development of a light-switchable gene expression system in … · 11 ci dosage required for...
TRANSCRIPT
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
Development of a light-switchable gene expression
system in Escherichia coli
Jae Myung Lee
Bioengineering Major
School of Nano-Bioscience and Chemical Engineering
Graduate school of UNIST
2011
Development of a light-switchable gene expression
system in Escherichia coli
Jae Myung Lee
Bioengineering Major
School of Nano-Bioscience and Chemical Engineering
Graduate school of UNIST
Development of a light-switchable gene expression
system in Escherichia coli
A thesis
submitted to the School of Nano-Bioscience and Chemical Engineering
and the Graduate School of UNIST
in partial fulfillment of the
requirements for the degree of
Master of Science
Jae Myung Lee
6. 17. 2011
Approved by
Major Advisor
Sung Kuk Lee, Ph. D.
Development of a light-switchable gene expression
system in Escherichia coli
Jae Myung Lee
This certifies that the thesis of Jae Myung Lee is approved.
6. 17. 2011
Thesis Supervisor: Sung Kuk Lee, Ph. D.
Cheol-Min Ghim, Ph. D.
Taesung Kim, Ph. D.
i
Abstract
Light-mediated regulation of gene expression has become a rapidly advancing area of research
across many fields of science and engineering. When light is used as an inducer of gene expression, it
gains several advantages over other chemical inducers. In contrast to chemical inducers, light offers
switchable gene expression without an alteration in metabolic conditions and it is a simple-to-use,
inexpensive inducer. Levskaya et al. previously constructed a light-inducible promoter system in
Escherichia coli by using a hybrid combination of a two-component system EnvZ/OmpR of E. coli
and a cyanobacterial phytochrome, Cph1. However, this system cannot provide a coordinated control
of the expression of multiple genes encoding for the enzymes of different metabolic pathways. Here,
we developed a new light-switchable gene expression system using the λ cI protein as a
transcriptional repressor of target genes. This synthetic sensory system can help control both
chromosomal and plasmid-borne genes. We also found that the main parameters that determine the
extent and duration of the light-switchable gene expression. The light-switchable promoter systems
could be applied effectively in metabolic engineering and synthetic biology.
ii
iii
Contents
Abstract i
Contents iii
List of figures v
List of tables vi
Nomenclature vii
1 Introduction 1
1.1 Light-sensing systems 3
1.2 Two-component systems in E. coli 4
1.3 Promoter-based gene expression systems 5
1.4 Protein degradation tags 6
2 Materials and methods 8
2.1 Bacterial strains and growth conditions 8
2.2 Strain construction 9
2.3 Plasmid construction 13
2.3.1 RBSDesigner: software for designing synthetic ribosome binding sites 16
2.4 β-galactosidase assay 17
2.5 Measurement of GFP expression 17
2.6 Light controllable equipment “LabVIEW” 17
3 Results 18
3.1 Components of the light-switchable promoter system 18
3.2 Evaluation of a light sensing module, holo-Cph8 20
3.3 Validation of reporter plasmids 21
3.4 Assessment of CI repressor 22
3.5 Effect of light duration on the CI repressible promoters 23
iv
3.6 Oscillating gene expression 25
3.7 Effect of the degradation tag on the oscillation of gene expression 26
4 Discussion 27
4.1 Superiority of the light-switchable system 27
4.1.1 Industrially profitable traits of light-switchable gene expression 27
4.1.2 Efficacy of chemical and physical inducers on gene expression 28
4.2 Improvements in light-switchable gene expressions 28
4.2.1 Key parameters that account for the regulation of multiple genes 28
4.3 Applications of light-switchable gene expression systems 29
5 Conclusion 30
Reference 31
Acknowledgements 39
v
List of figures
Number
1 Biosynthesis of phycocyanobilin and phytochromobilin 4
2 Schematic model of SsrA-tagged protein degradation 7
3(a) Strategy for chromosomal gene deletion with λ- red recombination system 11
3(b) Strategy for replacement of ompC with cI-LVA 12
4(a) Map of pProbe-pLGFP 15
4(b) Schematic representation of synthetic promoter, CI binding site and GFP 15
4(c) Sequence of PL, PCP6 and PCP12 15
5 RBSdesigner software 16
6 LabVIEW instrument 18
7 Schematic model of strain JM1012 19
8 Verification of light-sensing module 20
9 Effect of different wavelengths on gene expression 21
10 Verification of reporter plasmids 22
11 CI dosage required for optimal gene regulation 23
12(a-d) Comparison of light-switchable gene expression system in light to switch gene from
OFF state to ON state
24
12(e-h) Comparison of light-switchable gene expression system in light to switch gene from
ON state to OFF state
25
13 Light-mediated oscillation in gene expression 26
14 Rapid turn-over of GFP mediated by LVA/AAV tags 27
vi
List of tables
Number
1 Commonly used promoters 6
2 Strains and Plasmids used in this study 8
3 Primers for strain construction 10
4 Primers for reporter plasmid construction 14
vii
Nomenclature
AHL: Acyl homoserine lactone
CCR: Carbon catabolite repression
CP: Constitutive promoter
Cph 1: Cyanobacterial phytochrome 1
CRP: Catabolite repression protein
DNA: Deoxyribonucleic acid
LB: Luria bertani
FLP: Flippase recombination enzyme
FRT: Flippase recognition target
GFP: Green fluorescent protein
IPTG: Isopropyl β-D-1-thiogalactopyranoside
LED: Light emitting diode
MAGE: Multiplex automated genome engineering
MCS: Multi coding site
OD: Optical density
ONPG: o-nitrophenyl-β-D-galactoside
PCB: Phycocyanobilin
PCR: Polymerase chain reaction
Pr: red-light-absorbing form of phytochrome
RBS: Ribosome binding site
SDS: Sodium dodecyl sulfate
SOC: SOB (Super Optimal Broth) with the B changed to C for “catabolite repression”
SOE-PCR: Splicing by overlapping extension PCR
TF: Transcription factor
UNIST: Ulsan national institute of science and technology
viii
1
1. Introduction
With the help of synthetic biology and metabolic engineering, new biological systems and novel
metabolic pathways have been engineered1-7. Modulating the expression of bacterial genes can help
fine-tune microbial metabolism for the optimal production of desired products such as drugs,
chemicals and biofuels8. Especially, promoter engineering is a highly essential tool to engineer
metabolic pathways and can aid in the temporal expression of recombinant proteins9. It favors
moderate expression of a gene without much metabolic burden or toxic effect10. Therefore, many
researchers focused on modifying promoters for improving the productivity of target pathways11-14.
One of the major strategies employed for the reduction of metabolic burdens imposed by over-
expression of a variety of recombinant proteins is an attempt to use inducible promoter systems. An
inducible promoter system is an attractive regulatory expression system that can repress the
expression of target genes during host cell growth and hence reduce the metabolic burden that
decreases cellular growth rate15. A variety of inducible promoter systems have been reported. The lac
promoter (Plac) system is a traditional representative of an inducible expression system that controls
gene expression via isopropyl-β-D-1-thiogalactopyranoside (IPTG) as inducer that can be combined
with LacI repressor protein for initiation of transcription. The araBAD promoter (PBAD) system is a
more tightly regulated gene expression system than the lac promoter system. The activator AraC
forms a complex with arabinose (inducer), binds to the promoter and activates the expression from the
araBAD promoter. The T7 promoter system has already been commercialized for over-expression of
recombinant proteins in biotechnological applications because the T7 RNA polymerase has higher
transcriptional processivity16. Recently, a propionate-inducible promoter system (PprpB) has been
developed for tightly regulated gene expression using a non-toxic and inexpensive inducer,
propionate17. When expressing toxic proteins, the PprpB showed much higher protein production than
the T7 promoter system due to non-growth inhibition even at highly induced state18.
However, none of these systems is ideal for inducing gene expression in Escherichia coli. Many of
these promoters have common disadvantageous features, such as leaky expression under non-induced
conditions, catabolite repression in the presence of glucose, need for host specific proteins, inducer
toxicity or use of expensive inducers19. Cost of the inducer is particularly a very important factor on
an industrial scale. For example, IPTG costs about $1.56 per liter20. Chemical inducers could not be
also removed from the medium and hence it is not possible to turn off gene expression after induction
2
by adding inducer to culture media. Since most chemical inducer-based gene expression systems are
derived from E. coli promoters, metabolic burden and noise due to crosstalk with the host system are
another potential problem.
In order to overcome these disadvantages, we developed a novel light-switchable promoter system
in E. coli. Distinctive physical properties of light offer a high level of flexibility to control gene
expression without disturbing the normal metabolic activities of a cell20. A light-sensing system in E.
coli was previously constructed by Levskaya et al. using a synthetic combination of a two component
regulatory system and a light-sensing phytochrome from cyanobacteria to regulate gene expression21.
This system was used to demonstrate light-regulated gene expression in E. coli using lacZ as a
reporter gene. However, this system could not provide a coordinated control of the expression of
multiple genes that encode for different proteins and a continuous control of the expression levels of
specific genes. It is necessary to gain an in-depth knowledge of this system in order to provide a
continuous fine control of the expression of multiple genes. A few immediate questions that should be
answered to fully exploit the advantages offered by light-switchable promoter systems are as follows:
1) Gene expression from chemically inducible promoters depends on the concentration of the
inducer. Analogous to this, the different wavelengths, intensities, and durations of light that
affect gene expression should be determined.
2) Those systems should be capable of providing more tightly regulated gene expression with low
background expression.
3) They should be capable of coordinating the expression of multiple genes simultaneously or
controlling of target genes continuously.
In this study, we modified the sensory circuit of Levskaya et al. to control expression of multiple
genes, to reduce leaky expression, and to increase induction fold. First, lambda cI repressor gene
encoding for a transcriptional repressor protein was expressed under the control of ompC promoter,
unlike the system developed by Levskaya et al. where PompC directly controls the expression of the
reporter gene21. Second, two CI repressor binding sites were cloned into downstream of a constitutive
promoter (CP) expressing the reporter gene, GFP. Light-mediated changes in GFP level were
monitored to determine the efficiency of the system. The CI repressor protein is being produced in
response to light, which in turn blocks the expression of GFP from the constitutive promoter on a
3
reporter plasmid. This system would hence favor the control of gene expression from multiple
promoters with a CI operator site. This synthetic gene-regulatory network can help check if the
expression of a gene from both chromosome and plasmid can be controlled by light. Here, we present
the construction of a strain carrying light-responsive genes and reporter plasmids harboring a rapidly
degradable GFP gene under the control of a synthetic CP with two CI-binding sites. We also
demonstrate the possibilities of regulating a synthetic gene network in a cell and the ways to
harmonize the synthetic gene network by engineering the promoter and the ribosome binding site
(RBS). Our results demonstrate that gene expression even from the chromosomal DNA can be
controlled using light. We also show that the main parameter which determines the extent and
duration of oscillation in a genetic circuit lies with the half-life of the regulatory proteins and its target
protein (GFP) that are produced from various components of the circuit.
1.1 Light-sensing systems
Light input modules are recently regarded as the strong candidate tools for fine-tuning gene
expression22-25. The basic mechanism of this module is that light absorption drives the rapid excitation
of the chromophore, and the subsequent reactions cause a conformational change of the phytochrome.
E. coli naturally synthesize heme whose precursor is from glutamate-tRNA, it is possible to produce a
protein of bilins by adding two subsequent steps; heme oxygenase (HO1) to convert biliverdin IXα
(BV) and phycocyanobilin/ferredoxin oxidoreductase (PcyA) in cyanobacteria or PФB synthase
(HY2) in plants to produce PCB or PФB (Figure 1). Since the duration of photo-conversion is very
short (usually on the order of picoseconds)26, synthetic biology exploits the rapid response of light in
order to control gene expression. Several chimeric photoswitches have been developed for the
differential control of gene expression with a specific wavelength of light such as red, green, and blue
light27-29. In this study, we used chimeric red-light receptor (Cph1-EnvZ).
4
Figure 1: Biosynthesis of phycocyanobilin and phytochromobilin. Heme in E. coli is
converted to biliverdin IXα by heme oxygenase (HO1). BV is produced to PCB or PФB by
phycocyanobilin/ferredoxin oxidoreductase (PcyA) or PФB synthase (HY2). HoloCph1 is completed
by autocatalytically binding either of these chromophores to apoCph1 in the Pr form.
1.2 Two-component systems in E. coli
Most bacteria respond rapidly to their outer environment such as osmotic activity, pH, ionic
strength, temperature, and the concentrations of nutrient and harmful compounds for survival. For that
purpose, bacteria have evolved surface-exposed signal transduction systems popularly addressed as
two-component systems4. These systems typically consist of a sensor protein with a histidine kinase
domain and a response regulator30, 31. Role of the histidine kinase in the membrane, which is regulated
by specific environmental stimuli, is to direct phosphorylation of its cognate the response regulator.
5
The phosphorylated response-regulator in the cytoplasm can then bind to its operator sites to activate
or repress gene expression. The two-component systems regulate diverse responses including nutrient
acquisition (BarA-UvrY)32 and adaptation to physical and chemical aspects of the environment
(CheW-Tar and CheW*-Tsr*)33, 34. In this study, we have exploited the EnvZ-OmpR two component
systems respond to light rather than to osmotic shock.
1.3 Promoter-based gene expression systems
There are an immeasurable number of promoters, potentially as many as genes in an organism.
However, only a few set of promoters are a good candidate to express or overproduce desired proteins
because a useful promoter must have fine-tuning gene expression on induction and low basal
expression20. For that reason, many researchers have focused on inducible promoter systems because
they could help to avoid metabolic burden and obtain a high protein production via the dynamic range
of the induction35-37. Plac (lacUV5), Ptac, PT7, PL, PtetA, PBAD, and PprpB are traditionally used for a target gene
expression (Table 1). The lacUV5 promoter was used in overexpressed genes or operon for fatty-acid-
derived fuels38. A fusion promoter, PLtetO-1 and PLlacO1 were also used for 1-butanol and 1-propanol
production due to independent control of two transcription units39, 40. In recent years, synthetic biology
has tried to creative novel promoters which are not inherent to E. coli under synthetic regulatory
systems. For example, Acyl homoserine lactone (AHL) inducible promoter system can help modulate
gene expression efficiently in a chemostat41.
6
Table 1. Commonly used promoters
Promoter Inducer Characteristics References
Plac (lacUV5) IPTGa
expensive inducer
weak expression
catabolite repression
42, 43
Ptac IPTGa
expensive inducer
leaky expression
catabolite repression
43, 44
PT7 IPTGa expensive inducer
high leaky expression
19, 45, 18
PL thermal temperature-sensitive host
required
43, 46
PtetA anhydrotetracycline tightly regulated system
expensive inducer
47
PBAD L-arabinose
suffers from all or none
function
catabolite repression
48, 17
PprpB propionate suffers from catabolite
repression
17, 49
Ptrc
(Fim inversion) L-arabinose
pulse induction
no leaky expression
low induction cost
50
aIsopropyl β-D-1-thiogalactopyranoside
1.4 Protein degradation tags
GFP has been widely used as a reporter gene in a broad variety of bacteria because it allows easy in
situ monitoring of cellular process without the need for an exogenous substrate and is non-toxic to cell
growth51. However, GFP will stay fluorescing for over at least 24 hours52, 53. This long half-life
reduces its potential to monitor the rapid alteration of GFP under various environmental conditions.
Degradation tags have been developed in order to favor rapid turnover of GFP54, 55. Many of the
degradation systems in E. coli are mediated by ssrA-based tagging. The adaptor SspB recognizes the
SsrA tagged proteins and subsequently leads them to the ClpXP protease for degradation55 (Figure 2).
Many variants of SsrA tag with SspB binding site (AANDENY) and ClpX binding site (LVA/AAV)
have been developed which favors degradation of the tagged proteins to different extent. The half-
7
lives of GFP variants with LVA/AAV tag are approximately 1 hour (40 and 60 minutes, respectively)
as compared to wild-type GFP which is stable for 24 hours.
Figure 2: Schematic model of SsrA-tagged protein degradation. SspB adaptor binds SsrA-tagged
substrates and stick to ClpXP protease for degradation.
8
2. Materials and Methods
2.1 Bacterial strains and growth conditions
The bacterial strains used are listed in Table 2. E. coli MG1655 or RU1012 were used as a parental
strain. All strains were grown in Luria-Bertani (LB) medium at 37°C with rotation at 200 rpm (Lab.
Companion SI-R300). Strains carrying temperature sensitive plasmids were maintained at 30⁰C.
Media were supplemented with antibiotics at a suitable concentration (50 µg/mL Kanamycin, 100
µg/mL Ampicillin and 30 µg/mL Chloramphenicol). Solid media was supplemented with 1% agar.
Strains were maintained as 20% glycerol stock at -80°C.
Table 2. Strains and plasmids used in this study
E. coli strain
or plasmid Description Reference or source
E. coli
MG1655 K-12, F- lambda- ilvG- rfb-50 rph-1 56
JM1012
RU1012
MG1655, ∆envZ, ∆ompC::cI-LVA
MC4100, ara+ ф(ompC-lacZ) 10-25, ΔenvZ:: KmR
This study 57
Plasmids
pPL-PCB
pCph8
p15a ori., pcyA, ho1 gene, AmpR
ColE1 ori., envz-cph1 gene, CmR
58 21
pSIM5
pCP20
pKD13
pEDL3
pTrc99a-CI-LVA
pSC101 ori., exo, bet, gam gene, CmR
Yeast FLP recombinase gene controlled by cI repressor
and temperature sensitive replication, AmpR, CmR
FRT-flanked kanamycin resistamce
pSC101* ori., lacZ, cI-LVA, luxI, luxR gene, AmpR
pBR322 ori., cI-LVA gene, AmpR
59
60
61
62
This study
pProbe-PL-GFP
pProbe-PL-GFP-LVA
pProbe-PL(0.1)-GFP
pProbe-PCP6(0.1)-GFP
pProbe-PCP6(0.1)-GFP-LVA
pProbe-PCP6(0.1)-GFP-AAV
pProbe-PCP12(0.1)-GFP
pProbe-PCP12(0.1)-GFP-AAV
pBBR1 ori., gfp , KmR
pBBR1 ori., gfp-LVA, KmR
pBBR1 ori., gfp, KmR
pBBR1 ori., gfp, KmR
pBBR1 ori., gfp-LVA, KmR
pBBR1 ori., gfp-AAV, KmR
pBBR1 ori., gfp, KmR
pBBR1 ori., gfp-AAV, KmR
This study
This study
This study
This study
This study
This study
This study
This study
9
2.2 Strain construction
pSIM5 plasmid harboring the λ-Red mediated recombination system under the control of cI857
(temperature sensitive cI) was used for chromosomal gene deletion (Figure 3a) and integration (Figure
3b)59. Kanamycin cassette from pKD13 was amplified with primers carrying a 50 bp overhang that is
homologous to the target site. For cI integration, the kanamycin cassette and the cI gene was sewn
together using SOE-PCR61. The PCR products were used to perform the desired genetic modifications
(Table 3). Cells harboring the plasmid pSIM5 were induced by thermal inactivation of CI at 42°C for
15 minutes. The cells were chilled immediately after induction to arrest the metabolic state of the cell,
made electrocompetent, and transformed with the PCR products described above. SOC medium was
added after electroporation and the cells were recovered from electric shock by incubation at 30°C for
1h 30 min. Transformant colonies carrying the desired modification were directly selected on LB agar
plates containing kanamycin. Genomic DNA was isolated from the transformants, and the target
region was PCR-amplified and sequenced to confirm site-specific insertion.
The kanamycin cassette was then removed using the Flp recombinase system borne on the plasmid
pCP2061. The Flp recombinase excises the kanamycin gene flanked between the FRT sites from the
chromosomal DNA. The plasmid pCP20 was then cured by culturing cells at 42°C.
PompC driven LVA tagged cI gene was integrated into the chromosome of wild-type MG1655 and
the chromosomal envZ was deleted in order to connect the expression of cI through the native envZ-
ompR two-component signal transduction system. The strain was designated as E. coli JM1012. The
LVA tagged cI gene was a kind gift from Jeffrey J. Tabor et al.62. Strain RU1012 was used to analyze
light mediated LacZ activity57
10
Table 3. Primers for PCR amplification of EnvZ-KmR, CI-KmR, and GFP-KmR
PCR
product Template
Primer
name Primer sequencea
EnvZ-KmR pKD13 Envz-H1-(F) 5’-AACGGGAGGCACCTTCGCCTCCCGTTTATTTACCCTTCTTTTG
TCGTGCCTGTAGGCTGGAGCTGCTTCG -3’
Envz-H2-(R) 5’-ACCGTCTGGGGTCTGGGCTACGTCTTTGTACCGGACGGCTCT
AAAGCATGATTCCGGGGATCCGTCGACC -3’
CI-KmR
pKD13 H1-P1-(F) 5’- GCAGGCCCTTTGTTCGATATCAATCGAGATTAGAACTGGTAA
ACCAGACCTGTAGGCTGGAGCTGCTTCG -3’
P4-(R) 5’-ATTCCGGGGATCCGTCGACC -3’
pEDL3 P4-CI-(F) 5’- GGTCGACGGATCCCCGGAATTTAAGCTACTAAAGCGTAGTT
TTCGTCGTT -3’
CI-H2-(R) 5’- TGGCATAAAAAAGCAAATAAAGGCATATAACAGAGGGTTA
ATAACATGAGCACAAAAAAGAAACCATTAACACAAGAG -3’
GFP-KmR pProbe-
gfptagless
P4-GFPLVA-
(F)
5’- GGTCGACGGATCCCCGGAATTTAAGCTACTAAAGCGTAGTT
TTCGTCGTT -3’
GFPLVA-H2-
(R)
5’-TGGCATAAAAAAGCAAATAAAGGCATATAACAGAGGGTTAAT
AACATGAGTAAAGGAGAAGAACTTTTCACTGGA -3’
aHomologous regions are underlined and P1 or P4 regions are bold letters.
11
Figure 3(a): Strategy for chromosomal gene deletion with the λ-red mediated recombination
system. P1 and P4 of the FRT (FLP recombinase recognition target) sites flanking the kanamycin
resistance gene in pKD13 are linked with H1 and H2 that are the homologous region specific to the
upstream and downstream of the envZ. The λ-red recombination proteins catalyze recombination as a
result of the replacement of the partial envZ with H1-P1-KanR-P4-H2. The final step is to remove the
kanamycin resistance gene through the Flp recombinase system in pCP20.
12
Figure 3(b): Strategy for the replacement of the ompC with the cI-LVA. Two PCR products
are initially constructed; the first contains the cI-LVA flanked by H1 and P4, and the second contains
the removable kanamycin resistance cassette flanked by P4 and H2. Overlap sequences of P4 were
used to bridge two PCR products.
13
2.3 Plasmid construction
All DNA manipulations were performed using established protocols63. Strain JM1012 was
transformed with the light-sensing plasmids pPL-PCB58, pCph821. All reporter plasmids share a
common plasmid backbone (pProbe-NT’) with a pBBR1 origin of replication from Bordetella
bronchiseptica, T1 terminator from E. coli rrnB1 operon and kanamycin resistance gene52. A promoter
(PL/PCP6/PCP12) containing two CI binding sites, a ribosome binding site [(strong RBS AAGGAG (0.3)
or weak RBS GGATAA (0.1)]E and a reporter gene (GFP, GFP-AAV, or GFP-LVA) were cloned into
the EcoRI and SalI site of pProbe-NT’ (Figure 4 and Table 4). The PL promoter with two CI operators
(OR2, OR1) was constructed from a BioBrick part, #J64067 (http://partsregistry.org). CP6 and CP12
are synthetic constitutive promoters with different strengths (280 and 101 miller units, respectively)64.
The weak RBS(0.1) was predicted to have a low translational efficiency using an online tool
RBSDesigner65. The strength of strong RBS used in this study was predicted to be 0.3. For CI-LVA
expression, a PCR product of CI-LVA flanked with EcoRI and SalI was ligated into the MCS of
pTrc99a.
14
Table 4. Primers for PCR amplification of reporter plasmids
PCR
product Template
Primer
name Primer sequencea
pProbe-
PL/PL(0.1)-
GFP/
GFP-LVA/
GFP-AAV
pProbe-
gfptagless’
RE1-PL-CIbs-
(F)
5’- CGGAATTCCGTAAGCACCTGTAGGATCGTACAGGTTGACAA
CAAGAAAATGGTGTGTTATAGTCGAATAACACCGTGCGTGTT -3’
CIbs-GFP-(F)
5’- GTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCG
GTGATATATAAGGAGGAAAAACATATGAGT -3’
CIbs-0.1GFP-
(F)
5’- GTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCG
GTGATAATGCTTGGATAAGGAACTGTTTACATGAGTAAAGGAG
AAGAACTTTTCA -3’
GFP-RE2-(R)
5’- GAATTAAGCTTCTGCAGTCGACTTATTATTTGTATAGTTCATC
CATGCCAT -3’
GFPLVA-
RE2-SalI-(R)
5’- GAATTAAGCTTCTGCAGTCGACTTAAGCTACTAAAGCGTAG
TTTTCGTCGTTTGCTGCAGGCCTTTTGTATAGTTCATCCATGCC
AT -3’
GFPAAV-
SalI-(R)
5’-GAATTAAGCTTCTGCAGTCGACTTAAACTGCTGCAGCGTAG
TTTTCGTCGTTTGCTGCAGGCCTTTTGTATAGTTCATCCATGCC
AT -3’
pProbe-
PCP6(0.1)-
GFP/
GFP-LVA/
GFP-AAV
RE1-CP6-(F)
5’- CGGAATTCCGCATGTGGGAGTTTATTCTTGACACAGATATT
TCCGGATGATATAATAACTGAGTACTGTTGTCGAATAACACCG
TGCGTGTT -3’
pProbe-
PCP12(0.1)-
GFP/
GFP-LVA/
GFP-AAV
RE1-CP12-
(F)
5’- CGGAATTCCGCATATACAAGTTTATTCTTGACACTAGTCGG
CCAAAATGATATAATACCTGAGTACTGTTGTCGAATAACACCG
TGCGTGTT -3’
aRestriction sites are double underlined, SspB binding sites are underlined, and tags (LVA/AAV) are indicated by bold letters.
15
Figure 4(a): Map of pProbe-pLGFP as a representative reporter plasmid used in this study. This
plasmid was derived from pProbe-NT’. The synthesized DNA segments including constitutive
promoter (PL), CI binding site, and GFP, GFP-LVA/AAV were cloned into EcoRI and SalI site.
Figure 4(b): Schematic representation of synthetic promoter, CI binding site and GFP.
Figure 4(c): Sequence of PL, PCP6, PCP12. Italic, EcoRI site; Black bold, –35 and –10 region;
Underlined, CI binding sites; Blue bold, transcription start site; Red bold, RBS region; Green bold,
start codon of GFP
`
16
2.3.1 RBSDesigner: software for designing synthetic ribosome binding sites
RBSDesigner was developed to predict the translation efficiency of existing mRNA sequences and
computationally design synthetic ribosome binding sites to favor a desired level of expression from a
user-specified coding sequence (http://rbs.kaist.ac.kr/index.html)65, 5. It provides three functionalities:
translational efficiency estimation, synthetic RBS design, and secondary structure prediction via the
mfoldweb site. The translational efficiency of universal E. coli RBS (AGGAGG) for PL promoter was
predicted to be about 0.3 (Figure 5). Weak RBS was designed by setting the translational efficiency to
0.1.
Figure 5: RBSdesigner software. The translational efficiency of universal E. coli RBS (AGGAGG)
for PL promoter was predicted to be about 0.3. Blue box indicates RBS sequence of PL. Green box
denotes the start codon of GFP.
17
2.4 β-galactosidase assay
Activity of the enzyme, β-galactosidase, encoded by the reporter gene lacZ, can be assayed using
the substrate, o-nitrophenyl-β-D-galactoside (ONPG) as described previously63. In brief, 2 mL of the
final culture was spun at 6000 rpm for 10 minutes and the pellet was then suspended in 2 mL of Z-
buffer (40 mM Na2HPO4•7H2O, 60 mM NaH2PO4•H2O, 10 mM KCl, 1 mM MgSO4•7H2O, and 50
mM 2-mercaptoethanol, pH7.0). Optical density at 600 nm (OD600) was measured by using a Libra
S22 spectrophotometer. The cell extract was diluted with an equal volume of Z-buffer, lysed with the
addition of 100 μL of chloroform and 50 μL of SDS (0.1%), vortexed and incubated at room
temperature for 5 minutes. 200 μL of ONPG (4 mg/mL) was added. After 5 minutes, 0.5 mL of 1.0 M
Na2CO3 was added and vortexed to stop the reaction and spun down by centrifugation at 13,200 rpm
for 5 minutes. The amount of released o-nitrophenol was determined by measuring absorbance at 420
nm. Cell-debris was measured at 550 nm. Miller units were then calculated using the formula: 1000 x
[(OD420 – 1.75 x OD550)]/(V x T x OD600), where T= time (in minutes) of incubation and V = volume of
cells (mL) used in the assay (1 mL in the above example).
2.5 Measurement of GFP expression
The strain JM1012 containing the three plasmids (pPL-PCB, pCph8, and pProbe-PL/PCP6/PCP12 with
GFP/GFP-AAV/GFP-LVA) was grown in 5 mL LB medium supplemented with three different
antibiotics (25 µg/mL ampicillin, 25 µg/mL kanamycin, 15 µg/mL chloramphenicol) at 37°C
overnight. 50 μL of the overnight grown cells were inoculated into 5 mL of fresh LB medium in
culture tubes either wrapped (darkness) with foil or unwrapped (light). LED desk lamp (LS-100) was
used as a light source. The quantity of GFP was determined using a Tecan Infinite F200
spectrophotometer with an excitation/emission at 485 nm/535 nm, gain value at 30, and amplitude at 3
mm.
2.6 Light controllable equipment “LabVIEW”
The light controllable equipment was based on the LabVIEW which is a graphical programming
environment to facilitate measurement, test, and control systems. This software and toolkit developed
by Taesung Kim group, UNIST (2009) was used to determine the effect of light wavelengths on gene
expression (Figure 6). The instrument is capable of providing four different spectrums of wavelengths
18
(blue, 450-480 nm; green, 510-535 nm; white, 400-700 nm; red, 615-635 nm). This instrument was
combined with a 24-wells black plate of volume 2 mL per well and with rotation at 150 rpm. The light
exposure time was varied from 0 to 12 hours.
Figure 6: LabVIEW instrument. The instrument is capable of providing four different spectrums of
wavelengths which are blue (450-480 nm), green (510-535 nm), white (400-700 nm), and red (615-
635 nm) (Left). It was combined with a 24-wells black plate of volume 2 mL per well (Middle). The
light exposure time can be controlled by using the LabVIEW software (Right).
3. Results
3.1 Components of the light-switchable promoter system
Major components of the light-switchable promoter system used in this study include the strain
JM1012 (MG1655, ompC<>cI-LVA, ∆envZ) and three plasmids: two for sensing light (pPL-PCB,
pCph8) and one reporter plasmid (pProbe-PL/PCP6/PCP12 and GFP, GFP-AAV or GFP-LVA) (Figure 7).
The plasmid pPL-PCB expressing Synechocystis sp. heme oxygenease and biliverdin reductase genes
ho1 and pcyA lead to the biosynthesis of the chromophore, phycocyanobilin (PCB). PCB is the major
light sensing component. Plasmid pCph8 harbors a fusion gene encoding a red light responsive
domain (cph1) of a Synechocystis sp. phytochrome and an intracellular histidine kinase of E. coli envZ
gene58, 21. The chimeric light-receptor Cph8 combines with PCB to form a holophytochrome and
autophosphorylates its EnvZ-based histidine kinase domain in response to light. In the absence of
light, the chimeric light-receptor transfers its phosphate group to the response regulator OmpR. The
phosphorylated OmpR binds to the ompC promoter (PompC) and thus activates the expression of cI
gene that is expressed under the control of PompC. The expressed CI in turn blocks the transcription of
GFP from a CI repressible promoter on the reporter plasmid. Dark exposure therefore results in high-
level production of CI repressor and repression of GFP expression, while exposure to light relieves
this repression.
19
Figure 7: Schematic model of the JM1012. In case of darkness, the chimeric Cph8 (Cph1-EnvZ)
with PCB phosphorylates the response regulator OmpR. OmpR-P binds to the promoter of ompC and
drives the expression of CI. Expressed cI-LVA in turn blocks transcription of GFP.
20
3.2 Evaluation of a light sensing module, holo-Cph8
We analyzed the effect of light on holo-Cph8 by measuring the LacZ activity in strain RU1012
(Figure 8). We used an ordinary LED desk lamp (LS-100) to activate the light-sensing holo-Cph8.
Holo-Cph8 was previously characterized to respond to red light (wavelength 650 -705 nm). Here, we
have demonstrated that it responds to a wide range of wavelengths in the visible spectrum from the
desk lamp. To investigate the sensitivity of the light receptor to a broad spectrum of wavelengths, we
used the LabVIEW toolbox that is capable of providing four different spectrums of wavelengths (blue,
450-480 nm; green, 510-535 nm; white, 400-700 nm; red, 615-635 nm). Similar responses were
obtained from the light receptor even with varied wavelengths (Figure 9). This broad sensitivity of the
holo-Cph8 is an industrially important trait as it is not necessary to control the light source precisely.
Figure 8: Verification of light-sensing module. Graph showing the change in lacZ expression with
respect to light in RU1012 harboring the two light sensing plasmids. Strains grown in darkness (blue
line); Strains grown in the presence of light (black line).
21
Figure 9: Effect of different wavelengths on gene expression. Graph showing the effect of different
wavelengths on the functionality of holo-Cph8. Increasing order of vertical bars under each
wavelength represents darkness, 2, 4, 6 and 12 hours of light.
3.3 Validation of reporter plasmids
To investigate the optimal combination of promoter and RBS for tight regulation of a target gene
expression, we constructed 4 different reporter plasmids with varying promoters/RBSs: PL(RBS0.3),
PCP6(RBS0.1), PCP12(RBS0.1) and PL(RBS0.1) (Figure 10). The PL is a very strong constitutive
promoter with the optimal spacer length between the –35 and the –10 regions (17 bp)34. Synthetic
constitutive promoters, PCP6 and PCP12, were previously reported to have a medium and low
transcriptional efficiency in E. coli64. PL-RBS0.3 had about 4-fold higher expression compared to PL-
RBS0.1. Unlike previously reported, PCP6 and PCP12 had almost the same strength indicating the
altered effect of the strength of the promoter due to the cI operator region64. Strength of PL-RBS0.1
was less than those of PCP6-RBS0.1 and PCP12-RBS0.1.
22
Figure 10: Verification of reporter plasmids. Comparison of strength of reporter plasmids with
varied combinations of promoters and RBSs. Blue, PL-RBS0.3; Green, PCP12-RBS0.1; Red, PCP6-
RBS0.1; Purple, PL-RBS0.1; Black, MG1655
3.4 Assessment of CI repressor
Phage λ protein, CI repressor was used to favor simultaneous regulation of multiple genes66-68. The
CI was tagged with LVA tag for rapidly degradation and expressed on the JM1012 chromosome. To
investigate the expression level of CI-LVA repressor on the chromosome that is needed to efficiently
control gene expression from a CI repressible promoter on the reporter plasmid, we first cloned cI-
LVA gene into pTrc99a, a medium copy plasmid. There was a complete repression of GFP even with
0.1 mM IPTG (Figure 11). The result indicates that CI-LVA protein is sufficient to repress the GFP
expression in the JM1012.
23
Figure 11: CI dosage required for optimal gene regulation. Graph showing the effect of CI
expressed from lac promoter on GFP expression. Blue line, no IPTG; Red line, 0.01 mM IPTG; Green
line, 0.05 mM IPTG; Purple line, 0.1 mM IPTG; Black line, 1 mM IPTG.
3.5 Effect of light duration on the CI repressible promoters
In order to determine the relationship between the light dose and the induction fold, GFP expression
(under the control of various promoter/RBS combinations) was measured with respect to changes in
light exposure duration. The light exposure time was varied in strain JM1012 sequentially from 0 h to
12 h with the LabVIEW instrument. CI-LVA repressor efficiently controlled GFP expression from the
weak promoter PL-RBS0.3 in response to varied light conditions (Figure 12a and 12e). Strain JM1012
responded efficiently to light by expressing GFP in the presence of light. GFP expression was
comparable to that of background expression in the absence of light. GFP expression was strongly
dependent on the light exposure time. However, the leaky expression of GFP was unavoidable in
darkness. In order to decrease the leaky expression, we used PL with a weak RBS0.1. The background
leaky expression was decreased five-fold. Interestingly, the induction fold was increased from three-
fold (for strong RBS) to five-fold (for weak RBS) due to the reduced background expression (Figure
12b and 12f). Same pattern was observed even with the stronger promoter, PCP6-RBS0.1 (Figure 12c
and 12g). PL-RBS0.1 showed lower background expression than PCP6-RBS0.1 (Figure 12b and 12c).
These results indicate that the high background expression observed in the light-switchable promoter
system might be related to the strength of the promoter or RBS.
24
PCP12-RBS0.1 was functional and comparable to that of PCP6 when assayed independent of the CI
repressor (Figure 10). However, they failed to express GFP in JM1012 in response to light, indicating
that the CI operator may not be compatible with PCP12 (Figure 12d and 12h). This result indicates that
the promoter-CI operator combination is not universal.
Figure 12 (a-d): Comparison of light-switchable gene expression system in light to switch gene
from OFF state to ON state. Graph showing the effect of duration of light on GFP expression from
PL-RBS0.3 (a), PL-RBS0.1(b), PCP6-RBS0.1(c), and PCP12-RBS0.1(d). Blue line represents the
continuous presence of light; Red, green and purple lines denote 1, 2 and 3 hours of darkness,
respectively. Black line indicates the noisy expression obtained in the absence of light
25
Figure 12 (e-h): Comparison of light-switchable gene expression system in light to switch gene
from ON state to OFF state. Graph showing the effect of duration of light on GFP expression from
PL-RBS0.3 (e), PL-RBS0.1 (f), PCP6-RBS0.1 (g), and PCP12-RBS0.1 (h). Blue line represents the
continuous presence of light; Red, green and purple lines denote one, two, and three hours of light
respectively. Black line indicates the noisy expression obtained in the absence of light
3.6 Oscillating gene expression
In order to verify if oscillation by light (repeated cycles of ON and OFF) can affect GFP expression,
we varied the light condition every two hours. As expected, oscillation in light caused a step-wise
increase in GFP (Figure 13).
26
Figure 13: Light-mediated oscillation in gene expression. Graph showing variation in GFP
expression with respect to a fluctuating light source. Blue line represents GFP expression measured in
the presence of a constant light source while red line represents a fluctuating light source (fluctuates
every 2 hours). Black line represents the background noise
3.7 Effect of the degradation tag on the oscillation of gene expression
In order to demonstrate a oscillation in gene expression by turning light ON/OFF, degradation tag
such as LVA or AAV which is short peptide sequences was added to C-terminal end of intact GFP51.
LVA-tagged GFP is unstable due to the tail-specific protease, ClpX54. CI independent GFP expression
from the plasmids (PL-RBS0.3-GFP-LVA, PCP6-RBS0.1-GFP-AAV, and PCP12-RBS0.1-GFP-AAV)
seems to be detectable only for 4~6 hours till the late-log phase (Figure 14). However, GFP-LVA
expression was very little when compared to GFP-AAV. This result indicates that the LVA tag is
degraded faster than AAV tag (PCP6-RBS0.1-GFP-AAV compared with PCP6-RBS0.1-GFP-LVA).
Since GFP-LVA is combined with a weak RBS, the degradation level is higher than translational level
of GFP. The expression level of tagged GFP is comparable to that of background noise in most cases.
Relatively short half-life of the tagged GFP variants limits the ability to demonstrate light-mediated
oscillation in gene expression.
27
Figure 14: Rapid turn-over of GFP mediated by LVA/AAV tags. Graph showing the expression
level of GFP-LVA (closed square) and GFP-AAV (closed triangle) from different promoters: PL-
RBS0.3(blue); PCP12-RBS0.1(black) PCP6-RBS0.1(red), and PL-RBS0.1(green)
4. Discussion
We constructed an improved light-switchable gene expression system in E. coli JM1012 to favor
simultaneous control of multiple genes. Though the light system had been reviewed for decades, no
such attempts have been made to control multiple genes on chromosomal DNA or plasmids. This
study highlights the importance of CI repressor being able to control multiple genes rapidly in
response to light. We have designed different combinations of promoter and RBS with the same CI
operator site to provide insights onto the ways to optimize gene expression. We have also constructed
the target gene (GFP) with LVA/AAV tags to demonstrate oscillation in gene expression in response
to light.
4.1 Superiority of the light-switchable system
4.1.1 Industrially profitable traits of light-switchable gene expression
The holo-Cph8 formed by co-production of PCB and apophytochrome (Cph1-EnvZ) was
28
previously known to respond to red-light69, 70. However, this strain can respond to ordinary light from
a desk lamp. We furthermore checked if the strain responds to any specific wavelength of the desk
lamp using a light-controllable instrument. Our results indicate that the sensitivity of holo-Cph8
seems to be independent of the wavelength of light. It has been previously reported that the holo-Cph8
has a absorption maximum around 650 nm and a long absorption tail that extends till the blue region
of spectrum34, 70. Therefore, this broad sensitivity of the holo-Cph8 could be an industrially important
trait as it is not necessary to control the light spectrum precisely. In addition, Cph8 and PCB should be
integrated into chromosomal DNA to shun instability of plasmid, metabolic burden, and cost of
antibiotics.
Oscillation gene expression brought about by chemical inducers is usually a discontinuous process
where the inducer has to be washed away or the cell has to be diluted. We have demonstrated an
efficient oscillation in gene expression in a continuous process using light switchable gene expression.
A oscillation brought about in continuous process is of particular importance in industrial scale. To the
best of our knowledge, only light-switchable promoter system could favor oscillations in gene
expression in a continuous process.
4.1.2 Efficacy of chemical and physical inducers on gene expression
cI-LVA expressed from a medium copy plasmid (induced with 0.1 mM of IPTG) gives the same
result as the CI repressor borne on chromosomal DNA of JM1012 (Figure 11 and Figure 12e). This
result indicates that gene expression even from the chromosomal DNA can be controlled using light.
We also observed that the tendency of GFP expression in response to light was similar to that
encountered in a chemical-inducer based systems (For example, IPTG as discussed in 3.1.3). Similar
to the chemically inducible promoter where expression depends on the concentration of the inducer,
light-switchable promoter system is controlled by light exposure time. Light may win the race of
inducible systems with expression equivalent to the conventional systems but at a cheaper cost than
the chemical inducer.
4.2 Improvements in light-switchable gene expressions
4.2.1 Key parameters that account for the regulation of multiple genes
In order to control multiple gene expressions, the basic building blocks of engineered gene circuits
29
need to be well characterized, both independently and as a component of an integrated, complex
system71. Gene regulatory circuits are based on simple building blocks such as promoters,
transcription factors (TFs) and their binding sites on DNA. In this work, we constructed different
combinations of promoter, CI operator region and RBS. Our results indicate that the pattern of gene
regulation can be easily changed merely by a certain combination of promoter and RBS. It is
necessary to understand how the combination and multiplicity of promoter and RBS affect gene
expression to more accurately control multiple genes in synthetic networks72. In order to attain the
goal of optimized gene regulation, the combination efficiency number for the two factors (promoter
and RBS) should be predicted by computational modeling in parallel with sophisticated
experimentations. RBSDesigner is useful software to predict translational efficiency number
computationally5. Multiplex automated genome engineering (MAGE) a sophisticated experimental
method will be help in large-scale programming and evolution of cells73. MAGE can be used for
modification of many locations on the chromosome simultaneously. A multidisciplinary approach
such as the RBSDesigner and MAGE will be imperative for gaining such insights and improving the
efficiency of artificial gene network design.
4.3 Applications of light-switchable gene expression systems
In order to optimize inherent or synthetic metabolic pathways by a synchronized control of multiple
genes, we should consider the global metabolic flux distribution and burden imposed by the deletion
of bottleneck enzymes74. Flux imbalance causes a decrease in desired productivity75.
As is well demonstrated in this study, light can provide a temporal change in gene expression. This
becomes an important trait in metabolic engineering. For example, it is necessary to delete the
competing pyruvate formate lyase to favor ethanol production in E. coli76. However, deletion of this
enzyme renders a severe growth defect both in aerobic and anaerobic conditions. Strains such as E.
coli KO11 are a best example for this strategy which has a very poor growth characteristic77. Use of
light switchable gene expression system can favor a temporal change in gene expression and thus may
favor inactivation of these genes only during the stationary phase. This may help enhance productivity
with less metabolic burden to the host cells.
Light-switchable gene expression system may also help provide a temporal change in acetate
production. Acetate production is presumed to be one of the root causes of impaired heterologous
gene expression. However, deletion of phosphotransacetylase (enzyme responsible for the conversion
of acetyl-CoA to acetate) results in a severe growth defect78. Hence, engineering light inducible
30
promoters to this and similar essential metabolic genes may help improve the efficiency of
bioprocessing.
Carbon Catabolite Repression (CCR) is another widely reviewed and poorly understood area of
study. It is not even clear if CCR is imposed at the transcriptional level or at the translational level79.
Light-driven expression of sugar catabolic genes may help understand CCR. For example, here we
demonstrate the efficacy of the global repressor CI to regulate multiple genes. Similarly Catabolite
Repressor Protein (CRP), the global regulator of CCR, is known to affect transcription from more
than 200 genes in E. coli80. Expression level of CRP is considered as a potent determinant of CCR and
is strongly dependent on glucose. If we can bring about a light-driven CRP expression rather than
glucose-driven CRP expression then we may be able to maintain a homeostatic CRP level either in the
presence or absence of glucose. One such system may help gain deeper insights about CCR.
5. Conclusion
In this study, we constructed a light-switchable gene expression system in E. coli JM1012. As
chemically inducible promoter depends on the concentration of the inducer, this system can be
controlled by light duration. By CI transcriptional repressor, this system could be also facilitated for a
coordinated control of multiple genes expression. We demonstrated that the combination of promoter
and RBS on the reporter plasmids is related with a fine-control of gene expression. Taken together, the
synthetic gene-regulatory network in JM1012 could be used to control immediately desired genes on
the metabolic pathway.
By developing the innovative novel gene expression systems, we expect active research efforts in
synthetic biology that apply bio-energy and bio-refinery applications. We believe that the light
switchable gene expression system should affect basic technologies of designing and engineering
microorganisms with new synthetic gene constructs and biological components. Furthermore, this
system can help many synthetic biology researchers in multi-disciplinary technologies and fields.
31
References
1. Khalil, A. S. & Collins, J. J. (2010) Synthetic biology: applications come of age. Nature
Review Genetics, 11, 367-379.
2. Meyer, A., Pellaux, R. & Panke, S. (2007) Bioengineering novel in vitro metabolic
pathways using synthetic biology. Current Opinion in Microbiology, 10, 246-253.
3. Keasling, J. D. (2008) Synthetic biology for synthetic chemistry. ACS Chemical Biology, 3,
64-76.
4. Voigt, C. A. (2006) Genetic parts to program bacteria. Current Opinion in Biotechnology,
17, 548-557.
5. Na, D., Kim, T. Y. & Lee, S. Y. (2010) Construction and optimization of synthetic
pathways in metabolic engineering. Current Opinion in Microbiology, 13, 363-370.
6. Kiel, C., Yus, E. & Serrano, L. (2010) Engineering signal transduction pathways. Cell,
140, 33-47.
7. Young, E. & Alper, H. (2010) Synthetic biology: tools to design, build, and optimize
cellular processes. Journal of Biomedicine and Biotechnology, 2010, 12 pages.
8. Dellomonaco, C., Fava, F. & Gonzalez, R. (2010) The path to next generation biofuels:
successes and challenges in the era of synthetic biology. Microbial Cell Factories, 9, 3.
9. Chao, Y. P., Chiang, C. J. & Hung, W. B. (2002) Stringent regulation and high-level
expression of heterologous genes in Escherichia coli using T7 system controllable by the
araBAD promoter. Biotechnology Progress, 18, 394-400.
10. Goldstein, M. A. & Doi, R. H. (1995) Prokaryotic promoters in biotechnology.
Biotechnology Annual Review. Elsevier.
11. Yuan, L. Z., Rouvière, P. E., LaRossa, R. A. & Suh, W. (2006) Chromosomal promoter
replacement of the isoprenoid pathway for enhancing carotenoid production in E. coli.
Metabolic Engineering, 8, 79-90.
12. Hammer, K., Mijakovic, I. & Jensen, P. R. (2006) Synthetic promoter libraries - tuning
32
of gene expression. Trends in Biotechnology, 24, 53-55.
13. Wackett, L. P. (2008) Biomass to fuels via microbial transformations. Current Opinion in
Chemical Biology, 12, 187-193.
14. Alper, H., Fischer, C., Nevoigt, E. & Stephanopoulos, G. (2005) Tuning genetic control
through promoter engineering. Proceedings of the National Academy of Sciences of the
United States of America, 102, 12678-12683.
15. Herai, S., Hashimoto, Y., Higashibata, H., Maseda, H., Ikeda, H., Ōmura, S. &
Kobayashi, M. (2004) Hyper-inducible expression system for streptomycetes.
Proceedings of the National Academy of Sciences of the United States of America, 101,
14031-14035.
16. Terpe, K. (2006) Overview of bacterial expression systems for heterologous protein
production: from molecular and biochemical fundamentals to commercial systems.
Applied Microbiology and Biotechnology, 72, 211-222.
17. Lee, S. K. & Keasling, J. D. (2005) A Propionate-Inducible Expression System for
Enteric Bacteria. Applied and Environmental Microbiology, 71, 6856-6862.
18. Lee, S. K. & Keasling, J. D. (2008) Heterologous protein production in Escherichia coli
using the propionate-inducible pPro system by conventional and auto-induction
methods. Protein Expression and Purification, 61, 197-203.
19. Lee, S. K. & Keasling, J. D. (2006) A Salmonella-based, propionate-inducible, expression
system for Salmonella enterica. Gene, 377, 6-11.
20. Vinuselvi, P., Park, J. M., Lee, J. M., Oh, K., Ghim, C.-M. & Lee, S. K. (2011)
Engineering microorganisms for biofuel production. Biofuels, 2, 153-166.
21. Levskaya, A., Chevalier, A. A., Tabor, J. J., Simpson, Z. B., Lavery, L. A., Levy, M.,
Davidson, E. A., Scouras, A., Ellington, A. D., Marcotte, E. M. & Voigt, C. A. (2005)
Synthetic biology: engineering Escherichia coli to see light. Nature, 438, 441-442.
22. Drepper, T., Krauss, U., Meyer zu Berstenhorst, S., Pietruszka, J. & Jaeger, K.-E. (2011)
Lights on and action! Controlling microbial gene expression by light. Applied
Microbiology and Biotechnology, 90, 23-40.
33
23. Sorokina, O., Kapus, A., Terecskei, K., Dixon, L., Kozma-Bognar, L., Nagy, F. & Millar,
A. (2009) A switchable light-input, light-output system modelled and constructed in
yeast. Journal of Biological Engineering, 3, 15.
24. Shimizu-Sato, S., Huq, E., Tepperman, J. M. & Quail, P. H. (2002) A light-switchable
gene promoter system. Nature Biotechnology, 20, 1041-1044.
25. Moglich, A. & Moffat, K. (2010) Engineered photoreceptors as novel optogenetic tools.
Photochemical & Photobiological Sciences, 9, 1286-1300.
26. Dasgupta, J., Frontiera, R. R., Taylor, K. C., Lagarias, J. C. & Mathies, R. A. (2009)
Ultrafast excited-state isomerization in phytochrome revealed by femtosecond
stimulated Raman spectroscopy. Proceedings of the National Academy of Sciences, 106,
1784-1789.
27. Losi, A. & Gartner, W. (2008) Bacterial bilin- and flavin-binding photoreceptors.
Photochemical & Photobiological Sciences, 7, 1168-1178.
28. Rockwell, N. C. & Lagarias, J. C. (2010) A Brief History of Phytochromes.
ChemPhysChem, 11, 1172-1180.
29. Hirose, Y., Shimada, T., Narikawa, R., Katayama, M. & Ikeuchi, M. (2008)
Cyanobacteriochrome CcaS is the green light receptor that induces the expression of
phycobilisome linker protein. Proceedings of the National Academy of Sciences, 105,
9528-9533.
30. Chang, C. & Stewart, R. C. (1998) The two-component system. Plant Physiology, 117,
723-731.
31. Mascher, T., Helmann, J. D. & Unden, G. (2006) Stimulus perception in bacterial signal-
transducing histidine kinases. Microbiology and Molecular Biology Reviews, 70, 910-938.
32. Pernestig, A.-K., Georgellis, D., Romeo, T., Suzuki, K., Tomenius, H., Normark, S. &
Melefors, O. (2003) The Escherichia coli BarA-UvrY two-component system is needed
for efficient switching between glycolytic and gluconeogenic carbon sources. Journal of
Bacteriology, 185, 843-853.
33. Moon, T. S., Clarke, E. J., Groban, E. S., Tamsir, A., Clark, R. M., Eames, M.,
Kortemme, T. & Voigt, C. A. (2011) Construction of a genetic multiplexer to toggle
34
between chemosensory pathways in Escherichia coli. Journal of Molecular Biology, 406,
215-227.
34. Tabor, J. J., Levskaya, A. & Voigt, C. A. (2011) Multichromatic Control of Gene
Expression in Escherichia coli. Journal of Molecular Biology, 405, 315-324.
35. Siegele, D. A. & Hu, J. C. (1997) Gene expression from plasmids containing the araBAD
promoter at subsaturating inducer concentrations represents mixed populations.
Proceedings of the National Academy of Sciences, 94, 8168-8172.
36. Khlebnikov, A., Risa, O., Skaug, T., Carrier, T. A. & Keasling, J. D. (2000) Regulatable
arabinose-inducible gene expression system with consistent control in all cells of a
culture. Journal of Bacteriology, 182, 7029-7034.
37. Tegel, H., Ottosson, J. & Hober, S. (2011) Enhancing the protein production levels in
Escherichia coli with a strong promoter. FEBS Journal, 278, 729-739.
38. Steen, E. J., Kang, Y., Bokinsky, G., Hu, Z., Schirmer, A., McClure, A., del Cardayre, S.
B. & Keasling, J. D. (2010) Microbial production of fatty-acid-derived fuels and
chemicals from plant biomass. Nature, 463, 559-562.
39. Shen, C. R. & Liao, J. C. (2008) Metabolic engineering of Escherichia coli for 1-butanol
and 1-propanol production via the keto-acid pathways. Metabolic Engineering, 10, 312-
320.
40. Lutz, R. & Bujard, H. (1997) Independent and tight regulation of transcriptional units
in Escherichia Coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements.
Nucleic Acids Research, 25, 1203-1210.
41. Danino, T., Mondragon-Palomino, O., Tsimring, L. & Hasty, J. (2010) A synchronized
quorum of genetic clocks. Nature, 463, 326-330.
42. Gronenborn, B. (1976) Overproduction of phage Lambda repressor under control of the
lac promotor of Escherichia coli. Molecular and General Genetics, 148, 243-250.
43. Terpe, K. (2006) Overview of bacterial expression systems for heterologous protein
production: from molecular and biochemical fundamentals to commercial systems.
Applied Microbiology and Biotechnology, 72, 211-222.
35
44. Brosius, J., Erfle, M. & Storella, J. (1985) Spacing of the -10 and -35 regions in the tac
promoter: effect on its in vivo activity. Journal of Biological Chemistry, 260, 3539-3541.
45. Studier, F. W. & Moffatt, B. A. (1986) Use of bacteriophage T7 RNA polymerase to direct
selective high-level expression of cloned genes. Journal of Molecular Biology, 189, 113-
130.
46. Elvin, C. M., Thompson, P. R., Argall, M. E., Philip Hendr, N., Stamford, P. J., Lilley, P.
E. & Dixon, N. E. (1990) Modified bacteriophage lambda promoter vectors for
overproduction of proteins in Escherichia coli. Gene, 87, 123-126.
47. Skerra, A. (1994) Use of the tetracycline promoter for the tightly regulated production of
a murine antibody fragment in Escherichia coli. Gene, 151, 131-135.
48. Guzman, L., Belin, D., Carson, M. & Beckwith, J. (1995) Tight regulation, modulation,
and high-level expression by vectors containing the arabinose PBAD promoter. Journal of
Bacteriology, 177, 4121-4130.
49. Lee, S. K., Newman, J. D. & Keasling, J. D. (2005) Catabolite repression of the
propionate catabolic genes in Escherichia coli and Salmonella enterica: evidence for
involvement of the cyclic AMP receptor protein. Journal of Bacteriology, 187, 2793-2800.
50. Ham, T. S., Lee, S. K., Keasling, J. D. & Arkin, A. P. (2006) A tightly regulated inducible
expression system utilizing the fim inversion recombination switch. Biotechnology and
Bioengineering, 94, 1-4.
51. Andersen, J. B., Sternberg, C., Poulsen, L. K., Bjorn, S. P., Givskov, M. & Molin, S.
(1998) New unstable variants of Green Fluorescent Protein for studies of transient gene
expression in bacteria. Applied and Environmental Microbiology, 64, 2240-2246.
52. Miller, W. G., Leveau, J. H. J. & Lindow, S. E. (2000) Improved gfp and inaZ broad-
host-range promoter-probe vectors. Molecular Plant-Microbe Interactions, 13, 1243-1250.
53. Tombolini, R., Unge, A., Davey, M. E., de Bruijn, F. J. & Jansson, J. K. (1997) Flow
cytometric and microscopic analysis of GFP-tagged Pseudomonas fluorescens bacteria.
FEMS Microbiology Ecology, 22, 17-28.
54. Karzai, A. W., Roche, E. D. & Sauer, R. T. (2000) The SsrA-SmpB system for protein
tagging, directed degradation and ribosome rescue. Nature Structural & Molecular
36
Biology, 7, 449-455.
55. McGinness, K. E., Baker, T. A. & Sauer, R. T. (2006) Engineering controllable protein
degradation. Molecular Cell, 22, 701-707.
56. Blattner, F. R., Plunkett, G., Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-
Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W.,
Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B. & Shao, Y. (1997) The Complete
genome sequence of Escherichia coli K-12. Science, 277, 1453-1462.
57. Utsumi, R., Brissette, R., Rampersaud, A., Forst, S., Oosawa, K. & Inouye, M. (1989)
Activation of bacterial porin gene expression by a chimeric signal transducer in
response to aspartate. Science, 245, 1246-1249.
58. Gambetta, G. A. & Lagarias, J. C. (2001) Genetic engineering of phytochrome
biosynthesis in bacteria. Proceedings of the National Academy of Sciences of the United
States of America, 98, 10566-10571.
59. Datta, S., Costantino, N. & Court, D. L. (2006) A set of recombineering plasmids for
gram-negative bacteria. Gene, 379, 109-115.
60. Cherepanov, P. P. & Wackernagel, W. (1995) Gene disruption in Escherichia coli: TcR
and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance
determinant. Gene, 158, 9-14.
61. Datsenko, K. A. & Wanner, B. L. (2000) One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proceedings of the National Academy of
Sciences of the United States of America, 97, 6640-6645.
62. Tabor, J. J., Salis, H. M., Simpson, Z. B., Chevalier, A. A., Levskaya, A., Marcotte, E. M.,
Voigt, C. A. & Ellington, A. D. (2009) A synthetic genetic edge detection program. Cell,
137, 1272-1281.
63. Russell, J. S. a. D. W. (2001) Molecular Cloning- A Laboratory Manual, Cold Spring
Harbor Laboratory Press.
64. Jensen, P. R. & Hammer, K. (1998) The sequence of spacers between the consensus
sequences modulates the strength of prokaryotic promoters. Applied and Environmental
Microbiology, 64, 82-87.
37
65. Na, D. & Lee, D. (2010) RBSDesigner: software for designing synthetic ribosome
binding sites that yields a desired level of protein expression. Bioinformatics, 26, 2633-
2634.
66. Gardner, T. S., Cantor, C. R. & Collins, J. J. (2000) Construction of a genetic toggle
switch in Escherichia coli. Nature, 403, 339-342.
67. Dodd, I. B., Perkins, A. J., Tsemitsidis, D. & Egan, J. B. (2001) Octamerization of λ CI
repressor is needed for effective repression of PRM and efficient swiching from lysogeny.
Genes & Development, 15, 3013-3022.
68. Dodd, I. B., Shearwin, K. E., Perkins, A. J., Burr, T., Hochschild, A. & Egan, J. B. (2004)
Cooperativity in long-range gene regulation by the λ CI repressor. Genes & Development,
18, 344-354.
69. Gambetta, G. A. & Lagarias, J. C. (2001) Genetic engineering of phytochrome
biosynthesis in bacteria. Proceedings of the National Academy of Sciences, 98, 10566-
10571.
70. Park, C.-M., Shim, J.-Y., Yang, S.-S., Kang, J.-G., Kim, J.-I., Luka, Z. & Song, P.-S.
(2000) Chromophore−apoprotein interactions in Synechocystis sp. PCC6803
Phytochrome Cph1. Biochemistry, 39, 6349-6356.
71. Murphy, K. F., Balázsi, G. & Collins, J. J. (2007) Combinatorial promoter design for
engineering noisy gene expression. Proceedings of the National Academy of Sciences, 104,
12726-12731.
72. Hunziker, A., Tuboly, C., Horváth, P., Krishna, S. & Semsey, S. (2010) Genetic flexibility
of regulatory networks. Proceedings of the National Academy of Sciences, 107, 12998-
13003.
73. Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R. & Church, G. M.
(2009) Programming cells by multiplex genome engineering and accelerated evolution.
Nature, 460, 894-898.
74. Pitera, D. J., Paddon, C. J., Newman, J. D. & Keasling, J. D. (2007) Balancing a
heterologous mevalonate pathway for improved isoprenoid production in Escherichia
coli. Metabolic Engineering, 9, 193-207.
38
75. Nielsen, J. (2001) Metabolic Turnover. John Wiley & Sons, Ltd.
76. Hasona, A., Kim, Y., Healy, F. G., Ingram, L. O. & Shanmugam, K. T. (2004) Pyruvate
formate lyase and acetate kinase are essential for anaerobic growth of Escherichia coli
on xylose. Journal of Bacteriology, 186, 7593-7600.
77. Underwood, S. A., Buszko, M. L., Shanmugam, K. T. & Ingram, L. O. (2002) Flux
through citrate synthase limits the growth of ethanologenic Escherichia coli KO11
during xylose fermentation. Applied and Environmental Microbiology, 68, 1071-1081.
78. Yang, Y.-T., Aristidou, A. A., San, K.-Y. & Bennett, G. N. (1999) Metabolic flux analysis
of Escherichia coli deficient in the acetate production pathway and expressing the
Bacillus subtilis acetolactate synthase. Metabolic Engineering, 1, 26-34.
79. Gorke, B. & Stulke, J. (2008) Carbon catabolite repression in bacteria: many ways to
make the most out of nutrients. Nature Review Microbiology, 6, 613-624.
80. Khankal, R., Chin, J., Ghosh, D. & Cirino, P. (2009) Transcriptional effects of CRP*
expression in Escherichia coli. Journal of Biological Engineering, 3, 13.
39
Acknowledgements
그 어느 시기보다 치열했던 대학원의 생활이 어느덧 끝이 났습니다. 비록 짧은 2년 동
안의 석사과정이었지만 오늘의 이 부족한 논문을 낼 수 있기까지 많은 분들의 도움이 있
어 이렇게 감사의 인사를 전합니다.
먼저, 학문을 탐구하고 연구를 수행하는 방법이 무엇인지 잘 알려주신 이성국 지도 교
수님께 감사의 인사를 드립니다. 그리고 바쁘신 와중에도 저의 논문을 심사해주신 김철
민 교수님, 김태성 교수님 감사합니다. 차분한 논리와 프레젠테이션 방법에 대해서 자세
히 설명해주셨던 최성득 교수님, 미생물의 생리에 대해서 이해할 수 있도록 큰 도움을
주셨던 미첼 교수님, 그리고 영어 논문 작성하는 방법에 많은 도움을 주셨던 김정연 언
어교육원장님께 감사의 마음 전합니다.
실험실 생활을 잘 할 수 있도록 옆에서 든든한 힘이 되어준 합성생물학 실험실원 모두
감사인사 드립니다. 아무것도 없었던 실험실 초창기에 서로에게 힘이 되어준 기광이형,
수현이 감사하며, 성실한 모습으로 묵묵히 실험하는 법을 보여준 정민이, 그 누구보다 자
기 일처럼 물심양면 도움을 준 비누, 따뜻한 연구 조언 주신 류영신, 김구희 선생님과 결
실의 기쁨을 나누고 싶습니다. 그리고 고마운 이름들이 너무 많아서 다 넣을 순 없지만,
가끔씩 힘들었던 대학원 생활에 활력을 주었던 기숙사 룸메이트들, 축구 친구들 그리고
주변 동료들께도 못 다 전한 감사의 마음 전합니다.
항상 아들 잘되길 바라며 지원해주신 부모님께 큰 감사 인사 드립니다. 그리고 옆에서
응원해 준 동생 수빈이에게 감사 인사 전합니다. 끝으로 학위기간 동안 즐거운 일, 힘들
었던 모든 일들을 옆에서 함께 극복해준 제 인생의 동반자인 혜림이에게 사랑의 마음 전
하면서 감사의 인사를 마치겠습니다. 다시 한번 모두에게 감사 드립니다.
40
41
Hard cover