dr. sunita grover

Post on 04-Jun-2018

264 Views

Category:

Documents

1 Downloads

Preview:

Click to see full reader

TRANSCRIPT

  • 8/13/2019 Dr. Sunita Grover

    1/34

    Efficacy of Indian Probiotic Culturesfficacy of Indian Probiotic CulturesSunita Grover, Ph.DMolecular Biology Unit

    Dairy Microbiology Divisionairy Microbiology DivisionNational Dairy Research Institute

  • 8/13/2019 Dr. Sunita Grover

    2/34

    Outline of presentationutline of presentation Probiotics entr in India

    Status of probiotics at global level Need for Indigenous probiotics

    o e o po en a omar ers or screen ngand selection of potential strains

    Initiative for Develo in Indi enousProbiotics of Indian origin at NDRI, Karnal(DBT)

    Perspective Conclusion

    20.2.2009 2ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    3/34

    Probiotics the New Nutraceutical Starsd knter in Indian Market An old concept, with a new attitude

    global market

    - Dairy based probiotic foods / drinks (>

    50%)

    Probiotics gaining a foothold in India

    20.2.2009 3ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    4/34

    Status of probiotic cultures at Global leveltatus of probiotic cultures at Global level L. rhamnosus GG (Valio)

    L. caseiShirota (Yakult)

    L. plantarum 299v (Probi AB) L. johnsoniiLa7 (Nestle)

    .

    L. acidophilus NCFM (Nestle)

    L. caseistrain DN-114001 (Danisco) .

    L. rhamnosus 271 (Probi AB)

    L. casei (Chr Hansen)

    L. acido hilus La1

    VSL#3 (4 Lactobacillus spp.; 4 Bifidobacterium spp. and onestreptococcus) (CD Pharma)

    20.2.2009 4ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    5/34

    Efficacy / Prospects of probiotic strainsfficacy / Prospects of probiotic strains Widely studied strains world wide

    c en ca y proven pro o cs

    Clinical trials conducted for their efficacy However, results are debatable

    Several factors are known to

    influence this benefit

    Timing of probiotic delivery

    Prophylactic, empiric or therapeutic

    Specific strain of bacteria

    Various secreted components can modulate activityQuantity of bacteria

    Method of administration

    20.2.2009 5ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    6/34

    Major Issues for use in Indian populationf p p Data in Indian population lacking ?

    Poor adhesion /colonization and shorttransit period in the Indian gut due toeren gu eco ogy an oo a s

    Conditioning effect critical for

    Non-availability of established / Novel

    functions to demonstrate their efficacy

    20.2.2009 6ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    7/34

    Why Need for Indigenous probiotics ?y N f g p Better colonization / adhesion potential

    onger rans me

    Health promoting functions of probiotics highlystrain and host s ecific

    High incidences of diarrhoeal diseases and other

    gastric disorders in Infants and immuno-

    Probiotics as potential Immuno-modulators Healthy guts

    n an pro o c s ra ns m g e e er su e oIndian gut due to longer transit time, colonization /biofilm formations and conditioning effect

    20.2.2009 7ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    8/34

    Initiative for Developing Indigenous Probioticsf di i i N l T)f Indian origin at NDRI, Karnal DBT) More than one hundred cultures of indigenous

    Lactobacilli of human origin isolated and studied fore r pro o c a r u es an co on za on po en a s

    Tested for a battery of in vitro tests for culture shorts ng

    Selection of promising cultures based on strong

    colonization and in vitro probiotic attributes

    20.2.2009 8ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    9/34

    Selection of promising cultures based on in vitroprobiotic attributesrobiotic attributes

    H 1.5 pH 2.0

    Bile 1.5% Bile 2.0%

    20.2.2009 9ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    10/34

    PepsinLysozyme

    2

    4

    6

    8

    10

    cellcount(log

    cfu/ml)

    0

    0h 8.585 8.301 8.9201 8.7447 8.5965 8.672 8.2218

    1h 8.0412 8.4471 8.7626 8.231 8.2304 7.4471 8.284

    Lp

    5276Lp9 Lp72 Lp75 Lp77 Lp91 Ldch4

    Cell surface hydrophobicity Anti-oxidant

    20.2.2009 10ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    11/34

    Adhesion of Lactobacilli 109 cfu/ml for 2 hrs) to humanadenocarcinomal cell linesdenocarcinomal cell lines

    Caco2 cell line:

    HT-29 cell line:

    L. plantarum(Lp91)L. plantarum(Lp5276)L. plantarum(LpVS)

    L. plantarum(Lp91)

    L. plantarum(LpVS)

    L. plantarum(Lp5276)

    20.2.2009 11ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    12/34

    Role of Biomarkers for selection of probioticsole of Biomarkers for selection of probiotics Selection of a proven probiotic strain extremely

    crucial for application in clinical trials and product

    Potential biomarkers need to be developed forscreenin and selection of robiotic strains

  • 8/13/2019 Dr. Sunita Grover

    13/34

    Expression of bacterial and host genes during transition inGIT of human that can be used as potential biomarkers forfunctionalityMUC 2

    functionality

    Probiotics atp operonroEL

    -

    IL-10

    IL-4 bsh gene

    groES

    dnaK

    hsp70Surface proteins of bacteria

    Ma A

    IL-6

    Cox1

    -

    sp

    urvA

    dps

    Msr

    Mub

    CnBp

    Fbp

    TNF-

    -

    Human epithelial cells

    Small intestine

    -

    dlt operon

    eps operon

    IL-1

    IL-2

    IL-8

    Digestive system

    Cox2

    20.2.2009 13ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    14/34

    Quantification of BSH activity by modified ninhydrin assay6

    ivity

    l) P

  • 8/13/2019 Dr. Sunita Grover

    15/34

    Anti-Hypercholesterolemic effect of Lp-91

    Duration of treatment:- 21 days

    Lp91 Lp21

    TC 17.2 9.1

    )

    Total Cholesterol Triglyceride HDL LDL

    . .

    LDL 35.5 13.5HDL 47.8 14.4

    80

    100

    120

    le(m

    g/dL

    Diet without Lp-91P

  • 8/13/2019 Dr. Sunita Grover

    16/34

  • 8/13/2019 Dr. Sunita Grover

    17/34

    20.2.2009 17ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    18/34

    Cell surface proteins as probiotic markersf lor colonization Mucus Binding Protein (MBP)

    Collagen Binding Protein (CBP)

    -

    LTA

    20.2.2009 18ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    19/34

    M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6M 1 2 3 4 5 6

    250 bp

    405 bp200bp

    100bp250 bp

    405 bp200bp

    100bpFig. Multiplex PCR with primer pairsLBLMA1 /R-

    161 and MubD1_F87/ MubD1_R0.5

    p250 bp200bp

    400bp

    Fig. Multiplex PCR with primer pairsLBLMA1 /R-

    161 and MubD1_F87/ MubD1_R0.5

    p250 bp200bp

    400bp

    Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1

    /R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;

    5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68

    Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1

    /R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;

    5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68

    Lanes: M-100 bp marker;

    1-2- Genus specific PCR product of Lp9,Lp91

    3-4- Mub specific PCR product with primer

    MubD1_F87/ MubD1_R0.5 of Lp9,Lp91

    5-6-Multiplex PCR with both primer for Lp9,Lp91 .

    Lanes: M-100 bp marker;

    1-2- Genus specific PCR product of Lp9,Lp91

    3-4- Mub specific PCR product with primer

    MubD1_F87/ MubD1_R0.5 of Lp9,Lp91

    5-6-Multiplex PCR with both primer for Lp9,Lp91 .

    M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7PCR Assays405 bp

    250 bp200bp

    400bp 405 bp250 bp200bp

    400bp

    PCR Assays

    Fig. Multiplex PCR forL. casei , L. acidophilus and

    Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and

    MubD1_F87/ MubD1_R0.5

    - - - -

    Fig. Multiplex PCR forL. casei , L. acidophilus and

    Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and

    MubD1_F87/ MubD1_R0.5

    - - - -- - . - . - .

    J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12

    (Bifidobacerium bifidum)

    - - . - . - .

    J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12

    (Bifidobacerium bifidum)

    20.2.2009 19ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    20/34

    M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7

    1.6 kb

    M 1 2 3 4 5 6 7

    1.6 kb500bp

    1.5kb

    M 1 2 3 4 5 6 7

    1.6 kb500bp

    1.5kb

    1kb1kb

    Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161

    and MubN_F0.93/ MubN_R165

    Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161

    and MubN_F0.93/ MubN_R165

    F g. Mub P R w th pr mer pa r mubN_F .

    MubN_R1.65

    Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);

    2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20

    F g. Mub P R w th pr mer pa r mubN_F .

    MubN_R1.65

    Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);

    2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20

    Lanes: M- Supermix DNA ladder;

    1-2-(1:0.5 ratio of Genus and Mub primers);

    3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);

    7- 1kb DNA ladder (Chromous)

    Lanes: M- Supermix DNA ladder;

    1-2-(1:0.5 ratio of Genus and Mub primers);

    3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);

    7- 1kb DNA ladder (Chromous)

    M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2

    1.6 kb

    M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2

    1.6 kbPCR Assays 250 bp

    100bp

    500bp

    .

    250 bp100bp

    500bp

    .

    Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-

    161 and MubN_F0.93/ MubN_R165

    Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-

    Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-

    Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-

    161 and MubN_F0.93/ MubN_R165

    Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-

    Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-

    - - - -- - - -

    20.2.2009 20ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    21/34

    Potential Biomarkers for Selection of Probiotics againstifi dipecific diseases

    Probiotics Highly strain and host specific

    (Specific health promoting functions)

    Inflammatory diseases, IBD, Crohns disease, Ulcerative

    colitis consti ation etc.

    Gastro-intestinal disease

    Cancers colon, bladder etc. ,

    Allergies rhinitis

    Respiratory tract diseases pneumonia etc.

    Liver diseases Hypertension, obesity etc.

    20.2.2009 21ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    22/34

    Development of DM2 and CVD throughid i i fl dxidative-inflammatory cascade

    20.2.2009 ILSI-India 32

  • 8/13/2019 Dr. Sunita Grover

    23/34

    Evaluation of the evidence - Preclinicalditudies

    Too simplistic to mimic human systems Im ortant to screen strain characteristics

    Important to understand mechanisms

    vivo)

    Cannot be used for roof of efficac

    Excellent for safety

    20.2.2009 23ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    24/34

    Evaluation of the evidence - linical tudiesvaluation of the evidence Human target population RDBPCT :

    cornerstone of efficacy in humanstudies

    Phase I, II and III

    Critical Data analysis

    Post market surveillance studies

    20.2.2009 24ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    25/34

    Identification of probiotics a pre-requisite

    Identification at strain level very important False claims / labeling spurious products

    Molecular based identification more reliable at

    genus, species and strain level

    House keeping genes (rpo, tuf etc.)

    Lb. casei (13), Lb. paracasei (4), Lb.fermentum (25), Lb.

    plantarum (26), Lb. delbrueckii (2), Lb.rhamnosus(2),Lb.reuteri(4) and Lb. acidophilus (2)

    20.2.2009 25ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    26/34

    Nucleotide sequence of unique RAPD band ofLb casei with primer OPBB-02 >OPBB-02

    CACTGGCTGGGAAGGCACCGAGTTGTATGTTCAGCTAGTTCCGGAAGGCAAATTTGAAGGTGACACGTTAAATCCGTATTTTCTGATCA

    GACATTCTCGCTGAAGATTGGCAACTTGTTGACGCATGATAGCAT

    TCGATTTTAGCGGCAAAACGGTTGTTGTGACTGGTGCGGCATCG

    GGAATCGGCGCGGCTCAGGCAGCGGCGTTTACAGCAGCTGGTGCACGGGTTATTGGCGTCGATCTTCAGCCGATGACTGGGCTAGCC

    GTCACCATTCAGGCAGATGTCAGTAAGGCCGCGACAGCAGAAA

    ACATCGTTCGTGACTATGCGCCCGACATTGTCTGCAACACGGCG

    AACCTGGCAGCACATTCTTGATGTTGATCTCACCAGCCAGT

    >probe1

    - -

    20.2.2009 26ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    27/34

    Probiotics : Few Questions which remainl dnresolved

    Selection of probiotic culture what should be the criteria todefine the most ideal probiotic strain for a specific disease

    Monostrain vs multistrain ? Will cell free extracts work ? Quantity and quality of probiotic needed for desired effect ? Which Probiotics remain viable in GI tract ? How long do they remain in the gut to be effective? The best target site in pathogenesis of a particular disease for

    Cell lines / cell culture and Animal models Lack of correlation (In vitroversus in vivoassays) e.g. in vitro

    evaluation of adhesion using cell lines do not account for complex

    Probiotic safety ? Clinical trials on human subjects for validating health benefits

    20.2.2009 27ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    28/34

    Points to ponderoints to ponder Probiotic definition or selection criteria should include:

    y o genera e an mmune response

    In vitro assays to show that probiotics activate immune cells Does in vitro screening based on acid and bile predict in vivo

    survival ca acit other stresses like oxidative nutrientlimitation, antimicrobial components etc. might influence?)

    Selection of probiotics on the basis of Adhesion potential using

    in vitro assays is being debated ? Can not be extrapolated to GIT

    Host defense systems

    Competition for nutrients and space with commensals

    Mucosal shedding

    Peristaltic flow that continuously washes GIT Hence, extrapolation of these findings to clinical applicationsrequires caution

    20.2.2009 ILSI-india 36

  • 8/13/2019 Dr. Sunita Grover

    29/34

    Current problems with probiotics in Indiaurrent problems with probiotics in India Extravagant claims without research

    S ecific s ecies and strain effects

    Lack of good manufacturing practices Quality assurance Label vs content

    Viability of bacterial species

    Validated biomarkers for assessing function and

    activit Identification needs to be done using molecular

    tools

    16S rRNA

    FISH No specific guidelines currently

    20.2.2009 29ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    30/34

    Desired Interventions from Indianierspective

    A comprehensive database on Indian probiotic cultures, their diversity,

    disease mitigation need to be generated as a National priority

    Indian gut a rich habitat of diversified microbiota (gut ecology - food

    by metagenomic approaches

    High probability of biodiversity amongst probiotic strains from

    Initiatives for mining the complete genome of promising Indian strainsand the functional genes associated with novel physiological function

    Search for Novel probiotic strains (Lactobacilli and Bifidobacteria)with specific physiological functions in the gut using comparativegenomics, Transcriptomics, Proteomics approaches etc.

    20.2.2009 30ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    31/34

    Contdontd Identification of potential Biomarkers for evaluating functionality of

    probiotics because greatest challenge concerns functionality ofrobiotics to stren then health claims robiotics confer on host

    health

    Development of consortia of proven strains for ethnic dairy based

    Biosafety evaluation of selected probiotics and appropriate

    validation of health claims through clinical trials in target human

    Efforts should be made to conduct clinical trials in Indian populationfor comprehensive evaluation of the efficacy of the Indian probiotic

    established western cultures to prove their efficacy

    20.2.2009 31ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    32/34

    Time for a paradigm shiftime for a paradigm shift

    substrate which enhances a specific

    ene c a ac er a ns ea o ry ng

    to eliminate the pathogen ?

    20.2.2009 32ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    33/34

    Conclusiononclusion Thy Food Shall Be Thy Remedy

    Disease can be: Prevented

    Mitigated

    Treated Appropriate Choice of :

    Clinical proven probiotics

    We need to continue rigorous evaluation ofassumptions and hypothesis to discover

    nove pro o cs

    20.2.2009 33ILSI-India

  • 8/13/2019 Dr. Sunita Grover

    34/34

    Acknowledgementcknowledgement ILSI - India

    Department of Biotechnology, Govt. of India,

    Director, NDRI

    Dr. V. K. Batish, Prof. and Head, DM Division

    Raj Kumar, Ph.D student a es umar, . s u en

    Ashok, SRF

    ,

    20.2.2009 34ILSI-India

top related