inherited hematologic malignanciesplan.medone.co.kr/70_icksh2019/data/ss06-1_lucy_ann... · 2019....
TRANSCRIPT
Lucy A. Godley, M.D., Ph.D.
Section of Hematology/OncologyDepartments of Medicine and Human Genetics
The University of [email protected]
Inherited Hematologic Malignancies
대한혈액학회 Korean Society of Hematology
COI disclosureName of author : Lucy A. Godley
I currently have, or I have had in the past two years, an affiliation or financial interest with business corporation(s):
(1)Royalties from an article about inherited hematopoietic malignancies by UptoDate, Inc.
Godley LabImo Akpan
Stephen ArnovitzAnase Asom
Marcela CavalcanteJohn Cao
Michael DrazerSimone FeursteinAnastasia HainsMatthew Jones
Danijela MojsilovicAfaf Osman
Matthew PozsgaiBrian RuhleAmy Trottier
Funding: Cancer Research Foundation, The Taub Foundation, The Leukemia and Lymphoma Society, NIH, V Foundation
My patients and their families
Acknowledgments
Jane Churpek
Soma DasZejuan Li
Jeremy SegalJames Vardiman
Realizing the goal of precision medicine in oncology
DEFINE:Baseline genetics
Baseline epigeneticsAcquired genetics in the HSC/tumor
Acquired epigenetics in the HSC/tumor
to devise an effective treatment strategy for a particular patient
RussiaAshkenazi Jewish
AMLNl karyotypeDDX41 L373P VAF49%DDX41 R525H VAF10%
Rx: 7+3 morphologic remission
Northern EuropeDES exposure
DES daughterHLA-identical sibling—now what?
Case #1: Importance of germline predisposition syndromes to donor selection
RussiaAshkenazi Jewish
AMLDDX41 L373P VAF49%DDX41 R525H VAF10%
Northern EuropeDES exposure
DES daughterHLA-identical sibling—now what?
Case #1: Importance of germline predisposition syndromes to donor selection
Questions raised by this case:1) How do we use molecular profiling results to find these families?2) How do we test for germline status of a suspected inherited mutation?3) If the brother has the mutation and he receives G-CSF, is his leukemia risk increased?4) If the brother does not have the mutation, but the DDX41 L373P variant is found to be
germline, how do we determine if it is deleterious or not?5) If the patient is found to have a germline DDX41 mutation and opts for an allogeneic stem cell
transplant using an unrelated donor, what can we tell them about that donor’s genetic predisposition to cancer?
6) What is the role of environmental exposure to cancer risk for people at elevated genetic risk?
Class Patient Population Specific Syndromes
MDS/AL Predisposition SyndromesMDSAMLALL
ANKRD26 RUNX1CEBPA SAMD9/SAMD9LDDX41 ALL only: IKZF1ETV6 PAX5GATA2 SH2B3MBD4MECOM/EVI1RTEL1
Bone Marrow Failure SyndromesAA
MDSAML
Dyskeratosis congenita SAMD9/SAMD9LFanconi anemia SBDS/EFL1/DNAJC21ERCC6L2 NAF1
Genetic Syndromes ALL Ataxia Telangiectasia (ATM)Bloom syndrome (BLM)Down syndrome (Trisomy 21)Leopard/Noonan syndrome (PTPN11)Neurofibromatosis I (NF1)Nijmegen Breakage syndrome (NBS1)Wiskott Aldrich syndrome (WAS)
Familial MPNs PV, ET, PMF, CML 14q32.2 genomic duplication (ATG2B/GSKIP)RBBP6
Familial Lymphomas CLLHL/NHL
ASXL1 ITKCASP10 MAGT1CD27/CD40LG MKL1CTLA4 MLL DOCK8 PIK3CD
Cancer Predisposition Syndromes All
Li-Fraumeni syndrome (TP53)Hereditary breast & ovarian cancer (BRCA1/2)Lynch syndrome Cowden syndrome (PTEN)
Familial MM/LPL MM, MGUS, LPL KDM1A/LSD1
Inherited predisposition is increasingly recognized
NCCN MDS guidelines urge testing for germline
predisposition
European LeukemiaNet guidelines also include testing for predisposition mutations
WHO classification includes germline predisposition to
myeloid malignancies
Blood 129: 424-447, 2017
JNCCN 15: 60-87, 2017
Genetic predisposition with environmental insult
germline predisposition
environmental insult
Genetic predisposition with environmental insult
germline predisposition
environmental insult
germline CEBPA mutations- highly penetrant
Genetic predisposition with environmental insult
germline predisposition
environmental insult
post-atomic bomb radiation
Genetic predisposition with environmental insult
germline predisposition
environmental insult
therapy-related myeloid neoplasm
An algorithm for patient work-up
Patient acquired through strong personal/family
history
Patient acquired through routine clinical testing of
presenting leukemia
Family identified through evaluation of matched related
allogeneic stem donor
Perform detailed personal bleeding/family history
bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2/TP53 mutation
Perform skin biopsygrow skin fibroblasts
isolate gDNA
Run NGS panel and array analysis specific for
inherited predisposition to hematopoietic malignancies
if strong
if negative
Research-based whole exome/genome sequencing
Family-based genetic counseling and clinical site-specific testing
if positive
ANKRD26ATM
B Marrow FailureBRCA1/2
CEBPADDX41
ETV6Fanconi anemia
GATA2SAMD9
SAMD9LSRP72RUNX1
Telomere BiolTP53
A hematologic malignancy-focused cancer risk clinic
• Genetic counseling for family members
• Early identification allows proper anticipatory medical care for mutation carriers, but the few surveillance guidelines that exist are based on expert experience rather than prospective data
• Careful hematopoietic stem cell transplant donor evaluation, including interdisciplinary discussions regarding donor selection for patients under consideration for a matched related allogeneic stem cell transplant
• Incorporation of genetic predisposition within the new WHO classification scheme and clinical guidelines, including NCCN MDS and European LeukemiaNet
Key aspects of pedigree review
• A high index of clinical suspicion
• Familiarity with the known predisposition syndromes
• Key features within the personal and family history:– Multiple cancers within a single individual (e.g., t-MN)– Other hematopoietic malignancies within 2 generations– Other hematopoietic abnormalities within the family (e.g., macrocytosis, bleeding
propensity, severe anemia or anemia in men)– NOTE: NOT according to age of onset
• Consider results of molecular analyses performed on leukemic cells
An algorithm for patient work-up
Patient acquired through strong personal/family
history
Patient acquired through routine clinical testing of
presenting leukemia
Family identified through evaluation of matched related
allogeneic stem donor
Perform detailed personal bleeding/family history
bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2 mutation
Perform skin biopsygrow skin fibroblasts
isolate gDNA
Run NGS panel and array analysis specific for
inherited predisposition to hematopoietic malignancies
if strong
if negative
Research-based whole exome/genome sequencing
Family-based genetic counseling and clinical site-specific testing
if positive
197 pts65 children, 132 adults 110 females, 87 males
Age range: 1 - 84
Overall moleculardiagnostic rate: 19%
(37/197) 15% in children21% in adults
Guidugli L. et al. Leukemia 31: 1226-1229 (2017)
ClinGen Committee on Inherited Thrombocytopenia
ClinGen Committee on Inherited Myeloid Malignancies
variantcollation andclassification
How to interpret variants you see in molecular testing
An algorithm for patient work-up
Patient acquired through strong personal/family
history
Patient acquired through routine clinical testing of
presenting leukemia
Family identified through evaluation of matched related
allogeneic stem donor
Perform detailed personal bleeding/family history
bi-allelic CEBPA mutationsRUNX1/ETV6/GATA2/TP53 mutation
Perform skin biopsygrow skin fibroblasts
isolate gDNA
Run NGS panel and array analysis specific for
inherited predisposition to hematopoietic malignancies
if strong
if negative
Research-based whole exome/genome sequencing
Family-based genetic counseling and clinical site-specific testing
if positive
Detecting germline mutations through tumor mutational profiling
3 2
1
LF = TP53 mutation associated with Li-Fraumeni Syndrome
Drazer, M.W. et al. Blood Adv 2: 146-150 (2018)
Specific considerations regarding particular cancer predisposition syndromes
Known Familial MDS/AL SyndromesMyeloid malignancies only1.Familial AML with mutated CEBPA (CEBPA)2.Familial MDS/AML due to DDX41 mutation (DDX41)3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)
-- germline RBBP6 mutation
Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)
Additional Organ Systems Affected1.GATA2 deficiency syndromes (GATA2)2.Autosomal dominant telomere syndromes (TERT and TERC)3.Familial aplastic anemia/MDS due to SRP72 mutation (SRP72)4.Ataxia-Pancytopenia Syndrome (SAMD9L mutation) and
MIRAGE syndrome (SAMD9 mutation)5.Shwachman-Diamond Syndrome (new causative genes: EFL1 and
DNAJC21)
Key Management Issues
Myeloid malignancies only
1.Familial AML with mutated CEBPA (CEBPA)- Near complete penetrance- 10% AMLs with bi-allelic CEBPA mutations have germline mutation- Most often, the inherited allele has a mutation in the 5’ end of the
gene, with acquisition of a mutation in the second allele at the 3’end of the gene
2.Familial MDS/AML due to DDX41 mutation (DDX41)- Average age of diagnosis: 62yo- Three pedigrees now with pediatric cases of leukemia- Some mutations may also predispose to lymphoid malignancies;
colon ca/gastric ca
3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)-- germline RBBP6 mutation
Familial leukemia with CEBPA mutation
Tawana K et al. Blood 126: 1214-1223, 2015
Clonal Evolution in AMLs:– “Relapses” appear to be
independent leukemias, since acquired CEBPA mutation is distinct.
– Acquired mutations in GATA2and WT1 are common and mutually exclusive.
– AMLs are chemosensitive.
Key Management Issues
Myeloid malignancies only
1.Familial AML with mutated CEBPA (CEBPA)- Near complete penetrance- 10% AMLs with bi-allelic CEBPA mutations have germline mutation- Most often, the inherited allele has a mutation in the 5’ end of the
gene, with acquisition of a mutation in the second allele at the 3’end of the gene
2.Familial MDS/AML due to DDX41 mutation (DDX41)- Average age of diagnosis: 62yo- Three pedigrees now with pediatric cases of leukemia- Some mutations may also predispose to lymphoid malignancies;
colon ca/gastric ca
3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)-- germline RBBP6 mutation
DDX41 on 5q35.3 encodes a DEAD/H-Box helicase
Polprasert C, Schulze I et al. Cancer Cell 27: 1-13, 2015Lewinsohn, M et al. Blood 127: 1017-1023, 2016
Li R et al. Haematologica 101: e228-231, 2016
Frameshift mutationMissense mutationSplicing mutation
Blue, CaucasianRed, Asian
ZnF
Case #2: Detecting a germline syndrome from tumor mutational profiling
71yoT3N0M0 grade 3 gastric cancerRx: neoadjuvant chemo: cisplatin/5-FUtotal gastrectomyFOLFOX, completed 3/6 planned cycles due to cytopenias
73yot-MNPanel testing: DDX41 D140fs skin biopsy confirmed germline
paternal grandmothernon-smokerno alcohol intakehead and neck cancer in 60’s
Northern Europe
Case #3: Detecting a germline syndrome from tumor mutational profiling
2
Middle East- JordanfatherAML at 60yo
50yochronic phase CMLcomplete molecular response on Gleevec
53yo‘myeloid blast’ phase CMLno detectable BCR-ABLPanel testing: DDX41 P78fsR525HSkin biopsy confirmed P78fs is a germline mutation.
Known Familial MDS/AL SyndromesMyeloid malignancies only1.Familial AML with mutated CEBPA (CEBPA)2.Familial MDS/AML due to DDX41 mutation (DDX41)3.Familial MPNs--14q32.2 genomic duplication (ATG2B/GSKIP)
-- germline RBBP6 mutation
Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)
Additional Organ Systems Affected1.GATA2 deficiency syndromes (GATA2)2.Autosomal dominant telomere syndromes (TERT and TERC)3.Familial aplastic anemia/MDS due to SRP72 mutation (SRP72)4.Ataxia-Pancytopenia Syndrome (SAMD9L mutation) and
MIRAGE syndrome (SAMD9 mutation)5.Shwachman-Diamond Syndrome (new causative genes: EFL1 and
DNAJC21)
Key Management Issues
Decreased Platelet Number/Function1.Familial platelet disorder with propensity to myeloid malignancies (RUNX1)2.Thrombocytopenia 2 (ANKRD26)3.Thrombocytopenia 5 (ETV6)
- Both germline RUNX1 and ETV6 mutations predispose to both myeloid and lymphoid malignancies; to date, germline ANKRD26 mutations have only been associated with development of myeloid malignancies
- Patients can bleed out of proportion to their platelet counts, since the platelets have abnormal aggregation. Therefore for surgery/childbirth, we recommend transfusion of normal platelets
Churpek, J.E. et al.* Leuk Lymph 51: 1931-1935, 2010
Familial platelet disorder with propensity tomyeloid malignancies (germline RUNX1 mutation)
*Jacqueline S. Garcia
ANKRD26 promoter mutations disrupt RUNX1 and FLI1 repression,
leading to activation of MAPK and disrupted platelet development
ANKRD26
Exon 1Total of 34 exons
Repress transcriptionGAGGGAGAGATTGGAAACCGCGGAGTTTCCTTGGG
RUNX1 FLI1
Bluteau, D. et al. J Clin Invest 124: 580-591, 2014
ANKRD26 promoter mutations disrupt RUNX1 and FLI1 repression,
leading to activation of MAPK and disrupted platelet development
ANKRD26
Exon 1Total of 34 exons
GAGGGAGAGATTGGAAACCGCGGAGTTTCCTTGGG
CTG
TAACGT
GGA
CA
∆AT
RUNX1 FLI1
Bluteau, D. et al. J Clin Invest 124: 580-591, 2014
Clonal hematopoiesis
Churpek, JE et al. Blood 126: 2484-2490, 2015
in those with a germline predisposition syndrome
- Lynch: MSH2/6, MLH1, PMS2 - Li-Fraumeni: TP53- Hereditary Breast/Ovarian CA: BRCA1/2 are Fanconi anemia-like genes
Cancer is a genetic disease–‘Solid tumor’ gene syndromes do not exist
Churpek, JE et al. Cancer 122: 304-311, 2016
In a person with a germline mutation, all cells of the body have that mutation… so in the bone marrow,
which cell matters?
Mesenchymal stromal cells with germline mutations do not differentiate normally
Japanese
MDS
MDS MDS
cervical capancytopeniaMDS leukopeniabreast caprostate ca
AMLcancer
colon ca
cancer
breast capancreatic ca
Germline DDX41 mutations: Poor HSC function afterallogeneic stem cell transplantation with wild-type HSCs
Family with germline DDX41 R339L mutation
+ +
++ -
Smith, J.N.P. et al. PLos Pathog (2018).
Matched unrelated donor transplant
ANC 200plts <10K/uL
Romiplostim q 3wANC 1500plts >150K/uL
Realizing the goal of precision medicine in oncology
DEFINE:Baseline genetics
Baseline epigeneticsAcquired genetics in the HSC/tumor
Acquired epigenetics in the HSC/tumorto devise an effective treatment strategy for a particular patient
• Family history is an important tool in hematology.• Consider familial syndromes for all patients with hematopoietic
malignancies How can we test patients systematically? Special consideration at the time of allogeneic stem cell transplantation!
• Both point mutations and genomic rearrangements can lead to germline predisposition, so testing should be comprehensive for both.
• ClinGen Committee now formed to help with uniform variant calling• It is critical to test true germline DNA (e.g., cultured skin fibroblasts).
• Additional syndromes and pathways in leukemogenesis will be identified!