. Alternurive secondury structures of the 5’-noncoding region of the mRNA. (A) Segments of potential secondary structure; (B) configuration with the maximally extended second ‘stem and loop’ structure; (C) intermediate configuration; (D) configuration with the maximally extended first and third ‘stem and loop’ structures. Base-pairing is indicated by points but hyphens representing phosphodiester bonds between residues have been omitted. The AG value for the formation of each configuration is - 102.8 kJ/mol (B), - 97.0 kJ/ mol (C) or - 93.6 kJ/mol (D). For further details, see the legend to Fig. 7

83 %), whereas all pyrimidine-rich segments are located downstream from residue -474.

As shown in Fig. 8 A, the 5’-noncoding sequence of the mRNA exhibits three segments of potential

secondary structure which partially overlap. The first potential ‘stem and loop’ structure involves nucleotide residues -485 to -449, the second structure residues -458 to -430, and the third structure residues -436 to

s3x S'-Terminal Sequence of Coriicotropin/b-Lipotropin Precursor inRNA

G G G A

C . G G . C t - 4 4 0

-480 -470 -460 A C

G . C t -400 G.C

A . U -430+C.G

G.C c c

U.G U . A

L L c II

C - C t - 4 1 0 C C

-420 +G G U

G t* A A

L

Fig. 9. Secoiidcir! srrucrure of the 5'-tionroding rexion cd' the m R N A induced by its inrrr~ic,iion M'iili ihe 3'-terminal segment of 18-S r R N A . The thick arrow indicates the site of RNA splicing. For further details. hec the legend to Fig. 7 and Fig. 8

-397. Residues -458 to -449 can take part in the formation of either the first or the second stem, while residues -436 to -430 can participate in the formation of either the second or the third stem. The AG values for the formation of the first, second and third potential 'stem and loop' structures, calculated separately by using the base-pairing rules of Tinoco et al. [38], are - 48.5 kJ/mol. - 88.6 kJ/mol and - 45.1 kJ/mol, respectively. Thus, these secondary structures are ex- pected to be thermodynamically stable. Because the segments of potential secondary structure partially overlap, the 5'-noncoding region of the mRNA can exist in a number of alternative base-pairing configurations. If the second 'stem and loop' structure were maximally extended, the first structure would be short- ened, and the third structure would vanish (Fig. 8 B). If the first and the third 'stem and loop' structure were maximally extended. on the other hand, the second structure would be very short (Fig. 8 D). Several intermediate configurations, an example of which is presented in Fig.8C, can be formed between the two extreme ones. These configurations can shift to one another without a considerable thermodynamic barrier because the AG values for their formation range from - 92 to - 109 kJ/mol.

It is known that the sequence (3'-5')A-U-U-A-C- U-A-G-G-A-A-G-G-C-G-U-C-C present at the 3' end of 18-S rRNA is conserved in eukaryotes and ex- hi bits complementarity to a pyrimidine-rich sequence present in the 5'-noncoding region of most of the eukaryotic mRNAs studied 1391. The structure of the 5'-noncoding region of the corticotropinlb-lipotropin precursor mRNA reveals a number of possible se-

quences of such complementarity ; for example, residues -473 to -470, -469 to -452, -451 to -447, -447 to -443, -440 to -433, -427 to -423 and -405 to -400 (see Fig.7). It is to be noted that all possible sites of mRNA-rRNA interaction are located in relative proximity to the initiation codon AUG. Fig. 9 shows the base-pairing configuration of the 5'-noncoding region of the mRNA that would be formed if it inter- acted with the 3'-terminal segment of 18-S rRNA at the site of maximal complementarity. This configuration is thermodynamically favored ; the AG value for the formation of the two 'stem and loop' structures is - 57.7 kJ/mol and that for the mRNA-rRNA interaction is - 71.9 kJ/mol. Thus, the mRNA configuration would be fixed in such a way as to bring the possible site of ribosome binding near the initiation codon AUG. It seems attractive to speculate that this configuration is involved in the initiation of protein synthesis. If this were the case, it would be possible to regulate the rate of translation by affecting the mRNA configuration. An analogous shift between alternative RNA configurations has been reported to be associated with the regulation of transcription termination at the attenuators of the various operons of enteric bacteria [40-431. Another fact worthy of note is that an RNA splicing point is positioned between residues -41 3 and -414 [44]. Thus, the splicing is necessary for the formation of the RNA configuration considered to be required for translational initiation.

This investigation was supported in part by research grants from the Ministry of Education, Science and Culture of Japan, the Mitsubishi Foundation and the Japanese Foundation of Metab- olism and Diseases.

REFERENCES

1. Nakanishi, S., Taii, S., Hirata, Y., Matsukura. S., imura, H. & Numa, S. (1976) Proc. Nut1 Acud. Sc,i. U S A , 73, 4319- 4323.

2. Nakanishi, S., Inoue. A,, Taii, S. & Numa, S. (1977) F'EBS Lett. 84, 105- 109.

3. Scott, A. P., Ratcliffe, J. G., Rees, L. H.. Landon, J . , Bennett, H. P. J., Lowry, P. J. & McMartin, C. (1973) Nar. Ne~i . B id . 244, 65 - 67.

4. Li, C. H. & Chung, D. (1976) Pror. Nut[ Amd. Sci. GSA, 73.

5. Ling, N., Burgus, R. & Guillemin, R. (1976) Proc. Nurl Accid. Sci. USA, 73,3942 - 3946.

6. Chrt-tien, M., Seidah, G., Benjannet, S., Dragon, N., Routhier, R., Motomatsu, T., Crine, P. & Lis, M. (1977) Ann. N . Y. Acud. Sci. 297, 84- 107.

7. Mains, R . E. & Eipper, B. A. (1976) J. Bid. C/wn. .?.5I,

8. Mains, R. I:., Eipper, B. A. & Ling, N . (1977) Proc. Narl

9. Roberts, J. L. & Herbert, E. (1977) Proc. Nurl Acatl. Sci.

10. Kita, T., Inoue, A., Nakanishi, S. & Numa. S. (1979) ELK, J .

1145- 1148.

41 15 -4120.

Acad. Sci. USA, 74, 3014-3018.

USA, 74, 5300- 5304.

Biocliem. Y3, 213-220.


11. Nakanishi, S., Inoue, A,, Kita, T., Numa, S., Chang, A. C. Y., Cohen, S. N., Nunberg, J. & Schimke, R. T. (1978) Proc. Nut1 Acud. Sci. USA, 75, 6021 -6025.

12. Nakanishi, S., Inoue, A,, Kita, T., Nakamura, M., Chang, A. C. Y., Cohen, S. N. & Numd, S. (1979) Nature (Lond.) 278, 423 -427.

13. Nakamura, M., lnoue, A,, Nakanishi, S. & Numa, S. (1979) FEBS Lett. 105, 357- 359.

14. Nakanishi, S., Kita, T., Taii, S., Imura, H. & Numa, S . (1977) Proc. Nutl Acad. Sci. USA, 74, 3283-3286.

15. Nakamura, M., Nakanishi, S., SUeOkd, S. , Imura, 11. & Numa, S. (1978) Eur. J . Biochem. 86, 61 -66.

16. Buell, G. N., Wickens, M. P., Payvar, F. & Schimke, R. T. (1978) J. Biol. Cliem. 253, 2471 -2482.

17. Maxam, A. M. & Gilbert, W. (1977) Proc. Nut1 Acad. Sci.

18. Miura, K., Wdtanabe, K. & Sugiura, M. (1974) J . Mol. Biol.

19. Forget, B. G., Housman, D., Benz, E. J., Jr & McCaffrey, R. P. (1975) Proc. Nutl Acad. Sci. USA, 72, 984-988.

20. Donis-Keller, H., Maxam, A. M. & Gilbert, W. (1977) Nucleic Acids Res. 4, 2527-2538.

21. Lockard, R. E., Alzner-Deweerd, B., Heckman, J. E., Mac- Gee, J.. Tabor, M. W. & RajBhandary, U. L. (1978) Nucleic Acids Res. 5, 31 - 56.

USA, 74, 560 - 564.

86, 31 -48.

22. Gilham, P. T. (1964) J . Am. Cliem. Soc. 86, 4982-4985. 23. Sutcliffe, J. G. (1978) Cold Spring Harbor Symp. Quant. Biol.

24. Shatkin, A. J . (1976) Cell, Y, 645-653. 25. Baker, C. C., Herisse, .I., Courtois, G., Galibert, F. & Ziff, E.

26. Baralle, F. E. (1977) Cell, 12, 1085- 1095. 27. Baralle, F. E. (1977) Nuture (Lond.) 267, 279-281.

43, 77-90.

(1979) Cell, 18, 569-580.

28. Baralle, F. E. & Brownlee, G . G. (1978) Nature (Lond.) 274,

29. Baralle, F. E. (1977) Cell, 10, 549-5558, 30. Efstratiadis, A., Kafatos, F. C. & Maniatis, T. (1977) Cell, 10,

31. McReynolds, L., O’Malley, B. W., Nisbet, A. D., Fothergill, J. E., Givol, D., Fields, S., Robertson, M. & Brownlee, G . G. (1978) Nature (Lond.) 273, 723-7728,

32. Cochet, M., Gannon, F., Hen, R., Maroteaux, L., Perrin, F. & Chambon, P. (1979) Nature (Lond.) 282, 567-574.

33. Tonegawa, S., Maxam, A. M., Tizard, R., Bernard, 0. & Gil- bert, W. (1978) Proc. Natl Acad. Sci. USA, 75, 1485- 1489.

34. Bell, G. I . , Pictet, R. L., Rutter, W. J., Cordell, B., Tischer, E. & Goodman, H. M. (1980) Nuture (Lond.) 284, 26-32.

35. Lomedico, P., Rosenthal, N., Efstratiadis, A,, Gilbert, W., Kolodner, R. & Tizard, R. (1979) Cell, 18, 545-558.

36. Tsujimoto, Y. & Suzuki, Y. (1979) Cell, 18, 591 -600. 37. Szybalski, W. (1968) Methods Enzymol. 12B, 330-360. 38. Tinoco, I. , Borer, P. N., Dengler, B., Levine, M. D., Uhlen-

beck, 0. C., Crothers, D. M. & Gralla, J. (1973) Nut. New Biol. 246, 40-41.

39. Hagenbuchle, O., Santer, M. & Steitz, J. A. (1978) Ce/l, 13,

40. Lee, F. & Yanofsky, C. (1977) Proc. Nutl Acad. Sci. USA, 74,

41. Oxender, D. L., Zurawski, G. & Yanofsky. C. (1979) Proc.

42. Keller, E. B. & Calvo, J. M. (3979) Proc. Natl Acud. Sci. USA,

43. Johnston, H. M., Barnes, W. M., Chumley, F. G., Bossi, L. & Roth, J. R. (1980) Proc. Nut1 Acad. Sci. USA, 77, 508-512.

44. Nakanishi, S., Teranishi, Y., Noda, M., Notake, M., Wata- nabe, Y., Kakidani, H., Jingami, H. & Numa, S. (1980) Nature (Lond.) 287, 752-755.

84-87.

571 - 585.

551 -563.

4365 - 4369,

Natl Acad. Sci. USA, 76, 5524-5528.

76, 6186-6190.

A. Inoue, M. Nakamura, S. Nakanishi, and S. Numa. Department of Medical Chemistry, Kyoto University Faculty of Medicine, Yoshida, Sakyo-ku, Kyoto-shi, Kyoto-fu, Japan 606

S. Hidaka and K. Miura, National Institute of Genetics, Yata 111 1, Mishima, Shizuoka-ken, Japan 41 1

5′-terminal nucleotide sequence of the messenger rna coding for bovine corticotropin/β-lipotropin...

Documents