differential expression, regulation, and induction of smads, transforming growth factor-β signal...

Differential Expression, Regulation, and Induction ofSmads, Transforming Growth Factor-� SignalTransduction Pathway in Leiomyoma, and MyometrialSmooth Muscle Cells and Alteration by Gonadotropin-Releasing Hormone Analog

JINGXIA XU, XIAOPING LUO, AND NASSER CHEGINI

Department of Obstetrics/Gynecology, University of Florida, Gainesville, Florida 32610

The objective of this study was to further elucidate the role ofTGF� and GnRH analog (GnRHa) in leiomyoma growth andregression. We examined the expression of Smads, TGF� re-ceptor intracellular signaling molecules, in leiomyoma andmyometrial smooth muscle cells (LSMC and MSMC), and de-termined whether TGF� and GnRHa differentially regulatetheir expression and induction in these cells. Using semiquan-titative RT-PCR, Western blot analysis, and immunohisto-chemistry, we demonstrated that leiomyoma, myometrium,LSMC, and MSMC express receptor-activated Smad3, com-mon Smad4, and the inhibitory Smad7 mRNA and protein andshowed that TGF�1, in a time-dependent manner, transientlyinduced Smad7 expression, with Smad3 and Smad4 remaininglargely unchanged. TGF�1 increased the rate of Smad andphosphorylated Smad3 (pSmad3) induction in both cell types.

Pretreatment with TGF� type II receptor antisense oligonu-cleotide resulted in a trend toward a lower TGF�-inducedpSmad3. GnRHa, in a dose- and time-dependent manner, in-creased the expression of Smad7 mRNA and the rapid induc-tion of Smad3, Smad4, and Smad7 as well as pSmad3, whichdeclined to control values at doses above 1 �M in MSMC, butnot in LSMC. GnRHa-induced pSamd3 was partly inhibited bya GnRH antagonist (antide). We concluded that leiomyoma,myometrium, LSMC, and MSMC express Smads, which aredifferentially expressed, induced, and activated by TGF� andare altered as a result of GnRHa treatment. These resultssuggest that TGF� and GnRHa mediate their actions throughcross-talk involving Smads and most likely other signalingpathways that result in leiomyoma growth and regression.(J Clin Endocrinol Metab 88: 1350–1361, 2003)

LEIOMYOMAS ARE BENIGN uterine tumors consideredto originate from cellular transformation of myometrial

smooth muscle cells and/or connective tissue fibroblastsduring the reproductive years. The identity of factors thatinitiate such cellular transformation is not known; however,ovarian steroids are essential for leiomyoma growth, andGnRH analog (GnRHa) therapy, creating a hypoestrogeniccondition, is often used for their medical management (1, 2).GnRHa-induced leiomyoma regression is accompanied byalterations in uterine arteriole size, blood flow, and cellularcontent as well as changes in the expression of several growthfactors, cytokines, extracellular matrix, proteases, and pro-tease inhibitors (reviewed in Refs. 3 and 4). Differential ex-pression and autocrine/paracrine action of many of thesemolecules are considered to play a central role in leiomyomagrowth and GnRHa-induced regression (3, 4).

TGF�, a multifunctional cytokine, is a key regulator ofcellular migration, growth and differentiation, inflamma-tion, extracellular matrix (ECM) turnover and tissue remod-eling (5, 6). Overproduction of TGF� is widely accepted asa key element in tissue fibrosis, acting through a mechanisminvolving enhanced cell migration, expression, and deposi-

tion of various ECM with concurrent inhibition of proteasesthat accelerate ECM degradation (6). Leiomyoma is a fibroticdisorder in which TGF� and TGF� receptors are overex-pressed compared with normal unaffected myometrium,and GnRHa-induced leiomyoma regression is accompaniedby down-regulation of their expression (7). Under in vitroconditions, TGF� regulates its own expression, the expres-sion of ECM, matrix metalloproteinases, and tissue inhibitorof matrix metalloproteinases as well as the growth of leiomy-oma and myometrial smooth muscle cells (8–11). In addition,GnRHa treatment has been shown to down-regulate TGF�-and ovarian steroid-induced TGF� expression in these cells(11).

TGF� mediates its biological activity from the cell surfaceto the nucleus through the activation of serine/threoninekinase TGF� receptors and subsequent activation of multipleintracellular signals, including Smads (reviewed in Ref. 12).Smads are comprised of regulatory (Smad1, -2, -3, -5, and –8;RSmad), common (Smad4), and inhibitory (Smad6 and -7)types, of which the pathway-specific RSmads become phos-phorylated by activated TGF� type I receptor kinase, asso-ciate with Smad4, and translocate into the nucleus (13, 14).The inhibitory Smad7 interacts with TGF� type I receptorand prevents the phosphorylation of RSmad that leads tointerruption of TGF� receptor signaling (13, 14). Similar toTGF�, Smads are expressed by various normal and malig-nant cell and tissues. Gene mutation and/or alteration of

Abbreviations: ECM, Extracellular matrix; ERK, extracellular signal-regulated kinase; GnRHa, GnRH analog; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; LA, leuprolide acetate; LSMC, leiomyomasmooth muscle cell; MSMC, myometrial smooth muscle cell; PKC, pro-tein kinase C; RSmad, regulatory Smad.

0013-7227/03/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 88(3):1350–1361Printed in U.S.A. Copyright © 2003 by The Endocrine Society

doi: 10.1210/jc.2002-021325

1350

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 27 November 2014. at 19:09 For personal use only. No other uses without permission. . All rights reserved.

Smad expression have been associated with several abnor-malities, including resistance to growth inhibitory action ofTGF�, matrix expression, and malignancies (15–17).

We hypothesized that overexpression of TGF� and TGF�receptor in leiomyoma leads to alteration of TGF� intracel-lular signaling and the underlying mechanism of TGF� ac-tion. We also hypothesized that GnRHa-induced leiomyomaregression, which results in down-regulation of TGF� andTGF� receptors, also alters the components of the TGF�signal transduction pathway. To test our hypothesis we firstdetermined the expression and cellular localization of Smadsin leiomyoma and myometrium. We then isolated leiomy-oma and myometrial smooth muscle cells (LSMC andMSMC) to determine 1) whether LSMC and MSMC expressSmad3, Smad4, and Smad7; 2) whether TGF� regulates theexpression and induction of Smads; and 3) if their expressionand induction are altered by GnRHa.

Materials and Methods

All of the materials for collection of leiomyoma and myometrium,isolation and culturing of their smooth muscle cells, as well as semi-quantitative RT-PCR, Western blotting, and immunohistochemistrywere purchased from commercial sources, as previously described (18).Recombinant human TGF�1 was purchased from R&D Systems, Inc.(Minneapolis, MN). Affinity-purified mouse monoclonal anti-Smad4,rabbit antiphosphorylated Smad3 (pSmad3), goat anti-Smad3, and rab-bit anti-Smad7 were purchased from Santa Cruz Biotechnology, Inc.(Santa Cruz, CA). Additional polyclonal antibody generated againstSmad7 was provided by Dr. Carl-Henrik Heldin (Ludwig Institute forCancer Research, Uppsala, Sweden). Monoclonal antibody specific tohuman �-actin was purchased from Sigma-Aldrich (St. Louis, MO).

Portions of leiomyoma and matched myometrium were collectedfrom premenopausal women who were undergoing hysterectomy forsymptomatic uterine leiomyomas. These patients had not taken anymedication during the previous 3 months before surgery. The tissueswere collected at the University of Florida-affiliated Shands Hospitalwith the approval of the institutional review board. Immediately aftercollection, portions of leiomyoma and matched normal myometriumwere snap-frozen and stored in liquid nitrogen, fixed in Bouin’s solutionfor immunohistochemistry, or prepared for isolation of LSMC andMSMC as previously described (19). The isolated LSMC and MSMCwere cultured in DMEM/Ham’s F-12 containing antimycotic, antibioticsand 10% fetal bovine serum and incubated at 37 C in a humidified 5%CO2 incubator until reaching visual confluence. Before their use in theseexperiments the cell cultures were characterized using � smooth muscleactin, desmin, and vimentin antibodies as previously described (19).

To determine the expression of Smad-3, -4, and -7 mRNA and proteinin leiomyoma and myometrium, total RNA and protein were extractedfrom these tissues and subjected to semiquantitative RT-PCR and West-ern blot analysis, and their cellular localization was determined usingimmunohistochemistry as previously described (7, 18). Total cellularRNA was isolated using TRIzol (Life Technologies, Inc., Grand Island,NY), and an equal amount of RNA (2 �g) was converted to cDNA byRT. The PCR reaction was carried out over a range of 25–35 cycles toobtain the optimal condition within the logarithmic phase of amplifi-cation with primers (Table 1) for Smad3, Smad4, Smad7, and glyceral-dehyde-3-phosphate dehydrogenase (G3PDH; Mastercycler-Gradient,Eppendorf Scientific, Westbury, NY). The cDNA was then subjected to30–35 cycles of PCR at 95 C (1 min), 55–61 C (0.5 min), and 72 C (1 min)in reaction buffer containing 1.5 mm MgCl2. The PCR products wereseparated on 1% agarose gels containing ethidium bromide, and theimages were captured on a Kodak DC290 digital camera (EastmanKodak Co., Rochester, NY) and stored as TIFF files. The relative banddensity was determined using Kodak EDAS and/or NIH Image (version1.6) densitometry software and was reported as the fold change in theratio of Smad/G3PDH mRNA.

For Western blotting, total protein was isolated from small pieces ofleiomyoma and myometrium by homogenization (Polytron, Brinkmann

Instruments, Inc.-Eppendorf, Westbury, NY) in a buffer containing 50mm HEPES (pH 7.4), 1% Nonidet P-40, 0.5% deoxycholate, 5 mm EDTA,1 mm sodium ortho-vanadate, 5 mm NaF, and phosphatase and proteaseinhibitor cocktails (Sigma-Aldrich). The lysates were centrifuged at14,000 � g for 15 min at 4 C, the supernatants were collected, their totalprotein content was determined using a conventional method (PierceChemical Co., Rockford, IL), and aliquots were stored at –80 C untilassayed. Equal amounts of sample proteins were resolved using 10%SDS-PAGE and transferred to a polyvinylidene difluoride membrane byelectroblotting in a buffer containing Tris-HCl (25 mm), glycine (192mm), and methanol (20%, v/v). After transfer, the blots were incubatedin 5% powdered milk in Tween/Tris-buffered saline [10 mm Tris-HCl(pH 7.5), 0.15M NaCl, and 0.1% Tween 20] at room temperature for 1 h,then incubated with anti-Smad3, -Smad4, and -Smad7 and pSmad3antibodies overnight at 4 C, washed with Tween/Tris-buffered saline,and exposed to corresponding horseradish peroxidase-conjugated IgGfor 1 h. Immunostained proteins were visualized using enhanced chemi-luminescence reagents ( Amersham Pharmacia Biotech, Piscataway, NJ)and captured by Kodak DC290 camera, and the band intensity wasdetermined using Kodak and NIH image software.

For immunohistochemistry small portions of leiomyoma and myo-metrium were fixed in Bouin’s solution and paraffin-embedded andtissue sections 3–5 �m thick were prepared. Following standard pro-cedures that included pretreatments with Triton X-100 and protease, thesections were incubated with anti-Smad3, -4, and -7 and pSmad2/3antibodies at 5 �g immunoglobulin G/ml prepared in PBS, pH 7.4,containing 0.01% BSA (18). The sections were then exposed to biotin-ylated secondary antibodies, avidin horseradish peroxidase (Vector Lab-oratories, Inc., Burlingame, CA), chromogenic reaction was developedusing 3,3�-diaminobenzidine, and sections were counterstained withhematoxylin. Tissue sections incubated with normal IgG instead of theprimary antibodies or deletion of the primary antibodies during im-munostaining served as controls.

To determine whether LSMC and MSMC express Smads, the cellswere cultured in six-well dishes at an approximate density of 106 cells/well. After 48 h or until cells reached subconfluence by visual inspection,total cellular RNA and protein were isolated and subjected to semi-quantitative RT-PCR and Western blot analysis as described above. Thecells were lysed in the above buffer, their total protein content wasdetermined, and an equal amount of protein was subjected to Westernblot analysis. To determine whether TGF�1 regulates Smad mRNA andprotein expression, serum-starved LSMC and MSMC, cultured as de-scribed above, were treated with TGF�1 at 2.5 ng/ml for 2–24 h. TotalRNA and protein were isolated and subjected to semiquantitative RT-PCR and Western blot analysis, respectively. To determine whetherTGF�1 induces and activates Smads, serum-starved LSMC and MSMCwere treated with TGF�1 at doses of 1–5 ng/ml for 5–30 min. Totalprotein was isolated from TGF�-treated and untreated cells and sub-jected to Western blot analysis. To determine the autocrine/paracrineaction of TGF�1 on Smad induction and activation, serum-starvedLSMC and MSMC were treated with TGF� type II receptor antisense orsense 20-mer oligonucleotide at 1 �m for 24 h as previously described(11). The cells were washed and treated with 2.5 ng/ml TGF�1 for 15min, and total protein was isolated and subjected to Western blotanalysis.

To determine whether GnRHa alters the expression of Smads, serum-starved LSMC and MSMC were treated with GnRHa [leuprolide acetate(LA), Sigma-Aldrich] at 0.1 �m for 2–24 h. Total RNA and protein wereisolated and subjected to semiquantitative RT-PCR and Western blot

TABLE 1. PCR primers used

TargetmRNA Primer sequence Predicted

size

Smad3 Forward: GGGCTCCCTCATGTCATCTA 443 bpReverse: GGCTCGCAGTAGGTAACTGG

Smad4 Forward: CCCAGGATCAGTAGGTGGAA 451 bpReverse: CCATGCCTGACAAGTTCTGA

Smad7 Forward: TCCTGCTGTGCAAAGTGTTC 448 bpReverse: TTGTTGTCCGAATTGAGCTG

G3PDH Forward: TGTGAACCATGAGAAGTATGACAACAG 303 bpReverse: ACACGGAAGGCCATGCCAGT

Xu et al. • Smads and Leiomyoma J Clin Endocrinol Metab, March 2003, 88(3):1350–1361 1351


analysis, respectively. To determine whether GnRHa alters Smad in-duction, serum-starved cells were treated with 0.1 �m LA for 5–30 minor 0.001–10 �m LA for 15 min. Total protein were isolated and subjectedto Western blot analysis. The specificity of LA action on Smad inductionwas determined by treatment of serum-starved LSMC and MSMC withthe GnRH antagonist, antide (Sigma-Aldrich) at 10 �m for 15 min beforeexposure to 0.1 �m LA for 15 min. To determine whether LA altersTGF�-induced pSmad3, LSMC and MSMC were treated with LA (0.1�m), TGF�1 (2.5 ng/ml), or LA plus TGF�1 for 15 min. Total cellularprotein was isolated and subjected to Western blot analysis. To deter-mine whether LA action is independent of TGF� receptor-mediatedsignaling, LSMC were treated with TGF� type II receptor antisense andor sense oligomers for 24 h as described above and then exposed to LA(0.1 �m) for 15 min. Total cellular protein was isolated and subjected toWestern blot analysis to determine the rate of pSmad3 induction. Theresults were compared with TGF�1, used at 2.5 ng/ml.

All of the experiments were performed using at least two or threeseparate cell cultures prepared from different tissues and were pre-formed in duplicate. The results were expressed as the mean � sem andwere statistically analyzed using nonparametric Kruskal-Wallis andWilcoxon rank tests with SigmaStat (Jandel Corp., San Rafael, CA)software; P � 0.05 was considered significant.

ResultsExpression of Smads in leiomyoma and myometrium

Before isolating the myometrial and leiomyoma smoothmuscle cells for in vitro studies, we examined whether myo-

metrium and leiomyoma expresses Smad mRNA and pro-tein. As shown in Fig. 1, leiomyoma and myometrium ex-press mRNA (A) and protein (B) for Smad3, Smad4, andSmad7 and contain phosphorylated Smad3 (pSmad3).Smad3 and Smad4 were localized in the cytoplasm ofleiomyoma and myometrial smooth muscle cells, connec-tive tissue fibroblasts, and vasculature, whereas Smad7

FIG. 1. A, Semiquantitative RT-PCR ofSmad3, Smad4, Smad7, and G3PDH(lower bands) mRNA expression inleiomyoma (L) and matched myome-trium (M) from two patients (DM, DNAmarker). B, Western blot analysis ofSmad3, Smad4, Smad7, and pSmad3(arrows) in leiomyoma (L) and matchedmyometrium (M) from three patients.C, Immunolocalization of Smad3 (a),Smad4 (b), Smad7 (c), and pSmad3 (d)in leiomyoma associated with smoothmuscle cell cytoplasm (a and b), cyto-plasmic/nuclear (c), and nuclear (d) re-gions. Magnification, �110.

FIG. 2. Semiquantitative RT-PCR of Smad3, Smad4, Smad7 (ar-rows), and G3PDH (lower bands) mRNA expression using total RNAisolated from LSMC and MSMC cultured for 48 h. Western blotanalysis of the cell lysates prepared from these cells using antibodiesspecific to Smad3, Smad4, Smad7, and pSmad3 are shown in the lowerpanels (protein).

1352 J Clin Endocrinol Metab, March 2003, 88(3):1350–1361 Xu et al. • Smads and Leiomyoma


was localized in both cytoplasm and nuclear regions, andpSmad3 was principally localized in the nuclear region(Fig. 1C). Furthermore, as shown in Fig. 2, LSMC andMSMC isolated from these tissues and maintained in cul-ture also express Smad3, Smad4, and Smad7 mRNA andprotein and pSmad3 (Fig. 2).

Regulation of Smad expression by TGF�

We then determined whether the expression of Smads inMSMC and LSMC is regulated by TGF�. Treatment ofMSMC and LSMC with TGF�1 (2.5 ng/ml) for 2–24 h re-sulted in a moderate induction of Smad7 mRNA expression

FIG. 3. Time-dependent action of TGF�1 (2.5 ng/ml) onSmad3, Smad4, and Smad7 mRNA (A and B) and protein(C and D) expression in MSMC and LSMC. Serum-starvedMSMC and LSMC were treated with TGF�1 for 2–24 h,and total RNA and protein were isolated from treated anduntreated control (Crtl or time zero) and subjected to semi-quantitative RT-PCR, coamplifying Smads (arrows, upperbands), and G3PDH (lower bands; M, DNA marker). Thebar graph (B) shows the mean � SEM fold change in theratio of Smad7/G3PDH mRNA expression in MSMC andLSMC, with b, c, d, and e� statistically different from a anda�, respectively (P � 0.05). C, Western blot analysis ofSmad7 in MSMC and LSMC and of �-actin in MSMC(control) in cell lysates prepared from TGF�1-treated anduntreated controls, with the bar graph (D) showing thefold change in Smad7 band intensity, and b–f and b�–f�statistically different from a and a�, respectively(P � 0.05).



in MSMC and a trend toward higher expression in LSMC(Fig. 3, A and B) without significantly affecting Smad3 andSmad4 mRNA expression (bar graphs not shown). TGF�1treatment also altered Smad protein expression in MSMCand LSMC, in which it had a limited effect on Smad3 andSmad4 (not shown), but increased Smad7 expression in bothLSMC and MSMC after 2–12 h of exposure, which declinedafter 24 h compared with that in untreated control (Fig. 3, Cand D). The results suggest that TGF�1 has a limited regu-latory effect on Smad3 and Smad4 expression in MSMC andLSMC; however, it induced Smad7, where, through a feed-back interaction, it can regulate TGF� action in these cells.

Induction of Smads by TGF�

In addition to regulating Smad expression, TGF� mediatesits action through the induction and activation of Smads. Wefound that treatment of MSMC and LSMC with TGF�1 (1, 2.5,and 5 ng/ml) for 15 min increased the rate of Smad3 andSmad7 activity, whereas it decreased Smad4 induction inMSMC at high concentration compared with that in un-

treated control (Figs. 4). TGF� also increased the rate ofpSmad3 activity in both MSMC and LSMC compared withuntreated controls (Fig. 4). TGF�1-inducted Smad3, Smad4,Smad7, and pSmad3 occurred in a time-dependent manner,with some difference between LSMC and MSMC (Fig. 5).TGF�1-induced pSmad3 was in part abrogated after pre-treatment of the cells with TGF� type II receptor antisense,but not sense, oligonucleotide (see Fig. 11). These resultsindicate that TGF�1 rapidly induces and activates Smads inboth LSMC and MSMC, with some differences in their re-sponses that could lead to differential downstream transcrip-tional response to TGF� as described in other cell types(8, 13).

Alteration of Smad expression by GnRHa

Because leiomyoma and myometrium as well as LSMCand MSMC express GnRH and GnRH receptors, and GnRHaalters the expression of TGF� and TGF� receptors, we in-vestigated whether GnRHa alters the expression, induction,and activation of Smads. We found that treatment of serum-

FIG. 4. Dose-dependent action of TGF�1 (1, 2.5, and 5 ng/ml) on Smad3, Smad4, Smad7, and phospho-Smad3 (pSmad3) induction in LSMCand MSMC. Serum-starved MSMC and LSMC were treated with TGF�1 for 15 min, and cell lysates were prepared and analyzed by Westernblotting, with �-actin as the loading control. Bar graphs show the mean � SEM fold change in Smad7 and pSmad3 band intensity, with b, c,and d significantly different from a, and b�, c�, and d� significantly different from a� (P � 0.05).



starved LSMC and MSMC with GnRHa (LA) had a limitedeffect on Smad3 and Smad4 mRNA and protein expression(not shown); however, in a time-dependent manner (2–24 h),GnRHa increased Smad7 mRNA expression in MSMC, witha trend toward an increase in LSMC (Fig. 6). GnRHa, in adose- and time-dependent manner, also resulted in a rapidinduction of Smad3, Smad4, and Smad7 in MSMC andLSMC, which were either dose or time dependent (Fig. 7, Aand B, and Fig. 8). However, GnRHa increased the rate ofpSmad3 induction at a lower dose in MSMC, which returned

to control levels (Fig. 7B) or lower (Fig. 8) at a dose of 1 �mor higher, whereas in LSMC, pSmad3 activity displayed atrend toward an increase, except with GnRHa at 1 �m after5 min of incubation (Figs. 7B and 8). These results providefurther support for the direct action of GnRHa on leiomyomaand myometrium, suggesting that GnRH receptor, eitherdirectly or most likely through activation of other signalingpathways, interacts with TGF� receptor signaling that alterspSmad3 induction in the absence of a significant change inSmad3 (20). Although pretreatment of MSMC and LSMC

FIG. 5. Time-dependent action of TGF�1 (2.5 ng/ml) on Smad3, Smad4, Smad7, and pSmad3 induction in LSMC and MSMC. Serum-starvedcells were treated with TGF�1 for 5, 10, and 15 min, and cell lysates from TGF�1-treated and untreated control (time zero) were prepared andanalyzed by Western blotting, with �-actin as the loading control. The bar graphs show the mean � SEM fold change in Smads band intensityfrom three different experiments performed in duplicate. Smad3 and Smad4: a is significantly different from c, and a� is different from b� andc�. Smad7: b is significantly different from a, and b� and d� are different from a�. pSmad3: b, c, and d are significantly different from a, andb and c are different from a and d (P � 0.05).



with GnRH antagonist (antide) resulted in partial reversal ofGnRHa action, antide alone also increased pSmad3, despiteinconsistency in its action (Fig. 9). This may be due to in-teractions of GnRHa and antide with two types of GnRHreceptors in these cells that are alternatively and indepen-dently activated by GnRH agonists and antagonists (21–25).

To determine whether GnRHa (LA) alters TGF�1-inducedpSmad3, LSMC and MSMC were cotreated with LA (0.1 �m)and TGF�1 (2.5 ng/ml) for 15 min. TGF�1 increased pSmad3activation in these cells compared with LA-treated or un-treated controls; however, cotreatment of the cells withTGF�1 and LA resulted in a reduction in TGF�-inducedpSmad3, suggesting possible cross-talk between GnRH andTGF� receptor signaling pathways (Fig. 10). Furthermore,blocking/reducing the expression of TGF� type II receptorto prevent TGF� autocrine/paracrine action indicated thatpretreatment of the cells with TGF� type II receptor antisenseoligonucleotide reduced TGF�1-induced pSmad3 activationcompared with sense oligonucleotide-treated or untreatedcontrol (Fig. 11). However, treatment of the cells with TGF�type II receptor antisense and sense oligonucleotides alsoresulted in a slight increase in pSmad3, possibly due to thepresence of a low level of serum in the media that containTGF�. LA treatment of these cells resulted in a reduction inpSmad3 (Fig. 11).

Discussion

The expression and action of TGF� isoforms and TGF�receptors have been documented in leiomyoma and myo-metrium and their isolated smooth muscle cells (9, 10, 26, 27).Recent studies have established that TGF� receptors mediatetheir action through multiple pathways, including Smadsthat mediate TGF� receptor signals from the cell surface tothe nucleus, resulting in transcriptional activation of TGF�-responsive genes (for review, see Ref. 13). In the presentstudy we demonstrated that leiomyoma and myometrialsmooth muscle cells express some member of the Smad fam-ily, the regulatory Smad3, common Smad4, and inhibitorySmad7. In leiomyoma and myometrium, Smad3, -4, and -7were localized in both cytoplasmic and nuclear regions ofvarious cell types, including LSMC and MSMC, with nuclearlocalization of phosphorylated Smad3. Because binding ofTGF� leads to phosphorylation of TGF� type I receptor andcauses a rapid phosphorylation of Smad3, which interactswith Smad4, and translocation into the nucleus, nuclear lo-calization of pSmad3 in leiomyoma and myometrial smoothmuscle cells suggests that an autocrine/paracrine action ofTGF� may result in activation of Smads in these cells. Smad7is primarily localized in the nucleus in the absence of ligand,but accumulates in the cytoplasm upon receptor activation.The presence of both cytoplasmic and nuclear Smad7 inleiomyoma and myometrial smooth muscle cells furtherpoints to partial activation of the Smad pathway, possibly byan autocrine/paracrine action of TGF�. We further demon-strated that isolated MSMC and LSMC prepared and main-tained in culture also express Smad3, -4, and -7. Constitutiveexpression of Smads in leiomyoma and myometrium as wellas their isolated smooth muscle cells indicates that these cellspossess the necessary components of the TGF� signalingpathway that can be recruited and activated by TGF�.

We demonstrated that Smad expression, induction, andactivation were differentially regulated by TGF�1 in LSMCand MSMC. TGF�1 had a limited effect on the expression ofSmad3 and Smad4; however, it increased Smad7 mRNAexpression in MSMC, with a limited effect on LSMC, whileincreasing Smad7 protein in both cells. Differential regula-tion of Smad expression has been reported in several othercell types, including the induction of Smad7 expression inskin fibroblasts and Mv1Lu and HaCaT cell lines, as well asinhibition of Smad3 expression in skin fibroblasts, but not inMDA-MB468, a human breast cancer cell line deficient inSmad4 (28, 29). Differential regulation of Smad7 by TGF� isconsidered to act as a feedback mechanism to control TGF�signaling (29–31). Such regulation of Smad7 by TGF� inMSMC and LSMC may result in changes in Smad7 antago-nistic action that lead to alteration of cell proliferation, ap-optosis, and ECM accumulation in leiomyoma comparedwith myometrium (32–36). Despite limited regulation ofSmad3 and Smad4, their constitutive expression in LSMCand MSMC indicates that these cells, like many other celltypes, contain the necessary signaling components to re-spond to TGF� action. However, factors that regulate TGF�expression, i.e. ovarian steroids, may also influence Smadexpression, thus regulating TGF�-mediated local action inleiomyoma and myometrium.

FIG. 6. Time-dependent action of GnRHa (LA) at 0.1 �M on Smad3,Smad4, and Smad7 mRNA expression in MSMC and LSMC. Serum-starved cells were treated with LA for 2–24 h, and total RNA wasisolated from treated and untreated control (Ctrl, time zero) cells andsubjected to semiquantitative RT-PCR coamplifying Smads (arrows,upper bands) and G3PDH (lower bands). The bar graph shows themean � SEM fold change in the ratio of Smad7/G3PDH mRNA ex-pression in MSMC and LSMC determined from the band intensityfrom two different experiments performed in duplicate. b, c, and e aresignificantly different from a, and b� is different from a� (P � 0.05).M, DNA marker.



FIG. 7. The dose-dependent action of GnRHa (LA) onSmad3, Smad4, Smad7, and pSmad3 induction. Serum-starved MSMC and LSMC were treated with 0.001–10 �MLA for 15 min, and cell lysates from LA-treated and un-treated control (Crtl, time zero) were analyzed by Westernblotting, with �-actin as the loading control. Bar graphsshow the mean � SEM fold change in the band intensityfrom three different experiments. Smad4: e is signifi-cantly different from a and c, d and e are different froma�. Smad7: b, d, and e are different from a, and c� and d�are different from a. pSmad3: d, e, and f are significantlydifferent from a, and b�, c�, d�, and f are different from a�(P � 0.05).



Although overproduction of TGF� is widely accepted asa key factor in tissue fibrosis, Smad3 is proposed as a majorplayer in TGF� signaling pathways that lead to fibrogenesis(37, 38). We found that TGF�1 increased the rate of pSmad3induction in LSMC and MSMC. The action of TGF� was moreeffective in LSMC compared with MSMC, possibly due to ahigher TGF� receptor expression in leiomyoma and LSMC,resulting in enhanced activation of Smads. Because reduc-tion/inhibition of TGF� type II receptor expression resultedin lowering of TGF�1-induced pSmad3 in LSMC, the data

suggest that components of this pathway are at least in-volved in TGF� signaling. Furthermore, Smad7 functions asa dominant intracellular regulator of the TGF� signalingpathway through its interaction with activated TGF� type Ireceptor (12, 13). However, the stability of Smad7-TGF� typeI receptor interaction prevents receptor-mediated phosphor-ylation of Smad3 causing the disruption of TGF� mediatedsignaling (12, 13). Therefore, a balance between agonisticpSmad3 and inhibitory Smad7 as well as predominance intheir expression/activation may become critical in regulat-

FIG. 8. Time-dependent action of GnRHa (LA) at 0.1 �M on Smad3, Smad4, Smad7, and pSmad3 activation in LSMC and MSMC. Serum-starvedMSMC and LSMC were treated with 0.1 �M LA for 5, 10, and 15 min, and cell lysates from LA-treated and untreated controls (Ctrl, time zero)were prepared and analyzed by Western blotting, with �-actin as the loading control. The bar graphs show the mean � SEM fold change in theband intensity from three different experiments performed in duplicate. Smad3: b is significantly different from a. Smad4: b and c are differentfrom a and d. Smad7: d and d� are significantly different from a and a�, respectively. pSmad3: a and a� are significantly different from b� andc (P � 0.05).



ing the cellular response to TGF� in leiomyoma and myo-metrium during growth and regression. Inhibition of Smad7is reported to increase the cellular responsiveness to TGF�(28, 35), whereas it elevated expression resulted in inhibitionof bleomycin-induced lung fibrosis (31).

Clinically GnRHa is often used for medical managementof leiomyoma’s growth. Our results demonstrated the firstevidence that GnRHa (leuprolide acetate) differentially altersthe expression, induction and activation of Smads in LSMCand MSMC, although the biological significance of thesefinding and how GnRHa alter Smads is not clear from ourstudy. GnRHa-induced leiomyoma regression results indown-regulation of TGF� and TGF� receptors in vivo as wellas TGF�1 production and estradiol-induced TGF� expres-sion by LSMC in vitro (7, 8, 11). Our results indicated thatGnRHa alters the expression of Smad7 and pSmad3 activityin LSMA and MSMC; in other cell types GnRHa leads tochanges in the Smad-mediated transcriptional response (29,39–41). Although increased Smad7 expression could tran-siently act as a TGF� self-regulating feedback loop, a sus-tainable Smad7 expression by GnRHa could prolong theantagonistic action of Smad7. Interestingly, IFN-�-inducedSmad7 expression is reported to promote Smad7-Smurf2

complex formation and consequently increase TGF� receptorturnover (42). We found that GnRHa’s action on pSmad3 wassomewhat dependent on down-regulation of TGF� receptorexpression, which also involves TGF�’s autocrine/paracrineaction. Although our results are the first to demonstratespecific changes in the TGF� signaling pathway by GnRH,more details about how GnRH receptor-mediated actionleads to alteration of Smad expression and activation arerequired.

Signaling by TGF� receptors is not exclusively Smad de-pendent, as TGF� also activates MAPK, protein kinase C(PKC), and calcium/calmodulin, inducing Smad-indepen-dent transcriptional responses (12, 13, 43–46). These path-ways also become activated by GnRH receptors (47, 48).Because of the multifaceted activation of several signalingpathways by TGF� and GnRH receptors, understanding thecross-talk between Smad-dependent and Smad-independentpathways is necessary to sort out their complex mechanismsof action in leiomyoma. We have demonstrated that leiomy-oma and myometrium expresses extracellular signal-regu-lated kinase 1/2 (ERK1/2) and phosphorylated ERKs, whoseexpression and activation are altered because of GnRHa ther-apy (18) or by TGF�1 and GnRHa in vitro (Xu, J., X. Luo, andN. Chegini, in preparation). This suggests that TGF� andGnRH can activate multiple signaling pathways in LSMCand MSMC, including their potential cross-talk throughMAPK and Smads. Stimulation of receptor tyrosine kinase

FIG. 9. The effect of GnRH antagonist (antide), GnRHa (LA), andGnRHa plus antide on pSmad3 induction. Serum-starved LSMC werepretreated with 10 �M antide for 15 min and than treated with 0.1 �MLA for an additional 15 min. The cell lysates from treated and un-treated (control) cells were analyzed by Western blotting with �-actinas the loading control. The bar graph shows a representative of suchan experiment indicating an increase in the rate of pSmad3 inductionafter antide, GnRHa, and GnRHa plus antide treatments. Cotreat-ment with GnRHa and antide resulted in a limited change in pSmad3compared with other treatments, although it is higher than the con-trol value.

FIG. 10. The effect of GnRHa (LA), TGF�1, and GnRHa plus TGF�1on LSMC and MSMC on pSmad3 induction. Serum-starved cells weretreated with TGF�1 (2.5 ng/ml), LA (0.1 �M), or TGF�1 plus LA for15 min. The cell lysates from treated and untreated controls (�) wereanalyzed by Western blotting, with �-actin as the loading control. Thebar graph show the mean � SEM fold change in pSmad3 induction fromthree different experiments performed in duplicate. b, c, and d aresignificantly different from a, and b�, c�, and d� are significantlydifferent from a� (P � 0.05).



pathways via ERK2 has been shown to lead to increase phos-phorylation of Smad2 (15, 49, 50). Smad3 can also act as asubstrate for ERK2 (15), and ERK2-dependent phosphory-lation of Smad2 has been shown to increase nuclear local-ization and activity of Smad2 (49). In addition, calcium/calmodulin that becomes activated by GnRH receptor altersSmad function in part due to calmodulin binding to Smadamino terminal (50, 51). Inhibition of calmodulin is reportedto increase activin-dependent induction of target gene ex-pression in mink lung epithelial cells, whereas overexpres-sion of calmodulin resulted in decreased activin- and TGF�-dependent induction of transcriptional reporter genes thatprovide support for the functional consequence of calmod-ulin in TGF� receptor signaling (50). Our preliminary resultsalso indicate that GnRHa and TGF�1 activates PKC andcalcium/calmodulin in LSMC and MSMC, suggesting thatGnRH receptor activation of PKC, MAPK, and/or calmod-ulin could differentially regulate Smads and hence TGF�signaling in leiomyoma (15, 45, 49–51).

Because leiomyoma growth is dependent on ovarian ste-roid actions, and a GnRHa-induced hypoestrogenic stateresults in leiomyoma regression, ovarian steroids could alsoserve to regulate the expression of Smads in a fashion similarto TGF� and TGF� receptor expression in these tissues. How-ever, data supporting the influence of ovarian steroid onSmad expression are limited, with reports indicating differ-ential regulation of Smads by estrogen in human breast can-cer cell lines and by androgen in prostate cancer (52–54).Accumulating evidence also indicates that estrogen and pro-gesterone receptors activate MAPK and PKC; thus, cross-talkamong ovarian steroids, GnRH, and TGF� receptors may be

critical to regulate the availability of Smads resulting inleiomyoma growth and regression. Because TGF� has a keyregulatory action in tissue fibrosis such as leiomyoma, andGnRHa therapy causes leiomyoma regression, identificationof GnRH receptor signal transduction pathways that resultin interruption of TGF� action is of great clinical value in thisand other uterine abnormalities that are responsive to TGF�actions.

Taken together, the results of the present study indicatethat leiomyoma, myometrium, and their smooth muscle cellsexpress Smad mRNA and protein, where they are differen-tially expressed, induced, and activated by TGF� and alteredas a result of GnRHa treatment. These results suggest thatTGF� and GnRH mediate action through cross-talk involv-ing Smads, and most likely other signaling pathways resultin leiomyoma growth and regression.

Acknowledgments

Received August 19, 2002. Accepted December 9, 2002.Address all correspondence and requests for reprints to: Dr. Nasser

Chegini, Department of Obstetrics/Gynecology, University of Florida,Box 100294, Gainesville, Florida 32610. E-mail: [email protected].

This work was supported by NIH Grant HD-37432. This work waspresented in part at the 48th Annual Meeting of the Society for Gyne-cological Investigation, Los Angeles, California, March 2002.

References

1. Kettel LM, Murphy AA, Morales AJ, Rivier J, Vale W, Yen SS 1993 Rapidregression of uterine leiomyomas in response to daily administration of go-nadotropin-releasing hormone antagonist Fertil Steril 60:642–646

2. Takeuchi H, Kobori H, Kikuchi I, Sato Y, Mitsuhashi N 2000 A prospectiverandomized study comparing endocrinological and clinical effects of two types

FIG. 11. The effect of TGF�1 and GnRHa (LA) on pSmad3induction after treatment of LSMC with TGF� type IIreceptor antisense (1 �M) and sense (1 �M) oligonucleo-tides. LSMC were treated with TGF� type II receptorantisense or sense oligomers for 24 h (medium contained2% fetal bovine serum), and the cells were washed andthen treated with TGF�1 (2.5 ng/ml), GnRHa (0.1 �M), ortheir combination for 15 min. The cell lysates from treated(�) and untreated (�) groups were analyzed by Westernblot, with �-actin serving as the loading control. The bargraph shows the rate of pSmad3 induction from a repre-sentative experiment performed twice. TGF� type II re-ceptor antisense and sense oligonucleotide treatmentsslightly increased pSmad3 (possibly due to serum in theculture medium), GnRHa had a limited effect on pSmad3induction, but it increased that in cells pretreated withTGF� type II receptor antisense oligonucleotide, butnot in those treated with sense oligonucleotide. TGF�1-induced pSmad3 was inhibited after pretreatment withTGF� type II receptor antisense, but not sense, oligonu-cleotide.



of GnRH agonists in cases of uterine leiomyomas or endometriosis. J ObstetGynecol Res 26:325–331

3. Chegini N 2000 Implication of growth factor and cytokine networks inleiomyomas. In: Hill J, ed. Cytokines in human reproduction. New York: Wiley& Sons; 133–162.

4. Nowak RA 1999 Fibroids: pathophysiology and current medical treatment.Bailliere Best Pract Res Clin Obstet Gynaecol 13:223–238

5. Lawrence DA 1996 Transforming growth factor-�: a general review. Eur Cy-tokine Network 7:363–374

6. Branton MH, Kopp JB 1999 TGF-� and fibrosis. Microbes Infect 1:1349–13657. Dou Q, Zhao Y, Tarnuzzer RW, Rong H, Williams RS, Schultz GS, Chegini

N 1996 Suppression of TGF-�s and TGF-� receptors mRNA and protein ex-pression in leiomyomata in women receiving gonadotropin releasing hormoneagonist therapy. J Clin Endocrinol Metab 81:3222–3230

8. Chegini N, Tang XM, Ma C 1999 Regulation of transforming growth factor-�1expression by granulocyte macrophage-colony-stimulating factor in leiomy-oma and myometrial smooth muscle cells. J Clin Endocrinol Metab 84:4138–4143

9. Lee BS, Nowak RA 2001 Human leiomyoma smooth muscle cells show in-creased expression of transforming growth factor-�3 (TGF �3) and alteredresponses to the antiproliferative effects of TGF �. J Clin Endocrinol Metab86:913–920

10. Arici A, Sozen I 2000 Transforming growth factor-�3 is expressed at highlevels in leiomyoma where it stimulates fibronectin expression and cell pro-liferation. Fertil Steril 73:1006–1011

11. Chegini N, Tang XM, Ma C, Williams RS 2002 Effects of GnRH analogues,add-back, steroid therapy antiestrogen and antiprogestins on leiomyoma andmyometrial smooth muscle cells growth and transforming growth factor �expression. Mol Hum Reprod 8:1071–1078

12. Zimmerman CM, Padgett RW 2000 Transforming growth factor � signalingmediators and modulators. Gene 249:17–30

13. Massague J, Wotton D 2000 Transcriptional control by the TGF-�/Smadsignaling system. EMBO J 19:1745–1754

14. Moustakas A, Souchelnytskyi S, Heldin CH 2001 Smad regulation in TGF-�signal transduction. J Cell Sci 114:4359–4369

15. Kretzschmar M, Doody J, Timokhina I, Massague J 1999 A mechanism ofrepression of TGF�/Smad signaling by oncogenic Ras. Genes Dev 13:804–816

16. Lee S, Cho YS, Shim C, Kim J, Choi J, Oh S, Kim J, Zhang W, Lee J 2001Aberrant expression of Smad4 results in resistance against the growth-inhib-itory effect of transforming growth factor-� in the SiHa human cervical car-cinoma cell line. Int J Cancer 94:500–507

17. Hao J, Ju H, Zhao S, Junaid A, Scammell-La Fleur T, Dixon IM 1999 Elevationof expression of Smads 2, 3, and 4, decorin and TGF-� in the chronic phase ofmyocardial infarct scar healing. J Mol Cell Cardiol 31:667–678

18. Chegini N, Kornberg L 2003 Gonadotropin releasing hormone analogue ther-apy alters signal transduction pathways involving MAP and focal adhesionkinases in leiomyoma. J Soc Gynecol Invest 10:21–26

19. Rossi MJ, Chegini N, Masterson BJ 1992 Presence of EGF, PDGF and theirreceptors in human myometrial tissue and smooth muscle cells: their action insmooth muscle cells in vitro. Endocrinology 130:1716–1727

20. Xu G, Chakraborty C, Lala PK 2001 Expression of TGF-� signaling genes inthe normal, premalignant, and malignant human trophoblast: loss of smad3 inchoriocarcinoma cells. Biochem Biophys Res Commun 287:47–55

21. Ott TR, Troskie BE, Roeske RW, Illing N, Flanagan CA, Millar RP 2002 Twomutations in extracellular loop 2 of the human GnRH receptor convert anantagonist to an agonist. Mol Endocrinol 16:1079–1088

22. Grundker C, Gunthert AR, Millar RP, Emons G 2002 Expression of gona-dotropin-releasing hormone II (GnRH-II) receptor in human endometrial andovarian cancer cells and effects of GnRH-II on tumor cell proliferation. J ClinEndocrinol Metab 87:1427–1430

23. Cheon KW, Lee HS, Parhar IS, Kang IS 2001 Expression of the second isoformof gonadotrophin-releasing hormone (GnRH-II) in human endometriumthroughout the menstrual cycle. Mol Hum Reprod 7:447–452

24. Sun YM, Flanagan CA, Illing N, Ott TR, Sellar R, Fromme BJ, Hapgood J,Sharp P, Sealfon SC, Millar RP 2001 A chicken gonadotropin-releasing hor-mone receptor that confers agonist activity to mammalian antagonists. Iden-tification of d-Lys6 in the ligand and extracellular loop two of the receptor asdeterminants. J Biol Chem 276:7754–7761

25. Hislop JN, Everest HM, Flynn A, Harding T, Uney JB, Troskie BE, Millar RP,McArdle CA 2001 Differential internalization of mammalian and non-mam-malian gonadotropin-releasing hormone receptors. Uncoupling of dynamin-dependent internalization from mitogen-activated protein kinase signaling.J Biol Chem 276:39685–39694

26. Chegini N, Zhao Y, Williams RS, Flanders KC 1994 Human uterine tissuethroughout the menstrual cycle expresses transforming growth factor-� 1 (TGF�1), TGF �2, TGF�3, and TGF � type II receptor messenger ribonucleic acidand protein and contains 125I-TGF-�1-binding sites. Endocrinology 135:439–449

27. Tang XM, Dou Q, Zhao Y, McLean F, Davis J, Chegini N 1997 The expressionof transforming growth factor-�s and TGF-� receptor mRNA and protein andthe effect of TGF-�s on human myometrial smooth muscle cells in vitro. MolHum Reprod 3:233–240

28. Dong C, Zhu S, Wang T, Yoon W, Li Z, Alvarez RJ, ten Dijke P, White B,Wigley FM, Goldschmidt-Clermont PJ 2002 Deficient Smad7 expression: aputative molecular defect in scleroderma. Proc Natl Acad Sci USA 99:3908–3913

29. Mori Y, Chen SJ, Varga J 2000 Modulation of endogenous Smad expressionin normal skin fibroblasts by transforming growth factor-�. Exp Cell Res258:374–383

30. Pulaski L, Landstrom M, Heldin CH, Souchelnytskyi S 2001 Phosphorylationof Smad7 at Ser-249 does not interfere with its inhibitory role in transforminggrowth factor-�-dependent signaling but affects Smad7-dependent transcrip-tional activation. J Biol Chem 276:14344–14349

31. Nakao A, Fujii M, Matsumura R, Kumano K, Saito Y, Miyazono K, IwamotoI 1999 Transient gene transfer and expression of Smad7 prevents bleomycin-induced lung fibrosis in mice. J Clin Invest 104:5–11

32. Kato S, Ueda S, Tamaki K, Fujii M, Miyazono K, ten Dijke P, Morimatsu M,Okuda S 2001 Ectopic expression of Smad7 inhibits transforming growthfactor-� responses in vascular smooth muscle cells. Life Sci 69:2641–2652

33. Schiffer M, Bitzer M, Roberts IS, Kopp JB, ten Dijke P, Mundel P, BottingerEP 2001 Apoptosis in podocytes induced by TGF-� and Smad7. J Clin Invest108:807–816

34. Landstrom M, Heldin NE, Bu S, Hermansson A, Itoh S, ten Dijke P, HeldinCH 2000 Smad7 mediates apoptosis induced by transforming growth factor �in prostatic carcinoma cells. Curr Biol 10:535–538

35. Bitzer M, von Gersdorff G, Liang D, Dominguez-Rosales A, Beg AA, Roj-kind M, Bottinger EP 2000 A mechanism of suppression of TGF-�/SMADsignaling by NF-�B/RelA. Genes Dev 14:187–197

36. Afrakhte M, Moren A, Jossan S, Itoh S, Sampath K, Westermark B, HeldinCH, Heldin NE, ten Dijke P 1998 Induction of inhibitory Smad6 and Smad7mRNA by TGF-� family members. Biochem Biophys Res Commun 249:505–511

37. Zhao Y, Geverd DA 2002 Regulation of Smad3 expression in bleomycin-induced pulmonary fibrosis: a negative feedback loop of TGF-� signaling.Biochem Biophys Res Commun 294:319–323

38. Zhao J, Shi W, Wang YL, Chen H, Bringas P Jr, Datto MB, Frederick JP, WangXF, Warburton D 2002 Smad3 deficiency attenuates bleomycin-induced pul-monary fibrosis in mice. Am J Physiol 282:L585–L593

39. Chen SJ, Yuan W, Lo S, Trojanowska M, Varga J 2000 Interaction of smad3with a proximal smad-binding element of the human �2(I) procollagen genepromoter required for transcriptional activation by TGF-�. J Cell Physiol 183:381–392

40. Yuan W, Varga J 2001 Transforming growth factor-� repression of matrixmetalloproteinase-1 in dermal fibroblasts involves Smad3. J Biol Chem 276:38502–38510

41. Poncelet AC, Schnaper HW 2001 Sp1 and Smad proteins cooperate to mediatetransforming growth factor-� 1-induced �2(I) collagen expression in humanglomerular mesangial cells. J Biol Chem 276:6983–6892

42. Kavsak P, Rasmussen RK, Causing CG, Bonni S, Zhu H, Thomsen GH,Wrana JL 2000 Smad7 binds to Smurf2 to form an E3 ubiquitin ligase thattargets the TGF b receptor for degradation. Mol Cell 6:1365–1375

43. Mulder KM 2000 Role of Ras and MAPKs in TGF-� signaling. CytokineGrowth Factor Rev 11:23–35

44. Yue J, Mulder KM 2000 Requirement of Ras/MAPK pathway activation bytransforming growth factor � for transforming growth factor �1 production ina Smad-dependent pathway. J Biol Chem 275:30765–30773

45. Yakymovych I, Ten Dijke P, Heldin CH, Souchelnytskyi S 2001 Regulationof Smad signaling by protein kinase C. FASEB J 15:553–555

46. Uchida K, Suzuki H, Ohashi T, Nitta K, Yumura W, Nihei H 2001 Involve-ment of MAP kinase cascades in Smad7 transcriptional regulation. BiochemBiophys Res Commun 289:376–381

47. Cheng KW, Leung PC 2000 The expression, regulation and signal transductionpathways of the mammalian gonadotropin-releasing hormone receptor. CanJ Physiol Pharmacol 78:1029–1052

48. Kraus S, Naor Z, Seger R 2001 Intracellular signaling pathways mediated bythe gonadotropin-releasing hormone (GnRH) receptor. Arch Med Res 32:499–509

49. de Caestecker MP, Parks WT, Frank CJ, Castagnino P, Bottaro DP, RobertsAB, Lechleider RJ 1998 Smad2 transduces common signals from receptorserine-threonine and tyrosine kinases. Genes Dev 12:1587–1592

50. Scherer A, Graff JM 2000 Calmodulin differentially modulates Smad1 andSmad2 signaling. J Biol Chem 275:41430–41438

51. Zimmerman CM, Kariapper MST, Mathews LS 1997 Smad proteins physi-cally interact with calmodulin. J Biol Chem 273:677–680

52. Pouliot F, Labrie C 1999 Expression profile of agonistic Smads in human breastcancer cells: absence of regulation by estrogens. Int J Cancer 81:98–103

53. Xie W, Mertens JC, Reiss DJ, Rimm DL, Camp RL, Haffty BG, Reiss M 2002Alterations of Smad signaling in human breast carcinoma are associated withpoor outcome: a tissue microarray study. Cancer Res 62:497–505

54. Brodin G, ten Dijke P, Funa K, Heldin CH, Landstrom M 1999 Increasedsmad expression and activation are associated with apoptosis in normal andmalignant prostate after castration. Cancer Res 59:2731–2738



differential expression, regulation, and induction of smads, transforming growth factor-β signal...

Documents