저 시-비 리- 경 지 2.0 한민

는 아래 조건 르는 경 에 한하여 게

l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.

다 과 같 조건 라야 합니다:

l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.

l 저 터 허가를 면 러한 조건들 적 되지 않습니다.

저 에 른 리는 내 에 하여 향 지 않습니다.

것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.

Disclaimer

저 시. 하는 원저 를 시하여야 합니다.

비 리. 하는 저 물 리 목적 할 수 없습니다.

경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.

Functional studies of GST2, a

morphogenetic transition regulator on

nitrogen starvation, in Candida albicans

Candida albicans

GST2

2014 8

Thesis for the Degree of Doctor of philosophy

Functional studies of GST2,

a morphogenetic transition regulator on

nitrogen starvation, in Candida albicans

Advisor: Ki-bong Oh

So-Hyoung Lee

August 2014

i

ABSTRACT

SO-HYOUNG LEE

School of Agricultural Biotechnology

The Graduated School

Seoul National University

Candida albicans is a major human fungal pathogen, which undergoes

morphological transition from the budding yeast form to filamentous growth in

response to nitrogen starvation. In this study, C. albicans Gst2p, a new

morphogenetic regulatory gene induced by nitrogen starvation was identified and

characterized. C. albicans Gst2p displayed glutathione transferase (GST) activity

and is required in response to peroxide. Surprisingly, the Δgst2 mutant displayed

predominantly yeast phase growth on solid nitrogen limited media, whereas the wild-

type strain formed pseudohyphae efficiently under the same conditions. Furthermore,

Gst2p is strongly induced by nitrogen starvation. The morphological defect of Δgst2

mutant was not rescued by overexpression of Ras1p, Cph1p, or Efg1p, but was

rescued by either overexpression of a hyperactive RAS1G13V allele or by exogenous

addition of cyclic adenosine monophosphate (cAMP). The artificial expression was

consistent with the Ras1-cAMP pathway as a possible downstream target of Gst2p.

The deletion of GST2 also increased levels of MEP2 and MEP1 transcripts by

ii

elevating GLN3 expression under conditions of nitrogen starvation. These findings

suggest that Gst2p may be one of the regulators of GLN3 transcription, the regulation

of which controls ammonium permease expression, and a significant component of

filamentation under conditions of nitrogen starvation in C. albicans.

Keywords: Candida albicans, nitrogen starvation, GST2, filamentation, signaling

pathway

Student Number : 2009-30310

iii

CONTENTS

ABSTRACT ........................................................................................................ ⅰ

CONTENTS ........................................................................................................ ⅲ

LIST OF FIGURES ........................................................................................... ⅵ

LIST OF TABELS ............................................................................................. ⅷ

LIST OF ABBREVIATIONS ............................................................................ ⅸ

INTRODUTION .....................................................................................................1

1. Dimorphism, an important factor of virulence ................................................7

2. Signaling pathways and transcriptional regulators required for morphogenesis

..........................................................................................................................8

2.1 Mitogen-activated protein kinase pathway ...........................................8

2.2 cAMP-dependent protein kinase A pathway .........................................8

2.3 Ras1p-mediated signaling pathway .................................................... 10

3. Morphogenetic auto-regulatory substances ................................................... 11

4. Nitrogen starvation and morphogenesis ........................................................ 12

4.1 MEP2 is required for filamentous growth of C. albicans under nitrogen

starvation conditions ................................................................................ 12

4.2 Control of MEP2 expression by the GATA transcription factors ........ 13

4.3 TOR controls the GATA transcription factors ...................................... 13

5. Purpose of this study ..................................................................................... 14

MATERIALS AND METHODS ....................................................................... 17

iv

1. C. albicans strains and culture conditions ..................................................... 17

2. Rapid amplification of cDNA ends ............................................................... 18

3. Recombinant protein construction and glutathione transferase activity assay

........................................................................................................................ 18

4. Gene disruption ............................................................................................ 19

5. DNA isolation and Southern blot analysis .................................................... 21

6. Oxidative stress sensitivity assay .................................................................. 21

7. Northern hybridization .................................................................................. 22

8. RT-PCR and real-time quantitative PCR ...................................................... 22

9. Plasmid constructions for morphogenesis ..................................................... 23

10. Rapamycin sensitivity assay ......................................................................... 23

RESULTS ........................................................................................................... 31

1. Identification, characterization and deletion of GST2 ................................... 31

1.1 Identification and characterization of GST2 ....................................... 31

1.2 GST2 of C. albicans has a Gst activity ............................................... 31

1.3 Deletion of GST2 increases oxidative sensitivity ................................ 32

2. Nitrogen starvation-induced filamentous growth depends on the presence of

Gst2p in C. albicans ............................................................................................ 39

2.1 The Δgst2 mutant cells defect their filamentation under nitrogen

starvation condition ............................................................................ 39

2.2 Nitrogen starvation induces GST2 expression .................................... 40

v

2.3 FA do not effect to expression of GST2 under nitrogen starvation

condition ............................................................................................. 41

3. Effects of GST2 disruption on hyphal-inducing signaling pathway .............. 50

3.1 Effects of GST2 disruption on the expression levels of mRNAs related to

the hyphal-inducing signaling pathway .............................................. 50

3.2 A hyperactive RAS1 allele and exogenous addition of cAMP restore

filamentation ....................................................................................... 50

4. Influence of GST2 to transcriptional regulation of GLN3, an ammonium

permease regulatory GATA transcription factor ........................................... 59

4.1 GST2 regulates GLN3 transcription under nitrogen starvation condition

............................................................................................................. 59

4.2 Δgst2 increase sensitivity to rapamycin .............................................. 60

DISCUSSION ............................................................................................................. 65

REFERENCES .......................................................................................................... 71

ABSTRACT IN KOREAN ...................................................................................... 79

CURRICULUM VITAE .......................................................................................... 81

vi

LIST OF FIGURES

Figure 1. Signal transduction pathways leading to

expression of hypha-specific genes in C.

albicans.

3

Figure 2. Morphogenetic auto-regulatory substances

(ARSs).

5

Figure 3. TOR prevents nuclear accumulation of the

nitrogen-regulated transcription activator Gln3p

15

Figure 4. Conserved domains of GST2. 33

Figure 5. Functional identification of GST2. 35

Figure 6. Disruption of C. albicans GST2. 36

Figure 7. Defects in hyphal formation caused by deletion

of GST2.

42

Figure 8. Expression of GST2 under different conditions in

wild-type strain.

44

Figure 9. Northern blot analysis of GST2 expression. 46

vii

Figure 10. Effects of farnesoic acid (FA) on GST2

expression.

48

Figure 11. Northern blot analysis of mRNAs related to the

hyphal-inducing signaling pathway in C.

albicans.

53

Figure 12. Expression of genes related to the hyphal-

inducing signaling pathway in C. albicans.

55

Figure 13. Effects of various expression constructs on the

hyphal response to solid SLAD medium in C.

albicans.

57

Figure 14. Up-regulation of GLN3 in Δgst2. 61

Figure 15. Rapamycin sensitivity assay of Δgst2. 63

Figure 16. Proposed signaling pathway of Gst2p. 69

viii

LIST OF TABLE

Table 1. C. albicans strains used in this study. 25

Table 2. Plasmid list used in this study. 26

Table 3. Primers used in this study. 27

ix

LIST OF ABBREVIATIONS

ADH alcohol dehydrase

ADHpt promoter of alcohol dehydrogenase

ARS autoregulatory substance

cAMP cyclic adenosine monophosphate

FA farnesoic acid

GS glucose salt

SLAD synthetic low ammonium dextrose

MAPK mitogen-activated protein kinase

PKA protein kinase A

GST glutathione S-transferase

TOR target of rapamycin

RT-PCR reverse transcription-polymerase chain reaction

- 1 -

INTRODUCTION

Candida albicans is the most prevalent opportunistic fungal pathogen in humans.

It undergoes reversible morphogenetic transitions between budding yeast and

filamentous hyphal forms triggered by various environmental cues, such as the

presence of serum, neutral pH, high temperature, CO2, N-acetylglucosamine,

nitrogen starvation, and adherence (Biswas et al., 2007; Sudbery, 2011). This yeast-

to-hyphal transition is linked to the expression of virulence factors (Calderone and

Fonzi, 2001) and is therefore strongly associated with disease progression. Most of

the morphogenetic transition signals converge on two parallel signal transduction

pathways (Figure 1), defined by the transcription factors Efg1p and Cph1p (Hall et

al., 2009). Current models place Efg1p in the cyclic AMP (cAMP)-dependent protein

kinase A (PKA) signaling pathway, with several lines of evidence suggesting that

Efg1p functions downstream of PKA (Rocha et al., 2001). Cph1p is a transcription

factor thought to be activated by the mitogen-activated protein kinase (MAPK)

cascade (Liu, 2001). The small GTPase Ras1p initiates both of these pathways,

which can also influence other factors affecting morphology (Chen et al., 2000).

Morphogenetic transition of C. albicans was reported to be under the control of

at least three morphogenetic autoregulatory substances that accumulate in the

medium as cells proliferate: farnesoic acid (FA) (Oh et al., 2001) and farnesol

(Hornby et al., 2001), which inhibit the yeast-to-hyphal transition, and tyrosol (Chen

et al., 2004), which promotes this transition (Figure 2). Treatment of C. albicans

- 2 -

with farnesol reduces the mRNA expression of HST7 and CPH1, both components

of the MAPK cascade, but not that of the MAP kinase CST20 (Sato et al., 2004). In

addition, farnesol and dodecanol were reported to inhibit the Ras1p-mediated cAMP-

dependent PKA pathway (Davis-Hanna et al., 2008). Recently, repression of CPH1,

EFG1, GAP1 and HWP1 mRNA expression was observed in response to FA (Chung

et al., 2010). Nevertheless, how these substances regulate C. albicans hyphal

development is still unknown because the downstream regulatory factors controlled

by these signal molecules have not been identified. In our previous work, several

genes that were upregulated by FA, including GST2 (formerly CA15 induced by FA)

were identified (Chung et al., 2005). This study showed that GST2 was required for

filamentous growth of C. albicans under conditions of nitrogen starvation. GST2

expression was strongly induced when the ammonium sulfate concentration

decreased to 0.1 mM or below.

The Δgst2 mutant displayed predominantly yeast phase growth on solid nitrogen

limited media, whereas the wild-type (WT) strain formed pseudohyphae efficiently

under the same conditions. The deletion of GST2 increased levels of MEP2 and

MEP1 transcripts by elevated GLN3 expression. The results of the present study

indicated that GST2 is required for filamentous growth of C. albicans under

conditions of nitrogen starvation. I propose that Gst2p serves as a regulator of GLN3

involved in the response to nitrogen starvation in C. albicans.

- 3 -

Figure 1. Signal transduction pathways leading to expression of hypha-specific

genes in C. albicans (Sudbery, 2011).

- 4 -

- 5 -

Figure 2. Morphogenetic auto-regulatory substances (ARSs). FA and farnesol

inhibit the filamentation in C. albicans, and tyrosol promotes it.

- 6 -

- 7 -

1. Dimorphism, an important factor of virulence

Candida albicans is the most common human fungal pathogen which cause

opportunistic infection. It was found in the normal gastrointestinal flora and the oral

mucosa of most healthy humans. However, in immunocompromised patients,

bloodstream infections often cause death, despite the use of antifungal therapies

(Biswas et al., 2007).

An important feature of C. albicans is dimorphism between a single cell,

budding yeast form (blastospore) and a filamentous form (including both

pseudohyphae and true hyphae) (Berman, 2006). Typically, C. albicans grows as

single ellipsoidal cells called blastospores (also called blastoconidia). In the presence

of inducing environmental signals, e.g. serum, high temperature (37°C), high ratio

of CO2 to O2, neutral pH, and nutrient poor media, C. albicans can assume

filamentous forms in which cells remain attached to each other after dividing and

thereby form long branched strings of connected cells. The ability of C. albicans to

adopt these different morphologies is thought to contribute to colonization and

dissemination within host tissues, and thereby to promote infection (Lo et al., 1997;

Odds, 1994; Saville et al., 2003). Therefore, the regulation of morphogenesis has

been intensively investigated in the past years.

- 8 -

2. Signaling pathways and transcriptional regulators

required for morphogenesis

2.1 Mitogen-activated protein kinase pathway

A mitogen-activated protein kinase (MAPK) cascade has been shown to be

required for morphological change in C. albicans (Dhillon et al., 2003). MAPK

pathways are cascades of phosphorylation from a MAPK kinase kinase (MAPKKK)

to a MAPK and ultimately result in the activation of transcription factors (Hall et al.,

2009). This MAPK cascade consists of the Cst20p (p21-activated kinase; PAK),

Hst7p (MAP kinase kinase; MEK) and Cek1p (MAPK) (Liu, 2001). The

transcription factor Cph1p functions downstream of the MAPK cascade. Null

mutants of these genes show retarded filamentous growth but no impairment of

serum-induced germ tube and hyphae formation (Kohler and Fink, 1996; Kron and

Gow, 1995). These observations suggest that a kinase signaling cascade plays a part

in stimulating the morphological transition between blastospore and filamentous

forms in C. albicans.

2.2 cAMP-dependent protein kinase A pathway

Cyclic AMP acts as an intracellular regulator and participates in many cellular

processes in both prokaryotic and eukaryotic organisms (Dhillon et al., 2003).

cAMP-dependent protein kinase A (PKA) pathway has been shown to regulate

filamentous growth in C. albicans and other fungi (Lengeler et al., 2000). The

- 9 -

functions of cAMP are determined by its endogenous levels, which are carefully

regulated by adenylate cyclase and phosphodiesterase enzymes. C. albicans has a

sigle adenylate cyclase gene(CDC35/CYR1). Cyr1p integrates environmental signals

from a range of sources and is completely essential for hyphal formation but not

yeast-form growth (Dhillon et al., 2003; Whiteway, 2000). Recently, the adenylate-

cyclase-associated protein (CAP1) has been identified and disrupted in C. albicans.

The Δcap1 mutant is defective in germ tube formation and hyphal development in

all conditions examined, including serum-containing media. The defects are

suppressed by exogenous cAMP or dibutyryl cAMP. Δcap1 are avirulent in a mouse

model for systemic candidiasis (Bahn et al., 2003; Bahn and Sundstrom, 2001; Zou

et al., 2010). There are only two cAMP-dependent PKA catalytic subunits, Tpk1p

and Tpk2p, in C. albicans (Sonneborn et al., 2000). Efg1p, a basic helix-loop-helix

(bHLH) protein, plays a major role in hyphal morphogenesis in response to serum,

CO2, neutral pH and GlcNAc in liquid media, and on solid media such as Spider

medium. Δefg1 null mutant strains do not form hyphae under most hypha-inducing

conditions, including serum, and are defective in the induction of hypha-specific

genes. Efg1p is likely to function downstream of the PKAs (Lo et al., 1997; Stoldt

et al., 1997). TPK2 overexpression cannot suppress the Δefg1 defect in hyphal

development, whearas overexpression of EFG1 can suppress the filamentation

defect in Δtpk2 (Sonneborn et al., 2000).

- 10 -

2.3 Ras1p-mediated signaling pathway

Center to the regulation of C. albicans morphology is the Ras1p interrelated.

Networks Ras proteins are members of the small GTPase superfamily that cycle

between an inactive GDP-bound and an active GTP-bound form (Bourne et al.,

1990). The active form of Ras stimulates two main signaling pathways, cAMP-PKA

pathway and MAPK pathway (Biswas et al., 2007). In C. albicans, Ras1p has been

identified which is not essential for survival (Feng et al., 1999). The Δras1 deletion

mutant cells defect in hyphal growth in response to serum and other conditions. In

addition, while a dominant negative Ras1p variant (Ras1G16Ap) caused a defect in

filamentation, a dominant active Ras1p variant (Ras1G13Vp) enhanced the formation

of hypha (Feng et al., 1999). The constitutive hyphal growth induced by

overexpression of dominant-active Ras1 variant (Ras1G13Vp) was defected in cells

deleted for HST7, CPH1, EFG1, CYR1, or both CPH1 and EFG1 (Leberer et al.,

2001).

- 11 -

3. Morphogenetic auto-regulatory substances

C. albicans, a polymorphic fungus that is well studied for its importance as an

opportunistic human pathogen, was among the first fungi reported to have a quorum-

sensing system (Lim et al., 2012). It has long been documented that C. albicans

hyphal formation is suppressed at high cell densities and by supernatants from

stationary-phase C. albicans cultures, suggesting that hyphal formation was

controlled, at least in part, by a soluble factor (Hogan, 2006).

In Hornby et al., the “quorum-sensing molecule” was identified as farnesol

(Figure 2). This compound is able to block filamentation induced by the

environmental signals for most signaling pathways activating hyphae development

(Hornby et al., 2001). Farnesol was active against a variety of C. albicans strains at

concentrations between 1 and 50 μM (Hogan, 2006). A separate study by Oh et al.

showed that C. albicans strain ATCC10231 produces FA (Figure 2), a compound

closely related to farnesol, and that FA is responsible for the inhibition of hyphal

growth in dense cultures (Oh et al., 2001). Hornby and Nickerson later confirmed

that C. albicans strain 10231 did not produce farnesol (Hornby and Nickerson, 2004).

Kim et al. found that farnesol can inhibit hyphae formation at lower concentrations

than FA but that FA has decreased toxicity at high concentrations (Kim et al., 2001).

Another C. albicans QSM, tyrosol, was found to promote hyphae development by

shortening the lag-time of cells to begin germinating in hyphae-inducing conditions

(Chen et al., 2004).

- 12 -

4. Nitrogen starvation and morphogenesis

4.1 MEP2 is required for filamentous growth of C. albicans under nitrogen

starvation conditions

Nutrient availability also governs developmental processes, like the induction

of pseudohyphal growth of the budding yeast Saccharomyces cerevisiae in response

to nitrogen limitation (Gimeno et al., 1992). C. albicans also undergoes

morphological transition from the budding yeast form to filamentous growth in

response to amino acid starvation or limiting ammonium concentrations

(Morschhäuser, 2011). In many cases, membrane-transporter-related proteins serve

as extracellular nutrient sensors that activate signaling pathways to induce a cellular

response. Examples include the ammonium permease Mep2p, which is sufficient to

enable growth in low ammonium concentrations (Neuhäuser et al., 2011). Under

limiting nitrogen conditions, Mep2p induces the switch from yeast to filamentous

growth through a signaling domain in its C-terminal cytoplasmic tail that induces

morphogenesis in response to ammonium availability (Biswas and Morschhäuser,

2005; Dabas et al., 2009). In the presence of sufficient concentrations of a preferred

nitrogen source, such as ammonium or certain amino acids, the expression of

transporters and enzymes required for the utilization of alternative nitrogen sources

is repressed (Liao et al., 2008).

- 13 -

4.2 Control of MEP2 expression by the GATA transcription factors

The MEP2 expression is controlled by GATA factors, Gln3p and Gat1p (Dabas

and Morschhäuser, 2007; Liao et al., 2008). Gln3p has a broad role in nitrogen

metabolism and in virulence of C. albicans, partially overlapping, but distinct from

that of GAT1. As in liquid SLAD medium and in solid SLAD plates, Δgln3 and Δgat1

reduce MEP2 expression. Δgln3 mutants were seen fewer and shorter filamentous

than wild-type on SLAD plates. Thus this MEP2 reduced expression in strain lacking

GLN3 correlated with their filamentation defect. In contrast, deletion of GAT1 did

not affect filamentation despite reducing MEP2 expression (Dabas and

Morschhäuser, 2007).

4.3 TOR controls the GATA transcription factors

In S. cerevisiae, TOR (target of rapamycin) controls the expression of nutrient-

regulated genes by sequestering several nutrient-responsive transcription factors in

the cytoplasm (Figure 3) (Beck and Hall, 1999). The expression of most of the

nitrogen responsive genes is regulated by the GATA transcription factors Gln3p and

Gat1p and their cytoplasmic repressor Ure2p. Under good nitrogen conditions,

Gln3p is retained in the cytoplasm by Ure2p. The binding of Gln3p to Ure2p requires

TOR-dependent phosphorylation of Gln3p. Rapamycin treatment or nitrogen

starvation causes Gln3p to become dephosphorylated and to dissociate from Ure2p.

Gln3p then translocates into the nucleus to activate its target genes (Beck and Hall,

1999). TOR is conserved in all eukaryotic life forms (Crespo and Hall, 2002). In C.

- 14 -

albicans, a TOR1 homologue has also been identified and characterized (Cruz et al.,

2001).

5. Purpose of this study

In our previous work, the yeast-to-hyphae transition in C. albicans was

suppressed by FA, a morphogenetic autoregulatory substance that accumulates in the

medium as cells proliferate (Oh et al., 2001). Several genes were upregulated by FA

during the yeast-to-hyphae transition (Chung et al., 2010; Chung et al., 2005). In this

study, it is showed that GST2, one of genes induced by FA, is required for

filamentous growth of C. albicans under nitrogen starvation conditions. Gst2p serves

as a regulator of GLN3 involved in nitrogen starvation and functions as part of the

Ras1-cAMP signaling pathway-induced filamentation in C. albicans.

- 15 -

Figure 3. TOR prevents nuclear accumulation of the nitrogen-regulated transcription

activator Gln3p. Under good nitrogen conditions, Gln3p is phosphorylated and

retained in the cytoplasm by Ure2p. Upon nitrogen starvation or rapamycin treatment,

Activated Sit4p dephosphorylates the GATA transcription factor Gln3p.

Dephosphorylated Gln3p dissociates from Ure2p and translocates into the nucleus,

where it activates transcription of target genes. Arrows indicate activation; bars

indicate inhibition (Crespo and Hall, 2002).

- 16 -

- 17 -

MATERIALS AND METHODS

1. C. albicans strains and culture conditions

The C. albicans strains used in this study are listed in Table 1. All strains were

stored as frozen stocks with 15% glycerol at –80°C. For routine growth of most

strains, YPD liquid medium (20 g peptone, 10 g yeast extract, 20 g glucose per liter)

was used. Strains carrying plasmids or disrupted genes were propagated on synthetic

dextrose (SD) agar plates (0.67% yeast nitrogen base without amino acids (BD Difco;

Becton, Dickinson and Co., Sparks, MD), 2% glucose, and 2% agar) (Dabas and

Morschhäuser, 2007). Uracil prototrophic transformants were selected on SD agar

plates containing 0.19% yeast synthetic drop-out medium supplement without uracil

(Sigma Chemical Co., St. Louis, MO). Uracil auxotrophic transformants were

selected on 5-fluoroorotic acid (5-FOA) agar plates, which consisted of SD agar

plates supplemented with 50 μg/ml uracil (Sigma) and 0.1% 5-FOA (Sigma). To

visualize hyphal formation on solid medium, C. albicans was cultured by shaking in

YPD liquid medium at 28°C for 48 h. Yeast cells were harvested and washed three

times with distilled water before use. For specific experiments involving hyphal

growth, different media were used. SD medium containing high ammonium (SHAD),

SD medium containing low ammonium (SLAD) (Csank and Haynes, 2000), Spider

medium (Dabas and Morschhäuser, 2007), glucose salt (GS) medium (Oh et al.,

2001), and Lee’s medium at pH 7 (Lee et al., 1975) were prepared as described

- 18 -

previously. For exogenous cAMP rescue experiments, 10 mM dibutyryl cAMP

(Sigma) was added to SLAD solid medium.

2. Rapid amplification of cDNA ends

The rapid amplification of cDNA-ends (RACE) of GST2 was performed using

the BD SMARTTM RACE cDNA Amplification Kit (BD Biosciences, San Jose, CA)

according to the manufacturer’s instructions. Sequences of primers used in this study

are listed in Table 3. The GST2 cDNA was reverse transcribed from 0.5 μg mRNA

using either 5′-RACE CDS (5′-(T)25VN-3′ ; N = A, C or G ; V = A, G or C) and BD

SMART IITM A oligonucleotide (5′-AAGCAGTGGTATCAACGCAGAGT

ACGCGGG-3′) as primers for 5′-RACE, or using 3′-RACE CDS primer A (5′-

AAGCAGTGGTATCAACGCAGAGTAC(T)30VN-3′) for 3′-RACE. cDNA

amplification was performed using degenerate primers 5′-RACE GSP1 and 3′-

RACE GSP1. Amplified products in both 3′- and 5′-RACE were cloned into the

Litmus28i vector and subjected to automated sequencing.

3. Recombinant protein construction and glutathione

transferase activity assay

For the glutathione transferase (Gst) activity assay, GST2 and GTT11 genes were

generated by PCR amplification using specific primer sets (Table 3) from cDNA of

- 19 -

C. albicans SC5314 obtained after 2 mM tert-butyl hydroperoxide treatment and

cloned into the pET-21a plasmid. The L41S substitution mutagenesis of Gst2p was

performed by using QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla,

CA, U.S.A.). Recombinant proteins were induced in Escherichia coli BL21 cells

with isopropyl-β-D-thiogalactopyranoside and were purified from cell extracts by

affinity chromatography using Ni-NTA-agarose columns (Qiagen, Hilden,

Germany), following the manufacturer’s instructions. The Gst activity was

spectrophotometrically determined by measuring the conjugation of reduced

glutathione (GSH) to 1-chloro-2,4-dinitrobenzene (CDNB). The reaction mixture

contained 0.1 M potassium phosphate buffer, pH 6.5, 1 mM GSH, and 1 mM CDNB.

The reaction mixture was pre-incubated at 25°C (5 min), and the reaction was

initiated by an addition of the enzyme. The increase of A340 nm was recorded, and the

activity was calculated form the difference in A340 nm changes in the reaction mixtures

with and without enzyme (Choi et al., 1998; Garcerá et al., 2010).

4. Gene disruption

Disruption of the two allelic copies of GST2 was achieved by the two-step

replacement method described by Fonzi and Irwin (Fonzi and Irwin, 1993). For

disruption of GST2, a 3.4-kb BamHI fragment containing the hph-URA3-hph cassette

was isolated from pQF86 (Feng et al., 1999) and ligated with BamHI-digested

pUC18, yielding pQF181 (Table 2). The 87-bp 5′-GST2 region was amplified by

- 20 -

PCR using pQGD1-1F and pQGD1-1R as primers and C. albicans SC5314 genomic

DNA as the template. The PCR product was cloned into pQF181 digested with SalI-

AvaI, resulting in plasmid pQGD1-1. The 104-bp 3′-GST2 region was amplified by

PCR using primers pQGD1-2F and pQGD1-2R. The PCR product was cloned into

pQGD1-1 digested with SmaI-SacI, resulting in plasmid pQGD1-2. The SalI-SacI

fragment from pQGD1-2 was the 3.6-kb hph-URA3-hph cassette fragment

containing 87-bp 5′-GST2 and 104-bp 3′-GST2 homologous sequences. For the

construction of the second gene disruption cassette, the 80-bp 5′-GST2 was amplified

by PCR using primers pQGD2-1F and pQGD2-1R and cloned into pQF181 digested

with SacI-SmaI to obtain pQGD2-1. The 268-bp 3′-GST2 region was amplified by

PCR using primers pQGD2-2F and pQGD2-2R, and cloned into pQGD2-1 digested

with SalI-AvaI to obtain pQGD2-2. This final plasmid was digested with SalI and

SacI restriction enzymes to generate the 3.8-kb hph-URA3-hph cassette fragment

containing 80-bp 5′-GST2 and 268-bp 3′-GST2 homologous sequences.

Homologous recombination using the selectable marker URA3 flanked by hph

directed repeats was used for sequential gene disruptions. The heterozygous deletion

strain (GST2/Δgst2) was obtained by transforming spheroplasts (Sanglard et al.,

1996) of CAI4 (wild-type) with the SalI-SacI fragment of pQGD1-2 (Table 2). The

homozygous deletion strain (Δgst2/Δgst2) was obtained by transforming the

heterozygous deletion strain (GST2/Δgst2) with the SalI-SacI fragment of pQGD2-

2. Clones that had lost the URA3 gene by intrachromosomal recombination, mediated

by the hph repeats, were then selected on medium containing 5-FOA. The

- 21 -

replacement of the chromosomal gene with the fragment containing the hph-URA3-

hph cassette in place of the GST2 region was verified by PCR and Southern blot

analysis. (Figure 6).

5. DNA isolation and Southern blot analysis.

GST2 disruption in heterozygous and homozygous strains was verified by

Southern blotting. Genomic DNA from C. albicans was isolated as described

previously (Hoffman and Winston, 1987). Genomic DNA was isolated from wild-

type (CAI4) and mutant strains, digested with BglII and EcoRV, separated in a 1%

agarose gel, transferred onto a nylon membrane, and fixed by UV irradiation. The

hybridization probe was amplified by PCR from pQGD2-2 using pQF62 and

GST2probe-R as primers (Table 3). Labeling of the DNA probe and subsequent

hybridization was carried out using a random primer DNA labeling kit (Takara Bio,

Shiga, Japan) with (α-32P)dCTP (IZOTOP, Budapest, Hungary).

6. Oxidative stress sensitivity assay

Cells from wild-type (CAI4Y), Δgst2 mutant (GST2-1142Y) containing empty

YPB-ADHpt which carries the ADH1 promoter, terminator sequence, and C.

albicans URA3 (Table 2) were grown in YPD broth at 28°C for 48 h. Yeast cells were

harvested, washed, and resuspended to a density of 2×107 cells per ml in sterile

- 22 -

distilled water before use. Sensitivity to oxidative stress was determined by spotting

aliquots (5 μl) of serial ten-fold dilutions strains onto solid YNB media (without

amino acids, with 2% glucose, 2% agar, and 0.1% ammonium sulfate) containing 2

mM hydrogen peroxide (H2O2) after incubation for 3 days at 28°C (Inoue et al.,

1999).

7. Northern hybridization

Aliquots (10 μg) of total RNA were denatured and subjected to 1.2% agarose

electrophoresis in the presence of 1 M formaldehyde. The size-fractionated RNAs

were then transferred onto a nylon membrane and fixed by UV irradiation.

Hybridization probes were generated using a Random Primer DNA Labeling Kit

(Takara Bio) with (α-32P)dCTP (IZOTOP). Radioactivity was detected using a Bio-

Imaging Analyzer System (BAS 2500; FujiFilm, Tokyo, Japan).

8. RT-PCR and real-time quantitative PCR

Cells were grown SLAD media for 2 h at 28°C. Total RNA was extracted using

RNeasy Mini kit (Qiagen, Hilden, Germany), treated with DNase I (Invitrogen,

Carlsbad, California, U.S.A.), and reverse transcribed using the Superscript III First-

Strand Synthesis System (Invitrogen) following the manufacturer’s instructions.

Quantitative PCR was carried out in 8-strip tubes using the SYBR Green-Based

- 23 -

Detection assay with a LightCycler Nano System (Roche Diagnostics, Mannheim,

Germany). Genes investigated were MEP2, RAS1, EFG1, CPH1, HWP1, and GAP1.

The primers used in these experiments are listed on Table 3. Each primer pair was

tested for cross reactivity with epithelial cDNA. Each sample was handled in

triplicate and each experiment was repeated three times. Data analysis was

performed by the LightCycler Nano Software 1.0.

9. Plasmid constructions for morphogenesis.

Plasmids used in this study are listed in Table 2. C. albicans strains were

transformed using the LiAc/SS-DNA/PEG method as described (Bertram et al.,

1996). The plasmid-borne GST2 (pADH-GST2), CPH1 (pADH-CPH1), EFG1

(pADH-EFG1) and RAS1 (pADH-RAS1) genes were generated by PCR

amplification using specific primer sets (Table 3) from genomic DNA of C. albicans

SC5314. PCR products were cloned into the YPB-ADHpt plasmid (Bertram et al.,

1996). Site-directed mutagenesis was performed using oligonucleotides ADH-

RAS1G13V-F and -R to generate the RAS1G13V allele.

10. Rapamycin sensitivity assay

Sensitivity to rapamycin treatment was determined by comparison of growth

with the C. albicans strains on solid YPD media containing 10 ng/ml rapamycin after

- 24 -

incubation for 3 days at 28°C. Stationary phase cells cultured in YPD were washed

and suspended to a density of 2×107 cells per ml. Aliquots (5 μl) of serial ten-fold

dilutions were spotted onto YPD plate containing rapamycin (Liao et al., 2008).

- 25 -

Table 1. C. albicans strains used in this study

Strain Parent strain Relevant genotype or characteristic Reference

SC5314 Prototrophic clinical isolate Fonzi and Irwin,

1993

CAI4 SC5314 ura3Δ::imm434/ura3Δ::imm434 Fonzi and Irwin,

1993

CAI4Y CAI4 CAI4 containing pYPB-ADHpt This work

GST2-1 CAI4 ura3Δ::imm434/ura3Δ::imm434

GST2/gst2Δ::hph-URA3-hph This work

GST2-11 GST2-1 ura3Δ::imm434/ura3Δ::imm434

GST2/gst2Δ::hph This work

GST2-114 GST2-11 ura3Δ::imm434/ura3Δ::imm434 gst2Δ::hph-

URA3-hph /gst2Δ::hph This work

GST2-1142 GST2-114 ura3Δ::imm434/ura3Δ::imm434

gst2Δ::hph /gst2Δ::hph This work

GST2-1142Y GST2-1142 GST2-1142 containing pYPB-ADHpt This work

GST2-1142G GST2-1142 GST2-1142 containing pADHpt-GST2 This work

SCMEP1M4A SCMEP1M3A mep1-1Δ::FRT/mep1-2Δ::FRT Morschhäuser J,

unpublished.

SCMEP2M4A SCMEP2M3A mep2-1Δ::FRT/mep2-2Δ::FRT Dabas and

Morschhäuser, 2007

SCMEP12M4A SCMEP1M3A

mep1-1Δ::FRT/mep1-2Δ::FRT

mep2-1Δ::FRT/mep2-2Δ::FRT Neuhäuser et al.,

2011

GLN3M4A GLN3M3A gln3-1Δ::FRT/gln3-2Δ::FRT Dabas and

Morschhäuser, 2007

GAT1M4A GAT1M3A gat1-1Δ::FRT/gat1-2Δ::FRT Dabas and

Morschhäuser, 2007

Δgln3GAT1M4A Δgln3GAT1M3A gln3-1Δ::FRT/gln3-2Δ::FRT

gat1-1Δ::FRT/gat1-2Δ::FRT

Dabas and

Morschhäuser, 2007

- 26 -

Table 2. Plasmid list used in this study

Plasmid Construct Reference

pQF86 hph-URA3-hph cassette contained

pBluescript II KS(+) Sudbery ,2011

pQF181 hph-URA3-hph cassette contained pUC18 This work

pQGD1-1 5′-GST2(1-87 bp) in pQF181 This work

pQGD1-2 3′-GST2(556-660 bp) in pQGD1-1 This work

pQGD2-1 5′-GST2(40-120 bp) in pQF181 This work

pQGD2-2 3′-GST2(283-551 bp) in pQGD2-1 This work

YPB1-ADHpt CaADH1 promoter URA3 Ca. ARS,

Sc. 2μm plasmid Biswas et al., 2007

pADH-GST2 pYPB1-ADHpt-CaGST2 This work

pADH-CPH1 pYPB1-ADHpt-CaCPH1 This work

pADH-EFG1 pYPB1-ADHpt-CaEFG1 This work

pADH-RAS1 pYPB1-ADHpt-CaRAS1 This work

pADH-RAS1G13V pYPB1-ADHpt-CaRAS1G13V This work

pET21-GST2 pET-21a-CaGST2 This work

pET21-GST2L41S pET-21a-CaGST2 L41S This work

pET21-GTT11 pET-21a-CaGTT11 This work

- 27 -

Table 3. Primers used in this study

Primer Gene Sequence (5′-3′)*

For RACE

5′-GSP1 GST2 CATACGGAACTCCAAACG GTTTCAA

3′-GSP1 GST2 TTGGACCGTTTTCTGAAACTTGGAA

For gene disruption

pQGD1-1F GST2 TAGTCGACATGACTAAACCAATTCAATTCTACACATAC (SalI)

pQGD1-1R GST2 TACTCGAGGTAAGCCAATCCTAAAACTTCTAAGAA (AvaI)

pQGD1-2F GST2 TACCCGGGGTTGGTATTGATATTCATGATTGGCC (SmaI)

pQGD1-2R GST2 TTGAGCTCCTTTTATTTTTTCTCTGGGACATTGACA (SacI)

pQGD2-1F GST2 TTGAGCTCACGGTTTCAAAGTAAGCATTTTCTTAG (SacI)

pQGD2-1R GST2 TACCCGGGCTCGTTTTTAGTGATATCAACAGAAATG (SmaI)

pQGD2-2F GST2 TACTCGAGGGAACAGAAGAATATTACAAGACTTTAG (AvaI)

pQGD2-2R GST2 TAGTCGACTGCAAACTGTAGGCCCATCCAA (SalI)

For Southern blot analysis

pQF62 hph GGATCGATCTATTCCTTTGCCCTCGG

GST2probe-R GST2 ATCCAGGTACTGTTTCTGGTGGTGATTC

For GST assay

GST2-F GST2 CAGGATCCATGACTAAACCAATTCAATTCTACACA

GST2-R GST2 AACTCGAGTTTTTTCTCTGGGACATTGACAC

GTT11-F GTT11 CAGGATCCATGTCTGACACCAAAATTATTGTTC

GTT11-R GTT11 GCCTCGAGAATGTTAGGCTTAACAGTTTC

* The created restriction sites are underlined.

- 28 -

Table 3. (continued)

Primer Gene Sequence (5′-3′)**

For mutagenesis

GST2L41S-F GST2 CATTTCTGTTGATATCACTAAAAACGAGTCTAAATCTGATTGGTTTGTT

AAATTGAATCC

GST2L41S-R GST2 GGATTCAATTTAACAAACCAATCAGATTTAGACTCGTTTTTAGTGATAT

CAACAGAAATG

RAS1G13V-F RAS1 GTTGTTGTTGGAGGAGTTGGTGTTGGTAAATCCGC

RAS1G13V-R RAS1 GCGGATTTACCAACACCAACTCCTCCAACAACAAC

For real-time PCR

MEP2RT-F MEP2 CTGGAAGCAATTGGGGTATCAG

MEP2RT-R MEP2 TGGTTTCAGGATCGTCATCAGC

RAS1RT-F RAS1 GGAGGTGGTGGTGTTGGTAAAT

RAS1RT-R RAS1 CATGGCCAGATATTCTTCTTGTCC

EFG1RT-F EFG1 CCAGGAATCAGACCACGAGTAA

EFG1RT-R EFG1 CACAACGTGTCTCACCTTTTCTG

CPH1RT-F CPH1 TGTATGACGCTTCTGGGTTTCC

CPH1RT-R CPH1 GATATCCCATGGCAATTTGTTGTTG

HWP1RT-F HWP1 CCACTACTACTGAAGCCAAATCAT

HWP1RT-R HWP1 TGGATACTGTACCAGTTGGTGTTT

GAP1RT-F GAP1 TGTTAGACATGCATTACCCAAAGC

GAP1RT-R GAP1 CACCGTTAACAATGGCAATAGTGA

MEP1RT-F MEP1 AACAACAGCCAGAGGTACCTGA

MEP1RT-R MEP1 CCACTGGATCATGTTTCTCTTGTA

** The mutated codons are in boldface.

- 29 -

Table 3. (continued)

Primer Gene Sequence (5′-3′)

For real-time PCR

GLN3RT-F GLN3 ATG ACT ACA TCG AAT AGT CAG TCC

GLN3RT-R GLN3 CAT ACT AAG GGC CTG AGA TTG C

GAT1RT-F GAT1 CAA TGA CAG AGG TAG TTC AGG TG

GAT1RT-R GAT1 GGA TGT TTG ACT GGG GTG GTT A

For Northern blot analysis

MEP2-F MEP2 GTAGATCTCCAATATGTCTGGAAATTTCACTGG

MEP2-R MEP2 AGACTCGAGTTAATTTTTAGCTTCTCCTGAGTC

RAS1-F RAS1 GAAAGATCTATGTTGAGAGAATATAAATTAG

RAS1-R RAS1 GAAGATATCTCAAACAATAACACAACATCC

EFG1-F EFG1 CCGGATCCATGTCAACGTATTCTATACC

EFG1-R EFG1 CCACGCGTCAATGACTGAACTTGGG

CPH1-F CPH1 GAAATGTGGCGCCGATGCAA

CPH1-R CPH1 ACCCGGCATTAGCAGTAGAT

HWP1-F HWP1 GTGACAATCCTCCTCAACCT

HWP1-R HWP1 GAGAGGTTTCACCGGCAGGA

GAP1-F GAP1 TTAAGTACTGGTGGACCAGC

GAP1-R GAP1 CAAACCCCACTTTGAGCAAC

MEP1-F MEP1 ATGTCAGCAGAAGAAGTAATACAATACATTTC

MEP1-R MEP1 ACGATATTCCACTGGATCATGTTTCTCTT

GLN3-F GLN3 ATGACTACATCGAATAGTCAGTCCAAAC

GLN3-R GLN3 CTTGATTACATCTGACTTCAATGAAAGTGG

GAT1-F GAT1 ATGTACTACCGTGCTCGTCACTCAT

GAT1-R GAT1 GTTGGCGATGTTATTGATGCTGACG

- 30 -

Table 3. (continued)

Primer Gene Sequence (5′-3′)*

For overexpression

ADH-GST2-F GST2 GCAGATCTAGCAGCAACAATGACTAAACCA (BglII)

ADH-GST2-R GST2 GCCTCGAGTTTATTTTTTCTCTGGGACATTG (XhoI)

ADH-CPH1-F CPH1 GGCAGATCTCTTTCGCCATGTCAATTACTAAAAC (BglII)

ADH-CPH1-R CPH1 GACTCGAGCTATGTTTGTGACTGTTTTACTTC (XhoI)

ADH-EFG1-F EFG1 CCGGATCCATGTCAACGTATTCTATACC (BamHI)

ADH-EFG1-R EFG1 CCACGCGTCAATGACTGAACTTGGG (MluI)

ADH-RAS1-F RAS1 GAAAGATCTATGTTGAGAGAATATAAATTAG (BglII)

ADH-RAS1-R RAS1 GAAGATATCTCAAACAATAACACAACATCC (EcoRV)

* The created restriction sites are underlined.

- 31 -

RESULTS

1. Identification, characterization and deletion of GST2

1.1 Identification and characterization of GST2

In our previous work, several genes upregulated by FA in C. albicans were

identified (Chung et al., 2005). Of these, CA15 expression was increased by

approximately two-fold by treatment with 40 μM FA for 40 min. CA15 shares 99%

homology with GST2 (1–541 bp) from the Candida Genome Database

(http://candidagenome.org); which is thought to be a putative glutathione S-

transferase. To confirm the full-length cDNA sequence of CA15, 3′- and 5′- rapid

amplification of the cDNA ends (RACE) were performed. Sequencing produced an

open reading frame (ORF) consisting of 660 bp encoding a predicted product of 219

amino acids as expected (GenBank Accession Number HM594683).

Ca19.2693 (Candida albicans orf19.2693) was named GST2 which is predicted

to function as glutathione S-transferase (GST). According to BLAST search results,

GST2 exhibits sequence homology to fungal GSTs, that contains two conserved

domains of GST_N_Ure2p_like family or GST_C_YfcG_like family (Figure 4).

However, a GST activity of this gene is not yet verified.

1.2 GST2 of C. albicans has a GST activity

To determine a GST activity of Gst2p, GST assay was performed with Gst2L41Sp

- 32 -

and Gtt11p. The Gtt11p, which is already known to have activity against standard

GST substrates, was used as a positive control (Garcerá et al., 2010). In C. albicans,

the universal leucine CTG codon is translated both as serine (97%) and leucine (3%)

(Rocha et al., 2011). Hence, the CTG codon of Gst2p at 41st position to TCT was

mutated for codon usage (Lan et al., 2011). Recombinant Gst2p, Gst2L41Sp and

Gtt11p were purified by affinity chromatography from E. coli extracts for the in vitro

assay. As shown in Figure 5A, Gst2L41Sp exhibited higher GST activity than others.

These results indicate that the Gst2p has GST activity and 41st position serine residue

is important for this activity.

1.3 Deletion of GST2 increases oxidative sensitivity

To investigate the role of GST2 in C. albicans, homologous recombination was

used in a multistep procedure to delete both alleles of the gene in the SC5314-derived

C. albicans strain CAI4. These deletions were confirmed by Southern blotting

(Figure 6). In microorganisms, some GST proteins are induced in response to

oxidative stress and lacking these genes are more sensitive to the stress (Garcerá et

al., 2010; Inoue et al., 1999). Whether Gst2p plays the same role in H2O2 induced

oxidative stress responses was also examined. The results indicated that the deletion

mutant was more sensitive to this agent than wild-type (WT) CAI4 strain (Figure

5B).

- 33 -

Figure 4. Conserved domains of GST2. The C. albicans GST2 gene product and

conserved domains, N-terminal S. cerevisiae Ure2p like domain(dotted white) and

C-terminal alpha helical Escherichia coli YfcG like domain (black).

- 34 -

GST_N_Ure2p_like

GST_C_YfcG_like

N C

4 86 98 212

- 35 -

Figure 5. Functional identification of GST2. (A) GST activity of Gst2p was

expressed as mU mg–1 protein. Bars indicate the mean (±SD) of three separated

experiments. (B) Oxidative stress responses of wild-type containing pYPB-ADHpt

empty vector (CAI4Y) and Δgst2 mutant containing pYPB-ADHpt empty vector

(GST2-1142Y) were determined by spotting strains onto YNB agar containing 2 mM

H2O2 after 72 h incubation at 28°C.

- 36 -

0

10

20

30

40

50

60

Sp

ec

ific

ac

tivit

y

(mU

/mg

pro

tein

)

A

Gtt11p Gst2p Gst2L41sp

B

Wild-type / vector

Δgst2

/ vector

Δgst2

/ vector + GST2

105 10

4 10

3 10

2 10

1

Control + 2 mM H2O2

105 10

4 10

3 10

2 10

1

- 37 -

Figure 6. Disruption of C. albicans GST2. Southern blot analysis was performed

with a 32P-labeled 1.3-kb probe amplified by PCR from GST2/Δgst2(GST2-11)

genomic DNA using pQF62 and GST2probe-R as primers. Genomic DNA samples

digested with BglII and EcoRV were prepared from strains CAI4 (wild-type,

GST22/GST2), GST2-11 (heterozygous, GST2/Δgst2), and GST2-1142

(homozygous, Δgst2/Δgst2). The bottom line represents the wild-type (SC5314)

GST2 genomic locus. The middle line represents the first disruption allele and

disruption fragment. The top line represents the second disruption allele and

disruption fragment. B: BglII, E: EcoRV.

- 38 -

GST2

gst2AΔ::hph gst2BΔ::hph 2.4

Kb

2.1

0.8

CA

I4

GS

T2

-11

(G

ST

2/Δ

gst2

)

GS

T2

-11

42 (Δ

gst2

/Δg

st2

)

Probe

B E

hph

B E

hph

B E E

0.5 Kb

GST2

- 39 -

2. Nitrogen starvation-induced filamentous growth depends

on the presence of Gst2p in C. albicans

2.1 The Δgst2 mutant cells defect their filamentation under nitrogen

starvation condition

In C. albicans, FA acts as a quorum-sensing molecule (QSM) to suppress

filamentation (Oh et al., 2001). To investigate whether GST2, the gene induced by

FA, has a role in C. albicans morphogenesis, the ability of the homozygous deletion

mutant Δgst2 to switch from yeast to filamentous growth under a variety of growth

conditions was observed. Morphological switching was induced on GS medium,

Spider medium, Lee’s medium (pH 7), or SHAD (containing 10 mM ammonium

sulfate) at both 28°C and 37°C. Under these incubation conditions, no phenotypic

differences were observed between WT and deletion mutant cells (data not shown).

A defect in filamentous growth (predominantly yeast cells) was observed only on

SLAD agar plates (containing < 0.1 mM ammonium sulfate) at 28°C or 37°C (Figure

7A). This defect was rescued by overexpression of GST2 under the control of the

ADH promoter. As the gene is essential for filamentous growth (predominantly

pseudohyphae) under low-ammonium conditions, I next examined whether Gst2p is

involved in the induction of filamentous growth of C. albicans by other nitrogen

sources. The WT strain formed pseudohyphae efficiently at 28°C when grown on SD

agar containing 0.01 mM urea or amino acids, such as glutamine and proline,

whereas the deletion mutant strain did not (Figure 7B).

- 40 -

2.2 Nitrogen starvation induces GST2 expression

As the first step toward understanding the role of GST2 during filamentation in

C. albicans, the levels of GST2 transcript in the WT strain grown under various

culture conditions were investigated. Northern blot analysis showed that GST2

mRNA was expressed to some extent in all media tested; however, a marked increase

was observed within 2 h of incubation in SLAD (0.01 mM ammonium sulfate) liquid

medium (Figure 8). These results indicated that nitrogen limitation increases GST2

expression in C. albicans.

Next, the regulation of GST2 expression by nitrogen availability was

investigated. The wild-type strain was cultured in the presence of different

concentrations of ammonium or other nitrogen sources, and expression of GST2 was

examined by Northern hybridization. As shown in Figure 9A, GST2 expression was

strongly induced (about five-fold) when the ammonium sulfate concentration

decreased to 0.1 mM or below. In the presence of 0.01 mM ammonium, a marked

increase in GST2 transcript level was observed within 40 min (Figure 9B). Similar

amounts of GST2 mRNA were detected when 0.01 mM of urea or various amino

acids were used as the sole nitrogen source, indicating that the presence of

ammonium is not required for induction of GST2 expression under conditions of

nitrogen starvation (Figure 9C) and the capacity of C. albicans filamentation under

conditions of nitrogen starvation depends on a high level of GST2 expression.

Similar results were observed at 37°C.

- 41 -

2.3 FA does not affect expression of GST2 under nitrogen starvation

condition

The effects of FA on GST2 mRNA expression under conditions of nitrogen

starvation was also investigated. Interestingly, addition of FA (40 µg/ml) did not

affect the expression of GST2 mRNA in SD based media at 28°C, indicating that FA

does not induce GST2 expression and repress filamentous growth of C. albicans

under these test conditions (Figure 10).

- 42 -

Figure 7. Defects in hyphal formation caused by deletion of GST2. (A) C. albicans

wild-type (CAI4) and Δgst2 mutant (GST2-1142) strains were transformed with an

empty control vector (pADH) and a GST2-containing vector (pADH-GST2). The

resulting strains were assayed for filamentous growth on SLAD plates containing

0.01 mM ammonium sulfate. Images were obtained after 11 days of incubation at

28°C or after 5 days of incubation at 37°C (scale bar = 2 mm). (B) Wild-type and

Δgst2 mutant cells were grown on SD agar plates containing 0.01 mM urea or amino

acids as the sole nitrogen source. Images were obtained after 11 days of incubation

at 28°C or after 5 days of incubation at 37°C (scale bar = 2 mm).

- 43 -

A Vector

+ GST2

Vector

+ GST2

5 days,

37°C

11 days,

28°C

Vector Vector

Wild-type Δgst2

B Ammonium

sulfate Glutamine

Wild-type,

28°C

Δgst2,

28°C

Urea Proline

Wild-type,

37°C

Δgst2,

37°C

- 44 -

Figure 8. Expression of GST2 under different conditions in wild-type strain. Pre-

cultured Cells (SC5314) were inoculated into the liquid media indicated and grown

for 2 h in the conditions indicated. RNAs were prepared from each culture, and

Northern analysis was carried out with probe to the GST2 gene.

- 45 -

28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C

YPD Spider Lee’s GS SLAD SHAD

GST2

rRNA

- 46 -

Figure 9. Northern blot analysis of GST2 expression. Wild-type cells (CAI4

containing empty pYPB1-ADHpt) were grown at 28°C and 37°C for 2 h in SD liquid

medium containing the indicated concentrations of ammonium sulfate (A), incubated

at 28°C and 37°C for the indicated times in SD containing 0.01 mM ammonium

sulfate as the sole nitrogen source (B), or cultured at 28°C and 37°C for 2 h in SD

containing containing the indicated concentrations of various nitrogen sources (C).

Northern blots were prepared with total RNA from cells. PCR products were

amplified with the appropriate oligonucleotides (see Table 3) and labeled with (α-

32P)dCTP.

- 47 -

C

A

GST2,

28℃

rRNA

100 10 1 0.1 0.01

Ammonium sulfate (mM)

GST2,

37℃

rRNA

B

0 20 40 60 120 240

Ammonium sulfate (0.01mM)

Time

(min)

rRNA

GST2,

28℃

GST2,

37℃

rRNA

- 48 -

Figure 10. Effects of farnesoic acid (FA) on GST2 expression. WT (SC5314) cells

were grown at 28°C for 2 h in SD liquid medium containing the indicated

concentrations of ammonium sulfate with (+) or without (–) 40 μg/ml FA.

- 49 -

(-) FA

GST2

rRNA

100 10 1 0.1 0.01 100 10 1 0.1 0.01 Ammonium sulfate (mM)

(+) FA

- 50 -

3. Effects of GST2 disruption on hyphal-inducing signaling

pathway

3.1 Effects of GST2 disruption on the expression levels of mRNAs related

to the hyphal-inducing signaling pathway

As noted above, filamentous growth of C. albicans is mainly regulated by

MAPK and cAMP-dependent PKA pathways, defined by the transcription factors

Efg1p and Cph1p (Sudbery, 2011). To determine whether GST2 disruption

contributes to either of these pathways during inhibition of hyphal growth, RNAs

were isolated from wild-type and Δgst2 mutant cells growing on SLAD media

following incubation for 2 h at 28°C. Northern blot analysis (Figure 11) and real-

time PCR (Figure 12) about the signaling pathway component genes such as MEP2,

RAS1, EFG1, CPH1, HWP1, and GAP1 were performed for quantification. HWP1

and GAP1, which represent Efg1p- and Cph1p-dependent genes for hyphal induction,

respectively, were expressed at very low levels even in wild-type in this condition.

Transcriptions of MEP2, RAS1 and EFG1 were about 2.3, 0.6, and 1.2-fold higher,

respectively, in Δgst2 cells compared to wild-type cells.

3.2 A hyperactive RAS1 allele and exogenous addition of cAMP restore

filamentation

Based on our finding that the Δgst2 mutant fails to develop extensively

elongated filamentation, Gst2p may play a role in filamentous growth related

- 51 -

nitrogen starvation. As can be known Figure 11, Gst2p expression was influenced

MEP2, RAS1 and EFG1 transcription. According to these results, I suppose that

Gst2p might take part in hyphal-inducing signaling pathways of MEP2. To

investigate this, several elements that regulate MEP2-activating signaling pathways

during filamentation were cloned under the control of either the ADH promoter, and

transformed into wild-type (CAI4) and Δgst2 mutant (GST2-1142) strains. The

modified strains were assessed in terms of their abilities to support hyphal

development when cultured on solid SLAD medium.

In this work, the hyphal defect of the Δgst2 mutant strain was not suppressed by

the overexpression of transcription factors CPH1 or EFG1. Furthermore, an

overexpression of RAS1 was unable to complement the hyphal defect of the Δgst2

mutant strain at the condition tested. Contrary to preceding results, expression of the

hyperactive RAS1G13V allele, which carries a mutation that locks the G protein in the

active state (Feng et al., 1999), in Δgst2 mutant cells suppressed the hyphal-

formation defect on solid SLAD medium. The expression of the Ras1G13Vp in wild-

type cells also enhanced the formation of pseudohyphae.

Biochemical studies of C. albicans implicate cAMP level increases in yeast-

hyphae transitions (Niimi, 1996). Previous reports have shown that exogenous

addition of cAMP or dibutyryl cAMP to C. albicans cells increases the frequency of

yeast-hyphae transitions and is able to suppress a defect in adenylate cyclase activity

(Bahn and Sundstrom, 2001; Rocha et al., 2001). In this study, addition of cAMP to

wild-type cells enhanced the formation of pseudohyphae on solid SLAD medium

- 52 -

and exogenous addition of cAMP to Δgst2 mutant cells suppressed the hyphal-

formation defect in this medium (Figure 13B). Taken together, the present results

indicate that activation of hyphal-inducing signaling pathway by Gst2p occurs

upstream of the Ras1p-cAMP signaling pathway in response to nitrogen starvation.

- 53 -

Figure 11. Northern blot analysis of mRNAs related to the hyphal-inducing

signaling pathway in C. albicans. (A) Wild-type (WT) (CAI4Y) and Δgst2 mutant

(GST2-1142Y) strains were incubated at 28°C for 2 h on SLAD liquid medium

containing 0.01 mM ammonium sulfate, and Northern blots were prepared with total

RNA from cells. PCR products were amplified with the appropriate oligonucleotides

(see Table 3) and labeled with (α-32P)dCTP. (B) The time courses of mRNA

expression of MEP2, RAS1 and GST2. Total RNA was isolated from wild-type

(CAI4Y) and Δgst2 (GST2-1142Y) mutant cells cultured in SLAD liquid medium

for 4 h at 28°C, and transcript levels were determined.

- 54 -

Time

(min)

Wild-type Δgst2

RAS1

MEP2

GST2

rRNA

B

A

0 20 40 60 120 240 0 20 40 60 120 240

10 0.01

Δgst2 Wild-type

Ammonium sulfate (mM) 10 0.01

MEP2

RAS1

HWP1

EFG1

CPH1

GAP1

rRNA

- 55 -

Figure 12. Expression of genes related to the hyphal-inducing signaling pathway in

C. albicans. Wild-type (CAI4Y) and Δgst2 mutant (GST2-1142Y) were incubated at

28°C for 2 h on SLAD liquid medium containing 0.01 mM ammonium sulfate. Upper

panel is result of Northern blot analysis. rRNA was used as loading control. Lower

panel is result of quantitative real-time PCR. All values were normalized by using

18s rRNA as an internal control, according to the 2-ΔΔCt method. 104-fold diluted

cDNA was used for 18s rRNA. Data are derived from the average of three repeated

experiments from three samples. Bars represent the standard deviations.

- 56 -

0

5

10

15

20

MEP2 RAS1 EFG1 CPH1 HWP1 GAP1

No

rma

lize

d t

ran

sc

rip

t a

bu

nd

an

ce

(arb

itra

ry u

nit

s) WT

Δgst2

- 57 -

Figure 13. Effects of various expression constructs on the hyphal response to solid

SLAD medium in C. albicans. (A) Wild-type (WT; CAI4) and ∆gst2 mutant (GST2-

1142) strains containing each plasmid were incubated for 11 days at 28°C on SLAD

plates containing 0.01 mM ammonium sulfate (scale bar = 2 mm). The names of the

plasmids containing the various constructs are given on the left and described in

Table 2. (B) Cells from the WT and ∆gst2 mutant were incubated on SLAD plates

containing 0.01 mM ammonium sulfate with (+cAMP) or without (–cAMP)

dibutyryl cAMP (10 mM final concentration). Photographs were taken after 11 days

of incubation at 28°C in the test medium (scale bar = 2 mm).

- 58 -

Δgst2 Wild-type

pADH

pADH-

RAS1G13V

pADH-

RAS1

pADH-

CPH1

pADH-

EFG1

B Δgst2 Wild-type

-cAMP +cAMP +cAMP -cAMP

A

- 59 -

4. Influence of GST2 to transcriptional regulation of GLN3,

an ammonium permease regulatory GATA transcription

factor

4.1 GST2 regulates GLN3 transcription under nitrogen starvation

condition

Previous studies have shown that the expression of ammonium permease, MEP2,

is controlled by the GATA factors Gln3p and Gat1p under conditions of nitrogen

starvation (Dabas and Morschhäuser, 2007; Liao et al., 2008). As shown in Figure

12, the Δgst2 mutant promoted higher MEP2 mRNA levels than the wild-type under

nitrogen limitation conditions. These results suggested that the upregulation of

MEP2 in Δgst2 mutant is dependent on GATA factors. To investigate this hypothesis,

Northern blot analysis was performed with wild-type (CAI4Y), Δgst2(GST2-1142Y),

Δgln3, Δgat1, Δmep2, and Δmep1 single mutants, and Δgln3/Δgat1 and

Δmep2/Δmep1 double mutants (Figure 14A). All mutants without Δgst2, have URA3

at their own loci. Therefore I investigated SC5314 and Δgst2 (GST2-114) to reduce

effect of URA3 localization. The results indicated that deletion of GLN3 or GAT1

reduced the level of MEP2 transcription. However, Δmep2 and Δmep1 increased a

transcription level of MEP1 and MEP2, respectively. The Δgst2 mutant showed an

approximately 1.6-fold increase (Figure 14B) in GLN3 transcript level but not that

of GAT1, suggesting that Gst2p functions as a negative regulator of GLN3 expression

in response to nitrogen limitation. In addition, gene expression analysis revealed that

- 60 -

deletion of GST2 increased the MEP1, mRNA level similar to MEP2. These findings

led to the hypothesis that Gst2p regulates proper GLN3 expression and consequently

regulates ammonium permeases, MEP2 and MEP1, expression under nitrogen

starvation condition

4.2 Δgst2 increase sensitivity to rapamycin

The TOR (target of rapamycin) pathway is a global nutrient sensing pathway

and is the target of inhibition by the drug rapamycin in C. albicans and other fungi

(Cruz et al., 2001). Cell growth is inhibited in the presence of rapamycin, an inhibitor

of TOR kinases. The sensitivity of C. albicans to rapamycin was greatly decreased

by deletion of either GLN3 or GAT1. Sensitivity was further reduced in Δgln3Δgat1

double mutants. This suggests that Gln3p and Gat1p are subject to TOR kinase

control and function downstream of TOR kinase. Deletion of GST2 was increased

sensitivity to rapamycin (Figure 15). These results indicate that Gst2p is related with

TOR regulon. Taken together, these findings suggest that Gst2p regulates proper

GLN3 expression and consequently regulates the expression of the ammonium

permeases MEP2 and MEP1 under conditions of nitrogen starvation.

- 61 -

Figure 14. Up-regulation of GLN3 in Δgst2. (A) Northern blot analysis of mRNAs

related to ammonium permease regulation in C. albicans. Cells were incubated at

28°C for 2 h on SLAD liquid medium containing 0.01 mM ammonium sulfate. (B)

Quantitative PCR of genes related to ammonium permease regulation in C. albicans.

Wild-type (CAI4Y) and Δgst2 mutant (GST2-1142Y) were incubated at 28°C for 2

h on SLAD liquid medium containing 0.01 mM ammonium sulfate. All data were

normalized by using 18s rRNA as an internal control, according to the ΔΔCt method.

Data are derived from the average of three repeated experiments from three samples.

Bars represent the standard deviations, and the relatevie levels of MEP2, MEP1,

GLN3, GAT1 expression in Δgst2 mutant to that of the wild-type strain presented as

fold changes in y-axis.

- 62 -

0

0.5

1

1.5

2

2.5

3

MEP2 MEP1 GLN3 GAT1

Re

lative

exp

ressio

n

WT

Δgst2

A

B

GLN3

Ammonium sulfate (0.01 mM)

WT

GAT1

MEP2

MEP1

rRNA

(SC5314) (GST2 -114)

(GST2 -1142Y)

CAI4 Δgst2 Δmep2 Δgln3 Δmep1 Δgat1 Δgst2 Δmep2 Δgln3

(CAI4Y) Δmep1 Δgat1

- 63 -

Figure 15. Rapamycin sensitivity assay of Δgst2. Serial dilutions of strains WT

(CAI4Y), Δgst2 GST2-1142Y), the rescued Δgst2 mutant were spotted on YPD

containing 10 ng/ml rapamycin and imaged after incubation 72 h at 28°C.

Additionally, SC5314 (WT), Δgst2 (GST2-114), Δgln3(GLN3M4A),

Δgat1(GAT1M4A) and Δgln3/Δgat1(Δgln3GAT1M4A) double mutant were spotted

on YPD containing 10 ng/ml rapamycin and imaged after incubation 72 h at 28°C.

- 64 -

105 10

4 10

3 10

2 10

1 10

5 10

4 10

3 10

2 10

1

Control + 10 ng/ml Rapamycin

Δgst2 (GST2-114)

Δgln3

Δgat1

Δgln3Δgat1

WT (SC5314)

WT + pADH (CAI4Y)

Δgst2 + pADH (GST2-114Y)

Δgst2 + pADH-GST2

- 65 -

DISCUSSION

The results of this study demonstrate that GST2 is induced in response to

nitrogen limitation and required for nitrogen starvation-induced filamentation of C.

albicans. The present findings indicate that Gst2p has GST activity and is required

for response to oxidative stress. The GST activity relies at least in part on 41st

position serine residue of Gst2p, which is weakly conserved between C. albicans

Gst2p and S. pombe Gst2p. The Ser41 is a neighboring residue of predicted GSH

binding site from the RCSB Protein Data Bank (http://www.rcsb.org), hence the

residue may influence Gst activity. To investigate the possibility that Gst2p affects

yeast-to-hypha transition, phenotype of Δgst2 under various growth conditions was

examined and marked filamentous defect of Δgst2 was detected under conditions of

nitrogen starvation. Strongly induction of GST2 mRNA expression was also found

when the ammonium sulfate concentration decreased to 0.1 mM or below as the sole

nitrogen source. High concentration of ammonium suppresses filamenatation of C.

albicans and retains basal level transcription of GST2. GST2 expression was induced

irrespective of the nature of the limiting nitrogen source in the growth medium.

Expression of GST2 at body temperature (37 °C) was more inducible than that of

28 °C under various culture conditions. Elevated temperature induces filamentation

in C. albicans and increases hypha-specific genes under non-hypha-inducing media

(Kadosh and Johnson, 2005). GST2 was also influenced by high temperature, but the

increase of transcript by temperature was much less than that by nitrogen starvation.

- 66 -

Taken together, these results indicate that GST2 is involved in a wide range of

cellular responses to environmental stresses, including nitrogen starvation.

The morphological conversion from the yeast to filamentous growth forms in C.

albicans is regulated by several conserved signaling pathways, including the Cph1-

mediated MAPK and Efg1-mediated cAMP-PKA cascades (Hall et al., 2009; Liu,

2001; Rocha et al., 2001). Overexpression of either CPH1 or EFG1 results in

enhanced filamentous growth, with Ras1 capable of stimulating both the cAMP and

MAPK pathways (Courchesne and Magasanik, 1988; Sudbery, 2011). Cph1p and its

upstream activating pathway are required only for hyphal formation on solid Spider

medium, but not in liquid media. Consequently, Efg1p is thought to be the major

regulator of hyphal formation under most conditions (Csank et al., 1998; Liu et al.,

1994). C. albicans Mep2p, a high affinity ammonium permease, has been reported

to activate both the MAPK and cAMP-PKA pathways for the induction of

filamentous growth under conditions of nitrogen starvation (Biswas and

Morschhäuser, 2005). In Northern blot analysis, Δgst2 increase MEP2 transcription

and decrease RAS1 transcription markedly. These observations suggest a close

correlation between the Gst2p and Mep2p-regulated signaling pathways. The

resulting overexpression of CPH1 or EFG1 or RAS1 did not rescue the Δgst2

phenotype, whereas EFG1 overexpression in WT cells led to enhanced filamentation

around colonies. In contrast, the hyphal growth defect caused by homozygous

deletion of the GST2 gene was rescued by either overexpression of a hyperactive

RAS1G13V allele or through exogenous addition of cAMP. It means that the defect of

- 67 -

filamentation in Δgst2 was caused by inhibition of Ras1p activation. Based on these

observations, I propose that the Ras1-cAMP signaling pathway is a possible

downstream target of Gst2p in morphogenesis in response to nitrogen starvation.

Mep2p is an ammonium sensor that exists in a signaling component

conformation and induces morphogenesis when ammonium is absent or present at

low concentrations. Under these conditions, Mep2p is expressed at high levels, and

the high expression levels are required to promote morphogenesis (Biswas and

Morschhäuser, 2005). However, Northern blot analysis of cells growing on SLAD

medium indicated that the level of MEP2 transcripts was higher in Δgst2 cells than

wild-type cells despite defective filamentous growth in Δgst2 (Figure 7). In addition,

MEP1, another ammonium permease in C. albicans, transcripts were increased in

Δgst2 under conditions of nitrogen starvation (Figure 14). In C. albicans, the

signaling activity of Mep2p is inhibited by ammonium or its assimilation products.

Because Mep1p is a more efficient ammonium transporter than Mep2p (Biswas and

Morschhäuser, 2005), two-fold increase of MEP1 expression may induce

ammonium assimilation in Δgst2 cells despite nitrogen-starved condition. The

assimilation is possible to inhibit hyphal formation in Δgst2 cells.

The ammonium permeases MEP2 and MEP1 are controlled by the GATA

transcription factors GLN3 and GAT1. GLN3 is also an important regulator of

nitrogen starvation-induced filamentous growth in C. albicans (Dabas and

Morschhäuser, 2007; Liao et al., 2008). To determine whether Gst2p contributes to

the regulation of GATA factors, the transcript levels of GLN3 and GAT1 was

- 68 -

compared between Δgst2 and wild-type cells (Figure 14). Strikingly, the Δgst2

mutant exhibited a greater increase in GLN3 expression than wild-type cells. The

increased ammonium permease transcript level in Δgst2 mutant cells can probably

be attributed to elevated GLN3 expression. These findings suggest that Gst2p may

play a role as a regulator of GLN3 expression in C. albicans under conditions of

nitrogen starvation. Recently, deletion of GLN3, GAT1, or both genes resulted in

resistance to rapamycin, suggesting that the TOR kinase also controls Gln3p and

Gat1p in C. albicans (Dabas and Morschhäuser, 2007). The deletion mutants of

GST2 were more sensitive to rapamycin than wild-type (Figure 15). The result raises

the possibility that ammonium premeases regulation by Gst2p may also occur via

Gln3p in C. albicans.

Based on the results of the present study, I propose that Gst2p may be a

component of the Gln3p-related ammonium permease regulation process (Figure 16).

Gst2p also plays a role in nitrogen starvation-induced filamentation in preference to

induction of Mep2p expression. Although how Gst2p regulate GLN3 expression is

unclear, these findings have important implications for understanding of the

mechanism of filamentation by nitrogen starvation. Gst2p may be a new regulatory

component of filamentation in response to nitrogen starvation.

- 69 -

Figure 16. Proposed pathway of Gst2p during nitrogen starvation in C. albicans. A

MEP2 transcription may be regulated by the Gln3p via Gst2p. GLN3 is repressed by

Gst2p in response to nitrogen limitation. The repressed GLN3 transcription also

decreases Mep2p and Mep1p expression. Grey dashed line indicates a putative

regulation of Gst2p.

- 70 -

Gst2p Gln3p Gat1p

Mep2p

Nitrogen starvation

Filamentous growth

Mep1p

- 71 -

REFERENCES

Bahn, Y.S., Staab, J., and Sundstrom, P. (2003) Increased high-affinity phosphodiesterase

PDE2 gene expression in germ tubes counteracts CAP1-dependent synthesis of cyclic AMP,

limits hypha production and promotes virulence of Candida albicans. Mol Microbiol. 50,

391-409.

Bahn, Y.S., and Sundstrom, P. (2001) CAP1, an adenylate cyclase-associated protein gene,

regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required

for virulence of Candida albicans. J Bacteriol. 183, 3211-3223.

Beck, T., and Hall, M.N. (1999) The TOR signalling pathway controls nuclear localization

of nutrient-regulated transcription factors. Nature. 402, 689-692.

Berman, J. (2006) Morphogenesis and cell cycle progression in Candida albicans. Curr

Opin Microbiol. 9, 595-601.

Bertram, G., Swoboda, R.K., Gooday, G.W., Gow, N.A.R., and Brown, A.J.P. (1996)

Structure and regulation of the Candida albicans ADH1 gene encoding an immunogenic

alcohol dehydrogenase. Yeast. 12, 115-127.

Biswas, K., and Morschhäuser, J. (2005) The Mep2p ammonium permease controls

nitrogen starvation-induced filamentous growth in Candida albicans. Mol Microbiol. 56,

649-669.

Biswas, S., Van Dijck, P., and Datta, A. (2007) Environmental sensing and signal

transduction pathways regulating morphopathogenic determinants of Candida albicans.

Microbiol Mol Biol Rev. 71, 348-376.

- 72 -

Bourne, H.R., Wrischnik, L., and Kenyon, C. (1990) Ras Proteins - Some Signal

Developments. Nature. 348, 678-679.

Calderone, R.A., and Fonzi, W.A. (2001) Virulence factors of Candida albicans. Trends

Microbiol. 9, 327-335.

Chen, H., Fujita, M., Feng, Q.H., Clardy, J., and Fink, G.R. (2004) Tyrosol is a quorum-

sensing molecule in Candida albicans. Proc Natl Acad Sci U S A. 101, 5048-5052.

Chen, J.Y., Zhou, S., Wang, Q., Chen, X., Pan, T., and Liu, H.P. (2000) Crk1, a novel

Cdc2-related protein kinase, is required for hyphal development and virulence in Candida

albicans. Mol Cell Biol. 20, 8696-8708.

Choi, J.H., Lou, W., and Vancura, A. (1998) A novel membrane-bound glutathione S-

transferase functions in the stationary phase of the yeast Saccharomyces cerevisiae. J Biol

Chem. 273, 29915-29922.

Chung, S.C., Kim, T.I., Ahn, C.H., Shin, J., and Oh, K.B. (2010) Candida albicans

PHO81 is required for the inhibition of hyphal development by farnesoic acid. FEBS letters.

584, 4639-4645.

Chung, S.C., Lee, J.Y., and Oh, K.B. (2005) cDNA cloning of farnesoic acid-induced genes

in Candida albicans by differential display analysis. J Microbiol Biotechn. 15, 1146-1151.

Courchesne, W.E., and Magasanik, B. (1988) Regulation of nitrogen assimilation in

Saccharomyces cerevisiae roles of the URE2 and GLN3 Genes. J Bacteriol. 170, 708-713.

Crespo, J.L., and Hall, M.N. (2002) Elucidating TOR signaling and rapamycin action:

lessons from Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 66, 579-591.

- 73 -

Cruz, M.C., Goldstein, A.L., Blankenship, J., Del Poeta, M., Perfect, J.R., McCusker,

J.H., Bennani, Y.L., Cardenas, M.E., and Heitman, J. (2001) Rapamycin and less

immunosuppressive analogs are toxic to Candida albicans and Cryptococcus neoformans via

FKBP12-dependent inhibition of TOR. Antimicrob Agents Chemother. 45, 3162-3170.

Csank, C., and Haynes, K. (2000) Candida glabrata displays pseudohyphal growth. Fems

Microbiol Lett. 189, 115-120.

Csank, C., Schroppel, K., Leberer, E., Harcus, D., Mohamed, O., Meloche, S., Thomas,

D.Y., and Whiteway, M. (1998) Roles of the Candida albicans mitogen-activated protein

kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect Immun. 66,

2713-2721.

Cutler, J.E. (1991) Putative virulence factors of Candida albicans. Annu Rev Microbiol. 45,

187-218.

Dabas, N., and Morschhäuser, J. (2007) Control of ammonium permease expression and

filamentous growth by the GATA transcription factors GLN3 and GAT1 in Candida albicans.

Eukaryot Cell. 6, 875-888.

Dabas, N., Schneider, S., and Morschhäuser, J. (2009) Mutational analysis of the Candida

albicans ammonium permease Mep2p reveals residues required for ammonium transport and

signaling. Eukaryot Cell. 8, 147-160.

Davis-Hanna, A., Piispanen, A.E., Stateva, L.I., and Hogan, D.A. (2008) Farnesol and

dodecanol effects on the Candida albicans Ras1-cAMP signalling pathway and the regulation

of morphogenesis. Mol Microbiol. 67, 47-62.

- 74 -

Dhillon, N.K., Sharma, S., and Khuller, G.K. (2003) Signaling through protein kinases and

transcriptional regulators in Candida albicans. Crit Rev Microbiol. 29, 259-275.

Feng, Q.H., Summers, E., Guo, B., and Fink, G. (1999) Ras signaling is required for

serum-induced hyphal differentiation in Candida albicans. J Bacteriol. 181, 6339-6346.

Fonzi, W.A., and Irwin, M.Y. (1993) Isogenic strain construction and gene-mapping in

Candida albicans. Genetics. 134, 717-728.

Garcerá, A., Casas, C., and Herrero, E. (2010) Expression of Candida albicans glutathione

transferases is induced inside phagocytes and upon diverse environmental stresses. Fems

Yeast Res. 10, 422-431.

Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. (1992) Unipolar cell divisions

in the yeast Saccharomyces cerevisiae lead to filamentous growth regulation by starvation

and Ras. Cell. 68, 1077-1090.

Hall, R.A., Cottier, F., and Mühlschlegel, F.A. (2009) Molecular networks in the fungal

pathogen Candida albicans. Adv Appl Microbiol. 67, 191-212.

Hoffman, C.S., and Winston, F. (1987) A 10 minute DNA preparation from yeast efficiently

releases autonomous plasmids for transformation of Escherichia coli. Gene. 57, 267-272.

Hogan, D.A. (2006) Talking to themselves: autoregulation and quorum sensing in fungi.

Eukaryot Cell. 5, 613-619.

Hornby, J.M., Jensen, E.C., Lisec, A.D., Tasto, J.J., Jahnke, B., Shoemaker, R., Dussault,

P., and Nickerson, K.W. (2001) Quorum sensing in the dimorphic fungus Candida albicans

is mediated by farnesol. Appl Environ Microb. 67, 2982-2992.

- 75 -

Hornby, J.M., and Nickerson, K.W. (2004) Enhanced production of farnesol by Candida

albicans treated with four azoles. Antimicrob Agents Chemother. 48, 2305-2307.

Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999) Genetic analysis

of glutathione peroxidase in oxidative stress response of Saccharomyces cerevisiae. J Biol

Chem. 274, 27002-27009.

Kadosh, D., and Johnson, A.D. (2005) Induction of the Candida albicans filamentous

growth program by relief of transcriptional repression: a genome-wide analysis. Mol Biol

Cell. 16, 2903-2912.

Kim, S.Y., Kim, C., Han, I.S., Lee, S.C., Kim, S.H., Lee, K.S., Choi, Y., and Byun, Y.

(2001) Inhibition effect of new farnesol derivatives on all-trans-retinoic acid metabolism.

Metabolism. 50, 1356-1360.

Kohler, J.R., and Fink, G.R. (1996) Candida albicans strains heterozygous and

homozygous for mutations in mitogen-activated protein kinase signaling components have

defects in hyphal development. Proc Natl Acad Sci U S A. 93, 13223-13228.

Kron, S.J., and Gow, N.A.R. (1995) Budding yeast morphogenesis : signaling, cytoskeleton

and cell cycle. Curr Opin Cell Biol. 7, 845-855.

Lan, D.M., Hou, S.L., Yang, N., Whiteley, C., Yang, B., and Wang, Y.H. (2011) Optimal

production and biochemical properties of a lipase from Candida albicans. Int J Mol Sci. 12,

7216-7237.

Leberer, E., Harcus, D., Dignard, D., Johnson, L., Ushinsky, S., Thomas, D.Y., and

Schroppel, K. (2001) Ras links cellular morphogenesis to virulence by regulation of the

- 76 -

MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol

Microbiol. 42, 673-687.

Lee, K.L., Campbell, C.C., and Buckley, H.R. (1975) Amino acid liquid synthetic medium

for development of mycelial and yeast forms of Candida albicans. Sabouraudia. 13, 148-

153.

Lengeler, K.B., Davidson, R.C., D'Souza, C., Harashima, T., Shen, W.C., Wang, P., Pan,

X., Waugh, M., and Heitman, J. (2000) Signal transduction cascades regulating fungal

development and virulence. Microbiol Molecular Biol Rev. 64, 746-785.

Liao, W.L., Ramon, A.M., and Fonzi, W.A. (2008) GLN3 encodes a global regulator of

nitrogen metabolism and virulence of C. albicans. Fungal Genet Biol. 45, 514-526.

Lim, C.S.Y., Rosli, R., Seow, H.F., and Chong, P.P. (2012) Candida and invasive

candidiasis: back to basics. Eur J Clin Microbiol. 31, 21-31.

Liu, H.P. (2001) Transcriptional control of dimorphism in Candida albicans. Curr Opin

Microbiol. 4, 728-735.

Liu, H.P., Kohler, J., and Fink, G.R. (1994) Suppression of hyphal formation in Candida

albicans by mutation of a STE12 homolog. Science. 266, 1723-1726.

Lo, H.J., Kohler, J.R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., and Fink, G.R.

(1997) Nonfilamentous C. albicans mutants are avirulent. Cell. 90, 939-949.

Morschhäuser, J. (2011) Nitrogen regulation of morphogenresis and protease secretion in

Candida albicans. Int J Med Microbiol. 301, 390-394.

- 77 -

Neuhäuser, B., Dunkel, N., Satheesh, S.V., and Morschhäuser, J. (2011) Role of the Npr1

kinase in ammonium transport and signaling by the ammonium permease Mep2 in Candida

albicans. Eukaryot Cell. 10, 332-342.

Niimi, M. (1996) Dibutyryl cyclic AMP-enhanced germ tube formation in exponentially

growing Candida albicans cells. Fungal Genet Biol. 20, 79-83.

Odds, F.C. (1994) Pathogenesis of Candida infections. J Am Acad Dermatol. 31, S2-5.

Oh, K.B., Miyazawa, H., Naito, T., and Matsuoka, H. (2001) Purification and

characterization of an autoregulatory substance capable of regulating the morphological

transition in Candida albicans. Proc Natl Acad Sci U S A. 98, 4664-4668.

Rocha, C.R.C., Schröppel, K., Harcus, D., Marcil, A., Dignard, D., Taylor, B.N., Thomas,

D.Y., Whiteway, M., and Leberer, E. (2001) Signaling through adenylyl cyclase is essential

for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol Biol Cell.

12, 3631-3643.

Rocha, R., Pereira, P.J.B., Santos, M.A.S., and Macedo-Ribeiro, S. (2011) Unveiling the

structural basis for translational ambiguity tolerance in a human fungal pathogen. Proc Natl

Acad Sci U S A. 108, 14091-14096.

Sanglard, D., Ischer, F., Monod, M., and Bille, J. (1996) Susceptibilities of Candida

albicans multidrug transporter mutants to various antifungal agents and other metabolic

inhibitors. Antimicrob Agents Chemother. 40, 2300-2305.

Sato, T., Watanabe, T., Mikami, T., and Matsumoto, T. (2004) Farnesol, a morphogenetic

autoregulatory substance in the dimorphic fungus Candida albicans, inhibits hyphae growth

- 78 -

through suppression of a mitogen-activated protein kinase cascade. Biol Pharm Bull. 27, 751-

752.

Saville, S.P., Lazzell, A.L., Monteagudo, C., and Lopez-Ribot, J.L. (2003) Engineered

control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of

Candida albicans during infection. Eukaryot Cell. 2, 1053-1060.

Sonneborn, A., Bockmuhl, D.P., Gerads, M., Kurpanek, K., Sanglard, D., and Ernst,

J.F. (2000) Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans.

Mol Microbiol. 35, 386-396.

Stoldt, V.R., Sonneborn, A., Leuker, C.E., and Ernst, J.F. (1997) Efg1p, an essential

regulator of morphogenesis of the human pathogen Candida albicans, is a member of a

conserved class of bHLH proteins regulating morphogenetic processes in fungi. Embo J. 16,

1982-1991.

Sudbery, P.E. (2011) Growth of Candida albicans hyphae. Nat Rev Microbiol. 9, 737-748.

Whiteway, M. (2000) Transcriptional control of cell type and morphogenesis in Candida

albicans. Curr Opin Microbiol. 3, 582-588.

Zou, H., Fang, H.M., Zhu, Y., and Wang, Y. (2010) Candida albicans Cyr1, Cap1 and G-

actin form a sensor/effector apparatus for activating cAMP synthesis in hyphal growth. Mol

Microbiol. 75, 579-591.

- 79 -

ABSTRACT IN KOREAN

Candida albicans ,

. ( , 37°C,

pH>7.0, ) ,

,

.

GST2 . C.

albicans GST2 gene anotation

Gst2p glutathione S-transferase

.

,

(SLAD)

. GST2 mRNA

Gst2p

- 80 -

.

Δgst2

Ras1p, Cph1p, Efg1p

, Ras1p Ras1G13Vp

cyclic AMP

. Gst2p Ras1-cAMP

. GST2 Ras1p

MEP2 MEP1 .

ammonium permease GLN3

. , Gst2p

GLN3 ammonium

.