dit2 plant cell physiol 2004 taniguchi 187 200
TRANSCRIPT
-
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
1/14
Plant Cell Physiol. 45(2): 187200 (2004)
JSPP 2004
187
Differentiation of Dicarboxylate Transporters in Mesophyll and BundleSheath Chloroplasts of Maize
Yojiro Taniguchi1, Junko Nagasaki1, Michio Kawasaki1, Hiroshi Miyake1, Tatsuo Sugiyama2and
Mitsutaka Taniguchi1, 31 Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Aichi, 464-8601 Japan2 RIKEN Plant Science Center, Yokohama, Kanagawa, 230-0045 Japan
;
In NADP-malic enzyme-type C4 plants such as maize
( Zea mays L.), efficient transport of oxaloacetate and
malate across the inner envelope membranes of chloro-
plasts is indispensable. We isolated four maize cDNAs,
ZmpOMT1 andZmpDCT1 to3, encoding orthologs of plas-
tidic 2-oxoglutarate/malate and general dicarboxylate
transporters, respectively. Their transcript levels were
upregulated by light in a cell-specific manner; ZmpOMT1
and ZmpDCT1 were expressed in the mesophyll cell (MC)
and ZmpDCT2 and 3 were expressed in the bundle sheath
cell (BSC). The recombinant ZmpOMT1 protein expressed
in yeast could transport malate and 2-oxoglutarate but not
glutamate. By contrast, the recombinant ZmpDCT1 and 2
proteins transported 2-oxoglutarate and glutamate at simi-
lar affinities in exchange for malate. The recombinant pro-
teins could also transport oxaloacetate at the same binding
sites as those for the dicarboxylates. In particular,
ZmpOMT1 transported oxaloacetate at a higher efficiency
than malate or 2-oxoglutarate. We also compared the activ-
ities of oxaloacetate transport between MC and BSC chlo-
roplasts from maize leaves. TheKm value for oxaloacetate inMC chloroplasts was one order of magnitude lower than
that in BSC chloroplasts, and was close to that determined
with the recombinant ZmpOMT1 protein. Southern analy-
sis revealed that maize has a single OMT gene. These find-
ings suggest that ZmpOMT1 participates in the import of
oxaloacetate into MC chloroplasts in exchange for stromal
malate. In BSC chloroplasts, ZmpDCT2 and/or ZmpDCT3
were expected to import malate that is transported from
MC.
Keywords: Chloroplast C4 photosynthesis Dicarboxy-
late transporterMaizeOxaloacetate transporter2-Oxoglutarate/malate transporter.Abbreviations: BSC, bundle sheath cell; DCT, general dicarboxy-
late transporter; EST, expression sequence tag; GOGAT, glutamate
synthase; GS, glutamine synthetase; GSS, genome survey sequence;
MC, mesophyll cell; ME, malic enzyme; OAT, oxaloacetate trans-
porter; OMT, 2-oxoglutarate/malate transporter; PEPC, phosphoe-
nolpyruvate carboxylase; RT-PCR, reverse transcription-polymerase
chain reaction; Rubisco, ribulose-1,5-bisphosphate carboxylase/oxyge-
nase.
Nucleotide sequence data reported are available in the DDBJ/
EMBL/GenBank databases under the accession numbers of AB112936
(ZmpOMT1), AB112937 (ZmpDCT1), AB112938 (ZmpDCT2) and
AB112939 (ZmpDCT3).
Introduction
In NADP-malic enzyme (ME)-type C4 plants such as
maize and sorghum, bicarbonate is fixed by phosphoenolpyru-
vate carboxylase (PEPC) in mesophyll cell (MC) cytoplasm.
The carboxylation product, oxaloacetate, is transported to chlo-
roplasts, where it is reduced to malate. The malate produced is
transported from MC chloroplasts to bundle sheath cell (BSC)
chloroplasts, where malate is decarboxylated to pyruvate by
NADP-ME. The decarboxylation product, pyruvate, is trans-
ported back to MC chloroplasts (Kanai and Edwards 1999,
Furbank et al. 2000). High rates of both intra- and intercellular
transport of these metabolites are crucial to the efficient opera-
tion of C4 photosynthetic cycle and particularly important in
view of many attempts to genetically modify photorespirationand to introduce C4 characteristics into C3 plants (Leegood
2002).
Movement of metabolites between chloroplasts and
cytosol is mediated by multiple transporters located in the inner
envelope membranes (Flgge 2000), but most of the transport-
ers involved in the C4 cycle remain to be characterized at a
molecular level (Leegood 2000). Efficient transport of phos-
phoenolpyruvate in exchange for inorganic phosphate is
observed in C4-MC chloroplasts, although the C3 chloroplasts
poorly accepted phosphoenolpyruvate (Gross et al. 1990). The
exchange of phosphoenolpyruvate for inorganic phosphate is
thought to be mediated by triose phosphate/phosphate translo-cators and their cDNAs were isolated from maize MC and Fla-
veria trinervia, an NADP-ME type C4 plant (Fischer et al.
1994). Transport of pyruvate through chloroplast envelope
membranes is activated by light in C4-MC chloroplasts but not
in C4-BSC and C3 chloroplasts (Flgge et al. 1985,Ohnishi and
Kanai 1987a). The pyruvate uptake by C4-MC chloroplasts is
driven by light-enhanced cotransport with proton or Na+(Ohnishi and Kanai 1987b, Ohnishi and Kanai 1990). From
these findings, it is becoming clear that some chloroplast trans-
3 Corresponding author: E-mail, [email protected]; Fax: +81-52-789-4063.
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
2/14
Dicarboxylate transporters in maize188
porters participating in the C4 photosynthetic pathway are func-
tionally differentiated from the C3 counterparts.
On the other hand, the molecular basis for C4 dicarboxy-
late transport in MC and BSC chloroplasts of C4 plants remainsuncertain. In NADP-ME type C4 photosynthesis, import of
oxaloacetate and export of malate in MC chloroplasts, and
import of malate into BSC chloroplasts are necessary. In gen-
eral, transport of dicarboxylates such as malate, 2-oxoglutarate,
glutamate and oxaloacetate across the inner plastid envelope
membranes is thought to be facilitated by at least three distinct
types of counter-exchange transporters: 2-oxoglutarate/malate
transporter (OMT), general dicarboxylate transporter (DCT)
and oxaloacetate transporter (OAT) (Flgge 2000, Neuhaus and
Wagner 2000). DCT transports various dicarboxylates rather
nonspecifically, although OMT mainly transports 2-oxoglutarate
in exchange for malate but does not transport glutamate oraspartate (Flgge et al. 1988). Measurement of malate uptake
into maize MC chloroplasts has revealed that malate, oxaloace-
tate, glutamate, aspartate, and 2-oxoglutarate are exchangeable
(Day and Hatch 1981). OMT and DCT participate in a double
transporter system that functions in the transfer of 2-oxoglutar-
ate as a carbon skeleton to, and the export of glutamate synthe-
sized by, the stromal glutamine synthetase-glutamate synthase
(GS-GOGAT) cycle for ammonium reassimilation (Woo et al.
1987, Glvez et al. 1999). This OMT/DCT system is also
involved in assimilation of ammonium that is derived from
photorespiration. Measurements of oxaloacetate uptake by MC
chloroplasts from maize and spinach revealed that OAT is a
high-affinity transporter specific for oxaloacetate and the
apparent Km value for oxaloacetate is one or two orders of mag-
nitude lower than those for malate and 2-oxoglutarate (Hatch et
al. 1984). OAT takes part in a malateoxaloacetate shuttle
known as a malate valve that exports excess reducing equiva-
lents from stroma and balances the stromal ATP/NADPH ratio
(Heineke et al. 1991, Noctor and Foyer 2000).
A cDNA clone for OMT was first identified in spinach
and its name was assigned as DiT1 (Weber et al. 1995,Weber
and Flgge 2002). Furthermore, Arabidopsis genes encoding
plastidic OMT,AtpOMT1, and DCTs,AtpDCT1 andAtpDCT2,
have been identified by us (Taniguchi et al. 2002). In the study,
T-DNA insertional mutants ofAtpDCT1 were non-viable in
normal air but could grow under a high CO2 condition which
suppresses photorespiration. This observation indicates thatAtpDCT1 is a component necessary for photorespiratory nitro-
gen recycling. The AtpOMT1 recombinant proteins could
transport oxaloacetate with a Km value for oxaloacetate one
order of magnitude lower than those for malate and 2-oxogluta-
rate. The expression ofAtpOMT1 was prominently induced by
light and nitrate supplementation. These kinetic properties and
gene expression profiles suggested that AtpOMT1 functions as
OAT in the malateoxaloacetate shuttle in addition to its role in
the OMT/DCT double transporter system (Taniguchi et al.
2002).
In this study, we isolated maize cDNAs encoding
homologs of AtpOMT1 and AtpDCT1. The transcripts werelargely accumulated in green tissues in a light-inducible man-
ner. In particular, their expression in leaf blades was MC or
BSC specific. The recombinant proteins of the maize OMT and
DCT showed transport properties that were consistent with
those of the AtpOMT1 and AtpDCT1 proteins, respectively.
Based upon the results, we will discuss the physiological func-
tions of each dicarboxylate transporter in maize.
Results
Isolation and characterization of cDNAs for OMT and DCT
A maize expression sequence tag (EST) (Acc. No.
AI665141) encoding a predicted amino acid sequence similar
to that of spinach chloroplastic OMT (SoDiT1) was used as a
probe to isolate the full-length cDNA clone from a cDNA
library of maize greening leaves. Several positive clones were
isolated and sequencing revealed that these clones originated
from the same gene but with different poly(A) additional sites.
The longest cDNA named ZmpOMT1 was 1,907 bp long and
the putative open reading frame encoded a polypeptide of 578
amino acids with a calculated molecular mass of 59.9 kDa(Fig. 1). The ZmpOMT1 protein showed 77% identity to
SoDiT1 (Weber et al. 1995) at the amino acid level.
Fig. 1 Structures of cDNAs encodingZmpOMT1 andZmpDCT1 to 3. Open and shaded regions indicate non-coding and coding regions, respec-
tively. The PCR primers used for amplification of DNA fragments for hybridization probes are indicated by arrows below each cDNA.
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
3/14
Dicarboxylate transporters in maize 189
A sorghum partial cDNA, HHU51 (Acc. No. H55022),
was obtained as a BSC-specific gene by differential screening
(Wyrich et al. 1998). Although the cDNA was reported to
encode a chloroplastic OMT, the partial protein (188 amino
acids) encoded by the HHU51 cDNA had relatively low iden-
tity to SoDiT1 (42%). We speculated that the HHU51 cDNA
encodes another type of transporter and tried to isolate a maize
cDNA encoding a counterpart of the HHU51 protein. The
maize cDNA library was screened with the HHU51 cDNA that
was synthesized from greening sorghum leaf RNA by reverse
transcription-polymerase chain reaction (RT-PCR). Several
positive clones were isolated and the sequence analysis
revealed that these clones originated from the same gene. The
longest cDNA namedZmpDCT1 was 2,109 bp long and gave a
putative open reading frame that encoded a 554-amino acid
polypeptide with a calculated molecular mass of 59.6 kDa(Fig. 1). ZmpDCT1 showed 49% and 77% identity to SoDiT1
and HHU51, respectively, at the amino acid level. We further
screenedthemaizecDNAlibrarieswiththeHHU51cDNAasa probe and identified two different cDNAs. The cDNAs
(ZmpDCT2 and ZmpDCT3) were 1,992 bp and 1,990 bp long,
respectively, and their nucleotide sequences closely resembled
each other. There were 11 substitutions of nucleotides between
the two cDNAs and only four amino acid substitutions
occurred between the deduced ZmpDCT2 and ZmpDCT3
proteins.Thetwoproteinsconsistedof551aminoacidswith
Fig. 2 Phylogenetic tree of OMTs and DCTs. The deduced amino acid sequences in putative mature regions were aligned with a ClustalX pro-
gram (Thompson et al. 1997) and the tree was designed with a TreeView program (Page 1996). The sequences were taken from cDNAs or
genomic DNAs encoding plastidic DCT (Arabidopsis AtpDCT1, At5g64290; AtpDCT2, At5g64280; sorghum, AY123844, BG159483 and
CD431362; spinach, AY123846; tobacco, AY123847; Flaveria bidentis, AY123845), plastidic OMT (spinach SoDiT1, U13238; Arabidopsis
AtpOMT1, At5g12860) and eubacterial transporters (Bacillus subtilis yflS, Z99108;Escherichia coli CitT, P77405; YgjE, P39414; YbhI, P75763;
Haemophilus influenzae YbhI, Q57048). The putative amino acid sequences of rice OsOMT1, OsDCT1 and OsDCT2 were predicted from nucle-
otide sequences of rice chromosomes 12, 9 and 8, respectively. The amino acid sequences of sorghum DCTs (BG159483 and CD431362) are
deduced from EST clones and, therefore, are partial.
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
4/14
Dicarboxylate transporters in maize190
a molecular mass of 58.6 kDa and they showed 46% and76% identities to SoDiT1 and ZmpDCT1, respectively. These
ZmpDCT2 andZmpDCT3 genes are presumed to be alleles (see
Discussion).
Although there was no homology at the N-terminal
sequences of the deduced ZmpOMT1 and ZmpDCT1 to 3
polypeptides, a prediction program for the subcellular location,
TargetP (Emanuelsson et al. 2000), strongly suggested that
these proteins are targeted to the chloroplast like SoDiT1 (datanot shown). The putative mature proteins of ZmpOMT1 and
ZmpDCT1 to 3 also showed high identities to those of
AtpOMT1 and AtpDCT1, respectively (84% and 7880%).
The hydropathy profiles of the four transport proteins strongly
resembled those of SoDiT1, AtpOMT1 and AtpDCT1, all com-
posed of 12 putative transmembrane segments and intervening
hydrophilic loops (Weber et al. 1995, Taniguchi et al. 2002).
Some nucleotide sequences homologous to ZmpOMT1 or
ZmpDCT1 to 3 have been identified from several organisms
and a phylogenetic tree from the putative amino acid sequences
of the OMT and DCT genes was constructed (Fig. 2). The
OMT and DCT proteins of higher plants formed distinct groups
as pointed out previously (Weber and Flgge 2002). In each of
the OMT and DCT groups, member proteins from monocot and
dicot plants formed two distinct subgroups. This finding indi-
cates that divergence of ZmpDCTs occurred after a split of
monocots and dicots in the evolution of angiosperms. The plau-
sible bacterial homologues also contain 12 putative transmem-
brane helices and highly resemble plastidic OMTs and DCTs in
higher plants (Pos et al. 1998, Weber and Flgge 2002).
Number of genes coding for OMT in maize
To estimate the copy number of plastidic OMT gene(s),
Southern blot analysis of maize genomic DNA was performed
under a low-stringency hybridization condition (Fig. 3). A
same single fragment for each restriction enzyme hybridized
with both the 3-untranslated region and coding region of
ZmpOMT1 cDNA clone. This suggests that there is one copy of
plastidic OMT gene in the maize genome. By contrast, threedifferent cDNAs encoding ZmpDCT were isolated and, there-
fore, it was thought that maize has multiple gene copies of
plastidic DCT. Southern blot analysis detected several frag-
ments for the same set of restriction enzymes when hybridized
with probes ofZmpDCT1 (data not shown).
Expression profiles of the OMT and DCT genes
Total RNA was isolated from leaf blades, leaf sheaths,
husk leaves, stems, silk, young corns, anthers, rachises and
roots of maize plants and analysed by Northern hybridization
(Fig. 4). Approximately 2.2-kb transcripts of ZmpOMT1,
ZmpDCT1, and ZmpDCT2 and 3 were detected in all organs
tested, and a higher expression level was detected in the green
tissues. The mRNA levels of ZmpOMT1, ZmpDCT1, and
ZmpDCT2 and 3 were higher in leaf blades than in leaf sheaths,
and the basal regions of leaf blades accumulated the transcripts
at a higher level than the middle and tip regions. The transcript
levels in root tissues were significantly lower. These findings
suggest that maize ZmpOMT1, ZmpDCT1, and ZmpDCT2 and
3 mainly function in actively developing photosynthetic cells.
The transcripts of the OMT and DCT genes have been identi-
fied as several maize EST clones. These EST clones were
derived not only from green tissues but also from non-green tis-
Fig. 3 Southern blot analysis of the genomic DNA. Genomic DNA
from maize was digested with NdeI (N), EcoRV (EV), BamHI (B),
XhoI (X), KpnI (K), EcoRI (EI) and HindIII (H), and fractionated on
an agarose gel, blotted onto a nylon membrane, and hybridized with
ZmpOMT1 cDNA fragments corresponding to the 3-untranslated
region (A) or 3-untranslated and coding regions (B). The size of the
markers is shown on the left.
Fig. 4 Distribution of transcripts for ZmpOMT1, ZmpDCT1, andZmpDCT2 and 3 in different organs of maize. Ten g of total RNAs
from 22-day-old young plants or mature plants were electrophoresed,
transferred to a nylon membrane, and hybridized with cDNAs encod-
ingZmpOMT1,ZmpDCT1,ZmpDCT2 and 3, and ubiquitin (UBQ).
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
5/14
-
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
6/14
Dicarboxylate transporters in maize192
ZmpDCT2 recombinant proteins determined by measuring
uptake activities with proteoliposomes that had been preloadedwith a variety of substrates. The three recombinant proteins
could transport malate, 2-oxoglutarate and oxaloacetate effec-
tively in exchange for external malate, although they accepted
glutamine to a lesser extent. Glutamate was poorly transported
by ZmpOMT1, but ZmpDCT1 and ZmpDCT2 could transport
glutamate effectively. This low affinity for glutamate in
ZmpOMT1 is a common property of OMTs, spinach plastidic
OMT, SoDiT1 (Menzlaff and Flgge 1993), and AtpOMT1
(Taniguchi et al. 2002). To examine the transport properties in
detail, we determined the apparent Km values for malate and the
corresponding Ki values for 2-oxoglutarate (Table 2). The Km
values for malate were not significantly different among thethree recombinant proteins, although the Ki value for 2-
oxoglutarate was lower in ZmpOMT1 than in ZmpDCT1 and
ZmDCT2. The higher affinity for 2-oxoglutarate was also
detected in the Arabidopsis AtpOMT1 recombinant proteins
(Taniguchi et al. 2002).
We previously reported that AtpOMT1 and AtpDCT1 can
transport oxaloacetate efficiently at the same binding sites as
those for other dicarboxylates such as malate and 2-oxoglutar-
ate (Taniguchi et al. 2002). In particular, AtpOMT1 showed a
much lower Km value for oxaloacetate than that of AtpDCT1.
To examine whether these kinetic properties are conserved in
maize transporters, we measured the uptake of [14C]oxaloace-
tate by the ZmpOMT1, ZmpDCT1 and ZmpDCT2 recombinant
proteins in exchange for internal malate (Table 2). The apparent
Km value for oxaloacetate of ZmpOMT1 was lower than the
apparent Ki (malate) or Ki (2-oxoglutarate) and close to the
apparent Km (oxaloacetate) determined with intact chloroplasts
from maize (0.045 mM) (Hatch et al. 1984). This Km value was
more than one order of magnitude lower than that of
ZmpDCT1, which is expressed in the same MC chloroplasts.The apparent Ki value for 2-oxoglutarate in the uptake of
malate or oxaloacetate was much lower in ZmpOMT1 than in
ZmpDCT1 and ZmpDCT2 (Table 2). This kinetic property has
also been found in Arabidopsis (Taniguchi et al. 2002). These
findings indicate that ZmpOMT1 may function in the transport
of oxaloacetate in addition to 2-oxoglutarate and malate in MC
chloroplasts.
Transport characteristics of MC and BSC chloroplasts
Northern analysis suggested that BSC does not possess
plastidic OMT (Fig. 6). The characterization of the transport by
the recombinant OMT and DCT proteins showed thatZmpOMT1 has a higher affinity for oxaloacetate than either
ZmpDCT1 or ZmpDCT2 (Table 2). These findings suggested
Fig. 7 Changes of mRNA levels during greening of etiolated maize
seedlings. Maize seedlings, grown in the dark for 12 d, were illumi-
nated with continuous white light, and leaf blades were harvested at
the times indicated. Total RNA was extracted and 20 g was separated
by gel electrophoresis, blotted and hybridized with each specific
probe.
Fig. 8 Changes of mRNA levels in maize leaf blades during recovery from nitrogen deficiency. Maize seedlings grown with 0.8 mM NaNO3 for
18 d were transferred to a culture solution containing 16 mM nitrate at day 0 and leaf blades were harvested at the indicated times. (A) Total
RNAs (10 g) were subjected to Northern analyses with each specific probe as indicated, together with an appropriate probe of ubiquitin (UBQ)
as a loading control. RNA samples isolated from plants at time zero and 2 d after transfer to the culture solution with the same composition
(0.8 mM NaNO3) were also analysed as a control. (B) The signal intensities were quantified and the mRNA levels for ZmpOMT1 (triangles),
ZmpDCT1 (circles),ZmpDCT2 and 3 (squares), C4Ppc1 (crosses) and C4Me1 (asterisks) normalized to the ubiquitin content are shown as rela-
tive values with zero time values taken as one.
a
a
a
sa
s
y
,
pp
j
asg
a
http://-/?-http://-/?-http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-http://-/?-http://-/?- -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
7/14
Dicarboxylate transporters in maize 193
that MC chloroplasts may show higher affinity for oxaloace-
tate transport than BSC chloroplasts. Transport of oxaloacetate
into MC chloroplasts is an indispensable step in the NADP-
ME-type C4 photosynthetic pathway and, therefore, rapid
uptake of oxaloacetate is essential to maintain high photosyn-
thetic activity. We isolated MC and BSC chloroplasts from
maize leaves and examined the activities of oxaloacetate uptake
into the chloroplasts. Because the oxaloacetate transport was
rapid, the transport activities were measured at 4C with a dou-
ble silicone-oil-layer filtering centrifugation technique (Gross
et al. 1990). The transport time in our measurement system was
estimatedtobe2.0s(datanotshown).Adoublereciprocalplot indicated that the apparent Km value for oxaloacetate
uptake into MC chloroplasts was0.0340.007 mM (n =5)(Fig. 9A). This value is similar to Km values that were previ-
ously determined with oxaloacetate-dependent O2 evolution or
[14C]oxaloacetate reduction in illuminated chloroplasts (Hatch
et al. 1984). The apparent Km value of BSC chloroplasts was
calculated to be 0.470.07 mM (n = 4) and was one order of
magnitude higher than that of MC chloroplasts (Fig. 9B).
Discussion
Molecular evolution of OMT and DCT genes
Rapid transport of C4 dicarboxylates, malate and oxaloac-
etate, through chloroplastic envelope membranes is essential in
the NADP-ME-type C4 photosynthetic pathway and, therefore,
highly efficient transporters for dicarboxylates should exist in
the inner envelopes of MC and BSC chloroplasts. In this study,
we isolated cDNAs,ZmpOMT1 andZmpDCT1 to 3, by screen-ing a maize leaf cDNA library with probes of maize cDNA and
sorghum EST, and investigated whether the encoded proteins
were the transporters functioning in the C4 photosynthetic path-
way. The deduced amino acid sequences ofZmpOMT1 and
ZmpDCT1 to 3 were homologous to the previously identified
plastidic OMT and DCT, respectively (Fig. 2). Each of the plas-
tidic OMT and DCT genes can be grouped into two subgroups
of monocot and dicot members. Moreover, maize DCT gene
has diverged to ZmpDCT1 and ZmpDCT2 and 3 after the
monocot/dicot split. Therefore, each of the ZmpDCT genes has
Table 1 Substrate specificities of the reconstituted ZmpOMT1, ZmpDCT1 and ZmpDCT2 a
a Cell membranes of yeast transformed with pTV3e vector, ZmpOMT1-pTV3e, ZmpDCT1-pTV3e, or
ZmpDCT2-pTV3e were reconstituted into liposomes preloaded with the indicated substrates (50 mM) and
the uptake of [14C]malate (0.2 mM) into the proteoliposomes for 2 min was measured. The activities are
given as the percentage of the activity measured for proteoliposomes which had been preloaded with malate
(ZmpOMT1, 1.1 nmol (mg protein)1 min1; ZmpDCT1, 0.97 nmol (mg protein)1 min1; ZmpDCT2, 0.45
nmol (mg protein)1 min1). The values are the means of three independent experiments SE.
Internal substrate ZmpOMT1 ZmpDCT1 ZmpDCT2
KCl 61.6 212.0 31.5
Malate (100) (100) (100)
2-oxoglutarate 934.2 613.4 8213.5Glutamate 171.9 741.8 681.1
Oxaloacetate 852.3 1046.7 1331.1
Glutamine 152.2 321.0 286.0
Table 2 Apparent Km and Ki values of malate or oxaloacetate uptake by the reconstituted
ZmpOMT1, ZmpDCT1 and ZmpDCT2
a The uptake of external [14C]malate in exchange for internal malate (50 mM) for 1 min was assayed in the
absence or presence of 1 mM 2-oxoglutarate.b The uptake of external [14C]oxaloacetate in exchange for internal malate (30 mM) was measured. The trans-
port was assayed without competing substrate, in the presence of 1 mM malate or 2-oxoglutarate. The valuesare the means of three independent experiments SE.
ZmpOMT1 (mM) ZmpDCT1 (mM) ZmpDCT2 (mM)
[14C]malate uptake a
Malate Km (app) 0.610.07 1.10.1 0.850.44
2-oxoglutarate Ki (app) 0.800.37 2.91.3 1.51.3
[14C]oxaloacetate uptake b
Oxaloacetate Km (app) 0.0900.006 1.10.01 0.270.01
Malate Ki (app) 0.400.07 1.90.7 0.450.15
2-oxoglutarate Ki (app) 0.170.01 4.11.6 0.790.24
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
8/14
Dicarboxylate transporters in maize194
acquired a distinct cell-specific expression mechanism during
the evolution to C4 plants.
The three cDNAs encoding ZmpDCT1 to 3 were isolated
with a sorghum partial cDNA, HHU51, as a probe. The expres-
sion of the sorghum gene for HHU51 is BSC specific (Wyrich
et al. 1998). Its full-length cDNA (Acc. No. AY123844) has
been isolated and expression of the gene was confirmed to be
restricted to BSC (Renn et al. 2003). The deduced amino acid
sequences in putative mature region encoded by the AY123844
clone is more homologous to ZmpDCT1 than ZmpDCT2 and 3
(identity at the amino acid level: 86% vs. 79%, Fig. 2). This
finding seems paradoxical because expression ofZmpDCT1 is
restricted in MC in contrast to the BSC-specific expression ofZmpDCT2 and 3. However, we found other sorghum EST
clones that were more homologous toZmpDCT1 orZmpDCT2
and 3. A partial amino acid sequence encoded by the sorghum
EST clone, BG159483, is much more similar to ZmpDCT1
than to ZmpDCT2 (94% and 77%, respectively). On the other
hand, a partial amino acid sequence encoded by the sorghum
EST clone, CD431362, is much more similar to ZmpDCT2 and
3 than to ZmpDCT1 (95% and 81%, respectively). These high
identities indicate that the sorghum genes encoding BG159483
and CD431362 are orthologs ofZmpDCT1, andZmpDCT2and 3, respectively. The gene expression profiles of the newsorghum EST clones have not been examined, but theirexpression is expected to be MC or BSC specific like
ZmpDCT1, and ZmpDCT2 and 3. Although several clones for
ZmpDCT1 to 3 can be found in maize EST databases, a maize
ortholog clone of the sorghum AY123844 has not been found
in the databases. The maize ortholog gene needs to be identi-
fied to further elucidate molecular evolution of dicarboxylate
transporter genes in Gramineae.
The nucleotide sequences ofZmpDCT2 and 3 cDNAs
closely resemble each other and only 11 nucleotides are differ-
ent between them. Because the maize cultivar, Golden Cross
Bantam T51, used in this study is a hybrid between parental
lines, P39 and P51B, there is a possibility thatZmpDCT2 and 3
genes are alleles. To investigate this possibility, we searched
genome sequences encodingZmpDCT2 or 3 in GenBank data-
base. No data of full-length genes was available but we found
that 11 genome survey sequences (GSSs) from a maize inbred
B73 strain contained the same nucleotide sequences with the
ZmpDCT2 cDNA (data not shown). Although the identified
GSSs were short (558932 bp), they overlapped the coding
region of theZmpDCT2 cDNA. Intron insertion positions of the
ZmpDCT2 genes are conserved among the homologs from
maize, rice and Arabidopsis (data not shown). On the other
hand, no nucleotide sequence encoding ZmpDCT3 was found
from the GSS database of B73 strain. If the ZmpDCT2 and 3genes are overlapping genes that have recently duplicated, we
would find some ZmpDCT3 GSSs from the inbred B73 strain
in addition to theZmpDCT2 GSSs. These findings suggest that
the inbred line B73 probably possesses only the ZmpDCT2 and
theZmpDCT2 and 3 genes from the Golden Cross Bantam T51
strain should be alleles.
Arabidopsisalsopossesses twoDCTgenes,AtpDCT1andAtpDCT2,thatarelocatedtandemlyonchromosome5(Taniguchi et al. 2002). The two genes are thought to have orig-
inated from a gene duplication event, but AtpDCT1 is more
closely related to the DCT proteins from other higher plants
including ZmpDCT1 to 3 than to the AtpDCT2 protein (Fig. 2).
Our previous experiments showed that the AtpDCT2 recom-
binant protein could not transport malate and AtpDCT2 could
not compensate for the lack of AtpDCT1 in planta (Taniguchi
et al. 2002). Therefore, the AtpDCT2 gene diverged from the
plastidic DCT gene family prior to the monocot/dicot split and
the AtpDCT2 protein may have differentiated to possess
another physiological role.
Cell-specific expression of ZmpOMT and ZmpDCT genes
The transcripts for AtpOMT1 and AtpDCT1 are accumu-
lated in all tissues ofArabidopsis at similar levels (Taniguchi et
Fig. 9 LineweaverBurk plots of the [14C]oxaloacetate uptake by MC and BSC chloroplasts. Uptake of [14C]oxaloacetate by the purified MC
(A) and BSC (B) chloroplasts was measured by the double silicone layer filtration centrifugation method.
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
9/14
Dicarboxylate transporters in maize 195
al. 2002). This universal distribution of the transcripts inArabi-
dopsis is consistent with our speculation that AtpOMT1 and
AtpDCT1 participate mainly in the double transporter system
that exists in plastidic envelope membranes and links between
carbon metabolism and nitrogen metabolism in green and non-
green tissues. By contrast, the transcripts for four maize genes,
ZmpOMT1 and ZmpDCT1 to 3, were largely accumulated in
green tissues (Fig. 4). Moreover, the expression ofZmpOMT1
andZmpDCT1 to 3 genes was inducible by light in leaf tissues
in concert with other photosynthetic enzyme genes (Fig. 7),
specific to MC or BSC (Fig. 6), and upregulated in response to
nitrogen availability similarly to some C4 photosynthetic genes
(Fig. 8). All of these expression profiles suggested that
ZmpOMT1 and ZmpDCT1 to 3 participate in the C4 photosyn-
thetic pathway and accommodate the physiological specializa-
tion of each type of cell. The gene encoding mitochondrial
OMT in Panicum miliaceum, a NAD-ME-type C4 plant, was
also highly expressed in leaves, and was upregulated during
greening and cell development in concert with C4 photosyn-
thetic enzymes (Taniguchi and Sugiyama 1997). This expres-
sion profile is unique to the P. miliaceum gene, because the
ortholog genes of Arabidopsis and tobacco are expressed
nearly constitutively in all tissues (Picault et al. 2002). Further-
more, the expression of the P. miliaceum mitochondrial OMT
gene was restricted in BSC where the mitochondrial OMT is
thought to be necessary to accommodate the high rates of
Table 3 Oligonucleotide primers used in this study
a Nucleotide numbers relate to cDNA sequences of AI665141, HHU51 (Acc. No. H55022),ZmpOMT1 (AB112936),ZmpDCT1 (AB112937) and
ZmpDCT2 (AB112938). Nucleotide numbers ofMubG1 relate to a genomic clone (U29159) and a size of a PCR product fromMubG1 cDNA is
calculated to be 1,664 bp.b Extra nucleotides that are not included in cDNAs are underlined.
Gene Primer Position a Sequence b
From To 53
Screening probes
AI665141 AI-S 122 140 CTCACCACAGCCCGATTAT
AI-A 537 518 CTACCTCAACAAATTCGGGC
HHU51 HHU-S 8 29 TGGGGATGCTATTGGTGTGTCT
HHU-A 613 592 TGTCATCACTTCCAACACCACC
Hybridization probes
ZmpOMT1 OMT1-S1 1742 1760 ATAATCGGGCTGTGGTGAG
OMT1-A1 1908 1888 TGGGTTGCATTGCGATCATGT
OMT1-S2 273 289 ATCCAGTGCCGGTTCCA
ZmpDCT1 DCT1-S1 1728 1748 CATTTGGCACTGGTCGAATTG
DCT1-A1 2103 2085 CCATCAAGCCGACGAGTTC
DCT1-S2 278 296 ACTGGTGCGAAGCTACTGC
DCT1-A2 1664 1641 TTCCAACAACTCCCCATATTAACG
ZmpDCT2 DCT2-S1 1694 1712 GTCTTTATTGAGTGTCGGGDCT2-A1 1992 1976 TTCAAAAGTCCCTCATGCA
MubG1 MUB-S 1299 1320 ATCTCCCCCAAATCCACCCGTC
MUB-A 3967 3944 CGGCAGCTTAAACGACCCATGACT
RT-PCR
ZmpOMT1 OMT1-S3 468 489 CCATCGTCGGCATCATCACCCA
OMT1-A2 1595 1578 CCATGAGGTTCGAGAGGA
ZmpDCT1 DCT1-S3 593 612 ATCGCCACCTACTTCGTCAA
DCT1-A3 1748 1728 CAATTCGACCAGTGCCAAATG
ZmpDCT2 DCT2-S2 457 473 TTCCTTGGCCTCACAGC
DCT2-A2 1811 1793 GGCCCTCGGAAGAAAAACG
Expression constructs
ZmpOMT1 OMT1-S4 329 348 GGAATTCCCGAAGAAGCCCGCGCTGCA
OMT1-A3 1756 1734 CCATCGATTAGTGGTGGTGGTGGTGGTGCCACAGCCCGATTATCTTCCACC
ZmpDCT1 DCT1-S4 260 280 GGAATTCGAACCTGTGCCCGAGCCCACT
DCT1-A4 1693 1671 CCATCGATTAGTGGTGGTGGTGGTGGTGGTACAGACCCAAAAATTTCCACC
ZmpDCT2 DCT2-S3 268 285 GGAATTCGCGGCGTCGGCGGCATCT
DCT2-A3 1701 1679 CCATCGATTAGTGGTGGTGGTGGTGGTGATAAAGACCCAAAAATTTCCACC
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
10/14
Dicarboxylate transporters in maize196
exchange of C4 photosynthetic metabolites across mitochon-
drial membranes. To adapt to the decrease in atmospheric CO2concentration, C4 plants are thought to have acquired the C4pathways by duplication of genes that ancestral C3 plants pos-
sessed (Monson 1999, Miyao 2003). The metabolite transport
across organelle membranes would have been altered drasti-cally in accordance with the modification of the metabolic
pathways and the expression profiles of genes for some mem-
brane transporters including plastidic OMT and DCT, and
mitochondrial OMT would have been changed accordingly.
Functional characterization of ZmpOMT and ZmpDCT proteins
The transport properties of ZmpOMT1 and, ZmpDCT1
and 2 closely resembled those of AtpOMT1 and AtpDCT1,
respectively. The yeast-expressed ZmpOMT1 recombinant pro-
teins transported malate and 2-oxoglutarate but not glutamate
(Table 1). Their Km or Ki values for malate and 2-oxoglutarate
were comparable (Table 2). On the other hand, the recom-binant ZmpDCT1 and ZmpDCT2 proteins transported gluta-
mate more efficiently than ZmpOMT1 (Table 1) and their affin-
ities to 2-oxoglutarate were lower than those to malate (Table 2).
These findings suggest that ZmpOMT1 is a 2-oxoglutarate/
malate transporter, and that ZmpDCT1 and ZmpDCT2 are gen-
eral dicarboxylate transporters. ZmpDCT1 and ZmpDCT 2
were expected to be differentiated in the transport properties to
accommodate the physiological specialization of two types of
photosynthetic cells, but their kinetic properties were not sig-
nificantly different. Although glutamine seems to be barely
accepted as a countersubstrate for malate transport on the
ZmpOMT1, ZmpDCT1 or ZmpDCT2 recombinant proteins
(Table 1), competition experiments in [14C]malate uptake ordirect measurements of [14C]glutamine transport showed that
the three maize recombinant proteins cannot transport
glutamine at the same binding sites for dicarboxylates simi-
larly to AtpOMT1 and AtpDCT1 (Taniguchi et al. 2002) (data
not shown).
The recombinant ZmpOMT1 protein showed high-affinity
transport of oxaloacetate at the same binding site for dicar-
boxylates (Table 2). This property was also confirmed in
AtpOMT1 and may be a characteristic common to plastidic
OMT proteins. The Km value for oxaloacetate of ZmpOMT1
(90 M) is one order magnitude lower than that of ZmpDCT1
(1.1 mM) and close to the Km
value determined with maize MC
chloroplasts (45 M) (Hatch et al. 1984). Judging from the
gene expression profiles and kinetic data of ZmpOMT1, it is
expected that ZmpOMT1 is integrated in the C4 photosynthetic
pathway and functions in the uptake of oxaloacetate into MC
chloroplasts in exchange for stromal malate. However, the
recombinant ZmpOMT1 proteins showed relatively high affin-
ity for malate compared with the data obtained with the iso-
lated MC chloroplasts; the apparent Ki values for malate
against oxaloacetate uptake were 0.40 mM and 7.5 mM (Hatch
et al. 1984), respectively. If the ratio for the Ki for malate to the
Km for oxaloacetate is low, transport of oxaloacetate into chlo-
roplasts on OMT is highly susceptible to inhibition by cytosolic
malate. The malate concentration in maize MC cytosol is
thought to be orders of magnitude higher than that of oxaloace-
tate (Leegood 2000) and, therefore, it was speculated that there
is an additional high affinity OAT in maize MC chloroplasts
that is little affected by malate (Hatch et al. 1984). The kineticdata of the recombinant ZmpOMT1 proteins are not suited for
the metabolite levels in MC and there is currently no direct evi-
dence that ZmpOMT1 participates in exchange of oxaloacetate
and malate. However, the high affinity OAT other than OMT
has not been identified at a molecular level yet. The C4 cycle
works at a high rate in the daytime and high concentration of
oxaloacetate should be produced by cytosolic PEPC. Therefore,
the concentration of oxaloacetate in the MC cytoplasm should
be maintained at a high level and preferential uptake of oxaloa-
cetate may occur on ZmpOMT1. Another possible cause of the
discrepancy between the recombinant ZmpOMT1 proteins and
the MC chloroplasts is different measuring systems; singlerecombinant proteins reconstituted in proteoliposomes and
complex membrane proteins existing in chloroplastic envelope
membranes. It may also be necessary to check the reconstitu-
tion system of the recombinant proteins into liposomes, e.g. the
phospholipid content and ratio of proteins to lipid.
Putative physiological functions of ZmpOMT and ZmpDCT
proteins
Northern analysis showed that the transcript for
ZmpOMT1 was hardly detectable in BSC (Fig. 6). Since there
is one copy of plastidic OMT gene in the maize genome (Fig.
3), BSC chloroplasts should lack OMT. Measurement of
oxaloacetate uptake into chloroplasts supported this hypothesis:the affinity for oxaloacetate in BSC chloroplasts was lower
than that in MC chloroplasts, and the apparent Km value for
oxaloacetate observed in BSC chloroplasts was closer to that of
the DCT recombinant protein than to that of OMT (Table 2 and
Fig. 9). If BSC chloroplasts do not possess plastidic OMT pro-
teins, the uptake of malate into BSC chloroplasts may be facili-
tated mainly by ZmpDCT2 and 3 that are localized in BSC.
Because the photorespiration pathway exists only in BSC (Ku
and Edwards 1975, Ohnishi and Kanai 1983), BSC chloroplasts
are also the site of photorespiratory ammonium assimilation
(Sakakibara et al. 1992). Although the plastidic OMT/DCT
double transporter system is thought to function in the trans-
port of cytosolic 2-oxoglutarate in exchange for stromal gluta-
mate to assimilate photorespiratory ammonium via the stromal
GS-GOGAT cycle, ZmpDCT2 and/or ZmpDCT3 may solely
undertake this exchange of 2-oxoglutarate and glutamate in
BSC chloroplasts. Indeed, plastidic OMT is not always neces-
sary to operate the photorespiratory ammonium assimilation
reaction, because the Arabidopsis AtpOMT1 knockout plants
could grow normally under photorespiratory conditions(Taniguchi et al. 2002). By contrast, Renn et al. detected a
weak signal for OMT transcripts in sorghum BSC, while its
signal intensity was much higher in MC (Renn et al. 2003).
a
a
a
sa
s
y
,
pp
j
asg
a
http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?- -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
11/14
Dicarboxylate transporters in maize 197
They speculated that the OMT/DCT double transporter system
in BSC chloroplasts participates in the assimilation of ammo-
nium generated by photorespiration and nitrate reduction. We
cannot explain the reason of the conflicting data between maize
and sorghum at the moment, but it is necessary to ascertain
whether sorghum also has a single plastidic OMT gene and
whether the OMT protein exists in BSC chloroplasts.
High activities of malate transport in exchange for oxaloa-
cetate, glutamate, aspartate and 2-oxoglutarate were detected in
MC chloroplasts from maize (Day and Hatch 1981). Judging
from the substrate specificity, this transport activity may be
attributed to ZmpDCT1. Nitrate assimilation enzymes are
located predominantly in MC (Harel et al. 1977, Moore and
Black 1979) and, therefore, MC is thought to be the main site
for primary nitrate assimilation (Sakakibara et al. 1992). In this
case, transport of glutamate across inner envelope membranes
of MC chloroplasts is necessary and ZmpDCT1 whose expres-
sion level is abundant in MC but not in BSC may facilitate apart of this transport process.
It is expected that AtpOMT1 functions as an oxaloacetate
transporter in the malateoxaloacetate shuttle across chloro-
plast membranes (Taniguchi et al. 2002). This malate valve sys-
tem is necessary in maize MC to remove excess amounts of
stromal reducing equivalents to cytosol, because MC chloro-
plasts unlike BSC chloroplasts possess photosystem II activity
and generate the reducing equivalents. When maize plants are
exposed to some stresses such as high light, cold temperature
and salinity, and the reducing power is accumulated in MC
stroma, ZmpOMT1 may export stromal malate in exchange for
cytosolic oxaloacetate. By contrast, maize BSC chloroplastslack photosystem II activity and, therefore, the malate valve
may be dispensable in BSC chloroplasts.
The semiquantitative RT-PCR experiment indicated that
ZmpOMT1 andZmpDCT1 to 3 are expressed in root tissues at a
much lower level than in leaf tissues (Fig. 5). Northern analy-
sis (Fig. 4) and the EST data indicated that ZmpOMT and
ZmpDCT genes are also expressed in reproductive organs and
endosperms. Ammonium assimilation also occurs in plastids of
non-photosynthetic organs, and ZmpOMT1 and ZmpDCT1 to
3 expressed in these non-photosynthetic tissues should partici-
pate in the nitrogen metabolism. The high level expression of
ZmpOMT1 and ZmpDCT1 to 3 in green tissues is consistent
with the fact that these transporters are much in demand in C 4photosynthesis and nitrogen assimilation in the photosynthetic
cells. Although rice, a C3 monocot plant, also has OMT and
DCT genes that are highly homologous to maize ZmpOMT1,
andZmpDCT2 and 3, respectively (Fig. 2), their transcript lev-
els were relatively constant between rice leaf and root tissues
similar withArabidopsis (data not shown). It is speculated that
maize has conferred the mass-expression system in a cell-
specific manner on existing plastidic OMT and DCT without
drastic modification of transport properties. Further refined
study with gene-modified maize plants such as gene knockout
is needed to identify the precise physiological functions of
ZmpOMT and ZmpDCTs.
Materials and Methods
Plant materials and growth conditions
Maize ( Zea mays L. cv. Golden Cross Bantam T51) and sor-
ghum (Sorghum bicolor (L.) Moench cv. Tx430) were grown in agrowth chamber with 14 h of illumination (500E m2 s1) at 28C
and 10 h of darkness at 20C per day. Plants were fertilized regularly
with Arnon and Hoagland solution (Arnon and Hoagland 1940) dur-
ing growth. In the greening experiment, the seeds were grown in the
dark at 23C for 12 d and the etiolated seedlings were exposed to con-
tinuous fluorescent light at an intensity of about 120 E m2 s1 at
26C. For the analysis of induction by nitrate, seedlings were grown in
vermiculite with the Arnon and Hoagland solution containing 0.8 mMNaNO3 for 18 d. For supplementation of nitrogen, the concentration of
NaNO3 in the culture solution was changed to 16 mM. A third regionfrom the base of the third leaves was harvested and plunged into liq-
uid N2. For the analysis of cell specificity of gene expression, meso-
phyll protoplasts and bundle sheath strands were isolated by digestionof green maize leaves by a method reported previously (Ohnishi and
Kanai 1983).
Construction of cDNA library and isolation of cDNAs
Total RNA was prepared from the 19-h-greened maize leaves by
a guanidine thiocyanate procedure (McGookin 1984). Poly(A) RNA
was purified with Oligotex-dT30 (Takara Bio Inc., Shiga). A maize
cDNA library was constructed from the poly(A) RNA using a ZAP-
cDNA Synthesis Kit (Stratagene, La Jolla, CA, U.S.A.). The cDNA
library was screened by colony hybridization using DNA fragments of
maize EST (AI665141) and sorghum HHU51 cDNA (H55022). The
partial maize cDNA was amplified from total RNA of the greening
maize leaves by RT-PCR with synthetic oligonucleotides, AI-S and -A,
shown in Table 3. The sorghum partial cDNA was also amplified from
total RNA of the greening sorghum leaves by RT-PCR with syntheticoligonucleotides, HHU-S and -A. The probes were labeled with[-32P]dCTP using the Multiprime DNA Labeling System (Amersham
Biosciences, Piscataway, NJ, U.S.A.). Hybridization was performed
for 18 h at 42C in a solution containing 50 mM sodium phosphate,
pH 6.5, 5 SSC, 5 Denhardts solution, 0.1% (w/v) SDS, 50% (v/v)
formamide and 250 g ml1 salmon sperm DNA. The membranes were
washed twice with 2 SSC and 0.1% (w/v) SDS for 15 min at 42C,
and then once with 0.1 SSC and 0.1% (w/v) SDS for 15 min at 42C.
The membranes were exposed to X-ray films. The cDNA inserts in
positive phage clones were subcloned to pBluescript II vector and
sequenced by the dideoxynucleotide chain-termination method with a
sequencing kit (BigDye; Applied Biosystems, Foster City, CA, U.S.A.)
using a DNA sequencer (Model 373A; Applied Biosystems).
Southern blot analysis
Genomic DNA was isolated from etiolated seedlings by using a
DNA extraction kit (Nucleon PhytoPure, Amersham Biosciences).
Five g of DNA was digested with appropriate restriction enzymes,
fractionated on a 0.8% (w/v) agarose gel by electrophoresis and blot-
ted to a nylon membrane (Hybond-N+, Amersham Biosciences). After
fixation, the membranes were hybridized with 32P-labeled probes.
DNA fragments for the 3-untranslated and coding regions of
ZmpOMT1 and ZmpDCT1 were amplified from the cDNA clones by
PCR with combinations of oligonucleotide primers shown in Table 3
(OMT1-S1 and -A1 for ZmpOMT1 3-untranslated region, OMT1-S2
and -A1 for ZmpOMT1 coding and 3-untranslated regions, DCT1-S1
and -A1 for ZmpDCT1 3-untranslated region, DCT1-S2 and -A2 for
a
a
a
sa
s
y
,
pp
j
asg
a
http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?- -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
12/14
Dicarboxylate transporters in maize198
ZmpDCT1 coding region). The positions of each the primer on the
cDNAs are indicated in Fig. 1. The hybridization and washing condi-
tions were similar to those for cDNA screening described above.
Northern blot analysis
Total RNA was isolated from appropriate organs and tissues of
maize in the presence of aurinetricarboxylic acid as an inhibitor of
nucleases (Hallick et al. 1977) followed by lithium chloride precipita-
tion and phenol extraction. The RNA samples were electrophoresed in
a 1.2% (w/v) agarose gel containing formaldehyde (Sambrook and
Russell 2001), and blotted on the Hybond-N+ membranes. After fixa-
tion, the membranes were hybridized with 32P-labeled probes. The 3-
untranslated regions ofZmpOMT1, ZmpDCT1 andZmpDCT2 cDNAs
were used as specific probes for respective genes. DNA fragment for
the 3-untranslated region ofZmpDCT2 cDNA was amplified from the
ZmpDCT2 cDNA clone by PCR with oligonucleotide primers (DCT2-
S1 and -A1). Because the nucleotide sequences in the 3-untranslated
regions of ZmpDCT2 and ZmpDCT3 cDNAs are similar, the
ZmpDCT2 probe would hybridize both of the ZmpDCT2 and
ZmpDCT3 transcripts. Other cDNAs used as probes were a 1.3-kb
EcoRI fragment of maize pM52 cDNA clone for C4Ppc1 (Izui et al.1986), a full-size insert of maize SS1 cDNA clone for rbcS-m1 (Sheen
and Bogorad 1986), a full-size insert of maize C4Me1 for NADP-ME
(Rothermel and Nelson 1989), a coding region of maizeMubG1 cDNA
for ubiquitin (Liu et al. 1995), and 3.7-kb EcoRI fragment of Vicia
faba VER17 for 25S rRNA (Yakura and Tanifuji 1983). The MubG1
cDNA was amplified from total maize RNA by RT-PCR with oligonu-
cleotide primers, MUB-S and -A, shown in Table 3. The hybridization
and washing conditions were described previously (Taniguchi et al.
2002). The washed membranes were exposed and analyzed on a bio-
imaging analyzer (BAS 2500, Fujix, Tokyo).
RT-PCR analysis
Maize plants were grown hydroponically in Arnon and Hoag-
land solution for 14 d and total RNA was isolated from their roots and
leaf blades by a guanidine thiocyanate procedure (McGookin 1984).First-strand cDNA was synthesized with an oligo(dT) primer using an
AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Life
Sciences, Inc., St. Petersburg, FL, U.S.A.). DNA fragments of
ZmpOMT1,ZmpDCT1, andZmpDCT2 and 3 were amplified from the
cDNA templates by PCR with synthetic oligonucleotides (OMT1-S3
and -A2 for ZmpOMT1, DCT1-S3 and -A3 for ZmpDCT1, DCT2-S2
and -A2 for ZmpDCT2 and 3). As an internal control, ubiquitin was
also amplified with a specific primer set for MubG1 (MUB-S and
MUB-A).
Heterologous expression of OMT and DCT in yeast cells and measure-
ment of transport activities
The DNA coding for the putative mature proteins of the
ZmpOMT1, ZmpDCT1 and ZmpDCT2 were PCR-amplified from the
cDNA clones by Pfu DNA polymerase (Stratagene) with oligonucle-
otide primers (OMT1-S4 and -A3 for ZmpOMT1, DCT1-S4 and -A4
forZmpDCT1, DCT2-S3 and -A3 forZmpDCT2). A restriction site for
EcoRI was introduced at the 5 ends of the amplified DNA fragments.
At the 3 end, a sequence encoding a C-terminal (His)6 tag, stop codon
and ClaI site was attached (Table 3). The resulting PCR products were
digested with EcoRI and ClaI, and then the DNA fragments were
replaced with the open reading frame of GAL2 in a GAL2-pTV3e
(Nishizawa et al. 1995). The DNA inserts were checked by sequenc-
ing. The pTV3e vector and the resulting constructs (ZmpOMT1-
pTV3e, ZmpDCT1-pTV3e and ZmpDCT2-pTV3e) were transformed
into Saccharomyces cereviciae LBY416 strain. Transformed cells har-
boring the pTV3e constructs were selected on agar minimal selection
plates [2% (w/v) glucose, 0.67% (w/v) yeast nitrogen base without
amino acid (Difco Laboratories, Detroit, MI, U.S.A.), yeast synthetic
drop-out medium supplements without Trp (Sigma, St. Louis, MO,
U.S.A.), and 2% (w/v) agar]. The selected yeast transformants were
grown on a large scale and the crude yeast membrane fractions were
prepared as described previously (Taniguchi et al. 2002). The recom-
binant proteins of ZmpOMT1, ZmpDCT1 and ZmpDCT2 werereconstituted into liposomes and the uptake of external 14C-labeled
substrates was measured (Taniguchi et al. 2002). The net transport
activities were calculated by subtracting the activities of the liposomes
reconstituted with pTV3e vector transformant from those of the lipo-
somes reconstituted with ZmpOMT1-pTV3e, ZmpDCT1-pTV3e or
ZmpDCT2-pTV3e transformant.
Measuring the transport activities of chloroplasts
MC chloroplasts were prepared from MC protoplasts. The pre-
pared MC protoplasts were suspended in a chloroplast isolation
medium (0.35 M sorbitol, 25 mM HEPES-KOH, pH 7.8, 5 mM EDTA
and 1 mg ml1 bovine serum albumin) and broken by two passages
through a 20-m nylon mesh attached to a plastic syringe. The solu-
tion was layered onto the chloroplast isolation medium containing15% (v/v) Percoll (Amersham Biosciences) and centrifuged at 1,600g
for 1 min. The pellets were resuspended in the chloroplast isolation
medium. BSC chloroplasts were isolated by the method of Jenkins and
Boag (Jenkins and Boag 1985). The BSC chloroplasts were purified by
centrifugation through 20% (v/v) Percoll at 700g for 3 min. The
uptake of [4-14C]oxaloacetate into the purified chloroplasts was meas-
ured at 4C in the light (300 E m2 s1) with a double silicone-oil-
layer filtering centrifugation system (Gross et al. 1990). The used sili-
con oils were mixtures of SH550 and SH556 (Dow Corning Toray Sili-
cone, Tokyo) (3 : 1 for BSC and 2 : 1 for MC chloroplasts). The final
specific activity of [4-14C]oxaloacetate was 0.35 MBq nmol1. The
actual transport time for the double silicone-oil-layer centrifugation
system was estimated to be 2.0 s by comparing oxaloacetate uptake
measured in the double layer system and those obtained using a single
layer system with different time points. Stromal spaces were deter-mined by incubation with 3.7 kBq [U-14C]sorbitol (ICN Biomedicals,
Costa Mesa, CA, U.S.A.) and 26.9 kBq 3H2O (Moravek Biochemicals,
California, U.S.A.) (Heldt 1980). Average stromal volumes for BSC
and MC chloroplasts were 39.1 and 24.4 l (mg Chl)1, respectively.
The chlorophyll concentration was determined in 96% ethanol (Win-
termans and De Mots 1965).
Acknowledgments
We wish to thank Dr. Michihiro Kasahara (Teikyo University) for
the generous gift of pTV3e vector, and Dr. Junji Yamaguchi (Hokkaido
University) and Dr. Kyoko Toyofuku for the technical advices for yeast
expression. This work was supported by a Grant-in-Aid for Scientific
Research (C) (Grant No. 14540593).
References
Arnon, D.I. and Hoagland, D.R. (1940) Crop production in artificial solutions
and soils with special reference to factors influencing yield and absorption of
inorganic nutrients. Soil Sci. 50: 463471.
Day, D.A. and Hatch, M.D. (1981) Dicarboxylate transport in maize mesophyll
chloroplasts.Arch. Biochem. Biophys. 211: 738742.
Emanuelsson, O., Nielsen, H., Brunak, S. and von Heijne, G. (2000) Predicting
subcellular localization of proteins based on their N-terminal amino acid
sequence.J. Mol. Biol. 300: 10051016.
Fischer, K., Arbinger, B., Kammerer, B., Busch, C., Brink, S., Wallmeier, H.,
Sauer, N., Eckerskorn, C. and Flgge, U.-I. (1994) Cloning and in vivo
a
a
a
sa
s
y
,
pp
j
asg
a
http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?- -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
13/14
Dicarboxylate transporters in maize 199
expression of functional triose phosphate/phosphate translocators from C3-
and C4-plants: evidence for the putative participation of specific amino acid
residues in the recognition of phosphoenolpyruvate. Plant J. 5: 215226.
Flgge, U.-I. (2000) Metabolite transport across the chloroplast envelope of C3-
plants. In Photosynthesis: Physiology and Metabolism. Edited by Leegood,
R.C., Sharkey, T.D. and von Caemmerer, S. pp. 137152. Kluwer Academic
Publishers, Dordrecht.Flgge, U.I., Stitt, M. and Heldt, H.W. (1985) Light-driven uptake of pyruvate
into mesophyll chloroplasts from maize. FEBS Lett. 183: 335339.
Flgge, I.U., Woo, K.C. and Heldt, H.W. (1988) Characteristics of 2-oxolutarate
and glutamate transport in spinach chloroplasts.Planta 174: 534541.
Furbank, R.T., Hatch, M.D. and Jenkins, C.L.D. (2000) C4 photosynthesis:
mechanism and regulation.In Photosynthesis: Physiology and Metabolism.
Edited by Leegood, R.C., Sharkey, T.D. and von Caemmerer, S. pp. 435457.
Kluwer Academic Publishers, Dordrecht.
Glvez, S., Lancien, M. and Hodges, M. (1999) Are isocitrate dehydrogenases
and 2-oxoglutarate involved in the regulation of glutamate synthesis? Trends
Plant Sci. 4: 484490.
Gross, A., Brckner, G., Heldt, H.W. and Flgge, U.-I. (1990) Comparison of
the kinetic properties, inhibition and labeling of the phosphate translocators
from maize and spinach mesophyll chloroplasts.Planta 180: 262271.
Hallick, R.B., Chelm, B.K., Gray, P.W. and Orozco, E.M.J. (1977) Use of aur-
intricarboxylic acid as an inhibitor of nucleases during nucleic acid isolation.Nucleic Acids Res. 4: 30553064.
Harel, E., Lea, P.J. and Miflin, B.J. (1977) The localisation of enzymes of nitro-
gen assimilation in maize leaves and their activities during greening. Planta
134: 195200.
Hatch, M.D., Drscher, L., Flgge, U.I. and Heldt, H.W. (1984) A specific trans-
locator for oxaloacetate transport in chloroplasts.FEBS Lett. 178: 1519.
Heineke, D., Riens, B., Grosse, H., Hoferichter, P., Peter, U., Flgge, U.-I. and
Heldt, H.W. (1991) Redox transfer across the inner chloroplast envelope
membrane. Plant Physiol. 95: 11311137.
Heldt, H.W. (1980) Measurement of metabolite movement across the envelope
and of the pH in the stroma and the thylakoid space in intact chloroplasts.
Methods Enzymol. 69: 604613.
Izui, K., Ishijima, S., Yamaguchi, Y., Katagiri, F., Murata, T., Shigesada, K.,
Sugiyama, T. and Katsuki, H. (1986) Cloning and sequence analysis of cDNA
encoding active phosphoenolpyruvate carboxylase of the C4-pathway from
maize.Nucleic Acids Res. 14: 16151628.Jenkins, C.L.D. and Boag, S. (1985) Isolation of bundle sheath cell chloroplasts
from the NADP-ME type C4 plantZea mays: capacities for CO2 assimilation
and malate decarboxylation.Plant Physiol. 79: 8489.
Kanai, R. and Edwards, G.E. (1999) The biochemistry of C4 photosynthesis.In
C4 Plant Biology. Edited by Sage, R.F. and Monson, R.K. pp. 4987. Aca-
demic Press, San Diego.
Ku, S.B. and Edwards, G.E. (1975) Photosynthesis in mesophyll protoplasts and
bundle sheath cells of various types of C4 plants. IV. Enzymes of respiratory
metabolism and energy utilizing enzymes of photosynthetic pathways.Z.
Pflanzenphysiol. 77: 1632.
Leegood, R.C. (2000) Transport during C4 photosynthesis.In Photosynthesis:
Physiology and Metabolism. Edited by Leegood, R.C., Sharkey, T.D. and von
Caemmerer, S. pp. 459469. Kluwer Academic Publishers, Dordrecht.
Leegood, R.C. (2002) C4 photosynthesis: principles of CO2 concentration and
prospects for its introduction into C3 plants.J. Exp. Bot. 53: 581590.
Liu, L., Maillet, D.S., Frappier, R.H., Walden, D.B. and Atkinson, B.G. (1995)Characterization, chromosomal mapping, and expression of different polyu-
biquitin genes in tissues from control and heat-shocked maize seedlings.Bio-
chem. Cell Biol. 73: 1930.
McGookin, R. (1984) RNA extraction by the guanidine thiocyanate procedure.
In Methods in Molecular Biology. Edited by Walker, J.M. pp. 113116.
Humana Press, New Jersey.
Menzlaff, E. and Flgge, U.-I. (1993) Purification and functional reconstitution
of the 2-oxoglutarate/malate translocator from spinach chloroplasts.Biochim.
Biophys. Acta 1147: 1318.
Miyao, M. (2003) Molecular evolution and genetic engineering of C4 photosyn-
thetic enzymes.J. Exp. Bot. 54: 179189.
Monson, R.K. (1999) The origins of C4 genes and evolutionary pattern in the C4metabolic phenotype.In C4 Plant Biology. Edited by Sage, R.F. and Monson,
R.K. pp. 377410. Academic Press, San Diego.
Moore, R. and Black, C.C. (1979) Nitrogen assimilation pathways in leaf meso-
phyll and bundle sheath cells of C4 photosynthesis plant formulated from
comparative studies withDigitaria sanguinalis (L.) Scop. Plant Physiol. 64:
309313.
Neuhaus, H.K. and Wagner, R. (2000) Solute pores, ion channels, and metabo-
lite transporters in the outer and inner envelope membranes of higher plant
plastids.Biochim. Biophys. Acta 1465: 307323.Nishizawa, K., Shimoda, E. and Kasahara, M. (1995) Substrate recognition
domain of the Gal2 galactose transporter in yeast Saccharomyces cerevisiae
as revealed by chimeric galactose-glucose transporters. J. Biol. Chem. 270:
24232426.
Noctor, G. and Foyer, C.H. (2000) Homeostasis of adenylate status during pho-
tosynthesis in a fluctuating environment.J. Exp. Bot. 51: 347356.
Ohnishi, J. and Kanai, R. (1983) Differentiation of photorespiratory activity
between mesophyll and bundle sheath cells of C4 plants. I. Glycine oxidation
by mitochondria. Plant Cell Physiol. 24: 14111420.
Ohnishi, J. and Kanai, R. (1987a) Pyruvate uptake by mesophyll and bundle
sheath chloroplasts of a C4 plant, Panicum miliaceum L. Plant Cell Physiol.
28: 110.
Ohnishi, J. and Kanai, R. (1987b) Na+-induced uptake of pyruvate into meso-
phyll chloroplasts of a C4 plant, Panicum miliaceum. FEBS Lett. 219: 347
350.
Ohnishi, J. and Kanai, R. (1990) Pyruvate uptake induced by a pH jump in mes-ophyll chloroplasts of maize and sorghum, NADP-malic enzyme type C4 spe-
cies. FEBS Lett. 269: 122124.
Page, R.D. (1996) TreeView: An application to display phylogenetic trees on
personal computers. Comp. Appli. Biosci. 12: 357358.
Picault, N., Palmieri, L., Pisano, I., Hodges, M. and Palmieri, F. (2002) Identifi-
cation of a novel transporter for dicarboxylates and tricarboxylates in plant
mitochondria. Bacterial expression, reconstitution, functional characteriza-
tion, and tissue distribution.J. Biol. Chem. 277: 2420424211.
Pos, K.M., Dimroth, P. and Bott, M. (1998) The Escherichia coli citrate carrier
CitT: a member of a novel eubacterial transporter family related to the 2-
oxoglutarate/malate translocator from spinach chloroplasts.J. Bacteriol. 180:
41604165.
Renn, P., Dreen, U., Hebbeker, U., Hille, D., Flgge, U.-I., Westhoff, P. and
Weber, A.P.M. (2003) TheArabidopsis mutant dctis deficient in the plastidic
glutamate/malate translocator DiT2.Plant J. 35: 316331.
Rothermel, B.A. and Nelson, T. (1989) Primary structure of the maize NADP-dependent malic enzyme.J. Biol. Chem. 264: 1958719592.
Sakakibara, H., Kawabata, S., Hase, T. and Sugiyama, T. (1992) Differential
effects of nitrate and light on the expression of glutamine synthetases and
ferredoxin-dependent glutamate synthase in maize. Plant Cell Physiol. 33:
11931198.
Sambrook, J. and Russell, D.W. (2001)Molecular Cloning: A Laboratory Man-
ual, 3rd edn. Cold Spring Harbor Laboratory Press, New York.
Sheen, J.-Y. and Bogorad, L. (1986) Expression of the ribulose-1, 5-bisphos-
phate carboxylase large subunit gene and three small subunit genes in two cell
types of maize leaves.EMBO J. 5: 34173422.
Sugiyama, T. (1998) Nitrogen-responsive expression of C4 photosynthesis genes
in maize.In Stress Responses of Photosynthetic Organisms. Edited by Satoh,
K. and Murata, N. pp. 167180. Elsevier Science, Amsterdam.
Taniguchi, M. and Sugiyama, T. (1997) The expression of 2-oxoglutarate/malate
translocator in the bundle-sheath mitochondria of Panicum miliaceum, a
NAD-malic enzyme-type C4 plant, is regulated by light and development.Plant Physiol. 114: 285293.
Taniguchi, M., Taniguchi, Y., Kawasaki, M., Takeda, S., Kato, T., Sato, S.,
Tabata, S., Miyake, H. and Sugiyama, T. (2002) Identifying and characteriz-
ing plastidic 2-oxoglutarate/malate and dicarboxylate transporters inArabi-
dopsis thaliana. Plant Cell Physiol. 43: 706717.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G.
(1997) The ClustalX windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24:
48764882.
Weber, A. and Flgge, U.-I. (2002) Interaction of cytosolic and plastidic nitro-
gen metabolism in plants.J. Exp. Bot. 53: 865874.
Weber, A., Menzlaff, E., Arbinger, B., Gutensohn, M., Eckerskorn, C. and
Flgge, U.-I. (1995) The 2-oxoglutarate/malate translocator of chloroplast
envelope membranes: Molecular cloning of a transporter containing a 12-
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/ -
8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200
14/14
Dicarboxylate transporters in maize200
helix motif and expression of the functional protein in yeast cells.Biochemis-
try 34: 26212627.
Wintermans, J.F.G.M. and De Mots, A. (1965) Spectrophotometric characteris-
tics of chlorophylls and their pheophytins in ethanol.Biochim. Biophys. Acta
109: 448453.
Woo, K.C., Flgge, U.I. and Heldt, H.W. (1987) A two-translocator model for
the transport of 2-oxoglutarate and glutamate in chloroplasts during ammo-
nia assimilation in the light. Plant Physiol. 84: 624632.
Wyrich, R., Dressen, U., Brockmann, S., Streubel, M., Chang, C., Qiang, D.,
Paterson, A.H. and Westhoff, P. (1998) The molecular basis of C4 photosyn-
thesis in sorghum: isolation, characterization and RFLP mapping of meso-
phyll- and bundle-sheath-specific cDNAs obtained by differential screening.
Plant Mol. Biol. 37: 319335.
Yakura, K. and Tanifuji, S. (1983) Molecular cloning and restriction analysis of
EcoRI-fragments ofVicia faba rDNA. Plant Cell Physiol. 24: 13271330.
(Received July 23, 2003; Accepted December 10, 2003)
a
a
a
sa
s
y
,
pp
j
asg
a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/