Lucy A. Godley, M.D., Ph.D.

Section of Hematology/OncologyDepartments of Medicine and Human Genetics

The University of Chicagolgodley@medicine.bsd.uchicago.edu

Inherited Hematologic Malignancies

대한혈액학회 Korean Society of Hematology

COI disclosureName of author ： Lucy A. Godley

I currently have, or I have had in the past two years, an affiliation or financial interest with business corporation(s):

(1)Royalties from an article about inherited hematopoietic malignancies by UptoDate, Inc.

Godley LabImo Akpan

Stephen ArnovitzAnase Asom

Marcela CavalcanteJohn Cao

Michael DrazerSimone FeursteinAnastasia HainsMatthew Jones

Danijela MojsilovicAfaf Osman

Matthew PozsgaiBrian RuhleAmy Trottier

Funding: Cancer Research Foundation, The Taub Foundation, The Leukemia and Lymphoma Society, NIH, V Foundation

My patients and their families

Acknowledgments

Jane Churpek

Soma DasZejuan Li

Jeremy SegalJames Vardiman

Realizing the goal of precision medicine in oncology

DEFINE:Baseline genetics

Baseline epigeneticsAcquired genetics in the HSC/tumor

Acquired epigenetics in the HSC/tumor

to devise an effective treatment strategy for a particular patient

RussiaAshkenazi Jewish

AMLNl karyotypeDDX41 L373P VAF49%DDX41 R525H VAF10%

Rx: 7+3 morphologic remission

Northern EuropeDES exposure

DES daughterHLA-identical sibling—now what?

Case #1: Importance of germline predisposition syndromes to donor selection

RussiaAshkenazi Jewish

AMLDDX41 L373P VAF49%DDX41 R525H VAF10%

Northern EuropeDES exposure

DES daughterHLA-identical sibling—now what?

Case #1: Importance of germline predisposition syndromes to donor selection

Questions raised by this case:1) How do we use molecular profiling results to find these families?2) How do we test for germline status of a suspected inherited mutation?3) If the brother has the mutation and he receives G-CSF, is his leukemia risk increased?4) If the brother does not have the mutation, but the DDX41 L373P variant is found to be

germline, how do we determine if it is deleterious or not?5) If the patient is found to have a germline DDX41 mutation and opts for an allogeneic stem cell

transplant using an unrelated donor, what can we tell them about that donor’s genetic predisposition to cancer?

6) What is the role of environmental exposure to cancer risk for people at elevated genetic risk?

Class Patient Population Specific Syndromes

MDS/AL Predisposition SyndromesMDSAMLALL

ANKRD26 RUNX1CEBPA SAMD9/SAMD9LDDX41 ALL only: IKZF1ETV6 PAX5GATA2 SH2B3MBD4MECOM/EVI1RTEL1

Bone Marrow Failure SyndromesAA

MDSAML

Dyskeratosis congenita SAMD9/SAMD9LFanconi anemia SBDS/EFL1/DNAJC21ERCC6L2 NAF1

Genetic Syndromes ALL Ataxia Telangiectasia (ATM)Bloom syndrome (BLM)Down syndrome (Trisomy 21)Leopard/Noonan syndrome (PTPN11)Neurofibromatosis I (NF1)Nijmegen Breakage syndrome (NBS1)Wiskott Aldrich syndrome (WAS)

Familial MPNs PV, ET, PMF, CML 14q32.2 genomic duplication (ATG2B/GSKIP)RBBP6

Familial Lymphomas CLLHL/NHL

ASXL1 ITKCASP10 MAGT1CD27/CD40LG MKL1CTLA4 MLL DOCK8 PIK3CD

Cancer Predisposition Syndromes All

Li-Fraumeni syndrome (TP53)Hereditary breast & ovarian cancer (BRCA1/2)Lynch syndrome Cowden syndrome (PTEN)

Familial MM/LPL MM, MGUS, LPL KDM1A/LSD1

Inherited predisposition is increasingly recognized

NCCN MDS guidelines urge testing for germline

predisposition

European LeukemiaNet guidelines also include testing for predisposition mutations

WHO classification includes germline predisposition to

myeloid malignancies

Blood 129: 424-447, 2017

JNCCN 15: 60-87, 2017

Genetic predisposition with environmental insult

germline predisposition

environmental insult

Genetic predisposition with environmental insult

germline predisposition

environmental insult

germline CEBPA mutations- highly penetrant

Genetic predisposition with environmental insult

germline predisposition

environmental insult

post-atomic bomb radiation

Genetic predisposition with environmental insult

germline predisposition

environmental insult

therapy-related myeloid neoplasm

An algorithm for patient work-up

Patient acquired through strong personal/family

history

Patient acquired through routine clinical testing of

presenting leukemia

Family identified through evaluation of matched related

allogeneic stem donor

Perform detailed personal bleeding/family history

bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2/TP53 mutation

Perform skin biopsygrow skin fibroblasts

isolate gDNA

Run NGS panel and array analysis specific for

inherited predisposition to hematopoietic malignancies

if strong

if negative

Research-based whole exome/genome sequencing

Family-based genetic counseling and clinical site-specific testing

if positive

ANKRD26ATM

B Marrow FailureBRCA1/2

CEBPADDX41

ETV6Fanconi anemia

GATA2SAMD9

SAMD9LSRP72RUNX1

Telomere BiolTP53

A hematologic malignancy-focused cancer risk clinic

• Genetic counseling for family members

• Early identification allows proper anticipatory medical care for mutation carriers, but the few surveillance guidelines that exist are based on expert experience rather than prospective data

• Careful hematopoietic stem cell transplant donor evaluation, including interdisciplinary discussions regarding donor selection for patients under consideration for a matched related allogeneic stem cell transplant

• Incorporation of genetic predisposition within the new WHO classification scheme and clinical guidelines, including NCCN MDS and European LeukemiaNet

Key aspects of pedigree review

• A high index of clinical suspicion

• Familiarity with the known predisposition syndromes

• Key features within the personal and family history:– Multiple cancers within a single individual (e.g., t-MN)– Other hematopoietic malignancies within 2 generations– Other hematopoietic abnormalities within the family (e.g., macrocytosis, bleeding

propensity, severe anemia or anemia in men)– NOTE: NOT according to age of onset

• Consider results of molecular analyses performed on leukemic cells

An algorithm for patient work-up

Patient acquired through strong personal/family

history

Patient acquired through routine clinical testing of

presenting leukemia

Family identified through evaluation of matched related

allogeneic stem donor

Perform detailed personal bleeding/family history

bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2 mutation

Perform skin biopsygrow skin fibroblasts

isolate gDNA

Run NGS panel and array analysis specific for

inherited predisposition to hematopoietic malignancies

if strong

if negative

Research-based whole exome/genome sequencing

Family-based genetic counseling and clinical site-specific testing

if positive

197 pts65 children, 132 adults 110 females, 87 males

Age range: 1 - 84

Overall moleculardiagnostic rate: 19%

(37/197) 15% in children21% in adults

Guidugli L. et al. Leukemia 31: 1226-1229 (2017)

ClinGen Committee on Inherited Thrombocytopenia

ClinGen Committee on Inherited Myeloid Malignancies

variantcollation andclassification

How to interpret variants you see in molecular testing

An algorithm for patient work-up

Patient acquired through strong personal/family

history

Patient acquired through routine clinical testing of

presenting leukemia

Family identified through evaluation of matched related

allogeneic stem donor

Perform detailed personal bleeding/family history

bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2/TP53 mutation

Perform skin biopsygrow skin fibroblasts

isolate gDNA

Run NGS panel and array analysis specific for

inherited predisposition to hematopoietic malignancies

if strong

if negative

Research-based whole exome/genome sequencing

Family-based genetic counseling and clinical site-specific testing

if positive

Detecting germline mutations through tumor mutational profiling

3 2

1

LF = TP53 mutation associated with Li-Fraumeni Syndrome

Drazer, M.W. et al. Blood Adv 2: 146-150 (2018)

Specific considerations regarding particular cancer predisposition syndromes

Known Familial MDS/AL SyndromesMyeloid malignancies only1.Familial AML with mutated CEBPA (CEBPA)2.Familial MDS/AML due to DDX41 mutation (DDX41)3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)

-- germline RBBP6 mutation

Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)

Additional Organ Systems Affected1.GATA2 deficiency syndromes (GATA2)2.Autosomal dominant telomere syndromes (TERT and TERC)3.Familial aplastic anemia/MDS due to SRP72 mutation (SRP72)4.Ataxia-Pancytopenia Syndrome (SAMD9L mutation) and

MIRAGE syndrome (SAMD9 mutation)5.Shwachman-Diamond Syndrome (new causative genes: EFL1 and

DNAJC21)

Key Management Issues

Myeloid malignancies only

1.Familial AML with mutated CEBPA (CEBPA)- Near complete penetrance- 10% AMLs with bi-allelic CEBPA mutations have germline mutation- Most often, the inherited allele has a mutation in the 5’ end of the

gene, with acquisition of a mutation in the second allele at the 3’end of the gene

2.Familial MDS/AML due to DDX41 mutation (DDX41)- Average age of diagnosis: 62yo- Three pedigrees now with pediatric cases of leukemia- Some mutations may also predispose to lymphoid malignancies;

colon ca/gastric ca

3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)-- germline RBBP6 mutation

Familial leukemia with CEBPA mutation

Tawana K et al. Blood 126: 1214-1223, 2015

Clonal Evolution in AMLs:– “Relapses” appear to be

independent leukemias, since acquired CEBPA mutation is distinct.

– Acquired mutations in GATA2and WT1 are common and mutually exclusive.

– AMLs are chemosensitive.

Key Management Issues

Myeloid malignancies only

1.Familial AML with mutated CEBPA (CEBPA)- Near complete penetrance- 10% AMLs with bi-allelic CEBPA mutations have germline mutation- Most often, the inherited allele has a mutation in the 5’ end of the

gene, with acquisition of a mutation in the second allele at the 3’end of the gene

2.Familial MDS/AML due to DDX41 mutation (DDX41)- Average age of diagnosis: 62yo- Three pedigrees now with pediatric cases of leukemia- Some mutations may also predispose to lymphoid malignancies;

colon ca/gastric ca

3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)-- germline RBBP6 mutation

DDX41 on 5q35.3 encodes a DEAD/H-Box helicase

Polprasert C, Schulze I et al. Cancer Cell 27: 1-13, 2015Lewinsohn, M et al. Blood 127: 1017-1023, 2016

Li R et al. Haematologica 101: e228-231, 2016

Frameshift mutationMissense mutationSplicing mutation

Blue, CaucasianRed, Asian

ZnF

Case #2: Detecting a germline syndrome from tumor mutational profiling

71yoT3N0M0 grade 3 gastric cancerRx: neoadjuvant chemo: cisplatin/5-FUtotal gastrectomyFOLFOX, completed 3/6 planned cycles due to cytopenias

73yot-MNPanel testing: DDX41 D140fs skin biopsy confirmed germline

paternal grandmothernon-smokerno alcohol intakehead and neck cancer in 60’s

Northern Europe

Case #3: Detecting a germline syndrome from tumor mutational profiling

2

Middle East- JordanfatherAML at 60yo

50yochronic phase CMLcomplete molecular response on Gleevec

53yo‘myeloid blast’ phase CMLno detectable BCR-ABLPanel testing: DDX41 P78fsR525HSkin biopsy confirmed P78fs is a germline mutation.

Known Familial MDS/AL SyndromesMyeloid malignancies only1.Familial AML with mutated CEBPA (CEBPA)2.Familial MDS/AML due to DDX41 mutation (DDX41)3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)

-- germline RBBP6 mutation

Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)

Additional Organ Systems Affected1.GATA2 deficiency syndromes (GATA2)2.Autosomal dominant telomere syndromes (TERT and TERC)3.Familial aplastic anemia/MDS due to SRP72 mutation (SRP72)4.Ataxia-Pancytopenia Syndrome (SAMD9L mutation) and

MIRAGE syndrome (SAMD9 mutation)5.Shwachman-Diamond Syndrome (new causative genes: EFL1 and

DNAJC21)

Key Management Issues

Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)

- Both germline RUNX1 and ETV6 mutations predispose to both myeloid and lymphoid malignancies; to date, germline ANKRD26 mutations have only been associated with development of myeloid malignancies

- Patients can bleed out of proportion to their platelet counts, since the platelets have abnormal aggregation. Therefore for surgery/childbirth, we recommend transfusion of normal platelets

Churpek, J.E. et al.* Leuk Lymph 51: 1931-1935, 2010

Familial platelet disorder with propensity tomyeloid malignancies (germline RUNX1 mutation)

*Jacqueline S. Garcia

ANKRD26 promoter mutations disrupt RUNX1 and FLI1 repression,

leading to activation of MAPK and disrupted platelet development

ANKRD26

Exon 1Total of 34 exons

Repress transcriptionGAGGGAGAGATTGGAAACCGCGGAGTTTCCTTGGG

RUNX1 FLI1

Bluteau, D. et al. J Clin Invest 124: 580-591, 2014

ANKRD26 promoter mutations disrupt RUNX1 and FLI1 repression,

leading to activation of MAPK and disrupted platelet development

ANKRD26

Exon 1Total of 34 exons

GAGGGAGAGATTGGAAACCGCGGAGTTTCCTTGGG

CTG

TAACGT

GGA

CA

∆AT

RUNX1 FLI1

Bluteau, D. et al. J Clin Invest 124: 580-591, 2014

Clonal hematopoiesis

Churpek, JE et al. Blood 126: 2484-2490, 2015

in those with a germline predisposition syndrome

- Lynch: MSH2/6, MLH1, PMS2 - Li-Fraumeni: TP53- Hereditary Breast/Ovarian CA: BRCA1/2 are Fanconi anemia-like genes

Cancer is a genetic disease–‘Solid tumor’ gene syndromes do not exist

Churpek, JE et al. Cancer 122: 304-311, 2016

In a person with a germline mutation, all cells of the body have that mutation… so in the bone marrow,

which cell matters?

Mesenchymal stromal cells with germline mutations do not differentiate normally

Japanese

MDS

MDS MDS

cervical capancytopeniaMDS leukopeniabreast caprostate ca

AMLcancer

colon ca

cancer

breast capancreatic ca

Germline DDX41 mutations: Poor HSC function afterallogeneic stem cell transplantation with wild-type HSCs

Family with germline DDX41 R339L mutation

+ +

++ -

Smith, J.N.P. et al. PLos Pathog (2018).

Matched unrelated donor transplant

ANC 200plts <10K/uL

Romiplostim q 3wANC 1500plts >150K/uL

Realizing the goal of precision medicine in oncology

DEFINE:Baseline genetics

Baseline epigeneticsAcquired genetics in the HSC/tumor

Acquired epigenetics in the HSC/tumorto devise an effective treatment strategy for a particular patient

• Family history is an important tool in hematology.• Consider familial syndromes for all patients with hematopoietic

malignancies How can we test patients systematically? Special consideration at the time of allogeneic stem cell transplantation!

• Both point mutations and genomic rearrangements can lead to germline predisposition, so testing should be comprehensive for both.

• ClinGen Committee now formed to help with uniform variant calling• It is critical to test true germline DNA (e.g., cultured skin fibroblasts).

• Additional syndromes and pathways in leukemogenesis will be identified!