J Clin Periodontol 2000; 27: 763–768 Copyright C Munksgaard 2000Printed in Denmark . All rights reserved

ISSN 0303-6979

Mitsugi Okada, Fumiko Hayashi andNobuo NagasakaDetection of ActinobacillusDepartment of Pediatric Dentistry, HiroshimaUniversity School of Dentistry, Japanactinomycetemcomitans and

Porphyromonas gingivalis indental plaque samples fromchildren 2 to 12 years of ageOkada M, Hayashi F, Nagasaka N: Detection of Actinobacillus actinomycetem-comitans and Porphyromonas gingivalis in dental plaque samples from children 2 to12 years of age. J Clin Periodontol 2000; 27: 763–768. C Munksgaard, 2000.

AbstractThe purpose of this study was to detect the presence of Actinobacillus actinomyce-temcomitans and Porphyromonas gingivalis in plaque samples from 104 children,collected from their toothbrushes using a polymerase chain reaction (PCR). Theage range of all subjects was 2–12 years. 21, 73 and 10 children with healthygingiva, gingivitis and periodontitis respectively were selected. Plaque sampleswere collected from all erupted teeth sites using a sterile toothbrush. The meanconcentration of DNA recovered from brushing plaque samples was approxi-mately 660 mg/ml, which was sufficient for performing a PCR-based survey.Both A. actinomycetemcomitans and P. gingivalis were detected in the primaryand mixed dentition. The prevalence of A. actinomycetemcomitans in healthysubjects was 4.8%, and those with gingivitis and periodontitis was 6.8% and20.0% respectively, while the prevalence of P. gingivalis was 4.8% in healthy

Key words: PCR; toothbrush; dental plaque;subjects, and 9.6% and 20.0% in those with gingivitis and periodontitis, respec- bacterial detection; childrentively. Our survey, using a toothbrush, indicated that A. actinomycetemcomitansand P. gingivalis are rarely present in oral cavities of healthy children. Accepted for publication 19 November 1999

There is increasing evidence indicatingthat Actinobacillus actinomycetem-comitans, Porphyromonas gingivalis,and Prevotella intermedia are stronglyassociated with severe forms of peri-odontal diseases (Slots et al. 1986,Bragd et al. 1987). The prevalence of A.actinomycetemcomitans-infection hasbeen reported to be 20 to 25% amongyoung people in urban areas of the US(Slots et al. 1980, Slots et al. 1988) and13% in young periodontally healthy in-dividuals in Finland (Alaluusua & Asi-kainen 1988). P. gingivalis has beenfound in 80% of healthy childrenstudied, including such age categoriesas prepubescent, circumpubescent, andpostpubertal (Watson et al. 1991). In

another study however, using a culturalmethod, P. gingivalis was not detectedin prepubescent children (Wojcicki et al.1986). Therefore, the extent of A. acti-nomycetemcomitans and P. gingivalisinfection in prepubescent children is notclear.

Detection of a small number ofpathogens is of particular importancein regards to periodontitis that affectsprepubescent children (Watanabe 1990).It is possible that periodontal patho-gens remain in the area of exfoliatingprimary teeth and continue to survivein the gingival sulcus around the per-manent teeth in the mixed dentition. Inthis case, the number of pathogens in aspecific area may be low. However, their

presence would identify a patient as acarrier and at risk of developing peri-odontitis in adolescence (Watanabe &Frommel 1993).

In recent studies, a polymerase chainreaction (PCR) assay has been de-veloped for detecting putative organ-isms (Watanabe 1993, Lin et al. 1994,Meurman et al. 1997). It is quick, rela-tively simple, and able to detect lownumbers of bacterial species. PCR of-fers a highly sensitive and specific detec-tion method for bacteria in biologicalsamples, with detection limits as few as25–100 cells (Slots et al. 1995, Wahlforset al. 1995, Watanabe & Frommel1996). It could be suitable for the detec-tion of periodontal pathogens, as in the

764 Okada et al.

case of children’s subgingival plaquewhere there are a limited number ofpathogens present.

A curette or paper point is generallyused to collect subgingival plaquesamples. In a pediatric dental clinic set-ting, however, it is sometimes difficultto collect plaque samples from youngchildren, as they are typically afraid ofsharp-pointed instruments such asneedles, explorers, curettes or paperpoints. The collection of subgingivalplaque samples from several sites usingthese instruments is also time consum-ing, and may fail to detect some im-portant organisms with the limited gin-gival sites available. Therefore, theplaque sampling method used inchildren requires speed, reliability, whilelimiting anxiety.

Toothbrushing has been a widely ac-cepted method for removal of dentalplaque for many years. It is easy to useand does not cause any anxiety in thechildren. By using a toothbrushingmethod of sampling dental plaque forthe examination of periodontal patho-gens, the consent of parents can easilybe obtained.

The purpose of this study was to de-tect the presence of A. actinomycetem-comitans and P. gingivalis, using PCR,in plaque samples from children takenwith a toothbrush.

Material and Methods

104 children were enrolled the pediatricdental clinic at the Hiroshima Univer-sity Dental Hospital, Hiroshima, Japan.Consent for participation was obtainedfor the children from their mothersprior to the study. Subjects with clin-ically healthy gingiva, as well as thosewith gingivitis and periodontitis, wereclassified as follows. Subjects with anabsence of inflammation, no bleedingon brushing, and no radiographic boneloss were regarded as the clinicallyhealthy gingiva group. Subjects withmild to moderate inflammation and noradiographic bone loss were classifiedas the gingivitis group. Subjects withattachment loss of greater than 3 mmon at least one site of 4 teeth were de-fined as the periodontitis group. Theage range of all subjects was 2–12 years.There were 21 with healthy gingiva, 73who had gingivitis, and 10 who hadperiodontitis. Children with systematicdiseases were not excluded, although nosubjects who had taken antibioticswithin the past 3 months were included.

Plaque sampling

Dental plaque was collected with a ster-ile toothbrush for 1 min from theerupted teeth. The plaque adhering tothe brush was removed several times bywashing in a tube of sterile distilledwater. Thereafter, the plaque samplewas immediately transported to our re-search laboratory and stored at ª20æCbefore the extraction of genomic DNA.

Genomic DNA preparation from culture

A. actinomycetemcomitans ATCC29522and P. gingivalis ATCC33277 were usedas controls. A. actinomycetemcomitanswas grown in Brain Heart Infusionbroth (Difco, Detroit, MI, USA) at37æC in gas-pak jar systems (BBL,Cockeysville, Md, USA) containing10% H2, 5% CO2 and 85% NO2. P. gin-givalis was routinely grown in Todd-Hewitt broth (BBL, Cockeysville, Md,USA) supplemented with 10 mg/ml he-min and 1 mg/ml vitamin K1. The cul-tures were cultivated at 37æC under an-aerobic conditions using an anaerobicglove box (EAN-140, Tabai Spec. Co.,Osaka, Japan) containing an atmos-phere of 5% CO2, 5% H2, and 90% N2

for 48 h.Cells from broth cultures (1.5 to 3

ml) in the logarithmic phase were firstharvested by centrifugation at 1600¿gfor 20 min. The supernatants were dis-carded, and individual cell pellets werestored at ª20æC without additionalpreparation until DNA isolation. Puregenomic DNA from the two strainstested was obtained by a standard mini-prep procedure (Wilson 1990) to whichwe added an RNAase treatment (Smithet al. 1989). Briefly, the pellet waswashed twice with TE buffer (10 mMTris-HCl, pH 7.5, 1 mM EDTA) andthen resuspended in a sterile Eppendorftube containing 567 ml of TE buffer. 30ml of 10% SDS and 3 ml of 20 mg/mlproteinase K were added to the sus-pended cells. After incubation at 37æCfor 1 h, 100 ml of 5M NaCl and 80 mlof CTAB/NaCl (10% hexadecyltrime-thyl ammonium bromide/5M NaCl)solution were added, and the mixturewas incubated at 65æC for 10 min. Thelysed cells were extracted first with 700ml of chloroform/isoamyl alcohol (24:1)and then with 700 ml of phenol/chloro-form/isoamyl alcohol (25:24:1). TheDNA was precipitated with 0.6 volumesof isopropanol at room temperature.Precipitated DNA was dissolved in 30

ml of TE buffer and stored at ª20æCbefore use.

Genomic DNA preparation from plaquesample

Plaque samples were first harvested bycentrifugation at 1600¿g for 20 min.The supernatants were discarded, andindividual cell pellets were stored atª20æC until DNA isolation. The gen-omic DNA preparation from each sub-ject’s plaque sample was obtained by astandard miniprep procedure, as pre-viously described (Wilson 1990), towhich we added an RNAase treatment(Smith 1989). The concentration ofDNA in the samples from culture anddental plaque was calculated bymeasuring the A260, and the quality wasestimated by the A260/A280 ratio (Sam-brook 1989). The genomic DNAsamples were stored at ª20æC beforeuse.

PCR primers

We chose the sequence that encodes A.actinomycetemcomitans 16S ribosomalDNA (rDNA) (Larsen et al. 1993) asthe target sequence for amplification ofthe Aa-specific sequences. The primersfor the 16S rDNA sequences were se-lected as described previously (Ashimo-to et al. 1996). The upper primer, 5øAAACCCATCTCTGAGTTCTTCTTC3ø, is complementary to the sequence478–501, and the lower primer, 5øATGCCAACTTGACGTTAAAT 3ø, iscomplementary to the sequence 1015–1034. The size of the expected PCRproduct was 557 base pairs (bp). Wealso chose the sequence that encodes P.gingivalis 16s rDNA (GeneBank ac-cession number L16492) as the targetsequence for amplification of the Pg-specific sequences. The primers for 16SrDNA (Slots et al. 1995) sequences wereselected as described previously. Theupper primer, 5ø AGGCAGCTTGCC-ATACTGCG 3ø, is complementary tothe sequence 729–748, and the lowerprimer, 5ø ACTGTTAGCAACTACC-GATGT 3ø, is complementary to thesequence 1112–1132. The size of the ex-pected PCR product was 404 bp. Theprimers for eubacterial 16S rDNA se-quence (GeneBank accession numberM756035) were used as previously de-scribed (Goncharoff et al. 1993). Theupper primer, 5ø CAGGATTAGATAC-CCTGGTAGTCCACGC 3ø, is comple-mentary to the sequence 783–810, and

PCR detection of A.a. and P.g. from children 765

Table 1. Distribution of A. actinomycetemcomitans in children with healthy gingiva, gingivitisand periodontitis by dentition

No. positive subjects/sampled subjects (%)

Dentition healthy gingivitis periodontitis subtotal

primary 1/12 (8.3) 1/19 (5.3) 0/4 (0.00) 2/35 (5.7)mixed 0/9 (0.0) 4/54 (7.4) 2/6 (33.3) 6/69 (8.7)subtotal 1/21 (4.8) 5/73 (6.8) 2/10 (20.0) 8/104 (7.7)

Table 2. Distribution of P. gingivalis in children with healthy gingiva, gingivitis and peri-odontitis by dentition

No. positive subjects/sampled subjects (%)

Dentition healthy gingivitis periodontitis subtotal

primary 0/12 (0.0) 2/19 (10.5) 1/4 (25.0) 3/35 (8.6)mixed 1/9 (11.1) 5/54 (9.3) 1/6 (16.7) 7/69 (10.1)subtotal 1/21 (4.8) 7/73 (9.6) 2/10 (20.0) 10/104 (9.6)

Table 3. Clinical features and PCR results obtained from children with positive samples

Patient Age DNAa)

no. Sex (years.months) Dentition Diagnosis (mg/ml) Aa Pg rDNA

1 female 3.5 primary healthy 570 π ª π2 male 5.3 primary gingivitis 650 π π π3 male 5.8 primary gingivitis 1470 ª π π4 female 6.1 primary periodontitis 970 ª π π5 male 5.4 mixed gingivitis 1190 π ª π6 male 7.2 mixed gingivitis 730 π π π7 male 8.8 mixed gingivitis 1490 ª π π8 male 9.11 mixed healthy 230 ª π π9 male 9.6 mixed gingivitis 650 ª π π

10 male 9.9 mixed gingivitis 820 ª π π11 female 10.4 mixed gingivitis 1360 π ª π12 male 10.7 mixed gingivitis 560 π ª π13 male 10.8 mixed periodontitis 940 π π π14 male 11.0 mixed periodontitis 740 π ª π15 male 11.3 mixed gingivitis 1250 ª π πa) The concentration of the recovery DNA from brushing plaque samples.

the lower primer, 5ø GACGGGCGGT-GTGTACAAGGCCCGGGAACG 3ø,is complementary to the sequence1378–1407. The size of the expectedPCR product is 625 bp. All primerswere purchased from AmershamPharmacia Biotech, AB, Uppsala,Sweden.

PCR protocol

For PCR, bacterial DNA from plaquesamples was amplified in 50 ml of reac-tion mixture containing 100 ng of theDNA sample, 1 ¿ PCR buffer (50 mMKCl, 1.5 mM MgCl2, 10 mM Tris-HCl,pH 9.0), 1.5 mM MgCl2, deoxyribonu-cleotide mixture (Amersham Pharma-cia Biotech, AB, Uppsala, Sweden), 100pmol of each primer, and 2 units of TaqDNA polymerase (Amersham Pharma-cia Biotech, AB, Uppsala, Sweden) in a

thermal cycler (program temp controlsystem PC-700, ASTEC Co. Ltd., Fu-kuoka, Japan) for 36 cycles. Each set ofPCR analysis included negative control(water blank) in addition to the positivecontrol. Before the actual PCR cycles,the reaction components without theenzyme were kept at 95æC for 5 min.This so-called ‘‘hot start’’ technique im-proves the specificity of the PCR by pre-venting false hybridization and sub-sequent extension of the primers in thesuboptimal temperatures during the ini-tial heating period. For PCR amplifi-cation of the sequence of the 16SrDNA-based gene, each cycle involveddenaturation at 95æC for 30 s, primerannealing for A. actinomycetemcomit-ans at 55æC and for P. gingivalis at 60æCfor 1 min, and then primer extension at72æC for 1 min. The conditions used forPCR amplification of eubacterial 16S

rDNA were previously described byGoncharoff et al. (1993). After the am-plification, 15 ml of the PCR productswas analyzed on 1.2% agarose gel elec-trophoresis for A. actinomycetemcomit-ans, eubacterial 16S rDNA product,and 1.5% agarose gel electrophoresis forP. gingivalis. The newly synthesizedDNA fragments were visualized undera 302 nm ultraviolet light, after stainingwith ethidium bromide. The size of thePCR products was estimated from theelectrophoretic migration of productsrelative to a 100 base ladder (Amersh-am Pharmacia Biotech, AB, Uppsala,Sweden).

Results

The means and standard deviations ofthe DNA concentration from thehealthy group, the gingivitis and peri-odontitis groups, and the total for allgroups were 520∫385 mg/ml, 690∫419mg/ml, and 656∫416 mg/ml, respectively.PCR analysis using 16S rDNA primersconfirmed the presence of bacteria in allplaque samples (data not shown).

Distribution of A. actinomycetem-comitans in children with healthy gin-giva, gingivitis, and periodontitis in dif-ferent dentition stages are shown inTable 1. A. actinomycetemcomitans wasdetected in the healthy, gingivitis, andperiodontitis groups. Overall, 8 of the104 children (7.7%) were positive for A.actinomycetemcomitans. The percentageof A. actinomycetemcomitans detectedin the healthy, gingivitis, and peri-odontitis groups was 4.8%, 6.8%, and20.0%, respectively. The % of childrenpositive for A. actinomycetemcomitansin the primary and mixed dentitiongroups was 5.7% and 8.7%, respectively.

Distribution of P. gingivalis inchildren with healthy gingiva, gingivitis,and periodontitis by dentition is shownin Table 2. Overall, 10 of the 104children (9.6%) were positive for P. gin-givalis. The % of children positive for P.gingivalis in the healthy, gingivitis andperiodontitis groups was 4.8, 9.6 and20.0% respectively, while 8.6% and10.1% of children in the primary andmixed dentition groups were positivefor this species.

Table 3 shows the clinical featuresand PCR results obtained from childrenwith positive samples. Three of all 104subjects were found to be positive forboth A. actinomycetemcomitans and P.gingivalis. The minimum age of a sub-ject positive for A. actinomycetemcomit-

766 Okada et al.

ans and P. gingivalis was 3 year and 5months, and 5 year and 3 months old,respectively.

Discussion

Subgingival plaque samples are gener-ally taken from more than one pocketsite to detect periodontal pathogens.Alaluusua & Asikainen (1988) rec-ommended that more than one siteshould be sampled to determine the in-fection level of A. actinomycetemcomit-ans within the dentition. In somestudies, 1 to 4 plaque samples weretaken from each subject (Van der Weijd-en et al. 1994, Conrads et al. 1996,Meurman et al. 1997), whereas otherstudies routinely sampled each tooth inthe oral cavity (Christersson 1992, Pre-us 1994, Nakagawa 1996, Dibart 1998).In the present study, a toothbrush wasused to sample plaque from the teeth inorder to obtain as representative asample as possible with the least incon-venience. This procedure is simple, ex-peditious, and can be easily applied tochildren with dental anxiety.

PCR analysis using 16S rDNA-basedprimers in this study confirmed thepresence of bacteria in all plaquesamples (data not shown). The meanconcentration of genomic DNA was ap-proximately 660 mg/ml, which was suf-ficient for carrying out PCR. This sim-plified approach provides a practicaland screening method for large-scalestudies.

5 of the 73 children with gingivitis(6.8%) were positive for A. actinomyce-temcomitans in our study. Ashimoto etal. (1996) also reported that the preva-lence in pediatric gingivitis subjects was14% for A. actinomycetemcomitans, de-tected using PCR. 1 of the 21 childrenwith healthy gingiva was found to bepositive in the present study. Theyoungest periodontally healthy child inour study who was found to be positivefor A. actinomycetemcomitans was 3years and 5 months old. Our result isin agreement with previous studies thatused a cultural method and found thatthis bacterium was detected in the pri-mary dentition in children aged 4 to 7years (Alaluusua & Asikainen 1988,Frisken et al. 1987), but not in thechildren under the age of 2.5 years(Frisken et al. 1990). On the otherhand, Conrads et al. (1996), using PCRdetection, reported that A. actinomyce-temcomitans was not found in peri-odontally healthy children between the

ages of 3 to 10, although only 4 siteswere sampled in each subject. The in-consistencies among studies might bedue, in part, to the sampling methodsemployed.

Seven of the 73 children with gingi-vitis (9.6%) were positive for P. gingi-valis in the present study. Ashimoto etal. (1996) using PCR, reported that theprevalence of P. gingivalis in pediatricgingivitis subjects aged 2–11 years was14% by PCR. In our study, P. gingivaliswas not found in periodontally healthychildren with complete primary den-tition. In the mixed dentition subjects,however, 1 child with a healthy gingivawas found to be positive for this bac-terium. The youngest child that harbor-ed P. gingivalis was 9 yrs 11 mos. Al-though Prevotella intermedia is fre-quently found in plaque samples fromchildren, P. gingivalis is rarely detectedin healthy prepubescent children(Wojcicki et al. 1986, Frisken et al.1987). Petit et al. (1993) using culturaltechniques, reported that P. gingivaliswas present in only 1 of 49 periodontalhealthy children with a complete pri-mary dentition. Furthermore, Conradset al. (1996) reported in their study that,by PCR detection, P. gingivalis was notfound in periodontally healthy childrenfrom 3 to 10 years of age.

As noted in the above discussion, A.actinomycetemcomitans and P. gingi-valis are rarely established in the oralflora of periodontally healthy children.Transmission of A. actinomycetem-comitans to an established flora in ahealthy person may be difficult whenprotective immune mechanisms and mi-crobial antagonistic processes are intact(Zambon et al. 1983, Christersson et al.1985). Children are most often infectedwith a strain of A. actinomycetemcomit-ans identical to one of the parents withperiodontitis (Preus et al. 1994). Petit etal. (1994) reported that 5 of 26 childrenwith parents positive for A. actinomyce-temcomitans, were also positive for thisbacterium, and that only 1 of 55children with parents positive for P.gingivalis, was also positive. Theyfurther noted that colonization with P.gingivalis does not usually occur at anearly age. Asikainen et al. (1996) re-ported that a probability of 5% or lessfor occurrence by chance alone suggestsintra-familial transmission. The resultof the present study showed that bothA. actinomycetemcomitans and P. gingi-valis were detected in brushing plaquesamples of periodontally healthy

children by the PCR method, althoughthe subject population was limited. Thepresent investigation suggested that A.actinomycetemcomitans and P. gingi-valis were rarely found in the oral cavi-ties of periodontally healthy children.The prevalence of these species inchildren with gingivitis or periodontitiswas somewhat higher but might havebeen greater if samples were taken fromperiodontal pockets. Nonetheless, thereis a need for additional studies to assessthe prevalence of these bacteria inhealthy children.

In the current investigation, 5 of 104children harbored A. actinomycetem-comitans, 7 harbored P. gingivalis, and3 had both. It may be necessary to con-tinue to monitor individuals who arepositive for these bacteria since theirrisk of developing periodontal diseasesmay be increased. A longitudinal studywould be particularly important tomonitor these bacteria during the tran-sition from periodontal health to dis-ease.

In conclusion, our survey, using atoothbrush, indicated that A. actino-mycetemcomitans and P. gingivalis arerarely present in the oral cavity ofhealthy children.

Acknowledgments

This study was supported by the grants-in-aid for Scientific Research from theMinistry of Education, Science andCulture, Japan 11672050. We wish tothank Dr. Motoyuki Sugai of Hiroshi-ma University School of Dentistry forkindly reviewing the manuscript.

Zusammenfassung

Entdeckung von Actinobacillus actinomyce-temcomitans und Porphyromonas gingivalis inPlaqueproben bei 2 bis 12 jahringen KindernDer Zweck dieser Studie war die Suche nachActinobacillus actinomycetemcomitans undPorphyromonas gingivalis unter Nutzung derPolymerasekettenreaktion (PCR) in Plaque-proben von 104 Kindern, die von ihrenZahnbursten gesammelt wurden. Das Alterder Kinder schwankte zwischen 2 und 12Jahren. 21 Kinder hatten eine gesunde Gingi-va, 73 eine Gingivitis und 10 einer Parodonti-tis. Die Plaqueproben wurden von allendurchgebrochenen Zahnen mit einer sterilenZahnburste gesammelt. Die Mittlere Kon-zentration der DNA, die von den BurstenPlaqueproben gefunden wurde, war ungefahr660 mg/ml, was fur die Durchfuhrung derPCR-Untersuchung ausreichend war. SowohlActinobacillus actinomycetemcomitans alsauch Porphyromonas gingivalis wurden im

PCR detection of A.a. and P.g. from children 767

Milchgebiß und im Wechselgebiß entdeckt.Die Haufigkeit von Actinobacillus actinomy-cetemcomitans bei den Gesunden war 4.8%,bei denen mit Gingivitis und Parodontitis6.8% und 20.0%, wahrend die Haufigkeit vonPorphyromonas gingivalis 4.8% bei Gesun-den, 9.6% und 20.0% bei den Gingivitis- undParodontitis-Probanden betrug. Unsere Be-obachtung zeigte unter Nutzung einer Zahn-burste, daß Actinobacillus actinomycetemco-mitans und Porphyromonas gingivalis seltenin der Mundhohle von gesunden Kindernvorhanden sind.

Resume

Detection de l’Actinobacillus actinomycetem-comitans et du Porphyromonas gingivalis dansdes echantillons de plaque dentaire d’enfantsages de 2 a 12 ansLe but de cette etude a ete de detecter la pre-sence de l’Actinobacillus actinomycetemcomi-tans (A.a.) et du Porphyromonas gingivalis(P.g.) dans des echantillons de plaque dentai-re provenant de 104 enfants, echantillonnes apartir de leur brosse a dents en utilisant lareaction en chaıne de polymerase (PCR). Lesenfants avaient de 2 a 12 ans. 3 groupes d’en-fants se sont constitues: gencive saine (nΩ21),gingivite (nΩ72) et parodontite (nΩ10). Lesechantillons de plaque dentaire ont ete prele-ves de tous les sites dentaires apres eruptionen utilisant une brosse a dents sterile. Laconcentration moyenne d’ADN trouvee surles echantillons de plaque dentaire prelevespar brosse etait approximativement de 660mg/ml ce qui etait suffisant pour effectuer letest PCR. Tant A.a. que P.g. ont ete detectesdans la dentition primaire que mixte. La fre-quence globale de A.a. chez les sujets sainsetait de 5%, chez ceux avec gingivite de 7%et ceux avec parodontite de 20%, tandis quecelle du P.g. etait respectivement de 5, 10 et20%. Cette etude utilisant la brosse a dentsa indique que A.a. et P.g. etaient rarementpresents dans la cavite buccale des enfantssains.

References

Alaluusua, S. & Asikainen, S. (1988) Detec-tion and distribution of A. actinomycetem-comitans in the primary dentition. Journalof Periodontology 59, 504–507.

Ashimoto, A., Chen, C., Bakker, I. & Slots,J. (1996) Polymerase chain reaction detec-tion of 8 putative periodontal pathogens insubgingival plaque of gingivitis and ad-vanced periodontitis lesions. Oral Micro-biology and Immunology 11, 266–273.

Asikainen, S., Chen, C. & Slots, J. (1996)Likelihood of transmitting Actinobacillusactinomycetemcomitans and Porphyro-monas gingivalis in families with peri-odontitis. Oral Microbiology and Immu-nology 11, 387–394.

Bragd, J., Wikstrom, M., Dahlen, G. & Slots,J. (1987) The capacity of Actinobacillusactinomycetemcomitans, Bacteroides gingi-valis and Bacteroides intermedius to indi-

cate progressive periodontitis: a retrospec-tive study. Journal of Clinical Periodonto-logy 14, 95–99.

Christersson, L. A., Slots, J., Zambon, J. J. &Genco, R. J. (1985) Transmission andcolonization of Actinobacillus actinomyce-temcomitans in localized juvenile peri-odontitis. Journal of Periodontology 56,127–131.

Conrads, G., Mutters, R., Fischer, J., Fisch-er, J., Brauner, A., Lutticken, R. & Lam-pert, F. (1996) PCR reaction and dot-blothybridization of oral pathogens withinplaque samples of periodontally healthyindividuals. Journal of Periodontology 67,994–1003.

Christersson, L. A., Fransson, C. L., Dun-ford, R. G. & Zambon, J. J. (1992) Subgin-gival distribution of periodontal patho-genic microorganisms in adult peri-odontitis. Journal of Periodontology 63,418–425.

Dibart, S., Chapple, I. L. C., Skobe, Z.,Shusterman, S. & Nedleman, H. L. (1998)Microbiological findings in prepubertalperiodontitis. A case report. Journal ofPeriodontology 69, 1172–1175.

Frisken, K. W., Higgins, T. & Palmer, J. M.(1990) The incidence of periodontopathicmicroorganisms in young children. OralMicrobiology and Immunology 5, 43–45.

Frisken, K. W., Tagg, J. R., Laws, A. J. &Orr, M. B. (1987) Suspected peri-odontopathic microorganisms and theiroral habitats in young children. OralMicrobiology and Immunology 2, 60–64.

Goncharoff, P., Figurski, D. H., Stevens, R.H. & Fine, D. H. (1993) Identification ofActinobacillus actinomycetemcomitans:polymerase chain reaction amplification oflktA specific sequences. Oral Microbiologyand Immunology 8, 105–110.

Kraig, E., Dailey, T. & Kolodrubetz, D.(1990) Nucleotide sequence of the leuko-toxin gene from Actinobacillus actinomyce-temcomitans: Homology to the alpha-hem-olysin/leukotoxin gene family. Infectionand Immunity 58, 920–929.

Larsen, N., Olsen, G. J., Maidak, B. L., Mai-dak, B. L., McCaughey, M. J., Overbeek,R., Macke, T. J., Marsh, T. L. & Woese, C.R. (1993) The ribosomal database project.Nucleic Acids Res 21, (suppl) 3021–3023.

Lin, C.-Y., Wong, M.-Y., Jeng, J.-H., Chang,W.-K. & Kuo, M. Y.-P. (1994) Rapid andspecific detection of the leukotoxin se-quences of Actinobacillus actinomycetem-comitans from periodontal pockets by thepolymerase chain reaction. Journal of theFormosan Medical Association 93, 289–293.

Meurman, J. H., Wahlfors, J., Korhonen, A.,Alakuijala, P., Vaisanen, P., Torkko, H. &Janne, J. (1997) Identification of Bacter-oides forsythus in subgingival dentalplaque with the aid of a rapid PCRmethod. Journal of Dental Research 76,1376–1380.

Nakagawa, M., Kurihara, H., Nishimura, F.,Isoshima, O., Arai, H., Sawada, Koichi,Nagai, A. & Murayama, Y. (1996) Im-

munological, genetic, and microbiologicalstudy of family members manifestingearly-onset periodontitis. Journal of Peri-odontology 67, 254–263.

Petit, M. D. A., Van Steenbergen, T. J. M.,Van der Velden, U. & De Graaff, J. (1991)Clinical and microbiological aspects ofperiodontitis within families. Journal ofDental Research 70, 742.

Petit, M. D. A., Van Steenbergen, T. J. M.,Timmerman, M. F., de Graaff, J. & Vander Velden, U. (1994) Prevalence of peri-odontitis and suspected periodontalpathogens in families of adult peri-odontitis patients. Journal of Clinical Peri-odontology 21, 76–85.

Preus, H. R., Zambon, J. J., Dunford, R.G. & Genco, R. J. (1994) The distributionand transmission of Actinobacillus actino-mycetemcomitans in families with estab-lished adult periodontitis. Journal of Peri-odontology 65, 2–7.

Sambrook, J., Fritsch, E. F. & Maniatis, T.(1989) Molecular cloning: a laboratorymanual, 2nd edition. Cold Spring HarborLaboratory, Cold Spring Harbor, NY,USA.

Slots, J., Ashimoto, A., Flynn, M. J., Li,G. & Chen, C. (1995) Detection of puta-tive periodontal pathogens in subgingivalspecimens by 16S ribosomal DNA ampli-fication with the polymerase chain reac-tion. Clinical Infectious Diseases 20(suppl2), S304–S307.

Slots, J., Bragd, L., Wikstrom, M. & Dahlen,G. (1986) The occurrence of Actinobacillusactinomycetemcomitans, Bacteroides gingi-valis and Bacteroides intermedius in de-structive periodontal disease in adults.Journal of Clinical Periodontology 13, 570–577.

Slots, J., Reynolds, H. S. & Genco, R. J.(1980) Actinobacillus actinomycetemcomit-ans in human periodontal disease: A cross-sectional microbiological investigation. In-fection and Immunity 29, 1013–1020.

Slots, J., Taichman, N. S., Oler, J. & Listgart-en, M. A. (1988) Does the analysis of thegingival flora have value in predicting peri-odontal breakdown? In: Periodontology to-day, ed. Guggenheim, B., pp. 132–140. Ba-sel: Karger.

Smith, G. L. F., Socransky, S. S. & Smith, C.M. (1989) Rapid method for the purifi-cation of DNA from subgingival organ-isms. Oral Microbiology and Immunology4, 47–51.

Van der Weijden, G. A., Timmerman, M. F.,Reijerse, E., Wolffe, G. N., Van Winkel-hoff, A. J. & Van der Velden U. (1994) Theprevalence of A. actinomycetemcomitans,P. gingivalis and P. intermedia in selectedsubjects with periodontitis. Journal ofClinical Periodontology 21, 583–588.

Wahlfors, J., Meurman, J. H., Vaisanen, P.,et al. (1995) Simultaneous detection ofActinobacillus actinomycetemcomitans andPorphyromonas gingivalis by a rapid PCRmethod. Journal of Dental Research 74,1796–1801.

768 Okada et al.

Watanabe, K. (1990) Prepubertal peri-odontitis. A review of diagnostic criteria,pathogenesis, and different diagnosis.Journal of Periodontal Research 25, 31–48.

Watanabe, K. & Frommel, T. O. (1993) De-tection of Porphyromonas gingivalis in oralplaque samples by use of the polymerasechain reaction. Journal Dental Research72, 1040–1044.

Watanabe, K. & Frommel, T. O. (1996) Por-phyromonas gingivalis, Actinobacillus acti-nomycetemcomitans and Treponemadenticola detection in oral plaque samplesusing the polymerase chain reaction.Journal of Clinical Periodontology 23, 212–219.

Watson, M.-R., Lopatin, D. E., Bretz, W. A.,Ertel, I. J. & Loesche, W. J. (1991) Detec-

tion of two anaerobic periodontopathog-ens in children by means of the BANA andELISA assays. Journal Dental Research70, 1052–1056.

Wilson, K. (1990) Preparation of genomicDNA from bacteria. In: Current protocolsin molecular biology, eds. Ausubel, F. M.,Brent, R., Kingston, R. E., Moore, D. D.,Seidman, J. G., Smith, J. A. & Struhl, K.,p. 2.4.1–2.4.2. Philadelphia: Wiley Inter-science.

Wojcicki, C. J., Harper, D. S. & Robinson, P.J. (1986) Differences in periodontal dis-ease-associated microorganisms of gingi-val plaque in prepubertal, pubertal andpostpubertal children. Journal of Period-ontology 58, 219–223.

Zambon, J. J., Christersson, L. A. & Slots J.

(1983) Actinobacillus actinomycetemcomit-ans in human periodontal disease. Preva-lence in patient groups and distribution ofbiotypes and serotypes within families.Journal of Periodontology 54, 707–711.

Address:

Mitsugi OkadaDepartment of Pediatric DentistryHiroshima University School of Dentistry1-2-3, Kasumi, Minami-kuHiroshima 734-8553Japan

Fax: 81 82 257 5699e-mail: mitsugi/hiroshima-u.ac.jp