Modeling Glucocorticoid-Mediated Fetal Lung Maturation:II. Temporal Patterns of Gene Expression in Fetal Rat Lung

Mahesh N. Samtani, Nancy A. Pyszczynski, Debra C. DuBois, Richard R. Almon, andWilliam J. JuskoDepartments of Pharmaceutical Sciences, School of Pharmacy and Pharmaceutical Sciences (M.N.S., N.A.P., D.C.D., R.R.A.,W.J.J.), and Biological Sciences (D.C.D., R.R.A.), State University of New York at Buffalo, Buffalo, New York

Received September 20, 2005; accepted December 20, 2005

ABSTRACTOur previous report described the temporal steroid patternsduring pharmacokinetic (PK) studies with dexamethasone(DEX) where doses of six 1 �mol/kg injections were givenduring gestational ages 18 to 20 days in rats. DEX PK was usedin conjunction with the endogenous corticosterone profile tounderstand the regulation of fetal lung pharmacodynamics(PD). Expression of the glucocorticoid receptor (GR) and sur-factant proteins A and B mRNA were chosen as lung matura-tional markers. GR seemed to be insensitive to the circulatingglucocorticoids, indicating that unlike the adult situation, GRwas not under negative feedback control of its ligand. Surfac-tant protein B exhibited �400-fold induction in control fetallung during the last days of gestation, and the inductive effectwas even greater in the treatment group. Surfactant protein Adisplayed �100-fold induction in control fetal lung during late

gestation. However, the treatment group exhibited biphasicstimulatory and inhibitory effects for surfactant protein A. Theinhibitory effect indicated that the chosen dosing scheme forDEX was not an optimal regimen. These data were used todetermine by simulation the DEX regimen that would reproducethe temporal pattern of lung maturation observed in controlanimals. PK/PD modeling indicated that maintaining steroidexposure at approximately twice the equilibrium dissociationconstant for the steroid/receptor interaction should produceoptimal stimulation of both surfactant proteins. The simulationsillustrate that administering smaller quantities of steroids overextended periods that produce sustained steroid exposuremight be the optimal approach for designing dose-sparingantenatal corticosteroid therapy.

Glucocorticoids (GR) accelerate fetal lung maturation inalmost every animal species studied (Ballard, 1986). Glu-cocorticoids are clearly involved in normal fetal lung matu-ration because knockout animals for either GR or the glu-cocorticoid precursor corticotrophin releasing hormone die atbirth because of lack of lung development (Cole et al., 1995;Muglia et al., 1995). The importance of the steroid/receptorinteraction is exemplified by the fact that the corticotrophinreleasing hormone knockouts are rescued by glucocorticoidtreatment, whereas the GR knockouts are not.

Glucocorticoids induce lung maturation by stimulating theproduction of pulmonary surfactant (Kotas and Avery, 1971).Lung surfactant, composed of glycerophospholipids and pro-teins, helps to reduce the surface tension at the alveolarair-liquid interface. Enzymes involved in glycerophospho-

lipid synthesis as well as surfactant proteins are under thetranscriptional control of glucocorticoid-bound receptor mol-ecules. Evidence supporting GR-gene-mediated process reg-ulating fetal lung maturation has been reviewed by Ballardand Ballard (1995).

In spite of the rich literature concerning glucocorticoid-induced fetal lung maturation, most studies have been per-formed using isolated cells and explant cultures of fetal lung.Only sparse information is available on glucocorticoid-in-duced surfactant production after in vivo treatment. The fewstudies (Phelps and Floros, 1991; Schellhase and Shannon,1991) that have examined in vivo effects involve administra-tion of one or multiple DEX doses and a single time-pointanalysis at 24 h after the last DEX dose. Such a study designhas somewhat limited value given the fact that corticoste-roids produce markedly diverse multiphasic temporal pat-terns of gene expression (Jin et al., 2003). The objective ofthis work was to develop models that quantitatively describethe in vivo mechanism behind glucocorticoid-mediated fetallung maturation. Understanding the system in a quantita-

This study was supported by Grant GM 24211 from the National Institutesof Health and a predoctoral fellowship (to M.N.S.) from Merck (West Point, PA).

Article, publication date, and citation information can be found athttp://jpet.aspetjournals.org.

doi:10.1124/jpet.105.095869.

ABBREVIATIONS: GR, glucocorticoid receptor; RT-PCR, reverse transcription-polymerase chain reaction; DEX, dexamethasone; PK/PD, phar-macokinetic/pharmacodynamic; SR, steroid receptor complex.

0022-3565/06/3171-127–138$20.00THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 317, No. 1Copyright © 2006 by The American Society for Pharmacology and Experimental Therapeutics 95869/3092302JPET 317:127–138, 2006 Printed in U.S.A.

127

by guest on May 16, 2014

jpet.aspetjournals.orgD

ownloaded from

tive manner provides the unique benefit of using mathe-matical modeling to design optimal dosing regimens for an-tenatal corticosteroids. These models describe fetal lungmaturation being initiated by the free plasma concentrationof exogenous and endogenous steroids in fetal plasma (fordetailed plasma glucocorticoid temporal patterns, seeSamtani et al., 2006).

The markers selected for fetal lung maturation and therationale for their choice are as follows. 1) Appreciable dataindicate that the major factor governing steroid responsive-ness is the cytosolic GR (DuBois et al., 1995); hence, expres-sion of this cellular marker was followed. 2) Surfactant pro-teins are of two main types (hydrophobic and hydrophilic),and we chose the hydrophobic protein B as our secondmarker. Surfactant protein B represents the most criticalcomponent of lung surfactant since it imparts spreading ca-pability to glycerophospholipids that produce a surface activefilm on the alveolar surface. Furthermore, normal surfactantbiosynthesis, storage, and secretion depend on surfactantprotein B (Weaver and Conkright, 2001). 3) The hydrophilicprotein of choice was surfactant protein A since it is the mostabundant of all the surfactant proteins. This marker has thedistinct quality that its ontogeny reflects the development ofglycerophospholipids that primarily make up lung surfactant(Alcorn et al., 2004). It also plays the crucial role of acting asthe first line of defense against inhaled microbes and patho-gens and therefore serves as indicator of lung immune func-tion (McCormack and Whitsett, 2002). Surfactant protein Aalso has the advantage that it is exquisitely sensitive tocorticosteroid exposure such that excessive exposure desta-bilizes its mRNA (Boggaram et al., 1989). In designing opti-mal regimens, this marker therefore helps in deciding theupper safety threshold for steroid exposure.

We chose to follow the message levels of all of thesemarkers. The advantage of studying message levels is thatadvancement of technologies such as TaqMan-based quan-titative reverse transcription-polymerase chain reaction (RT-PCR) allows measurement of extremely low copy numbers formarkers of interest. This becomes important when evaluat-ing fetal maturation where expression levels can be ex-tremely low because of the immature state of the developingorgan. Furthermore, the biggest advantage of the chosenmarkers is that the protein levels of these markers as afunction of gestation in control fetal rat lung are available inthe literature (Ballard et al., 1984; Schellhase et al., 1989;Shimizu et al., 1991). By establishing a mathematical rela-tionship between the measured message and protein datafrom the literature in the control group, the behavior of themarker proteins in the DEX-treated animals can be pre-dicted. PK/PD modeling is used in designing an optimalsteroid regimen based on the in-depth biomarker profiles forglucocorticoid-induced fetal lung maturation reported here.

Materials and MethodsmRNA Measurement

RNA Preparation. Fetal lung was obtained from 54 control andDEX-treated pregnant rats described in Samtani et al. (2006). Fetallungs from fetuses belonging to each litter were pooled. Fetal lungwas ground into powder using liquid nitrogen-chilled pestles andmortars. Extraction of total RNA was carried out using TRIzol (In-vitrogen, Carlsbad, CA) according to the manufacturer’s instruc-

tions. An external standard pseudomessage (GRG-1 cRNA) wasadded to each sample before homogenization of tissue in TRIzol toallow correction for variable extraction yield (DuBois et al., 1993).GRG-1 was chosen as the external standard because it was originallycloned from Neurospora and did not share homology with any mam-malian gene (McNally and Free, 1988). The extracted total RNA wasresuspended in nuclease-free water (Ambion, Austin, TX) and storedat �80°C. To assess the purity and integrity of total RNA, the ratioof 260/280-nm absorbance was computed, and electrophoresis onformaldehyde agarose gels was performed. Finally, total RNA con-centrations were determined using absorbance readings at 260 nm.

Preparation of cRNA Standards. The construction of GR andGRG-1 cRNAs has been described previously (DuBois et al., 1993,1995). Rat surfactant protein A and B cDNA clones were a generousgift from Dr. J. H. Fisher (University of Colorado Health SciencesCenter, Denver, CO) and have been described previously (Sano et al.,1987; Emrie et al., 1989). Surfactant protein A cDNA was subclonedinto the EcoR1 site of the pGEM-3Z (Promega, Madison, WI) vector,linearized with HindIII restriction enzyme, and transcribed in vitrowith T7 polymerase (MEGAScript T7 polymerase kit; Ambion) tosynthesize cRNA standards. The concentration of the cRNA stockwas determined by absorbance at 260 nm. Purity and integrity of theRNA were confirmed by 260/280-nm absorbance, and electrophoresisin 5% acrylamide/8 M urea gels. Working dilutions were preparedfrom the cRNA stock. Surfactant protein B cDNA provided by Dr.J. H. Fisher was extremely dilute and was therefore first amplifiedusing PCR. The PCR product was cloned using TOPO TA cloning(Invitrogen) according to manufacturer’s instructions. Thereafter,the procedure for cRNA standard generation was identical to that forsurfactant protein A.

Absolute Quantification of mRNA Using Real-Time Quan-titative RT-PCR. Assays for all messages of interest (GR, surfac-tant protein A and B, and GRG-1) in extracted lung samples weredeveloped. These assays used the in vitro-synthesized cRNA as stan-dards. The kinetic-based RT-PCR methodology made use of theStratagene MX4000 fluorescence-based thermal cycler and TaqManprobe technology (Stratagene, La Jolla, CA). TaqMan probes andprimers were designed using PrimerExpress software (Applied Bio-systems, Foster City, CA) under the condition that sequences shar-ing homology with other genes were excluded. Primers/probes werecustom synthesized by Biosearch Technologies, Inc. (Novato, CA).The probes were synthesized with the fluorescent reporter (5-car-boxyfluorescein or hexachlorofluorescein) attached to the 5� end andthe quencher Black Hole Quencher attached to the 3� end. Forwardand reverse primer design allowed positioning of the two oligonucle-otides as close to one another without overlapping the probe. Theamplicons that were generated were between 76 and 107 base pairs.The assays used a one tube/two enzyme Brilliant 1-Step quantitativeRT-PCR core reagent kit (Stratagene) that was used according tomanufacturer’s instructions. The concentrations of the primers/probes and magnesium chloride were optimized, and the reactionconditions along with the oligonucleotide sequences are reported inTable 1. The cRNA standards were run in duplicate concurrently onthe same plate with unknown samples, which were run in triplicate.The reverse transcriptase minus controls to test for possible genomicDNA contamination in extracted RNA were run for each sample, andin all cases they gave no measurable amplification signal. The con-struction of the standard curves allowed estimation of moles ofmRNA rather than relative message expression. Fractional yieldswere calculated based on the recovered GRG-1 cRNA relative to thequantity added before tissue homogenization. This allowed molarquantification of mRNA per gram of fetal lung tissue. As a time-saving measure, the RT-PCR multiplex assay for GR and GRG-1message was run in a single tube without reduction in sensitivity.The intra- and inter-assay coefficients of variation for all transcriptsof interest were under 18%.

128 Samtani et al.

Additional Data Sources

Total GR concentrations in fetal rat lung were obtained fromBallard et al. (1984). GR data were reported as femtomoles permilligram of DNA, which were converted to femtomoles per milli-gram of protein using the protein/DNA ratio of 7.2 reported by thesame authors. Ontogeny of surfactant protein A in male and femalefetal rat lung has been published by Schellhase et al. (1989). Finally,Shimizu et al. (1991) have reported developmental patterns of sur-factant protein A and B during normal ontogenic stages of rat lungs.The three data sets for surfactant protein A are in excellent agree-ment; therefore, all the information was used during the modelingexercise. Data were captured by computer digitalization (SigmaScan; Jandel Scientific, Corte Madera, CA).

PK/PD Model

Pharmacokinetics. The equations and parameters describingunbound DEX and corticosterone plasma concentrations in controland DEX-treated fetuses were from Samtani et al. (2006).

Mechanistic Basis for Pharmacodynamics. Free glucocorti-coids in fetal plasma can rapidly equilibrate with intracellular ste-roid concentrations because their lipophilicity allows ready passageacross cellular membranes. Steroids interact with the cytosolic GRbased on their relative receptor affinity. Binding of the steroid to itsreceptor produces an activated complex, which can transcriptionallyinduce expression of surfactant components and related enzymes(Ballard and Ballard, 1995). For surfactant proteins A and B, induc-tion of mRNA synthesis occurs via a mechanism that is consistentwith a receptor-mediated process (Liley et al., 1988, 1989). In addi-tion, higher concentrations of corticosteroids in vitro reduce surfac-tant protein A mRNA stability leading to increased degradation(Boggaram et al., 1989). This paradoxical effect also occurs via areceptor-mediated process (Boggaram et al., 1991), producing aninhibitory effect on surfactant protein A during steroid overexposurein cell culture systems. Finally, the altered message expressiontranslates into corresponding changes in protein concentration,which prepares the fetal lung for life outside the womb. Thus, thesteroid-induced lung maturation primarily occurs via transcriptionalregulation at the message level (Liley et al., 1988; Ballard et al.,1996). Most interestingly, GR in the fetus (unlike the adult situation)is not under feedback transcriptional regulation by its own ligand(Kalinyak et al., 1989; Ghosh et al., 2000). Thus, heightened expo-sure to glucocorticoids is not associated with down-regulation of itsown receptors, which serves as a mechanism of amplifying glucocor-ticoid effects during fetal development.

GR Dynamics. The cellular mechanisms of glucocorticoid effectsin the fetal lung are portrayed in Figs. 1 and 2 for mRNA andsurfactant proteins A and B. GR binding component is identical forboth markers, since the steroid-bound receptor complex drives thePD effects. It will be shown later that the message levels for GR wereidentical in control and treatment groups, which agrees well with the

general notion that GR is not under transcriptional feedback regu-lation. Furthermore, GR exhibited a peculiar temporal patternwhere the message in the fetal lung behaved like a short infusion.This influx of GR message was followed by occurrence of GR after amodest translational delay. The delay in the occurrence of the recep-tor can be recognized visually by comparing the receptor messagedata from the current study versus the GR profile reported by Bal-lard et al. (1984). Thus, GR information in treatment and controlgroups were described by the following equations.

dmRNAR

dt� ks,Rm�0 � T� � kd,Rm � mRNAR, mRNAR(0) � mRNAR0 (1)

dRtotal

dt�

1�r

� �mRNAR�r�Rtotal), Rtotal(0) � 0 (2)

Symbols include receptor message (mRNAR) and total protein (Rtotal)as a function of time (t), ks,Rm represents the zero-order input ofreceptor message defined as ks,Rm � ks,Rm when 0 � t � T; else ks,Rm

� 0, kd,Rm is the first-order rate constant for receptor mRNA degra-dation, and mRNAR0 is the average receptor message observed ongestational day 17 defined as time 0. The production and loss of totalreceptor was described as being dependent upon a first-order rateconstant that is equivalent to the reciprocal of the transit time �r and�r is the amplification factor indicating that, on average, a singlemRNA transcript can be used to translate multiple copies of GR.Finally, the baseline value of receptor (R0total) was incorporated bysetting the measured total receptor equal to R0total � Rtotal (Magerand Jusko, 2001).

The equilibration of steroids across cellular barriers and theirbinding to cytosolic GR was assumed to be an instantaneous process.The concentration of steroid-receptor complex (SR) in control (con)and DEX-treated groups is given by the following equations:

SRcon�Rtotal � Cfree,con

Kd,cort � Cfree,con(3)

SRDEX�

Rtotal � Cfree,DEX

Kd,cort

1 �Cfree,DEX

Kd,cort�

Df,free

Kd,DEX

�

Rtotal � Df,free

Kd,DOX

1 �Cfree,DEX

Kd,cort�

Df,free

Kd,DEX

(4)

where Cfree,con, Cfree,DEX, and Df,free are the concentrations of un-bound corticosterone (C) and DEX (D) in fetal plasma from thecompanion report. Equation 4 is the well known Gaddum equation(Gaddum, 1937) that describes two ligands competing for binding totheir receptor. The first component of eq. 4 computes the portion ofthe SR containing corticosterone as the ligand and the second com-ponent expresses the quantity of SR containing DEX. The Kd,DEX andKd,cort represent the equilibrium dissociation constants for the twosteroids. The Kd,DEX for fetal rat lung GR has been published and

TABLE 1Primer/probe sequences and optimized reaction conditions for quantitative RT-PCR

Oligonucleotide Sequence 5�-3� MgCl2 dNTP

nM mM

Surfactant protein A Forward primer 250 CCTTTAGAGCAGGAGGCAACA 3 0.8Reverse primer 250 AATCATGCCCAAGTAGACATAGTTGTFAM-labeled probe 100 CTTCGCAATACTTGCAATGGCCTCGT

Surfactant protein B Forward primer 250 GATGACCAAGGAAGACGCTTTC 3 0.8Reverse primer 250 CAAGCAGCTTCAAGGGTAGGATFAM-labeled probe 200 TCACATTCTTGTTCCAGGAACTTCCGGA

Multiplex Receptor forward primer 300 AACATGTTAGGTGGGCGTCAA 5 1.0Receptor reverse primer 300 GGTGTAAGTTTCTCAAGCCTAGTATCGFAM-labeled receptor probe 100 TGATTGCAGCAGTGAAATGGGCAAAGGRG-1 forward primer 300 CGGTTCTGGTGTAATGCTAAAGCTGRG-1 reverse primer 300 AGTTCGCCAAGGGCTTCTCHEX-labeled GRG-1 probe 100 CCCTTCGAAATTCCAAGCCAAGTATGTCAT

FAM, 6-carboxyfluorescein; HEX, hexachloro-6-carboxyfluorescein.

Temporal Patterns of Gene Expression in Fetal Rat Lung 129

Kd,cort can be calculated from its relative receptor affinity (Ballard,1986). Thus, the values for Kd,DEX and Kd,cort were fixed to 4.7 and22.1 nM, respectively, during the modeling procedure. The equationsfor SR will be used to drive PD under the assumptions that postre-ceptor events are steroid-independent and that differences betweencorticosteroids can be explained by their relative receptor affinityand plasma temporal patterns. We have recently shown that theseassumptions are suitable by applying quantitative structure-prop-erty relationship theory to corticosteroid genomic effects (Mager etal., 2003). Once the parameter estimates were obtained for GR dy-namics, they were fixed in the following analysis.

Biphasic Effect on Surfactant Protein A mRNA. Corticoste-roids can affect surfactant protein A mRNA by dual mechanisms.The following equations were jointly fitted to describe the simulta-neous action of SR on mRNA synthesis and degradation in controland treatment groups.

dmRNAA,con

dt� ks,A � �1 �

SmaxAs � SRcon�As

SC50,As�As � SRcon

�As�� kd,A

� �1 �SmaxAd � SRcon

�Ad

SC50,Ad�Ad � SRcon

�Ad� � mRNAA,con (5)

Fig. 1. Model for receptor-mediated transcrip-tional effects of corticosteroids on surfactantprotein A. Effects are driven by corticosteronein control animals (top) and by DEX and cor-ticosterone in treated animals (bottom). Dot-ted arrows and rectangles indicate stimula-tion of processes via indirect mechanisms.Dashed arrows arising from the mRNAs donot affect their concentrations since proteinsynthesis from its message is not a degrada-tion route. Processes occurring intracellularlyare enclosed within a box.

Fig. 2. Receptor-gene-mediated model for sur-factant protein B driven by corticosteroids.The notation for different processes is thesame as in Fig. 1.

130 Samtani et al.

dmRNAA,DEX

dt� ks,A � �1 �

SmaxAs � SRDEX�As

SC50,As�As � SRDEX

�As��

kd,A � �1 �SmaxAd � SRDEX

�Ad

SC50,Ad�Ad � SRDEX

�Ad� � mRNAA,DEX (6)

Surfactant protein A message (mRNAA) is synthesized in a zero-order process (ks,A) and degraded by a first-order process (kd,A).SmaxAs

and SC50,As represent the maximum possible stimulation ofks,A and the concentration of SR required for half-maximal stimula-tion. SmaxAd

and SC50,Ad are analogous parameters affecting kd,A. TheHill coefficients �s and �d adjust for the degree of sigmoidicity inthe PD profiles. Stationary baseline was assumed at time 0 and thefollowing rate constant was derived from eq. 5,

kd,A �

ks,A � �1 �SmaxAs � SR0

�As

SC50,As�As � SR0

�As�mRNAA

0 � �1 �SmaxAd � SR0

�Ad

SC50,Ad�Ad � SR0

�Ad� (7)

The baseline initial condition values of surfactant protein A message(mRNAA

0 ) for eqs. 5 and 6 were fixed as the mean value from controlanimals on gestational day 17 at which time the steroid receptorcomplex (SR0) contained only corticosterone as the binding ligand.Equation 7 reduces one parameter during estimation. Once the pa-rameter estimates were obtained for the message dynamics, theywere fixed in the following analysis.

Surfactant Protein A Dynamics. The protein was translatedfrom its mRNA, and its production and loss were described as beingdependent upon a first-order rate constant that is equivalent to thereciprocal of the transit time �A. The amplification factor �Ap indi-cates that, on average, a single mRNA transcript can be used totranslate multiple copies of the protein. The equations used to de-scribe protein synthesis and degradation in control and DEX groupswere as follows:

dSP-Acon

dt�

1�A

� �mRNAA,con�Ap � SP-Acon), SP-Acon(0) � 0 (8)

dSP-ADEX

dt�

1�A

� �mRNAA,DEX�Ap � SP-ADEX), SP-ADEX(0) � 0 (9)

On gestational day 17, surfactant protein A was not detectable andhence the initial conditions were set at zero.

Induction of Surfactant Protein B mRNA. The following equa-tions were jointly fitted to describe the inductive effect of SR onmRNA synthesis in control and DEX groups.

dmRNAB,con

dt� ks,B � �1 �

SmaxB � SRcon�B

SC50,B�B � SRcon

�B�� kd,B � mRNAB,con

(10)

dmRNAB,DEX

dt� ks,B � �1 �

SmaxB � SRDEX�B

SC50,B�B � SRDEX

�B�� kd,B � mRNAB,DEX

(11)

Surfactant protein B message (mRNAB) is synthesized through azero-order process (ks,B) and degraded by a first-order process (kd,B).SmaxB

and SC50,B represent the maximum possible stimulation of ks,B

and the concentration of SR required for half-maximal stimulation.The Hill coefficient � adjusts for the degree of sigmoidicity in thePD profiles. Stationary baseline was assumed at time 0, and thefollowing rate constant was derived from eq. 10, which reduces oneparameter during the estimation procedure.

kd,B �

ks,B � �1 �SmaxB � SR0

�B

SC50,B�B � SR0

�B�mRNAB

0 (12)

The baseline initial conditions (mRNAA0 ) for eqs. 10 and 11 were

fixed as the mean value from control animals on gestational day 17.Once the parameter estimates were obtained for the message dy-namics, they were fixed in the following analysis.

Surfactant Protein B Dynamics. The protein was translatedfrom its mRNA, and its production and loss were described as beingdependent upon a first-order rate constant that is equivalent to thereciprocal of the transit time �B. The amplification factor �Bp indi-cates that, on average, a single mRNA transcript can be used totranslate multiple copies of the protein. The equations used to de-scribe protein synthesis and degradation in control and DEX groupswere as follows:

dSP-Bcon

dt�

1�B

� �mRNAB,con�Bp � SP-Bcon), SP-Bcon(0) � 0 (13)

dSP-BDEX

dt�

1�B

� �mRNAB,DEX�Bp � SP-BDEX), SP-BDEX(0) � 0 (14)

On gestational day 17, surfactant protein B was not detected andhence the initial conditions were set at zero.

Data Analysis. Data from multiple animals were pooled and theADAPT II program (D’Argenio and Schumitzky, 1997) with the max-imum likelihood method was applied for all fittings. The followingvariance model was used:

Variance � coefficient2 � Y�t�power (15)

where coefficient and power are variance parameters, and Y(t) rep-resents the model output function. The goodness-of-fit was assessedusing correlation coefficients, examination of residuals, visual in-spection of the fitted curves, estimator criterion value, sum ofsquared residuals, and coefficients of variation of the estimatedparameters.

Simulation Study

The PK/PD equations described in this article and in Samtani etal. (2006) were used to design an infusion regimen for DEX thatwould cause stimulation of surfactant proteins A and B withoutaffecting the stability of surfactant protein A mRNA. The study aimsto find an optimal dosing regimen that is defined as the least possibleDEX dose that would reproduce the endogenous prenatal steroidexposure and up-regulation of fetal lung maturational markers pre-cociously.

ResultsTemporal Patterns of Free Steroids in Plasma. Free

concentrations of steroids that have the ability to gain accessto the intracellular targets are depicted in Fig. 3. The injec-tion of DEX caused suppression of corticosterone secretionvia a negative feedback mechanism. In the treatment group,the endogenous and exogenous steroids initiate the PD pro-cesses, whereas free corticosterone is the active species in thecontrol group. The degree of interindividual variability wasrelatively low; hence, the average fitted free steroid profileswere allowed to drive the lung maturational effects.

GR Dynamics. The temporal pattern of GR mRNA incontrol and treatment groups is shown in Fig. 4. The messagelevels in control fetal lung start to rise in concert with therising free corticosterone in fetal plasma. The increasingmessage concentrations are striking because in adult ani-mals GR exists under negative transcriptional regulation

Temporal Patterns of Gene Expression in Fetal Rat Lung 131

(Sun et al., 1998). Thus, rising steroid concentrations in adultanimals causes suppression of its own receptor (Sun et al.,1998). In contrast, the fetus does not exhibit suppression ofGR message in a high corticosteroid milieu. The injection ofan even more potent steroid DEX does not inhibit the risingGR message, which further confirms the notion of a lack ofautoregulatory feedback in the fetus. However, at 72 h, thereseemed to be a clustering of mRNA values below the controlsfor DEX-treated animals. The mean � S.D. concentrations ofGR mRNA in the control and treatment groups were 7.8 �0.5 and 5.7 � 0.7 fmol/g, respectively. It would be very diffi-cult to explain mechanistically (and to capture mathemati-cally) why the message data would overlay over one anotherin the control and treatment groups except at this one timepoint. It is therefore likely that this difference in GR mRNAat 72 h between DEX-treated and control animals is a reflec-tion of interlitter variability rather than a true difference.

Since the majority of the GR mRNA data did not exhibit adifference between control and treatment animals, both pro-files were captured using identical equations representing abrief influx of GR message. The temporal pattern of themessage was followed by a similar temporal pattern for GR,albeit with a moderate translational delay (Fig. 5). The de-layed GR profile was assumed to be similar between controland treatment groups because the message profiles did notdisplay any difference between the two groups. The delay inthe GR profile was captured using a transit compartmenttransduction approach (Mager and Jusko, 2001). Thus, al-though the total concentration of receptor sites in the fetallungs of treated animals was not measured, these concentra-tions could be easily computed based on GR message data.Parameters describing GR dynamics are presented inTable 2.

Surfactant Protein A. Message levels for this proteinincreased �100-fold during the last days of gestation in con-trol fetal rat lung, which was followed by increased proteinsynthesis (Fig. 6). In the treatment group, the message levelsbegan to rise earlier than the control group. However, theinitial increase was followed by an inhibitory phase (Fig. 6).The concentrations of surfactant protein A in the DEX grouptherefore did not reach the same high plateau as was seen inthe control group. Thus, the chosen regimen of six 1 �mol/kgdoses of DEX cannot be considered as an optimal regimen.The parameters describing surfactant protein A dynamicsare reported in Table 3.

Surfactant Protein B. Message levels of this proteinincreased �400-fold during the final days of gestation incontrol fetal rat lung (Fig. 7). This increase was followed byan increase in protein levels for this critical lung matura-tional marker. Fetal lungs from DEX-treated animals exhib-ited an even higher plateau of message levels (Fig. 7). Themessage not only reached a higher plateau but also began torise earlier compared with the control group. Thus, surfac-tant protein B exhibited the optimal properties desired froman antenatal steroid regimen. This marker exhibited amonophasic stimulatory pattern such that higher steroid ex-posure produced a higher response without any inhibitory

Fig. 3. Model fittings from Samtani et al. (2006) depicting fetal freeplasma corticosteroid concentrations that are capable of gaining intracel-lular access and driving PD. The solid line is fetal free corticosterone incontrol animals. Dashed and dotted lines represent fetal free DEX andcorticosterone in treated animals.

Fig. 4. GR mRNA in fetal lung from control (F) and DEX-treated (E)animals. Solid line represents model fitting.

Fig. 5. Total GR concentrations in fetal rat lung from Ballard et al.(1984). Solid line is the result of the model fitting.

132 Samtani et al.

effects. The control group data indicated that increased mes-sage levels translate into correspondingly high protein levels.Thus, the treatment group would be expected to exhibitheightened protein levels because of higher message expres-sion observed in this group (Fig. 7). The parameters esti-mated for surfactant protein B dynamics are shown inTable 4.

The Driving Force behind PD Effects. To understandthe basis behind the varied effects of corticosteroids on thetwo surfactant proteins, the driving force for these effects

was simulated using eqs. 3 and 4. Figure 8 shows the profilesfor the steroid receptor complex in the two groups and com-pares them to the various SC50 values obtained from curvefitting of the surfactant mRNA data. In the control group, theconcentrations for the complex exceed the two lower SC50

values needed for inducing mRNA synthesis. Maintenance ofthe free plasma corticosterone concentrations by the endog-enous system at approximately twice the Kd,cort value of 22nM (Fig. 3) allowed occupation of two-thirds of the availablereceptors in the fetal lung. The SRcon concentrations never

Fig. 6. Surfactant protein A mRNA and protein concentra-tions in control (top) and DEX-treated (bottom) animals.Dashed lines are the results of the simultaneous fitting ofthe control and treatment mRNA data. Solid lines aremodel predictions for protein concentrations.

TABLE 2Estimated and fixed parameters for receptor dynamics

Parameter (units) Definition Estimate CV%

ks,Rm (fmol/g lung/h) Zero-order input of receptor message 0.13 12Tinf (h) Duration of receptor message input 40.3 12kd,Rm (h�1) First-order rate of receptor mRNA degradation 0.0067 26�R (h) Receptor transit time 71.8 33�r Amplification factor for the translation of receptor message to protein 2.98 3Kd,cort (nM) Equilibrium dissociation constant for corticosterone 22.1 FixedKd,DEX (nM) Equilibrium dissociation constant for dexamethasone 4.70 FixedmRNAR0 (fmol/g lung) Average receptor message observed at time 0 (gestational day 17) 4.13 FixedR0total (fmol/mg protein) Receptor baseline value 326 Fixed

Temporal Patterns of Gene Expression in Fetal Rat Lung 133

approached the higher degradation enhancing SC50 value,thus allowing the endogenous biology to selectively induceboth surfactant proteins without any inhibitory effects. Thuscontrolled and sustained exposure to the endogenous steroidwas the key factor that produced an inductive effect on bothsurfactant proteins. In contrast to the control group, SR waspredominantly occupied by the exogenous steroid in thetreatment group (Fig. 8). The concentrations of SR exceeded

the two lower stimulatory SC50 values after each intramus-cular injection of DEX. However, the degradation enhancingSC50 was also exceeded during the third to sixth DEX doses.This excessive exposure to corticosteroids therefore produceda predominant inhibitory effect on surfactant protein A in thetreatment group.

Simulation Study. The predominant inhibitory effect ob-served in the treatment group for surfactant protein A dem-

Fig. 7. Surfactant protein B mRNA and protein concen-trations in control (top) and DEX-treated (bottom) ani-mals. Dashed lines are the results of the simultaneousfitting of the control and treatment mRNA data. Solidlines are model predictions for the protein concentrations.

TABLE 3Dynamic parameters for effects of corticosteroids on surfactant protein A regulation

Parameter (units) Definition Estimate CV%

Surfactant protein A mRNA dynamics�s Hill coefficient for stimulation of ks,A 8.96 23ks,A (fmol/g lung/h) Zero-order rate constant for mRNA synthesis 0.32 35SmaxAs

Maximum possible stimulation of ks,A 99.3 43SC50,As (fmol/mg protein) Concentration required for half-maximal stimulation of ks,A 296 9SmaxAd

Maximum possible stimulation of kd,A 5.65 54�d Hill coefficient for stimulation of kd,A 35.2 176SC50,Ad (fmol/mg protein) Concentration required for half-maximal stimulation of kd,A 400 5kd,A (h�1) First-order rate constant for mRNA degradation 0.035 34a

mRNAA0 (fmol/g lung) Baseline value for surfactant protein A mRNA 9.10 Fixed

Surfactant protein A dynamics�A (h) Surfactant protein A transit time 21.1 26�Ap Amplification factor for the translation of message to protein 0.97 2SP-A (0) Baseline value for surfactant protein A 0 Fixed

a Secondary parameter.

134 Samtani et al.

onstrated that six 1 �mol/kg doses were not optimal forinducing fetal lung maturation. The gathered informationwas therefore applied to a simulation study to ascertain anoptimal dosing regimen. It was soon recognized that giventhe narrow window available for SR (Fig. 8) and the rela-tively short DEX half-life of 3 h, intramuscular injection maynot serve as the most optimal dosing route. Steroid adminis-tration would be required too frequently (every 4–6 h) for 3days to achieve the targeted window displayed in Fig. 8.From a study design point of view, such a dosing regimenwould be highly impractical. We therefore performed a seriesof simulations that involved zero-order infusion regimens,which can be readily implemented in future studies usingosmotic pumps or slow release pellets. The PK parametersobtained from the intramuscular regimen are directly appli-cable to an infusion regimen because intramuscular inputproduces complete bioavailability for DEX (Samtani andJusko, 2005). The infusion regimen that met the require-ments of an optimal DEX regimen was 31 nmol/kg/h (12�g/kg/h) on gestational days 18 to 21. The temporal patternsof the steroids in the fetal circulation arising from this steroidregimen are presented in Fig. 9. Interestingly, the DEXsteady-state concentration achieved during this simulation(9 nM) is roughly twice the Kd,DEX value of 4.7 nM. Thus, the

system responds optimally when two-thirds of the GR sitesare occupied regardless of the steroid in circulation. Thisreflects the assumption that postreceptor events are indepen-dent of the steroid. Although the concentration of free DEXreached only 9 nM, the simulations indicate that this concen-tration is still sufficient to cause inhibition of corticosteronesecretion. This is not unanticipated because the concentra-tion of DEX required for 50% inhibition of corticosteronesecretion is less than 1 nM, indicating that any steroid reg-imen that targets the Kd,DEX value of 4.7 nM will invariablycause adrenosuppression. Thus, the hypothalamus-pituitary-adrenal axis is exquisitely sensitive to exogenous steroidexposure, leading to negative feedback inhibition even dur-ing moderate glucocorticoid exposure. The simulated tempo-ral pattern for the driving force SR is also portrayed in Fig. 9.The SR would primarily contain DEX as the bound ligandbecause of its higher receptor affinity and low circulatingcorticosterone. The temporal pattern for SR was designedwith the goal of preventing its concentrations from reachingthe degradative SC50 of 400 nM. This requirement was alsomet by the 31 nmol/kg/h dosing regimen.

The simulated PD profiles for the infusion regimen arepresented in Fig. 10. For comparison, the ontogeny of the twosurfactant proteins in control animals is also provided. The

Fig. 8. Profiles for the steroid receptor complex in control and DEX-treated animals. Lines are defined in the graph. The lower horizontallines represent the SC50 for stimulating mRNA production of the twosurfactant proteins. The upper horizontal line represents the SC50 forstimulating the mRNA degradation for surfactant protein A.

Fig. 9. Simulated curves for fetal free corticosterone (dashed line) andDEX (dotted line) during a 31 nmol/kg/h maternal DEX infusion ongestational days 18 to 21. The solid line represents the simulated profilefor the steroid receptor complex in fetal rat lung which will serve as thedriving force for PD effects.

TABLE 4Dynamic parameters for effects of corticosteroids on surfactant protein B regulation

Parameter (units) Definition Estimate CV%

Surfactant protein B mRNA dynamics� Hill coefficient for stimulation of ks,B 13.9 11ks,B (fmol/g lung/h) Zero-order rate constant for mRNA synthesis 0.30 34SmaxB

Maximum possible stimulation of ks,B 448 18SC50,B (fmol/mg protein) Concentration required for half-maximal stimulation of ks,B 305 3kd,B (h�1) First-order rate constant for mRNA degradation 0.0287 34a

mRNAA0 (fmol/g lung) Baseline value for surfactant protein B mRNA 10.3 Fixed

Surfactant protein B dynamics�B (h) Surfactant protein B transit time 16.5 94�Bp Amplification factor for the translation of message to protein 1.53 3SP-B (0) Baseline value for surfactant protein B 0 Fixed

a Secondary parameter.

Temporal Patterns of Gene Expression in Fetal Rat Lung 135

simulated regimen not only produced higher protein concen-trations but also hastened the appearance of the two mark-ers. The proposed infusion protocol may therefore reflect adose-sparing regimen that produces precocious lung matura-tion.

In designing regimens, it is also important to consider thecumulative dose of the drug being administered. Two dosingregimens have been described in this report. The adminis-tered six doses of 1 �mol/kg DEX doses translate into 2250nmol, whereas the simulated 3-day 31 nmol/kg/h infusion isequivalent to 826 nmol of DEX. This estimate assumes a bodyweight of 375 g for pregnant rats, which was the averageweight of our 54 animals. The lower cumulative DEX associ-ated with the infusion regimen may therefore allow benefi-cial effects on lung maturation and permit dose reduction.Thus, administering a smaller quantity of the steroid withsustained controlled exposure might be the optimal strategyfor dosing corticosteroids antenatally.

DiscussionIn vivo effects of glucocorticoids on surfactant proteins in

fetal lung have only been looked at in a limited manner. Thetwo main studies (Phelps and Floros, 1991; Schellhase andShannon, 1991) report single time-point data for various lungmaturational markers after single or multiple doses of DEX.Most markers were measured using either qualitative tech-niques or relative values in treated animals compared withcontrols. The noteworthy feature of this report is that allmarkers quantified or adapted from the literature representabsolute quantification. The term absolute is not meant todescribe current state of knowledge in this area. The termabsolute is a description of the methodological proceduresadopted as part of this research. Such measurements areamenable to PK/PD modeling and offer the advantage thatthe knowledge gained can be extended to new situationsusing simulations.

Literature data suggest that glucocorticoid effects on sur-factant protein B are stimulatory and induction occurs at alldoses and durations of steroid exposure. Such observationsagree with our results. Literature results for in vivo surfac-

tant protein A induction seem to be relatively low, variable,and dependent on the gestational age and duration of expo-sure. These results have been attributed to the possible bi-phasic effects of glucocorticoids observed in vitro where lowconcentrations (10�9 nM) produce stimulation, whereashigher concentrations (10�7 nM) cause inhibitory effects. Ourdata confirm that the biphasic effect is also true in vivo andselective induction of surfactant protein A can be achievedunder controlled and sustained exposure to glucocorticoids.

Another in vitro phenomenon investigated is the revers-ibility of surfactant protein and enzyme induction upon re-moval of corticosteroids from the medium (Ballard and Bal-lard, 1995; Vidaeff et al., 2004). Our pilot experiments (datanot shown) support this reversible induction theory. Use offewer than six doses of DEX in rats produced transient effectsthat would start returning to baseline after stopping steroidadministration. All of the above-mentioned findings haveimportant physiological consequences when considering thetwo most popular antenatal corticosteroid regimens. Thecommonly used single course of glucocorticoids (National In-stitutes of Health Consensus Panel, 1995) will probably loseits efficacy after a few days because of reversibility of glu-cocorticoid action. The seminal clinical trial by Liggins andHowie (1972) supports this hypothesis because the studyreported a high incidence of respiratory distress in infantsborn 7 to 20 days after a single course of glucocorticoids. Toprevent this problem, clinicians have adopted another ante-natal regimen where women at risk of preterm labor areadministered multiple courses of corticosteroids for weeks tomonths (Newnham, 2001). It is possible that fetuses exposedto repeated doses of corticosteroids may become deficient insurfactant protein A and exhibit adult onset metabolic dis-orders (Iannuzzi et al., 1993; Newnham, 2001). Therefore,these possible adverse effects warrant reassessment of opti-mal antenatal dosing strategies.

Our data from control animals shows that the endogenousbiology circumvents the reversibility of inductive effects andselectively induces both surfactant proteins. The innate biol-ogy does this by maintaining the concentrations of the freeendogenous corticosteroid above a critical threshold, which is

Fig. 10. Simulated PD profiles (dashed lines) for surfac-tant protein A (thick line) and surfactant protein B (thinline) during a 31 nmol/kg/h maternal DEX infusion ongestational days 18 to 21. For comparison, the normalontogeny for these proteins in control fetal rat lung is alsopresented (solid lines).

136 Samtani et al.

the Kd value for the steroid/receptor interaction. Excessiveendogenous steroid exposure is prevented by maintaining theconcentration at approximately twice the threshold, whichleads to two-thirds occupation of available receptors. Thus,by sustaining the steroid concentrations at a steady plateau,overexposure to glucocorticoids is prevented; paradoxical in-hibitory effects are not permitted; fetal programming thatcauses adult onset metabolic disorders is avoided; and mostimportantly, critical lung maturation is achieved in controlanimals. Based on the simulation results, it is thereforeproposed that conservative use of steroids involving smalldivided doses producing sustained exposure may be morebeneficial rather than weekly repeated courses over pro-longed periods. Rational and conservative use of steroidsbecomes even more important in light of the finding that fetalGR is not under negative feedback regulation by its ownligand (Fig. 4). Lack of this protective mechanism in the fetusmakes the possibility of adverse corticosteroid effects evenmore likely. This should therefore serve as additional encour-agement for investigators to intensify the search for rationaland safe antenatal doses of corticosteroids.

The knowledge gained from the pregnant rodent model inunderstanding glucocorticoid effects on fetal lung during thepast few decades has been immense (Brown and Seckl, 2005).However, there are limitations with this animal model. Un-like in humans, rat gestation is extremely short. Glucocorti-coid exposure and GR concentrations rise in tandem very latein gestation, which also represents the time frame whererodent fetuses are large enough for experimental manipula-tion. Precocious lung maturation is therefore difficult to in-duce in this animal model, which is obvious from Fig. 10,where the extent of early lung maturation is small. GR peaksonly after gestational day 20 in the fetal rat lung. Thus, apartfrom the transcriptional and translational delays, the mainfactor regulating the slow and late appearance of fetal lungmaturation is the availability of GR. Although this animalmodel is not ideal for producing precocious lung maturation,the study of DEX effects in fetal rat lung almost reflects theclinical situation. This is because DEX administration se-verely inhibits endogenous corticosterone secretion. Thus,the treatment effects are primarily driven by DEX in a lowcorticosterone environment. This corticosteroid milieu re-flects the clinical situation of steroid administration in pre-term labor where lung maturation is primarily driven by theexogenous steroid because the endogenous steroid surge hasnot begun yet.

Finally, it is important to reflect on the multitude of mech-anisms that the endogenous biology draws together to ensureefficient lung maturation during the late gestational cortico-steroid surge. These represent a combination of changes inthe disposition of the endogenous steroid and alterations inthe system pharmacology. These mechanisms are supportedby the data presented in our two reports and are as follows:1) Increased plasma free fraction for corticosterone is mani-fested by decreasing corticosteroid binding globulin inplasma, thus providing a bigger pool of steroid for driving PDeffects. 2) There is increased maternal to fetal corticosteronetransfer, which probably occurs because of shutting down ofplacental corticosteroid-metabolizing enzymes. This equili-bration of steroid concentrations across the placenta leads toincreased fetal glucocorticoid exposure. 3) The concentrationof GR in the fetal lung rises markedly in concert with the

plateau of corticosterone to its critical steady-state value of 2times the Kd,cort. The heightened concentrations of the ligandand GR lead to production of a greater driving force (i.e., SR),which is necessary for mediating fetal lung maturation. 4)Unlike the adult situation, GR is not under negative regula-tory feedback. This allows GR levels to increase in a highglucocorticoid environment. The mechanisms related to GR,although essential for normal functioning of the endogenousbiology, also predispose the fetus to adverse effects in theevent of overexposure to exogenous glucocorticoids. It istherefore essential to use these highly potent steroids in arational, safe, effective, and conservative manner to ensureimprovement of maternal/fetal health without causing fore-seeable adverse effects.

ReferencesAlcorn JL, Islam KN, Young PP, and Mendelson CR (2004) Glucocorticoid inhibition

of SP-A gene expression in lung type II cells is mediated via the TTF-1-bindingelement. Am J Physiol 286:L767–L776.

Ballard PL (1986) Hormones and lung maturation. Monogr Endocrinol 28:173–196.Ballard PL and Ballard RA (1995) Scientific basis and therapeutic regimens for use

of antenatal glucocorticoids. Am J Obstet Gynecol 173:254–262.Ballard PL, Ballard RA, Gonzales LK, Huemmelink R, Wilson CM, and Gross I

(1984) Corticosteroid binding by fetal rat and rabbit lung in organ culture. JSteroid Biochem 21:117–126.

Ballard PL, Ertsey R, Gonzales LW, and Gonzales J (1996) Transcriptional regula-tion of human pulmonary surfactant proteins SP-B and SP-C by glucocorticoids.Am J Respir Cell Mol Biol 14:599–607.

Boggaram V, Smith ME, and Mendelson CR (1989) Regulation of expression of thegene encoding the major surfactant protein (SP-A) in human fetal lung in vitro.Disparate effects of glucocorticoids on transcription and on mRNA stability. J BiolChem 264:11421–11427.

Boggaram V, Smith ME, and Mendelson CR (1991) Posttranscriptional regulation ofsurfactant protein-A messenger RNA in human fetal lung in vitro by glucocorti-coids. Mol Endocrinol 5:414–423.

Brown RW and Seckl JR (2005) Glucocorticoid action in development. Curr OpinEndocrinol Diabetes 12:224–232.

Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G,Hummler E, Unsicker K, and Schutz G (1995) Targeted disruption of the glucocor-ticoid receptor gene blocks adrenergic chromaffin cell development and severelyretards lung maturation. Genes Dev 9:1608–1621.

D’Argenio DZ and Schumitzky A (1997) ADAPT II User’s Guide: Pharmacokinetic/Pharmacodynamic Systems Analysis Software. Biomedical Simulations Resource,Los Angeles.

DuBois DC, Almon RR, and Jusko WJ (1993) Molar quantification of specific mes-senger ribonucleic acid expression in northern hybridization using cRNA stan-dards. Anal Biochem 210:140–144.

DuBois DC, Xu ZX, McKay L, Almon RR, Pyszcznski N, and Jusko WJ (1995)Differential dynamics of receptor down-regulation and tyrosine aminotransferaseinduction following glucocorticoid treatment. J Steroid Biochem Mol Biol 54:237–243.

Emrie PA, Shannon JM, Mason RJ, and Fisher JH (1989) cDNA and deduced aminoacid sequence for the rat hydrophobic pulmonary surfactant-associated protein,SP-B. Biochim Biophys Acta 994:215–221.

Gaddum JH (1937) The quantitative effect of antagonistic drugs. J Physiol (Lond)89:7–9.

Ghosh B, Wood CR, Held GA, Abbott BD, and Lau C (2000) Glucocorticoid receptorregulation in the rat embryo: a potential site for developmental toxicity? ToxicolAppl Pharmacol 164:221–229.

Iannuzzi DM, Ertsey R, and Ballard PL (1993) Biphasic glucocorticoid regulation ofpulmonary SP-A: characterization of inhibitory process. Am J Physiol 264:L236–L244.

Jin JY, Almon RR, DuBois DC, and Jusko WJ (2003) Modeling of corticosteroidpharmacogenomics in rat liver using gene microarrays. J Pharmacol Exp Ther307:93–109.

Kalinyak JE, Griffin CA, Hamilton RW, Bradshaw JG, Perlman AJ, and Hoffman AR(1989) Developmental and hormonal regulation of glucocorticoid receptor messen-ger RNA in the rat. J Clin Investig 84:1843–1848.

Kotas RV and Avery ME (1971) Accelerated appearance of pulmonary surfactant inthe fetal rabbit. J Appl Physiol 30:358–361.

Liggins GC and Howie RN (1972) A controlled trial of antepartum glucocorticoidtreatment for prevention of the respiratory distress syndrome in premature in-fants. Pediatrics 50:515–525.

Liley HG, White RT, Benson BJ, and Ballard PL (1988) Glucocorticoids both stim-ulate and inhibit production of pulmonary surfactant protein A in fetal humanlung. Proc Natl Acad Sci USA 85:9096–9100.

Liley HG, White RT, Warr RG, Benson BJ, Hawgood S, and Ballard PL (1989)Regulation of messenger RNAs for the hydrophobic surfactant proteins in humanlung. J Clin Investig 83:1191–1197.

Mager DE and Jusko WJ (2001) Pharmacodynamic modeling of time-dependenttransduction systems. Clin Pharmacol Ther 70:210–216.

Mager DE, Pyszczynski NA, and Jusko WJ (2003) Integrated QSPR-pharmacody-namic model of genomic effects of several corticosteroids. J Pharm Sci 92:881–899.

Temporal Patterns of Gene Expression in Fetal Rat Lung 137

McCormack FX and Whitsett JA (2002) The pulmonary collectins, SP-A and SP-D,orchestrate innate immunity in the lung. J Clin Investig 109:707–712.

McNally MT and Free SJ (1988) Isolation and characterization of a Neurosporaglucose-repressible gene. Curr Genet 14:545–551.

Muglia L, Jacobson L, Dikkes P, and Majzoub JA (1995) Corticotropin-releasinghormone deficiency reveals major fetal but not adult glucocorticoid need. Nature(Lond) 373:427–432.

National Institutes of Health Consensus Panel (1995) NIH consensus developmentpanel on the effect of corticosteroids for fetal maturation on perinatal outcomes.J Am Med Assoc 273:413–418.

Newnham JP (2001) Is prenatal glucocorticoid administration another origin of adultdisease? Clin Exp Pharmacol Physiol 28:957–961.

Phelps DS and Floros J (1991) Dexamethasone in vivo raises surfactant protein BmRNA in alveolar and bronchiolar epithelium. Am J Physiol 260:L146–L152.

Samtani MN and Jusko WJ (2005) Comparison of dexamethasone pharmacokineticsin female rats after intravenous and intramuscular administration. BiopharmDrug Dispos 26:85–91.

Samtani MN, Pyszczynski NA, DuBois DC, Almon RA, and Jusko WJ (2006) Mod-eling glucocorticoid-mediated fetal lung maturation: I. Temporal patterns of cor-ticosteroids in rat pregnancy. J Pharmacol Exp Ther 317:117–126.

Sano K, Fisher J, Mason RJ, Kuroki Y, Schilling J, Benson B, and Voelker D (1987)Isolation and sequence of a cDNA clone for the rat pulmonary surfactant-associated protein (PSP-A). Biochem Biophys Res Commun 144:367–374.

Schellhase DE, Emrie PA, Fisher JH, and Shannon JM (1989) Ontogeny of surfac-tant apoproteins in the rat. Pediatr Res 26:167–174.

Schellhase DE and Shannon JM (1991) Effects of maternal dexamethasone onexpression of SP-A, SP-B and SP-C in the fetal rat lung. Am J Respir Cell Mol Biol4:304–312.

Shimizu H, Miyamura K, and Kuroki Y (1991) Appearance of surfactant proteins,SP-A and SP-B, in developing rat lung and the effects of in vivo dexamethasonetreatment. Biochim Biophys Acta 1081:53–60.

Sun YN, DuBois DC, Almon RR, and Jusko WJ (1998) Fourth-generation model forcorticosteroid pharmacodynamics: a model for methylprednisolone effects on re-ceptor/gene-mediated glucocorticoid receptor down-regulation and tyrosine amino-transferase induction in rat liver. J Pharmacokinet Biopharm 26:289–317.

Vidaeff AC, Ramin SM, Gilstrap LC 3rd, and Alcorn JL (2004) In vitro quantificationof dexamethasone-induced surfactant protein B expression in human lung cells. JMatern Fetal Neonatal Med 15:155–159.

Weaver TE and Conkright JJ (2001) Function of surfactant proteins B and C. AnnuRev Physiol 63:555–578.

Address correspondence to: Dr. William J. Jusko, Department of Pharma-ceutical Sciences, School of Pharmacy and Pharmaceutical Sciences, 565 Hoch-stetter Hall, State University of New York at Buffalo, Buffalo, NY 14260.E-mail: wjjusko@buffalo.edu

138 Samtani et al.