dr. sunita grover
Post on 04-Jun-2018
264 Views
Preview:
TRANSCRIPT
-
8/13/2019 Dr. Sunita Grover
1/34
Efficacy of Indian Probiotic Culturesfficacy of Indian Probiotic CulturesSunita Grover, Ph.DMolecular Biology Unit
Dairy Microbiology Divisionairy Microbiology DivisionNational Dairy Research Institute
-
8/13/2019 Dr. Sunita Grover
2/34
Outline of presentationutline of presentation Probiotics entr in India
Status of probiotics at global level Need for Indigenous probiotics
o e o po en a omar ers or screen ngand selection of potential strains
Initiative for Develo in Indi enousProbiotics of Indian origin at NDRI, Karnal(DBT)
Perspective Conclusion
20.2.2009 2ILSI-India
-
8/13/2019 Dr. Sunita Grover
3/34
Probiotics the New Nutraceutical Starsd knter in Indian Market An old concept, with a new attitude
global market
- Dairy based probiotic foods / drinks (>
50%)
Probiotics gaining a foothold in India
20.2.2009 3ILSI-India
-
8/13/2019 Dr. Sunita Grover
4/34
Status of probiotic cultures at Global leveltatus of probiotic cultures at Global level L. rhamnosus GG (Valio)
L. caseiShirota (Yakult)
L. plantarum 299v (Probi AB) L. johnsoniiLa7 (Nestle)
.
L. acidophilus NCFM (Nestle)
L. caseistrain DN-114001 (Danisco) .
L. rhamnosus 271 (Probi AB)
L. casei (Chr Hansen)
L. acido hilus La1
VSL#3 (4 Lactobacillus spp.; 4 Bifidobacterium spp. and onestreptococcus) (CD Pharma)
20.2.2009 4ILSI-India
-
8/13/2019 Dr. Sunita Grover
5/34
Efficacy / Prospects of probiotic strainsfficacy / Prospects of probiotic strains Widely studied strains world wide
c en ca y proven pro o cs
Clinical trials conducted for their efficacy However, results are debatable
Several factors are known to
influence this benefit
Timing of probiotic delivery
Prophylactic, empiric or therapeutic
Specific strain of bacteria
Various secreted components can modulate activityQuantity of bacteria
Method of administration
20.2.2009 5ILSI-India
-
8/13/2019 Dr. Sunita Grover
6/34
Major Issues for use in Indian populationf p p Data in Indian population lacking ?
Poor adhesion /colonization and shorttransit period in the Indian gut due toeren gu eco ogy an oo a s
Conditioning effect critical for
Non-availability of established / Novel
functions to demonstrate their efficacy
20.2.2009 6ILSI-India
-
8/13/2019 Dr. Sunita Grover
7/34
Why Need for Indigenous probiotics ?y N f g p Better colonization / adhesion potential
onger rans me
Health promoting functions of probiotics highlystrain and host s ecific
High incidences of diarrhoeal diseases and other
gastric disorders in Infants and immuno-
Probiotics as potential Immuno-modulators Healthy guts
n an pro o c s ra ns m g e e er su e oIndian gut due to longer transit time, colonization /biofilm formations and conditioning effect
20.2.2009 7ILSI-India
-
8/13/2019 Dr. Sunita Grover
8/34
Initiative for Developing Indigenous Probioticsf di i i N l T)f Indian origin at NDRI, Karnal DBT) More than one hundred cultures of indigenous
Lactobacilli of human origin isolated and studied fore r pro o c a r u es an co on za on po en a s
Tested for a battery of in vitro tests for culture shorts ng
Selection of promising cultures based on strong
colonization and in vitro probiotic attributes
20.2.2009 8ILSI-India
-
8/13/2019 Dr. Sunita Grover
9/34
Selection of promising cultures based on in vitroprobiotic attributesrobiotic attributes
H 1.5 pH 2.0
Bile 1.5% Bile 2.0%
20.2.2009 9ILSI-India
-
8/13/2019 Dr. Sunita Grover
10/34
PepsinLysozyme
2
4
6
8
10
cellcount(log
cfu/ml)
0
0h 8.585 8.301 8.9201 8.7447 8.5965 8.672 8.2218
1h 8.0412 8.4471 8.7626 8.231 8.2304 7.4471 8.284
Lp
5276Lp9 Lp72 Lp75 Lp77 Lp91 Ldch4
Cell surface hydrophobicity Anti-oxidant
20.2.2009 10ILSI-India
-
8/13/2019 Dr. Sunita Grover
11/34
Adhesion of Lactobacilli 109 cfu/ml for 2 hrs) to humanadenocarcinomal cell linesdenocarcinomal cell lines
Caco2 cell line:
HT-29 cell line:
L. plantarum(Lp91)L. plantarum(Lp5276)L. plantarum(LpVS)
L. plantarum(Lp91)
L. plantarum(LpVS)
L. plantarum(Lp5276)
20.2.2009 11ILSI-India
-
8/13/2019 Dr. Sunita Grover
12/34
Role of Biomarkers for selection of probioticsole of Biomarkers for selection of probiotics Selection of a proven probiotic strain extremely
crucial for application in clinical trials and product
Potential biomarkers need to be developed forscreenin and selection of robiotic strains
-
8/13/2019 Dr. Sunita Grover
13/34
Expression of bacterial and host genes during transition inGIT of human that can be used as potential biomarkers forfunctionalityMUC 2
functionality
Probiotics atp operonroEL
-
IL-10
IL-4 bsh gene
groES
dnaK
hsp70Surface proteins of bacteria
Ma A
IL-6
Cox1
-
sp
urvA
dps
Msr
Mub
CnBp
Fbp
TNF-
-
Human epithelial cells
Small intestine
-
dlt operon
eps operon
IL-1
IL-2
IL-8
Digestive system
Cox2
20.2.2009 13ILSI-India
-
8/13/2019 Dr. Sunita Grover
14/34
Quantification of BSH activity by modified ninhydrin assay6
ivity
l) P
-
8/13/2019 Dr. Sunita Grover
15/34
Anti-Hypercholesterolemic effect of Lp-91
Duration of treatment:- 21 days
Lp91 Lp21
TC 17.2 9.1
)
Total Cholesterol Triglyceride HDL LDL
. .
LDL 35.5 13.5HDL 47.8 14.4
80
100
120
le(m
g/dL
Diet without Lp-91P
-
8/13/2019 Dr. Sunita Grover
16/34
-
8/13/2019 Dr. Sunita Grover
17/34
20.2.2009 17ILSI-India
-
8/13/2019 Dr. Sunita Grover
18/34
Cell surface proteins as probiotic markersf lor colonization Mucus Binding Protein (MBP)
Collagen Binding Protein (CBP)
-
LTA
20.2.2009 18ILSI-India
-
8/13/2019 Dr. Sunita Grover
19/34
M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6M 1 2 3 4 5 6
250 bp
405 bp200bp
100bp250 bp
405 bp200bp
100bpFig. Multiplex PCR with primer pairsLBLMA1 /R-
161 and MubD1_F87/ MubD1_R0.5
p250 bp200bp
400bp
Fig. Multiplex PCR with primer pairsLBLMA1 /R-
161 and MubD1_F87/ MubD1_R0.5
p250 bp200bp
400bp
Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1
/R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;
5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68
Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1
/R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;
5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68
Lanes: M-100 bp marker;
1-2- Genus specific PCR product of Lp9,Lp91
3-4- Mub specific PCR product with primer
MubD1_F87/ MubD1_R0.5 of Lp9,Lp91
5-6-Multiplex PCR with both primer for Lp9,Lp91 .
Lanes: M-100 bp marker;
1-2- Genus specific PCR product of Lp9,Lp91
3-4- Mub specific PCR product with primer
MubD1_F87/ MubD1_R0.5 of Lp9,Lp91
5-6-Multiplex PCR with both primer for Lp9,Lp91 .
M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7PCR Assays405 bp
250 bp200bp
400bp 405 bp250 bp200bp
400bp
PCR Assays
Fig. Multiplex PCR forL. casei , L. acidophilus and
Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and
MubD1_F87/ MubD1_R0.5
- - - -
Fig. Multiplex PCR forL. casei , L. acidophilus and
Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and
MubD1_F87/ MubD1_R0.5
- - - -- - . - . - .
J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12
(Bifidobacerium bifidum)
- - . - . - .
J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12
(Bifidobacerium bifidum)
20.2.2009 19ILSI-India
-
8/13/2019 Dr. Sunita Grover
20/34
M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7
1.6 kb
M 1 2 3 4 5 6 7
1.6 kb500bp
1.5kb
M 1 2 3 4 5 6 7
1.6 kb500bp
1.5kb
1kb1kb
Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161
and MubN_F0.93/ MubN_R165
Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161
and MubN_F0.93/ MubN_R165
F g. Mub P R w th pr mer pa r mubN_F .
MubN_R1.65
Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);
2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20
F g. Mub P R w th pr mer pa r mubN_F .
MubN_R1.65
Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);
2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20
Lanes: M- Supermix DNA ladder;
1-2-(1:0.5 ratio of Genus and Mub primers);
3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);
7- 1kb DNA ladder (Chromous)
Lanes: M- Supermix DNA ladder;
1-2-(1:0.5 ratio of Genus and Mub primers);
3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);
7- 1kb DNA ladder (Chromous)
M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2
1.6 kb
M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2
1.6 kbPCR Assays 250 bp
100bp
500bp
.
250 bp100bp
500bp
.
Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-
161 and MubN_F0.93/ MubN_R165
Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-
Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-
Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-
161 and MubN_F0.93/ MubN_R165
Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-
Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-
- - - -- - - -
20.2.2009 20ILSI-India
-
8/13/2019 Dr. Sunita Grover
21/34
Potential Biomarkers for Selection of Probiotics againstifi dipecific diseases
Probiotics Highly strain and host specific
(Specific health promoting functions)
Inflammatory diseases, IBD, Crohns disease, Ulcerative
colitis consti ation etc.
Gastro-intestinal disease
Cancers colon, bladder etc. ,
Allergies rhinitis
Respiratory tract diseases pneumonia etc.
Liver diseases Hypertension, obesity etc.
20.2.2009 21ILSI-India
-
8/13/2019 Dr. Sunita Grover
22/34
Development of DM2 and CVD throughid i i fl dxidative-inflammatory cascade
20.2.2009 ILSI-India 32
-
8/13/2019 Dr. Sunita Grover
23/34
Evaluation of the evidence - Preclinicalditudies
Too simplistic to mimic human systems Im ortant to screen strain characteristics
Important to understand mechanisms
vivo)
Cannot be used for roof of efficac
Excellent for safety
20.2.2009 23ILSI-India
-
8/13/2019 Dr. Sunita Grover
24/34
Evaluation of the evidence - linical tudiesvaluation of the evidence Human target population RDBPCT :
cornerstone of efficacy in humanstudies
Phase I, II and III
Critical Data analysis
Post market surveillance studies
20.2.2009 24ILSI-India
-
8/13/2019 Dr. Sunita Grover
25/34
Identification of probiotics a pre-requisite
Identification at strain level very important False claims / labeling spurious products
Molecular based identification more reliable at
genus, species and strain level
House keeping genes (rpo, tuf etc.)
Lb. casei (13), Lb. paracasei (4), Lb.fermentum (25), Lb.
plantarum (26), Lb. delbrueckii (2), Lb.rhamnosus(2),Lb.reuteri(4) and Lb. acidophilus (2)
20.2.2009 25ILSI-India
-
8/13/2019 Dr. Sunita Grover
26/34
Nucleotide sequence of unique RAPD band ofLb casei with primer OPBB-02 >OPBB-02
CACTGGCTGGGAAGGCACCGAGTTGTATGTTCAGCTAGTTCCGGAAGGCAAATTTGAAGGTGACACGTTAAATCCGTATTTTCTGATCA
GACATTCTCGCTGAAGATTGGCAACTTGTTGACGCATGATAGCAT
TCGATTTTAGCGGCAAAACGGTTGTTGTGACTGGTGCGGCATCG
GGAATCGGCGCGGCTCAGGCAGCGGCGTTTACAGCAGCTGGTGCACGGGTTATTGGCGTCGATCTTCAGCCGATGACTGGGCTAGCC
GTCACCATTCAGGCAGATGTCAGTAAGGCCGCGACAGCAGAAA
ACATCGTTCGTGACTATGCGCCCGACATTGTCTGCAACACGGCG
AACCTGGCAGCACATTCTTGATGTTGATCTCACCAGCCAGT
>probe1
- -
20.2.2009 26ILSI-India
-
8/13/2019 Dr. Sunita Grover
27/34
Probiotics : Few Questions which remainl dnresolved
Selection of probiotic culture what should be the criteria todefine the most ideal probiotic strain for a specific disease
Monostrain vs multistrain ? Will cell free extracts work ? Quantity and quality of probiotic needed for desired effect ? Which Probiotics remain viable in GI tract ? How long do they remain in the gut to be effective? The best target site in pathogenesis of a particular disease for
Cell lines / cell culture and Animal models Lack of correlation (In vitroversus in vivoassays) e.g. in vitro
evaluation of adhesion using cell lines do not account for complex
Probiotic safety ? Clinical trials on human subjects for validating health benefits
20.2.2009 27ILSI-India
-
8/13/2019 Dr. Sunita Grover
28/34
Points to ponderoints to ponder Probiotic definition or selection criteria should include:
y o genera e an mmune response
In vitro assays to show that probiotics activate immune cells Does in vitro screening based on acid and bile predict in vivo
survival ca acit other stresses like oxidative nutrientlimitation, antimicrobial components etc. might influence?)
Selection of probiotics on the basis of Adhesion potential using
in vitro assays is being debated ? Can not be extrapolated to GIT
Host defense systems
Competition for nutrients and space with commensals
Mucosal shedding
Peristaltic flow that continuously washes GIT Hence, extrapolation of these findings to clinical applicationsrequires caution
20.2.2009 ILSI-india 36
-
8/13/2019 Dr. Sunita Grover
29/34
Current problems with probiotics in Indiaurrent problems with probiotics in India Extravagant claims without research
S ecific s ecies and strain effects
Lack of good manufacturing practices Quality assurance Label vs content
Viability of bacterial species
Validated biomarkers for assessing function and
activit Identification needs to be done using molecular
tools
16S rRNA
FISH No specific guidelines currently
20.2.2009 29ILSI-India
-
8/13/2019 Dr. Sunita Grover
30/34
Desired Interventions from Indianierspective
A comprehensive database on Indian probiotic cultures, their diversity,
disease mitigation need to be generated as a National priority
Indian gut a rich habitat of diversified microbiota (gut ecology - food
by metagenomic approaches
High probability of biodiversity amongst probiotic strains from
Initiatives for mining the complete genome of promising Indian strainsand the functional genes associated with novel physiological function
Search for Novel probiotic strains (Lactobacilli and Bifidobacteria)with specific physiological functions in the gut using comparativegenomics, Transcriptomics, Proteomics approaches etc.
20.2.2009 30ILSI-India
-
8/13/2019 Dr. Sunita Grover
31/34
Contdontd Identification of potential Biomarkers for evaluating functionality of
probiotics because greatest challenge concerns functionality ofrobiotics to stren then health claims robiotics confer on host
health
Development of consortia of proven strains for ethnic dairy based
Biosafety evaluation of selected probiotics and appropriate
validation of health claims through clinical trials in target human
Efforts should be made to conduct clinical trials in Indian populationfor comprehensive evaluation of the efficacy of the Indian probiotic
established western cultures to prove their efficacy
20.2.2009 31ILSI-India
-
8/13/2019 Dr. Sunita Grover
32/34
Time for a paradigm shiftime for a paradigm shift
substrate which enhances a specific
ene c a ac er a ns ea o ry ng
to eliminate the pathogen ?
20.2.2009 32ILSI-India
-
8/13/2019 Dr. Sunita Grover
33/34
Conclusiononclusion Thy Food Shall Be Thy Remedy
Disease can be: Prevented
Mitigated
Treated Appropriate Choice of :
Clinical proven probiotics
We need to continue rigorous evaluation ofassumptions and hypothesis to discover
nove pro o cs
20.2.2009 33ILSI-India
-
8/13/2019 Dr. Sunita Grover
34/34
Acknowledgementcknowledgement ILSI - India
Department of Biotechnology, Govt. of India,
Director, NDRI
Dr. V. K. Batish, Prof. and Head, DM Division
Raj Kumar, Ph.D student a es umar, . s u en
Ashok, SRF
,
20.2.2009 34ILSI-India
top related