Kobe University Repository : Thesis

学位論文題目Tit le

Funct ions of serotonin receptors in integrat ion of physiology andbehavior in insects(昆虫の生理および行動の統合性におけるセロトニン受容体の機能)

氏名Author Wang, Qiushi

専攻分野Degree 博士（学術）

学位授与の日付Date of Degree 2014-03-25

公開日Date of Publicat ion 2015-03-01

資源タイプResource Type Thesis or Dissertat ion / 学位論文

報告番号Report Number 甲第6028号

権利Rights

JaLCDOI

URL http://www.lib.kobe-u.ac.jp/handle_kernel/D1006028※当コンテンツは神戸大学の学術成果です。無断複製・不正使用等を禁じます。著作権法で認められている範囲内で、適切にご利用ください。

PDF issue: 2021-05-25

Doctoral Dissertation

博士論文

Functions of serotonin receptors in integration of

physiology and behavior in insects

昆虫の生理および行動の統合性におけるセロトニン

受容体の機能

Qiushi Wang

Graduate School of Agricultural Science, Kobe University

神戸大学大学院農学研究科

January 2014

平成 26年 1月

i

CONTENT

CHAPTER 1 General Introduction

1.1 5HT and melatonin functions in insect nervous system…….…………………... 01

1.2 NAT in insect system……………………………………………………………. 05

1.3 References………………………………………………………..……………... 08

CHAPTER 2

Serotonin receptor B may lock the gate of PTTH release/synthesis in the Chinese

silk moth, Antheraea pernyi; a diapause initiation/maintenance mechanism?

2.1. Abstract……………………………………………………………………...….. 14

2.2. Introduction…………………………………………………………...…….….. 16

2.3. Material and Methods…………………………………………………...….…... 19

2.3.1 Insect………………………………………...…………………….…..….. 19

2.3.2 Primary antibodies……………………...…………………………….…… 19

2.3.3 Immunohistochemistry……………………………….………………...…. 20

2.3.4 RNA extraction and cDNA synthesis……………………..…………......... 22

2.3.5 Preparation and injection of dsRNA……………..……………………….. 23

2.3.6 qRT-PCR……………………………………………………………….….. 23

2.3.7 SDS-PAGE and Western blotting analysis…………………………….….. 24

2.3.8 5HT and luzindole injection………………………………...…….……..... 25

2.3.9 5,7-dihydroxytryptamine (5,7-DHT) injection…………………..……..…. 25

2.3.10 Statistical analysis………………………………………………..……… 26

ii

2.4. Results……………………………………………………………..…………… 26

2.4.1 mRNA level of 5HTRs……………………………………...…………….. 26

2.4.2 Co-localization of PTTH-ir and EH-ir with 5HTR-ir in adult and pupal

BR-SOG of A. pernyi…………………………………………..………… 28

2.4.3 Effects of RNAi against 5HTRA and 5HTRB on diapause……………...… 37

2.4.4 5HT Pharmacology on diapause determination………………………...… 38

2. 5. Discussions…………………………………………………………………….. 46

2.6. References……………………………………………………………………… 53

CHAPTER 3

Serotonin receptor 2a regulates polyethism in the honeybee, Apis mellifera

3.1. Abstract…………………………………………………………………...…….. 60

3.2. Introduction……………………………………………………………..……… 61

3.3. Material and Methods…………………………………………………...……… 63

3.3.1 Animals…………………………………………………………..………... 63

3.3.2 Isolation of total RNA and cDNA synthesis………..……………………... 64

3.3.3 Preparation and injection of dsRNA………………………………..…...... 64

3.3.4 qRT-PCR…………………………………………………………..………. 64

3.3.5 PCR……………………………………………………………………….. 65

iii

3.3.6 5HT, melatonin and 5,7-DHT injection…………………………………… 66

3.3.7 Statistical analysis………………………………………………………… 66

3.4 Results…………………………………………………………………………... 66

3.4.1 mRNA level of Am5HTRs in the brain and HG…………………….…….. 66

3.4.2 Effects of RNAi against Am5HTR2a on royalactin in the brain…………... 71

3.4.3 Effect of 5HT pharmacology on royalactin……………………………….. 72

3.5 Discussion………………………………………………………………………. 76

3.6 References………………………………………………………………………. 79

CHAPTER 4

Summary……………………………………………………………...……………. 86

Acknowledgements…………………………………………………...…………….. 90

1

Chapter 1 General Introduction

1.1 5HT and melatonin functions in insect nervous system

Intercellular communications are conducted and integrated either by neural

circuit or humoral factors in multicellular organisms. Neurotransmission is conducted

in such a way that action potential streaks along axon ending at the exonterminal

where chemical neurotransmitters are released to a synaptic cleft or electrical

excitation continues to the adjacent cell. The terminal structure of axon is called

synapse across which electrically or chemically the adjacent cells are stimulated via

tight junctions or receptors. To date six types of neurotransmitters are known, 1)

amino acids such as glutamate, aspartate, gamma-amino butyric acid (GABA) and

glycine; 2) monoamines derived aromatic amino acids phenylalanine, tyrosine and

tryptophan, 3) peptides, 4) polypeptide/protein, 5) choline ester and 6) adenosine

related compounds. These compounds are not always released into synaptic deft but

sometimes to general circulation. In the latter case, agents are called neurohormones.

In between releases are made into a close vicinity, a paracrine secretion.

Indolamines are derivative of tryptophan containing 5HT (5-hydroxytryptamine),

a typical neurotransmitter and melatonin, a neurohormone. In the brain, these

indolamines antagonize each other to switch-on or –off individual functions such as

sleep, aggression and metabolism. Serotonin system sometimes counteract

catecholamine system including dopamine, norepinephrine and epinephrine, or

phenolamine system including octopamine and tyramine particularly in invertebrate

2

systems. Catecholamines system is more specified via the ligand but serotonin system

has only one ligand but is regulated by multiple types of receptors. For example, the

number of serotonin receptors (5HTRs) is 13 (Hoyer et al., 2002; Kroeze et al., 2002)

in mammals, but little is known about 5HTRs in insects.

5HT was a penultimate substrate (Fig. 1) for melatonin synthesis. Melatonin is

an indoleamine that is synthesized form 5HT via N-acetylation reactions catalyzed by

arylalkylamine N-acetyltransferase (NAT) and 5-hydroxyindole-O-methyltransferase

(HIOMT). In mammals, serotonin controls and modulates important physiological

and behavioral processes such as learning, sleep, feeding, mood and so on (Weiger,

1997). It acts as a hormone (Erspamer and Asero, 1952), a neurotransmitter (Brodie

and Shore, 1957), and a mitogen (Mohammad et al., 2008).

3

Fig. 1 Synthesis of melatonin from serotonin.

5HT functions as a neurotransmitter, neuromodulator and neurohormone also, in

most insects. 5HT is responsible for the modulation of behaviors in insects, such as

foraging (Schulz et al., 2002), sensitivity to olfactory stimuli (Menzel et al., 1999).

5HT also affects feeding in ants (Falibene et al., 2012). Lines of evidence from

various experimental approaches show that 5HT plays important physiological roles

in the circadian system of insects (Pyza and Meinertzhagen, 1996; Tomioka, 1999).

4

Tomioka and Ikeda (1993) found that 5HT content in the optic lobe of the cricket

(Gryllus bimaculatus) fluctuates, depending on the time of day and the time course of

the fluctuation is similar to the circadian change in the sensitivity of visual

interneurons. In Drosophila melanaogaster, serotonergic neurons innervate optic

neuropils that overlap with dendritic arborization of ventral lateral neuron. This is

means that the pacemaker neurons may be modulated by serotonergic neurons

(Rodrguea Moncalvo and Campos, 2005). In the honeybee, 5HT affects motor

behavior and sensory responses (Blenau and Erber, 1998; Pribbenow and Erber, 1996).

In adult bee, the level in the brain increased with age, highest concentrations being

found in foragers (Taylor et al., 1992; Wagener-Hulme et al., 1999).

The effects of serotonin are mediated through interactions with guanine

nucleotide binding and regulatory proteins (G-protein)-coupled receptor proteins that

activate multiple effectors pathways, except the 5HT3 receptors (Raymond et al.,

2001). 5HT receptors in insects have been divided into seven subfamilies that depend

on sequence homology, gene organization, coupling to second-messenger pathways,

and pharmacological properties (Hannon and Hoyer, 2008; Nichols and Nichols,

2008). All the 5HTRs are coupled to G-proteins, except the 5HT3 receptors (Raymond

et al., 2001).

By recently knowledges of 5HTRs in insects are limited. In Drosophila, 5HT1A,

5HT1B, 5HT2 and 5HT7 were designated (Nichols, 2006) to be orthologous to the

mammalian 5HTR1A, 5HTR2 and 5HTR7, just 5HT1A. 5HT1B is involved in circadian

5

system (Yuan et al., 2005). Expression levels of Dm5HTR1A and Dm5HTR2 were

under circadian regulation. These genes were defined as clock-controlled genes on

microarray analysis (Claridge-Chang et al., 2001). There are some molecular

biological reports suggesting the existence of 5HTRs in lepidopteran insects. In

Manduca sexta, two types of 5HTR were cloned and revealed that these receptors in

antennae, thoracic ganglia and abdominal ganglia of adult (Dacks et al., 2006). In

Papilio xuthus, 5HTR was cloned and shown to exist in the antenna, brain, labellum,

thoracic ganglia and tarsus of adult or pharate adult (Ono and Yoshikawa, 2004). Two

5HTRs (Ap5HT1A and Ap5HT1B) were cloned from A. pernyi (Hiragaki et al., 2008).

However, there is no report about the role of 5HTRs in regulation of pupal diapause

of lepidopteran insects. The honeybee expresses four 5HTR subtypes (Am5HT1A,

Am5HT1B, Am5HT2 and Am5HT7) that are predicted to be orthologs of the

mammalian 5HT1, 5HT2 and 5HT7 receptors (Blenau and Thamm, 2011). Am5HT1A is

a likely mediator of serotonin that was involved in the regulation of honeybee

phototactic behavior (Thamm et al., 2010).

1.2 NAT in insect system

NAT constitutes a large family of enzymes, found a variety of organisms (David,

2007). In insect, it is also involved in many other physiological functions such as,

formation of puparium, tanning of oviposited eggs (Smith, 1990), formation of

N-acetyldopamine and N-acetyloctopamine, agents for sclerotization of the cuticle

(Karlson et al., 1962). NAT activity has been found in developing eggs, various

6

organs and hemolymph of cricket G. bimaculatus (Itoh et al., 1998). Takeda et al.

(2011) found NAT activity in the silkwoth A. pernyi. NAT activity changed during

cold storage and at least ten cycles of long-day in diapause pupal. The rise of NAT

activity and diapause termination were at the same time.

Melatonin is a neurohormone, involved in a variety of functions in vertebrates

and invertebrates (Zawilska, 1992; Vivien-Roels and Pevet, 1993). In invertebrates,

melatonin is synthesized also during in dark period (Gorbet and steel, 2003).

Melatonin has been identified in the compound eyes and brain of Gryllus bimaculatus

by HPLC with fluorometric detection (Itoh et al., 1994), and its levels peaked during

the dark period (Itoh et al., 1995). In A. pernyi, melatonin receptor (MT)-like

reactivity was co-existed with PTTH, suggesting that melatonin is involved PTTH

release (Ahmed unpublished data). Similarly to A. pernyi, the stimulation of PTTH

release has been documented by co-incubation of melatonin in the brain prothoracic

gland in vitro system Periplaneta americana (Richter et al., 2000). Therefore,

melatonin plays a role as a releasing factor of the glandotropic neuropeptide PTTH in

the brain. In the honeybee, melatonin was suggested to be involved in the regulation

of aging, behavior, polyethism and sleep or wake. High levels of melatonin appeared

in foragers and during day time in caged 30 days bee (Yang et al., 2007). Whether

5HT has some relationship with melatonin in the brain of honeybee at different ages

and its role in polyethism is unclear. In Bombyx mori, melatonin level in the head was

higher during dark than light period. The synthesis and release of melatonin in the

head shows a circadian rhythm. In crickets, melatonin rhythm was also observed (Itoh

7

et al., 1998.) In vertebrates, melatonin is produced in the pineal gland, retina, skin and

gastrointestinal tract and regulated by the light/dark cycle. When melatonin was

synthesized in the pineal, it was under control of circadian oscillator (Simonneaux and

Ribelayga, 2003) and it synthesized during dark period.

Melatonin binds to on the MTs. However until now, just three types of MTs were

found in mammals. MT1 and MT2 subtypes were found in humans and other

mammals (Reppert et al., 1996) and MT3 was identified in birds and amphibians

(Sugden et al., 2004). However, little is known about the function and distribution of

MT in the central nervous system of insects.

To clarify functional roles of 5HTR in insects, we focus on 5HTRs, in the

process of diapause termination silkmoth A.pernyi and in nurse specific royalactin

production in the honeybee A. mellifera by the asking following in the questions: (1)

Serotonin receptor B may lock the gate of PTTH release/synthesis in the Chinese silk

moth, Antheraea pernyi; a diapause initiation/maintenance mechanism? (2) Does

serotonin receptor 2a regulate royalactin in the honeybee, Apis mellifera.

This study revealed the presence of 5HTR in the brain, and its regulatory

mechanisms in some developmental events and behavior.

8

1.3 References

Blenau W, Thamm M (2011) Distribution of serotonin (5-HT) and its receptors in the

insect brain with focus on the mushroom bodies. Lessons from Drosophila

melanogaster and Apis mellifera. Arthropod Structure & Development 40: 381-394

Blenau W, Erber J (1998) Behavioural pharmacology of dopamine, serotonin and

putative aminergic ligands in the mushroom bodies of the honeybee (Apis

mellifera). Behav Brain Res 96: 115-124

Brodie B, Shore P (1957) A concept for a role of serotonin and norepinephrine as

chemical mediators in the brain. Ann New York Acad Sci 66: 631-642

Claridge-Chang A, Wijnen H, Naef F, Boothroyd C, Rajewsky N, Young MW (2001)

Circadian regulation of gene expression systems in the Drosophila head. Neuron 32:

657-671

Dacks AM, Dacks JB, Christensen TA (2006) The cloning of one putative octopamine

receptor and two putative serotonin receptors fromthe tobacco hawkmoth, Manduca

sexta. Insect Biochem Molec Biol 36: 741–747

David CK (2007) Arylalkylamine N-acetyltransferase: the timezyme. J Biol Chem

282: 4233-4237

Erspamer V, Asero B (1952) Identification of enteramine, specific hormone of

enterochromaffin cells, as 5-hydroxytrptamine. Nature 169: 800-801

9

Falibene A, Rossler W, Josens R (2012) Serotonin depresses feeding behaviour in

ants. J Insect Physiol 58: 7-17

Gorbet DJ, Steel CGH (2003) A miniature radioimmunoassay for melatonin for use

with small samples from invertebrates. General Comperative Endocrinology.

134:193-197

Hannon J, Hoyer D (2008) Molecular biology of 5-HT receptors. Behav Brain Res

195: 198-213

Hiragaki S, Kawabe Y, Takeda M (2008) Molecular cloning and expression analysis

of two putative serotonin receptors in the brain of Antheraea peryni pupa.

International Journal of Wild Silkmoths & Silk 13: 1–14

Hoyer D, Hannon JP, Martin GR (2002) Molecular, pharmacological and functional

diversity of 5-HT receptors. Pharmacol Biochem Behav 71: 533-554

Itoh MT, Hattori A, Surni Y, Suzuki T (1994) Identification of melatonin in different

organs of the cricket, Gryllus bimaculatus. Zool Sci 11: 577-581

Itoh MT and Sumi Y (1998) Melatonin and serotonin N-acetyltransferase activity in

developing eggs of the cricket Gryllus bimaculatus. Brain Res 781(1-2): 90-99.

Itoh MT, Hattori A, Nomura T, Sumi Y and Suzuki T (1995) Melatonin and

arylalkylamine N-acetyltransferase activity in the silkworm, Bombyx mori. Mol

Cell Endocrinol 115(1): 59-64.

10

Itoh MT, Sumi Y (1998) Circadian clock controlling arylkamine N-acetyltransferase

like activity in cricket (Gryllus bimacullatus) egg. Brain Res. 799: 172-175

Karlson P, Sekeris CE, Sekeri KE (1962) Zum Tyrosinstoffwechsel der Insecten: VI.

Identifizierung von N-Acetyl 3, 4-dihydroxy-β-phenäthylamin (N-Acetyldopamine)

als Tyrosinmetabolit. Z Phys Chem 327: 86-94

Kroeze WK, Kristiansen K, Roth BL (2002) Molecular biology of serotonin receptors

structure and function at the molecular level. Curr Top Med Chem 2: 507-528

Menzel R, Heyne A, Kinzel C, Gerber B, Fiala A, (1999) Pharmacological

dissociation between the reinforcing, sensitizing, and response-releasing functions

of reward in honeybee classical conditioning. Behavioral Neuroscience 113: 744–

754

Mohammad-Zadeh LF, Moses L, Gwaltney-Brant SM (2008) Serotonin: a review. J

vet Pharmacol Therap 31: 187-199

Nichols R, (2006) FMRFamide-related peptides and serotonin regulate Drosophila

melanogaster heart rate: mechanisms and structure requirements. Peptides 27:

1130–1137

Nichols DE, Nichols CD (2008) Serotonin receptors. Chem rev 108: 1614-1641

Ono H, Yoshikawa H (2004) Identification of amine receptors from a swallowtail

butterfly, Papilio xuthus L: cloning and mRNA localization in foreleg

11

chemosensory organ for recognition of host plants. Insect Biochem Mol Biol 34:

1247-1256

Pribbenow B, Erber J (1996) Modulation of antennal scanning in the honeybee by

sucrose stimuli, serotonin, and octopamine: behavior and electrophysiology.

Neurobiol Learn Mem 66: 109-120

Pyza E and Meinertzhagen I A (1996) Neurotransmitters regulate rhythmic size

changes amongst cells in the fly’s optic lobe. J. Comp.Physiol. A 178: 33–45

Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW, Grewal

JS, Garnovskaya MN (2001) Multiplicity of mechanisms of serotonin receptor

signal transduction. Pharmacology and Therapeutics 92: 179–212

Richter K, Peschke E D and Peschke E (2000) A neuroendocrine releasing effect of

melatonin in the brain of an insect, Periplaneta americana (L.) J. Pineal Res. 28:

129-135

Rodriguez Moncalvo VG, Campos AR (2005) Genetic dissection of trophic

interactions in the larval optic neuropil of Drosophila melanogaster. Dev Biol 286:

549-558

Schulz DJ, Elekonich MM, Robinson GE (2002) Biogenic amines in the antennal

lobes and the initiation and maintenance of foraging behavior in honey bees.

Journal of Neurobiology 54: 406–416.

12

Simonneaux V, Ribelayga C (2003) Generation of melatonin endocrine message in

mammals: a review of the complex regulation of melatonin synthesis by

norepinephrine, peptides and other pineal transmitters. Pharmacol Rev 55: 325-395

Smith TJ (1990) Phylogenic distribution and function of arylalkylamine

N-acetyltransferase. Bioassay 12: 30-33

Sugden D, Davidson K, Hough KA, Teh MT (2004) Melatonin, melatonin receptors

and melanophores: a moving story. Pigment Cell Res. 17 (5): 454–60

Reppert SM, Weaver DR, Godson C (1996) Melatonin receptors step into the light:

cloning and classification of subtypes. Trends Pharmacol. Sci. 17 (3): 100–2

Takeda M, Hiragaki S, Bembenek J, Tsugehara T, Tohno Y, Matsumoto M, Ichihara

N (2011) Photoperiodic system for pupal diapause in Antheraea pernyi: clock,

counter, endocrine switch and roles of indolamine pathways. Int. J. Wild Silkmoth

& Silk 16: 97-109

Taylor DJ, Robinson GE, Logan BJ, Laverty R, Mercer AR (1992) Changes in brain

amine levels associated with the morphological and behavioural development of the

worker honeybee. J Comp Physio A 184: 471-479

Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of

the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin

in phototactic behavior. Cell Mol Life Sci 67: 2467-2479

13

Tomioka K (1999). Light and serotonin phase-shift the circadian clock in the cricket

optic lobe in vitro. J. Comp. Physiol. A 185: 437–444.

Tomioka K and Ikeda M (1993) Involvement of serotonin in the circadian rhythm of

an insect visual system. Naturwissenschaften 80: 137-139

Vivien-Roels B, Pevet P (1993) Melatonin: presence and formation in invertebrates.

Experientia 49: 642-647

Wagener-Hulme C, Kuehn JC, Schulz DJ, Robinson GE (1999) Biogenic amines and

division of labor in honey bee colonies. J Comp Physio A 184: 471-479

Weiger WA (1997) Serotonergic modulation of behavior: a phylogenetic overview.

Biological Reviews 72: 61-95

Yang L, Qin Y, Li X, Song D, QI M (2007) Brain melatonin content and polyethism

in adult workers of Apis mellifera and Apis cerana. J Applied Entomo 131(9-10):

734-739

Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment

in Drosophlia. Neuron 47: 115-127.

Zawilska JB (1992) Melatonin in vertebrate retina: biosynthesis, receptors and

functions. Pol J Pharmacol Pharm 44: 62

14

Chapter 2: Serotonin receptor B may lock the gate of PTTH release/synthesis in

the Chinese silk moth, Antheraea pernyi; a diapause initiation/maintenance

mechanism?

2.1 Abstract

The release of prothoracicotropic hormone, PTTH, or its blockade is the major

endocrine switch regulating the developmental channel either to metamorphosis or to

pupal diapause in the Chinese silk moth, Antheraea pernyi. We have cloned cDNAs

encoding two types of serotonin receptors (5HTRA and B). 5HTRA-, and 5HTRB-like

immunohistochemical reactivities (-ir) were colocalized with PTTH-ir in two pairs of

neurosecretory cells at the dorsolateral region of the protocerebrum (DL). Therefore,

the causal involvement of these receptors was suspected in PTTH release/synthesis.

The level of mRNA5HTRB responded to 10 cycles of long-day activation, falling to 40%

of the original level before activation, while that of 5HTRA was not affected by

long-day activation. Under LD 16:8 and 12:12, the injection of dsRNA5HTRB resulted

in early diapause termination, whereas that of dsRNA5HTRA

did not affect the rate of

diapause termination. The injection of dsRNA5HTRB induced PTTH accumulation,

indicating that 5HTRB binding suppresses PTTH synthesis also. This conclusion was

supported pharmacologically; the injection of luzindole, a melatonin receptor

antagonist, plus 5TH inhibited photoperiodic activation under LD 16:8, while that of

5,7-DHT, induced emergence in a dose dependent fashion under LD 12:12. The

results suggest that 5HTRB may lock the PTTH release/synthesis, maintaining

15

diapause. This could also work as diapause induction mechanism.

Keywords: Prothoracicotropic hormone (PTTH), Serotonin 5-HTRA, and Serotonin

5-HTRB, Diapause

16

2.2 Introduction

Many living organisms can monitor day or night length to adjust their behavior,

metabolism, physiology and developmental course to maximally adapt for an adverse

or favorable season. This is called photoperiodism, which remains as a biological

mystery, at least at the molecular level. This system is complex, consisting of several

functional subunits; a photoreceptor, a clock/timer, a summation mechanism counting

effective photoperiodic cycles and an endocrine switch. The photoperiodism of

insects, poikilotherms with wide distributions and short life, shows overwhelming

sophistication (Danks, 2003; Danilevskii, 1965). It is important to understand the

photoperiodic mechanism and its effects on the seasonal demography of pest insects

from the pest management point of view, as well as scientific curiosity. Therefore,

many scientists have attempted to elucidate this mechanism. However, the molecular

mechanism still remains obscure and dispute over the mode of photoperiodic time

measurement continues, that is hourglass timer vs. circadian clock (Saunders, 2005)

vs. mixed type (Truman, 1971; Beck, 1974; Veerman and Vaznunes, 1980).

We chose Antheraea pernyi as a model animal to study this issue, since this is a

classical organism used for study of the endocrine mechanism for metamorphosis and

pupal diapause (Williams and Adkisson, 1964b). Other advantages of using this

species include the availability of circadian clock genes and the PTTH gene (Sauman

and Reppert, 1996). A. pernyi enters pupal diapause when raised under short days, but

diapause is averted under long days. Photoperiod affects the release of PTTH. When it

is released, diapause is terminated or averted, and when it is not released, diapause

17

results or is maintained. Diapause is also terminated after long storage at a low

temperature (Takeda et al., 2011). However, the question of what releases PTTH or

conversely what stops its release remains to be answered. We have monitored brain

neurotransmitter dynamics and enzymatic activity changes during diapause and

photoperiodic activation (Matsumoto and Takeda, 2002; Takeda et al., 2011).

Sauman and Reppert (1996) have shown the juxtaposion of PER (PERIOD)-ir to

PTTH-ir in A. pernyi and Ichihara (2000) have demonstrated the colocalization of

DBT-, NAT-, HIOMT-, and melatonin-ir with PER-ir. We continuted to carry out

immunohistochemical localization of circadian clock proteins, neurotransmitter

receptors, neuropeptides and neurotransmitter metabolic enzyme-like antigens, here

showing the colocalization of Cyc- and Clk-ir with PER-ir. The results suggest that the

indolamine metabolic pathway may mediate circadian output pathway to PTTH

release.

RIA showed that “immunoreactive melatonin” increased in the brain and

hemolymph of diapause pupa of A. pernyi under long-day condition and REA,

redioengymatic assay, showed that this activation was caused by the increased insect

anylalkylamine NAT (iaaNAT, aaNAT, NAT). We have retrieved cDNA encoding

NAT from A. pernyi on the PCR-based cloning and show enzymatic activity of

baculovirus expressed protein with serotonin (5-hydroxytryptamine, 5HT) as a

substrate (Tsugehara et al., 2013). These results suggest that melatonin stimulates

PTTH release and the mechanism that dictates circadian output involves the aaNAT

gene (Bembenek, 2004). The injection of dsRNAaaNAT

abolished photoperiodism

18

under LD 16:8. The upstream promotor region of this NAT contained multiple

E-boxes and melatonin receptor (MT), MT-ir was observed in PTTH neurons

(unpublished data). During this course of study, we noticed not only MT-ir but also

serotonin receptors (5HTRs)-ir in PTTH-ir cells. The neurosecretory cells (ns cells)

secreting PTTH were located in the dorsolateral protocerebrum (DL) of A. pernyi

(Sauman and Reppert, 1996), and this condition was also found in Bombyx mori and

Manduca sexta (Mizoguchi et al., 1990; Sedlak, 1981). cDNAs encoding PTTH from

B. mori, M. sexta and A. pernyi were successfully cloned and sequenced

(Adachi-Yamada et al., 1994; Shionoya et al., 2003; Williams and Adkisson, 1964).

In A. pernyi, PTTH release was a gated phenomenon under control of the circadian

clock that terminates pupal diapause under long-day conditions (Saunder, 2011;

Williams and Adkisson, 1964; Williams and Adkisson, 1964). The release of PTTH is

also under the regulation of the photoperiodic/circadian clock, and in Periplaneta

americana melatonin stimulates PTTH release and serotonin suppresses it (Shirai et

al., 1995). In B. mori, serotonin stimulates PTTH release (Sehadova et al., 2004) but

serotonin is an upstream precursor for melatonin. Therefore it cannot be determined

which of the two indolamines is the direct releaser of PTTH. The question to be asked

here is whether diapause is simply a default condition for melatonin activation

mechanism or it requires a special mechanism of developmental arrest. If the former

is the case, these were no need of 5HTR in PTTH neurons.

5HT is a major biogenic amine distributed in the insect central nervous system

(Nassel and Cantera, 1986). 5HT regulates behaviors such as mood, sleep, memory

19

and sex in humans (Lucki, 1998). It also plays important roles in the circadian system

of insects (Tomioka et al., 1993). Recently, studies on 5HTRs have progressed in

insects, especially in Lepidoptera and Diptera (von, Nickisch-Rosenegk et al., 1996).

5HTRs are now classified into 7 subfamilies in insects (Raymond et al., 2001). The

honey bee, for example, is known to express four 5HTR subtypes (Am5HT1A,

Am5HT1B, Am5HT2 and Am5HT7). Hiragaki et al., (2008) have cloned two putative

5HTR subtypes from the brain of A. pernyi (AP5HTRA and AP5HTRB). However, the

roles of these 5HTRs in the regulation of diapause are still unclear. This is thus the

focus of this investigation.

2.3 Material and methods

2.3.1 Insect

Diapause pupae of a univoltine strain of A. pernyi were either shipped or

personally carried by researchers from Henang Province, to Japan. The diapause

pupae were stored under LD 12:12 at 25oC for 2 weeks. Diapause pupae were used for

physiological experiments within 4 months, during which time photoperiodism was

securely maintained.

2.3.2 Primary antibodies

Antibodies against two Ap5HT receptors, 5HTRA and B, were raised by injecting

totally four New Zealand white rabbits with synthetic peptides conjugated with KLH.

The 18-amino-acid peptide from 447 to 464 of the deduced sequence of A. pernyi

20

5HTRA and another peptide corresponding to 20 amino acids from 429 to 448 of the

deduced sequence of A. pernyi 5HTRB were used as antigens. Immunizations were

performed using two groups rabbits (n=2 for each group). The antigens and TiterMax

Gold were mixed at a ratio of 1:1 (v:v) before injection. Blood samples of 10 mL

were harvested from ear vein, antibody detection was analyzed from 2 weeks to 4

weeks. The whole blood collected during general anesthesia by using sodium

pentobarbital. Their specificities and details of the antibody have been described

previously in Shao et al (2010). The two sequences have no overlap. A kind gift from

Drs. Ivo Sauman of the Czech Academy of Sciences, Ceske Budejovice and Steven

Reppert of antiserum against A. pernyi PTTH (ApPTTH) raised in rabbit (residues

132-152; GenBank accession no. AAB05259) was used. We raised antibodies against

B. mori PTTH (BmPTTH) in rat (antigen sequence: GNIQVENQAIPDPPCTCKYKK)

(Genmed, Taxas, USA). This antibody was also used for double-staining and

confirmation.

2.3.3 Immunohistochemistry

Immunohistochemistry was performed on the BR-SOG of male and female

adults and pupae of A. pernyi. Dissection was conducted during the daytime from

pupae 5 days after the activation by LD 16:8. The BR-SOG, frontal ganglion (FG),

corpora cardiaca (CC) and corpora allata (CA) were dissected from the

water-anesthetized animals in sterile saline. The tissues were fixed overnight at 4oC in

Bouin solution. Standard histochemical methods were used for tissue dehydration,

embedding in paraffin, sectioning (8 µm), deparaffinization and rehydration according

21

to a previous report (Sehadova et al., 2004). The sections were blocked with 1.5%

normal goat serum diluted in Tris-buffered saline (TBS; 135 mM NaCl, 2.6 mM KCl,

25 mM Tris-HCl, pH7.6) for 30 min at room temperature (RT). Subsequent overnight

incubation with primary antibodies diluted with blocking serum (Table 1) was

conducted in a humidified chamber at 4oC. In the controls, the primary antibodies

were replaced with normal serum. After 3 rinses with TBS, each for 10 min, the

sections were incubated for 90 min with a biotinylated secondary antibody, rinsed 3

times for 10 min with TBS and treated for 30 min with VECTASTAIN ABC kit

(Vector Laboratories, Burlingame, CA, USA). Following 3 rinses each for 10 min and

one with 0.1 M Tris-HCl, pH7.5 (5 min), the HRP enzymatic reaction was visualized

with hydrogen peroxide (0.005%) and 3,3’-diaminobenzidine tetrahydrochloride

(DAB, 0.25 mM in 0.1 M Tris-HCl, pH7.5). Stained sections were dehydrated and

mounted on Bioleit mounting medium (Kouken Rika, Osaka, Japan). The mounted

specimens were examined under a BX50F4 microscope (Olympus, Tokyo, Japan).

For the double labeling (with antibodies derived from the same animal),

experiments were performed according to the method of Hiragaki et al. (2009).

Anti-Ap5HTRA/B antibody (Table 1) was incubated overnight at 4oC. After rinsing (3×)

with TBS-Tw, the slides were incubated with secondary antibody for 60 min. After

rinsing (3×) with TBS-Tw, they were treated for 30 min with VECTASTAIN ABC

reagent. Then, sections were treated with TSA Biotin System (Perkin Elmer, MA, US),

which can induce covalent bonds between tissue and biotin on the position of first

color. Anti-Ap5HTRA/B antibody was stripped out of the sections for 24 hours at RT

22

in stripping buffer (100 mM 2-mercaptoethanol, 50 mM glycine-HCl, pH2.2) in a

horizontal electric field (40 V). The sections were then incubated with anti-ApPTTH

(Table 1) overnight at 4oC. The slides were treated for 30 min with VECTASTAIN

ABC reagent. After rinsing (3×) with TBS-Tw, the slides were incubated with Alexa

Fluor 488-conjugated (green) goat anti-rabbit IgG for 60 min at RT. After rinsing (3×)

with TBS-Tw, the biotin signal was visualized with green fluorophore using a TSA

Labeling Kit #42. Finally, the slides were rinsed (3×) with TBS-Tw, mounted in Aqua

Ploymount and observed using a BX50F4 microscope (Olympus, Japan).

For double labeling (with antibodies derived from different animals), we used a

combination of anti-Ap5HTRA/B (Antibody 2) with anti-BmEH (Antibody 1) or with

anti-BmPTTH (Antibody 1), as follows. Drop cocktail of both primary antibodies

(Table 1) diluted in TBS-Tw containing 1% BSA was used to incubate the sections

overnight at 4oC. After rinsing (3×) with TBS-Tw, the slides were incubated with

horse anti-goat IgG (H+L)-biotin or goat anti-mouse IgG (H+L)-biotin (Vector

Laboratories, CA, US) for 1.5 hours. After rinsing (3×) with TBS-Tw, the slides were

incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG for 60 min at RT

(Invitrogen, Tokyo, Japan). After rinsing (3×) with TBS-Tw, the biotin signal was

visualized with red fluorophore using TSA Labeling Kit #42 with Alexa Fluor 555.

Finally, the slides were rinsed (3×) with TBS-Tw, mounted in Aqua Ploymount and

observed using a BX50F4 microscope (Olympus, Japan).

2.3.4 RNA extraction and cDNA synthesis

The BR-SOG of A. pernyi was dissected and immediately transferred to liquid

23

nitrogen and total RNA was isolated by using the RNAiso Plus reagent (Takara,

Kyoto, Japan). Five hundred nanograms of total RNA with primers using ReverTra

Ace kit (Toyobo Co. Ltd., Osaka, Japan) was used for synthesizing the cDNA.

2.3.5 Preparation and injection of dsRNA

PCR products of 539 bp for 5HTRA (accession number EU402612.1) and 345 bp

for 5HTRB (accession number EU402613.1) were prepared by gene-specific primers

(5HTRA-T7-F, 5HTRA-T7-R and 5HTRB-T7-F, 5HTRB-T7-R) (Table 4) in which the

T7 promoter was attached to the 5’ end of each primer. dsRNAs were synthesized

after incubation of the purified PCR product at 37oC for 4 hours with MEGAscript

RNAi kit (Ambion, CA, USA) according to the manufacturer’s instructions. The

control dsRNA was generated from the GFP gene of jellyfish (dsRNAGFP

) that should

have no effect on the target gene (Tschuch et al., 2008). The dsRNA and Metafectene

PRO (Biontex, Planegg, Germany) were mixed at a ratio of 1:1 (v:v) before injection.

One μg of dsRNA was injected into individual pupae.

2.3.6 qRT-PCR

The qRT-PCR was performed with the SYBR® Green and THUNDERBIRD

TM

qPCR Mix (Toyobo Co. Ltd., Osaka, Japan), with the forward and reverse primers

designed as mentioned in Table 4. Cycling parameters were 95oC for 1 min to activate

DNA polymerase, then 40 cycles of the following PCR amplification with primers

were performed using the following temperature program 95oC for 15 sec and 60

oC

24

for 1 min. To confirm the specificity of the PCR products, melting curves were

determined using the software ABI 7000 Sequence Detection System (Applied

Biosystems, Foster City, CA, USA). Amounts of amplified products were calculated

from cDNA standard curves generated for each PCR run. For expression levels of

each transcript, the rp49 (accession number DQ296005.1) mRNA was used as the

internal control. For each gene, the primers used in qRT-PCR (Table 4) were designed

to correspond to outside the region of knocking down by RNAi. The sizes of the PCR

products were 180 bp for 5HTRA and 174 bp for 5HTRB.

2.3.7 SDS-PAGE and Western blotting analysis

Pupal BR-SOGs of A. pernyi under LD 16:8 were collected 72 h after injection

of nuclease-free water (control), dsRNAGFP

and dsRNA5HTRB. The samples were

homogenized in 200 µl of sample buffer (25% 0.5 M Tris-HCl, pH 6.8, 2.3% SDS, 10%

glycerol, 5% 2-mercaptoethanol, 0.8 mg/ml bromophenol blue, 37% Millipore water)

using Branson Sonic Power (CT 06810). The homogenate was centrifuged (10,000 g,

5 min at 4oC) to eliminate the cuticle and cell debris, and from that the supernatant

was collected and denatured at 95oC for 10 min before storage at -20

oC until use.

Fifteen µl sample was loaded per lane on 10% SDS-polyacrylamide, and SeeBlue

Plus2 Pre-stained Standard marker 4-250 kDa (Invitrogen, USA) was used to estimate

the molecular marker. The proteins were transferred onto a PVDF membrane (GE

Healthcare Bio-Science Co., Piscataway, NJ, USA). The membrane was treated with

commercial blocking solution (Blocking One, Nacalai Tesque, Japan) for 30 min at

25

room temperature. The membrane was incubated with primary antibodies for

ApPTTH (1:10,000) and BmEH (1:20,000) overnight at 4oC, followed by the

corresponding HRP-conjugated secondary antibody for 1 h at room temperature. The

immunoreaction was visualized using an ECL system. The image analysis software of

Image J was used to determine the densities of specific bands.

Table 1. Data of primary antibodies used in this study

Antibody used Immunized

Animal Dilution Source

Ap5HTRA and B Rabbit 1:1000 M. Takeda, Kobe

University, Japan

BmEH Rat 1:2000 Purchased (Santa Cruz;

at-34973)

ApPTTH Rabbit 1:2000 Sauman and Reppert,

1996

BmPTTH Rat 1:1500 M. Takeda, Kobe

University, Japan

2.3.8 5HT and luzindole injection

Ten pmol 5HT in 5 µl of distilled water (D.W.) and 10 pmol luzindole (TocRis,

USA) in 5 µl of DMSO were injected using a Hamilton syringe (Hamilton Company,

USA) into the intersegmental membrane between the thorax and the abdomen for

each pupa. The control was injected with 5 µl of D.W. and 5 µl of DMSO into each

pupa under LD 16:8.

2.3.9 5,7-dihydroxytryptamine (5,7-DHT) injection

26

0.1, 1 and 10 pmol of 5,7-DHT (Sigma, USA) in 10 µl of D.W. were injected by

using a syringe into each pupa as mentioned above. The same volume of D.W. was

injected into each pupa as a control group.

2.3.10 Statistical analysis

The results are expressed as mean ± S.E.M. p＜0.05 was considered the level of

significant difference between means by one-way ANOVA (Fishers, LSD) and

Kaplan-Meier.

2.4 Results

2.4.1 mRNA level of 5HTRs

Since photoperiodism constitutes a long chain of reactions, we considered

whether the two types of 5HTR are the part of this chain reaction for photoperiodic

control. If so, which of the two? We tried to determine the proximity of these

receptors to photoperiodic mechanisms by quantifying the mRNA level of the two

receptors under different photoperiodic conditions. After diapause pupae were kept

under LD 16:8 for 0, 5 and 10 days, the relative levels of mRNAs of two 5HTRs were

examined. The level of 5HTRB mRNA after 10 days of incubation under LD 16:8 was

significantly lower than those after 0 and 5 days of incubation under LD 16:8.

However, the level of 5HTRA mRNA was almost constant among the treatments (Fig.

1). Only 5HTRB was affected by photoperiodic activation.

27

Fig. 1 Relative mRNA levels of 5HTR after long-day activation. Diapause pupae

were exposed to LD 16:8 for 0, 5 and 10 cycles at 25oC and mRNA level of 5HTRA

(gray bar) and 5HTRB (white bar) in the brain-SOG was determined by real time PCR.

The results are presented as the mean ± S.E.M. from three independent experiments.

Asterisks indicate significant difference from 0-day incubation by one-way ANOVA

(Fishers, LSD). p<0.05. [LSD provides multiple comparison, giving significance

between a series of paired test by alphabets].

28

2.4.2 Co-localization of PTTH-ir and EH-ir with 5HTR-ir in adult and pupal

BR-SOG of A. pernyi

Next, we localized these receptors immunohistochemically. Data on antibodies

against Ap5HTRs, Ap/BmPTTH and BmEH are listed in Table S1. The antibodies

recognized several immunoreactive neurons in the brain of less than one day-old adult

and early pupa of A. pernyi. Tables 1 and 2 summarize the loci and numbers of those

neurons.

Table 2. The number of immunopositive cells in both hemispheres in the cephalic

ganglia of female adult A. pernyi and intensity of their immunostaining

Antigen

targeted

Locus

DL PI DC SOG

Ap5HTRA 4++++ - - -

Ap5HTRB 4+++ - - 2+++

ApPTTH 4++++ - - -

BmPTTH 4++++ - - -

BmEH - - 4++++ 2++++

PI: pars intercerebralis; DL: dorsolateral region of the protocerebrum; DC:

deutocerebrum; SOG: subesophageal ganglion. Immunoreactivity was quantified as

strong (++++), considerable (+++), moderate (++), weak (+), and negative (-).

29

Table 3. The number of immunopositive cells in both hemispheres in the cephalic

ganglia of 5 days after the exposure to LD 16:8 of A. pernyi and intensity of their

immunostaining.

Antigen

targeted

DL PI DC SOG

Ap5HTRA 4++++ - - -

Ap5HTRB 4++ - 2+ -

ApPTTH 4++++ - - -

BmPTTH 4++++ - - -

BmEH - 2++ 2++++ -

PI: pars intercerebralis; DL: dorsolateral region of the protocerebrum; De:

deutocerebrum; SOG: subesophageal ganglion. Immunoreactivity was quantified as

strong (++++), considerable (+++), moderate (++), weak (+), and negative (-).

30

A pair of large neurosecretory (ns) cells showed ApPTTH-ir in the dorsolateral

(DL) region of protocerebrum of each hemisphere of adult brain (Fig. 2B) less than

one day after emergence and also in the BR-SOG of pupa 5 days after incubation

under LD 16:8 (Fig. 3B). Ap5HTRA-ir was observed in the same cell bodies as

ApPTTH-ir in the BR-SOG of adult and early pupa (Fig. 2C; Fig. 3C).

Ap5HTRB-ir was also found in the DL of new adult and early pupa, as well as

PTTH-ir cells. One pair of neurons were found in SOG of adult (Fig. 4I) and in

deutocerebrum (DC) of early pupa (Fig. 5J). BmPTTH-ir/ApPTTH-ir and

Ap5HTRA-ir/5HTRB-ir were co-localized in the DL of adult and pupa (Fig. 2D-F,

2G-I; Fig. 3D-F, 3G-I; Fig. 4C-E, 4F-H; Fig. 5D-F, 5G-I).

Two pairs of large ns cells showed BmEH-ir in the DC of adult (Fig. 4B) and one

pair did in the pars intercerebralis (PI) of pupal brain 5 days after incubation under

LD 16:8 (Fig. 5B), and a single cell did in DC per hemisphere (Fig. 5C). This DC cell

showed 5HTRB-ir. 5HTRB-ir and EH-ir were co-localized in the SOG of adult and in

the DC of 5-day-old pupa (Fig. 4I-K; Fig. 5J-L), but 5HTRA-ir was not co-localized

with EH-ir in the brain of adult and pupa.

31

Fig. 2 Colocalization of 5HTRA- and PTTH-ir in the adult brain-SOG of A.

pernyi. BmPTTH-ir/ApPTTH-ir was co-localized with Ap5HTRA-ir in the female

adult brain-SOG. (A) The topography of detected cells. Lower-case letters indicate

regions shown in the photographs (e.g., b is the site of B). (B) Two large PTTH-ir

neurons in the DL region. (C, D, H) Two large 5HTRA-ir neurons in the DL region. (E)

BmPTTH in the DL region. (F) Merged image of BmPTTH- and 5HTRA-ir in the DL

region. (G) ApPTTH-ir in the DL region. (I) Merged image of ApPTTH and 5HTRA in

the DL region. Scale bar = 100 µm.

32

Fig. 3 Colocalization of 5HTRA- and PTTH-ir in the early pupal brain-SOG of A.

pernyi. BmPTTH-ir/ApPTTH-ir was co-localized with Ap5HTRA-ir in the brain-SOG

of 5-day-old pupa under LD 16:8. (A) The topography of detected cells. Lower-case

letters indicate regions shown in the photographs (e.g., b is the site of B). (B) Two

large PTTH-ir neurons in the DL region. (C, D, H) Two large 5HTRA-ir neurons in

the DL region. (E) BmPTTH-ir in the DL region. (F) Merged image of BmPTTH- and

5HTRA-ir in the DL region. (G) ApPTTH-ir in the DL region. (I) Merged image of

ApPTTH-ir and 5HTRA-ir in the DL region. Scale bar = 100 µm.

33

34

Fig. 4 Colocalization of 5HTRB- and PTTH-ir in the adult brain-SOG of A.

pernyi. BmPTTH-ir/ApPTTH-ir in the DL region of protocerebrum of female adult

was co-localized with Ap5HTRB-ir (●). EH-ir in the adult brain of A. pernyi and its

colocalization with Ap5HTRB-ir (●) and unique distribution (○) of EH-ir in other

regions of the brain. (A) The topography of detected cells. Lower-case letters indicate

regions shown in the photographs (e.g., b is the site of B). (B) Two pairs BmEH-ir

cells in the DC region. (C, G) 5HTRB-ir in the DL region. (D) BmPTTH-ir in the DL

region. (E) Merged image of BmPTTH-ir and 5HTRB-ir in the DL region. (F)

ApPTTH-ir in the DL region. (H) Merged image of ApPTTH-ir and 5HTRB-ir in the

DL region. (I) A 5HTRB-ir cell in the SOG. (J) One BmEH-ir cell in the SOG. (K)

Merged image of BmEH-ir and 5HTRB-ir in the SOG region. Scale bar = 100 µm.

35

36

Fig. 5 Colocalization of 5HTRB- and PTTH-ir in the erly pupal brain-SOG of A.

pernyi. BmPTTH-ir/ApPTTH-ir in the 5-day-old pupal brain of A. pernyi under LD

16:8 and its colocalization with Ap5HTRB-ir (●). BmEH-ir in the 5-day-old pupa brain

and its colocalization with Ap5HTRB-ir (●) and unique distribution (○) of BmEH-ir in

other regions of the brain. (A) The topography of detected cells. Lower-case letters

indicate regions shown in the photographs (e.g., b is the site of B). (B) One BmEH-ir

neuron in the PI. (C) BmEH-ir in the DC region. (D, H) 5HTRB-ir in the DL region.

(E) BmPTTH-ir in the DL region. (F) Merged image of BmPTTH-ir and 5HTRB-ir in

the DL region. (G) ApPTTH-ir in the DL region. (I) Merged image of ApPTTH-ir and

5HTRB-ir in the DL region. (J) 5HTRB-ir in the DC region. (K) One EH-ir neuron in

the DC. (L) Merged image of BmEH-ir and 5HTRB-ir in the DC region. Scale bar =

100 µm.

37

2.4.3 Effects of RNAi against 5HTRA and 5HTRB on diapause

To identify the function of the two serotonin receptors, diapause pupae were

injected with dsRNAGFP

, dsRNA5HTRA and dsRNA

5HTRB and then kept under LD 16:8

or LD 12:12 at 25oC. The levels of 5HTRA and 5HTRB mRNAs were significantly

lower after 72 hours of injection of dsRNA5HTRA and dsRNA

5HTRB (Fig. 6A, 7A),

while the injection of dsRNA5HTRA or dsRNA

5HTRB did not alter the level of 5HTRB

mRNA and 5HTRA mRNA, respectively (Fig. 6B, 7B). The injection of dsRNAGFP

had no effect on the transcription level of both receptor genes. Therefore, it was

concluded that RNAi acted specifically. The adult emergence from pupae injected

with dsRNA5HTRA was the same as that of the control groups, that is, uninjected and

dsRNAGFP

-injected under LD 16:8 and LD 12:12 (Fig. 6C, D). However, adults

emerged from pupae that were injected with dsRNA5HTRB earlier than the control

groups under LD 16:8 (Fig. 7C, D), and the injection of dsRNA5HTRB terminated pupal

diapause even under LD 12:12 (Fig. 7E, F).

Seventy-two hours after dsRNA5HTRA

or dsRNA5HTRB injections, PTTH- and

EH-ir bands detected on western blots were examined. No change was detected in the

samples treated with dsRNA5HTRA from uninjected and dsRNA

GFP-injected controls

(Fig. 6E, F), while a significant increase was observed in the dsRNA5HTRB-treated

group (Fig. 7G, H). A single band around 30 kDa was detected in western blotting

with ApPTTH antibody, which had a molecular mass close to that of the predicted

size of PTTH of A. pernyi (GenBank: AAB05259.1, 221aa=24.56 kDa). A single

band around 9.7 kDa detected with BmEH antibody was close to the estimated values

38

of the EH of M. sexta (GenBank: AAA29311.1, 88aa=9.67 kDa) and B. mori

(GenBank: AAA29310.1, 88aa=9.67 kDa). dsRNA5HTRB intensified these bands by

more than 300% (Fig. 7G, H). This result suggests that 5HTRB suppresses not only

the release but also the synthesis of PTTH and EH.

2.4.4 5HT Pharmacology on diapause determination

We have shown that insect aaNAT is involved in the circadian regulation of

photoperiodic termination of regulation of pupal diapause in A. pernyi (under

submission). A melatonin receptor antagonist, luzindole, inhibited the release of

PTTH in cockroach (Adachi-Yamada et al., 1994). First, we did single injections of

5HT and luzindole. After injection, the time of emergence was delayed in both groups

(data unpublished). Since NAT metabolizes 5HT to melatonin via N-acetylserotonin

and the two terminal amines have opposite physiological functions, we made a double

injection of 5HT and luzindole. Effect of 5HT should thereby most properly evaluated,

since we cannot control NAT activity. When NAT activity is high, the injected 5HT

should be converted promptly to melatonin that should antagonist 5HT effect. We

showed that the co-injection of 5 pmoles 5HT and luzindole delayed diapause

termination under LD 16:8 (Fig. 8A). This suggests a dual mechanism of diapause.

5HT maintains diapause while melatonin terminates it. This notion is further

supported by the injection of 10 pmoles 5,7-DHT into diapause pupae, which induced

emergence in a dose-dependent manner under LD 12:12 (Fig. 8B).

39

Table 4. A list of primers used in the experiments. Underlined sequences are the T7

promoter and the highlighted sequences are the original primers.

Name Sequence of the primers

5HTRA-T7-F TAATACGACTCACTATAGGGAGAAATACCTCCCGACTGTGTAAATATG

5HTRA-T7-R TAATACGACTCACTATAGGGAGACGTAATGTCACTTAAACAACAGGTG

5HTRA-F GATAGTTGACGGTAAAATCGTCGT

5HTRA-R AGCAGTTCCCGTCGTACCAG

5HTRB-T7-F TAATACGACTCACTATAGGGAGAATCAGAGGATCTAAGATGTGTCGTC

5HTRB-T7-R TAATACGACTCACTATAGGGAGACTAGATTGTTTTTCCGGGCTAGTAT

5HTRB-F TATGGCTAGGTTACTTCAACTCCAC

5HTRB-R GTTTCAAACTAGACGAGGTCAGTCA

GFP-T7-F TAATACGACTCACTATAGGGAGACCTGAAGTTCATCTGCACCAC

GFP-T7-R TAATACGACTCACTATAGGGAGAACGAACTCCAGCAGGACCAT

RP49-F AAGACCCGTCACATGCTACC

RP49-R GCGTTCGACGATTAACTTCC

40

41

Fig. 6 RNAi against 5HTRA and the effect on photoperiodism. (A) Relative

mRNA level of 5HTRA in the brain-SOG of intact diapauses pupae (control) and

those in pupae injected either with dsRNAGFP

or dsRNA5HTRA

were measured by

q-PCR. The level of 5HTRA mRNA was measured by qPCR with total RNA extracted

from brains collected at 0, 24, 48 and 72 h under LD 16:8 at 25oC. (B) Relative

mRNA level of 5HTRB in the brain-SOG of the control pupae and those of pupae

injected either with dsRNAGFP

or dsRNA5HTRA under LD 16:8 at 25

oC. (C) Adult

emergence from the control, dsRNAGFP

- or dsRNA5HTRA-injected diapause pupae

under LD 16:8 at 25oC. (D) Adult emergence after injection of dsRNA to diapauses

pupae targeting either at GFP or 5HTRA under LD 12:12 at 25oC. Emergence was

analyzed up to 40 days after injection. (E) Diapause pupae were injected with

dsRNAGFP

and dsRNA5HTRA

or nuclease-free water as a control and 72 hours later the

brain-SOG was dissected. ApPTTH and BmEH were loaded and SDS-PAGE was run.

The gel was subjected to western blot analysis. Equal amounts of protein from each

group were loaded on each lane. A single band of around 30 kDa was detected with

ApPTTH antibody and a single band of around 9.7 kDa with BmEH antibody. (F) The

density of each band was quantified and the value in the control was set to 100%. The

filled columns, PTTH and open columns, EH. Cont., water was injection. G,

dsRNAGFP

was injected. A, dsRNA5HTRA was injected and pupae were kept under LD

12:12 at 25oC. The results are presented as the mean ± S.E.M. from three independent

experiments and the differences were not significant from control by one-way

ANOVA (Fishers, LSD).

42

43

Fig. 7 RNAi against 5HTRB and the effect on photoperiodism. (A) Relative

mRNA level of 5HTRB in the brain-SOG of diapause pupae (control) and in pupae

injected either with dsRNAGFP

or dsRNA5HTRB. The level of 5HTRB mRNA was

measured by q-PCR with total RNA extracted from brain-SOG 0, 24, 48 and 72 h

after injection. (B) Relative mRNA level of 5HTRA in the brain-SOG of diapause

pupae (control) and pupae injected either with dsRNAGFP

or dsRNA5HTRB. (C) Adult

emergence from the control, dsRNAGFP

- and dsRNB5HTRB-injected diapauses pupae

under LD 16:8 at 25oC. (D) Adult emergence from the control, dsRNA

GFP- and

dsRNA5HTRB-injected pupae at 25

oC under LD 16:8. Emergence was analyzed up to

40 days after injection. (E) Diapause pupae were injected with dsRNAGFP

and

dsRNA5HTRB and adult emergence was recorded at 25

oC under LD 12:12. (F)

Cumulatively 70% adults emerged in 40 days after injection. (G) The expression of

ApPTTH and BmEH was examined using western blot analysis 72 hours after dsRNA

injection against GFP and 5HTRB, or nuclease-free water as a control. ApPTTH and

BmEH were loaded and SDS-PAGE was run. The gel was subjected to western blot

analysis. Equal amounts of protein from each group were loaded on each lane. A

single band of around 30 kDa was detected with ApPTTH antibody and a single band

of around 9.7 kDa with BmEH antibody. (H) The densitometry of each band as the

control was set to 100% after dsRNA5HTRB injection. The filled columns, PTTH and

open columns, EH. Cont., water injection. G, dsRNAGFP

injection. B, dsRNA5HTRB

injection. The results are presented as the mean ± S.E.M. from three independent

experiments. Asterisks indicate significant difference from control by one-way

44

ANOVA (Fishers, LSD). ** p＜0.01.

45

Fig. 8 Pharmacological confirmation of RNAi effect targeting at 5HTRB. Effect of

injections of 5HT, 5,7-DHT and luzindole on photoperiodism. (A) Diapause pupae

were injected either with 5 µl water and 5 µl DMSO (Mock injection) or 10 pmol

Luzindole plus 10 pmol 5HT in the same volume of solvent and thereafter placed

under LD: 16:8 at 25oC. Cumulatively 5% adults emerged in 40 days. Cont., untreated.

M, injection with distilled water and DMSO. Luzindole +5HT, luzindole and 5HT

co-injected. (B) Diapause pupae were injected with 5,7-DHT at three doses and

thereafter the pupae were kept under LD 12:12 at 25oC. Cont., untreated. M, mock

injection with 10 µl distilled water. 5,7-DHT, injected with 5,7-DHT dissolved in the

same volume as in the mock. 5%, 30% and 100% adults emerged in 40 days.

Asterisks indicate significant difference from control by Kaplan-Meier. ** p＜0.01.

46

2.4 Discussion

This study focused on the roles of 5HTRs in photoperiodism that regulates pupal

diapause in A. pernyi. 5HTRs have been investigated in many insects, including

Drosophila melanogaster (Nichols, 2006), Apis mellifera (Thamm et al., 2010), two

crickets (Dianemobius. nigrofasciatus and Allonemobius. allardi) (Shao et al., 2010)

and M. sexta (Dacks et al., 2006). We have cloned cDNAs encoding two 5HTRs in A.

pernyi (Hiragaki et al., 2008). We then examined the distributions of 5HTR-ir in the

BR-SOG of A. pernyi. The two receptors have both shared and unique distributions:

5HTRA-ir and 5HTRB-ir were shared in the PTTH-ir neurosecretory cells but only

5HTRB was colocalized with EH-ir, which was therefore unique.

A. pernyi overwinters in pupal diapause under short-day conditions, while it

produces another generation under long-day conditions. This developmental switch is

controlled by the release or inhibition of release of PTTH. Once diapause is initiated,

it is terminated by ten cycles of long days or low temperature for several months

(Takeda et al., 1997).

PTTH-ir has been immunohistochemically investigated in some insects,

including B. mori (Mizoguchi et al., 1990), A. pernyi (Sauman and Reppert, 1996), M.

sexta (Sedlak, 1981) and P. americana (Hiragaki et al., 2009). 5HT also stimulated

PTTH release in vitro also in a BR-SOG culture co-incubated with prothoracic gland

in B. mori (Shirai et al., 1994), but 5HTR subtypes have not been characterized in this

species. Since 5HT is metabolized to melatonin, which of the indoleamines stimulates

PTTH release cannot be determined. Richer et al. (2000) have demonstrated that, in P.

47

americana, melatonin stimulates PTTH release in vitro, whereas 5HT inhibits this

release. Luzindole inhibited PTTH release (Richter et al., 2000), with a wide use of

inhibitors of these receptors.

We here demonstrated that BmPTTH-ir/ApPTTH-ir was co-localized with

5HTR-ir ns cells at DL of both adult and early pupa of A. pernyi. Two types of

Ap5HTR-ir have also been investigated in two ground crickets, D. nigrofasciatus and

A. allardi, where 5HTRA-ir was located in PI, DL, optic tract, optic lobe and midline

of SOG, whereas 5HTRB-ir was located in the PI, DL and weakly in optic lobe,

tritocerebrum and midline of SOG in both crickets. In A. allardi, both receptors may

be involved in circadian photo-entrainment or photoperiodism because they were

co-localized with CLK-ir; in D. nigrofasciatus, only 5HTRB was co-localized with

CLK-ir. Therefore, it may be involved in circadian photo-entrainment or

photoperiodism (Shao et al., 2010). In D. melanogaster, Dm5HTR1B is expressed in

clock neurons, and changed the molecular and behavioral responses of the clock to

light (Yuan et al., 2005). This effect of 5HT is mediated via Dm5HTR1B, but not

Dm5HTR1A. These results showed that Dm5HTR1A and Dm5HTR1B play different

roles (Yuan et al., 2006). Dm5HTR1A was modulated in the larval response to light

(Rodriguez et al., 2009). Dm5HTR1A also regulates sleep, learning and memory

(Yuan et al., 2006). In our results, the function of Ap5HTRA remains unresolved in

relation to the photoperiodic regulation of diapause, but the possibility remains that it

regulates PTTH release via routes other than the photoperiodic pathway. It may be

involved in the inhibition of activation by temperature. Am5HT1A was shown to be

48

involved in the regulation of honeybee phototactic behavior (Thamm et al., 2010). It

also affects olfactory learning in the honeybee (Blenau and Thamm, 2011). 5HTRA

may be involved in the regulation of PTTH release, but not via the photic route,

because the mRNA level did not react to long-day activation. Another possibility is

that it regulates bilateral coupling with contralateral PTTH ns cells, since PTTH-ir

fibers can be traced to the contralateral ns cells.

These data strongly suggest that melatonin and a related indolamine play a key

role in the release of PTTH (Richter et al., 2000). Then, the next question to ask

should be about what locks up the release of PTTH to initiate/maintain diapause. The

answer is 5HT/5HTRB binding. The expression of 5HTRB showing circadian

fluctuation in mRNA (Hiragaki et al., 2008) is photoperiodically controlled and the

injection of dsRNA5HTRB accelerated diapause termination under LD 12:12. This

notion was supported pharmacologically. After the melatonin receptor was shut down,

5HT injection inhibited diapause termination even under LD 16:8. The injection of

5HTR antagonist, 5,7-DHT, terminated diapause in a dose-dependent manner under

LD 12:12.

Fig. 9 is a projected over-all view of dual regulation mechanism of pupal

diapause in A. pernyi. Photoperiodic/circadian gear affects aaNAT via circadian

transcription factors, CYC and CLK (photic route). If 5HT is overproduced, diapause

is initiated and maintained via 5HTRB. If melatonin is overproduced, it activates MT

that stimulates PTTH release. A balance between the two indoleamines is regulated at

NAT. Non-photic environmental condition such as low temperature may inactivate

49

5HTRA.

At the end of molting, EH release responds to both circadian gate and 20E

decline (Roy et al., 2012). EH-ir has been investigated in some insects, including

Siphlonurus armatus (Zavodska et al., 2003), M. sexta (Hewes and Truman, 1991)

and B. mori (Uno et al., 2013). 5HTRB is not only involved in PTTH release but also

in EH release/synthesis. We have demonstrated co-localization of EH-ir and

5HTRB-ir. The injection of dsRNA5HTRB increased the EH synthesis/accumulation.

Therefore, it is likely that 5HTRB is involved in EH synthesis, if EH release is not

leaky but gated.

We have demonstrated that insect aaNAT constitutes a connecting gear between

circadian oscillation and the endocrine switch mechanism because 1) circadian

neurons showing PER-, CLK-, CYC- and DBT-ir juxtapose to PTTH-ir cells and

these cells also showed aaNAT, hydroxyindol O-methytransferase (HIOMT)-, 5HT-

and melatonin-ir (under submission); 2) aaNAT enzymatic activity, its mRNA and

melatonin content all showed circadian change and aaNAT activity rises after

long-day and low-temperature exposure (under submission); 3) the promoter sequence

of aaNAT had E-boxes and the injection of both CYC and CLK suppressed NAT

transcription most convincingly (under submission); 4) injection of dsRNAPER

up-regulated aaNAT and melatonin synthesis, transcription inducing early diapause

termination, and 5) the injection of aaNAT abolished photoperiodism (under

submission).

The role of 5HTRB in the diapause induction/maintenance mechanism in the

50

brain of A. pernyi is to lock the gate for PTTH release, because dsRNA5HTRB opened

the gate. Photoperiods therefore affect two ways 1) by changing relative abundance of

5HT and melatonin via circadian regulation of aaNAT and 2) by changing 5HTRB

expression via circadian system, since 5HTRB showed a day/night fluctuation and

responded to long-day activation. We still do not know photoperiodic/circadian

influence over MT. This is our next task. Since 5,7-DHT treatment induced early

emergence under LD 12:12, diapause is not only regulated by the release of PTTH but

the main mechanism to induce/maintain diapause is 5HTRB mechanism. This drug

poisons both 5HT and melatonin. If melatonin is the only regulator of PTTH release,

the injection would not induce early emergence under LD 12:12.

51

52

Fig. 9 Schematic illustration of 5HTRs role of diapause induction/maintenance in

pupal diapause of A. pernyi. The moth has two 5HTR subtypes, 5HTRA and

5HTRB.The former subtype shows no transcription rhythm and did not respond to

photoperiodic activation by long day, while the latter showed rhythmic expression and

responded to photoperiodic activation. Therefore, it is regulated by circadian system.

At the same time, the ligand metabolism is under circadian control via one type of

arylalkylamine N-acetyltransferase, aaNAT. This nat is a circadian-controlled gene

(ccg) since dsRNACYC

, and dsRNACLK

suppressed nat transcription and dsRNANAT

dysfunction photoperiodism. The other subtype was non-rhythmic and

non-photoperiodic. MT-binding closes the endocrine switch to PTTH release that

terminates diapauses, while 5HTRB opens the switch to enforce diapauses or initiate it.

Therefore diapause of A.penyi is under binary regulation and circadian system

regulates at least two points in this system, nat transcription and 5HTRB expression.

PER, Period protein, a negative regulator of transcription. CYC/CLK, heterodimeric

circadian transcription regulator. Mel, melatonin. MT, melatonin receptor. LD, long

day. SD, short day. PTTH, prothoracicotropic hormone. PTG, prothoracic gland. E,

ecdysone. 20E, 20 hydroxyecdysone.

53

2.6 References

Adachi-Yamada T, Iwami M, Kataoka H, Suzuki A, Ishizaki H (1994) Structure and

expression of the gene for the prothoracicotropic hormone of the silkmoth Bombyx

mori. Europ J Biochem 220: 633-643

Beck SD (1974) Photoperiodic determination of insect development and diapause. II.

The determination gate in a theoretical model. J Comp Physiol 90: 297-310

Bembenek J (2004) Structure and regulatory mechanisms of circadian and

photoperiodic clocks in insects with special references to indoleamine metabolic

pathway. D. Sc. Thesis, Kobe university, pp10

Blenau W, Thamm M (2011) Distribution of serotonin (5-HT) and its receptors in the

insect brain with focus on the mushroom bodies. Lessons from Drosophila

melanogaster and Apis mellifera. Arthropod Struct Dev 40: 381-394

Dacks AM, Dacks JB, Christensen TA (2006) The cloning of one putative octopamine

receptor and two putative serotonin receptors fromthe tobacco hawkmoth, Manduca

sexta. Insect Biochem Molec Biol 36: 741–747

Danks HV (2003) Studying insect photoperiodism and rhythmicity: components,

approaches and lessons. Eur J Entomol 100: 209-221

Danilevskii AS (1965) Photoperiodism and seasonal development of insects, (Oliver

and Boyd, Edinburgh)

54

Hewes RS, Truman JW (1991) The roles of central and peripheral eclosion hormone

release in the control of ecdysis behavior in Manduca sexta. J Comp Physio A 168:

697-707

Hiragaki S, Kawabe Y, Takeda M (2008) Molecular cloning and expression analysis

of two putative serotonin receptors in the brain of Antheraea pernyi pupa.

International Journal of Wild Silkmoths and Silk 13: 1-14

Hiragaki S, Uno T, Takeda M (2009) Putative regulatory mechanism of

prothoracicotropic hormone (PTTH) secretion in the American cockroach,

Periplaneta americana as inferred from co-localization of Rab8, PTTH, and protein

kinase C in neurosecretory cells. Cell Tiss Res 335: 607-615

Ichihara N (2000) Molecular biological study on the neuroendocrine mechanisms of

circadian and photoperiodic clocks in insects. Doctoral dissertation, Kobe

University. pp. 166

Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiat 44:

151-162

Matsumoto M, and Takeda M (2002) Changes in brain monoamine contents in

diapause pupae of Antheraea pernyi when activated under long-day and by

chilling. J Insect Physiol 48(8): 765-771

Mizoguchi A, Oka T, Kataoka H, Ngasawa H, Suzuki A, Ishizaki H (1990)

55

Immunohistochemical localization of prothoracicotropic hormone-producing

neurosecretory cells in the brain of Bombyx mori. Dev Growth & Differ 32:

591-598

Nassel DR, Cantera R (1986) Mapping of serotonin-immuno reactive neurons in the

larval nervous system of the flies Calliphora erythrocephala and Sarcophaga bullata.

A comparison with ventral ganglia in adult animals. Cell and Tissue Research 239:

423-434

Nichols R (2006) FMRFamide-related peptides and serotonin regulate Drosophila

melanogaster heart rate: mechanisms and structure requirements. Peptides 27:

1130–1137

Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW, Grewal

JS, Garnovskaya MN (2001) Multiplicity of mechanisms of serotonin receptor

signal transduction. Pharmacol Therap 92: 179-212

Richter K, Peschke E, Peschke D (2000) A neuroendocrine releasing effect of

melatonin in the brain of an insect, Periplaneta americana (L.) J. Pineal Res. 28:

129-135

Richter K, Peschke E, Peschke D (1999) Effect of melatonin on the release of

prothoracicotropic hormone from the brain of Periplaneta americana (Blattodea:

Blattidae). Eur J Entomol 96: 341-345

56

Rodriguez Moncalvo VG, Campos AR (2009) Role of serotonergic neurons in the

Drosophila larval response to light. BMC Neurosci 10: 66

Roy A, Shimizu S, Kiya T, Mita K, Iwami M (2012) Identification of

20-hydroxyecdysone-inducible genes from larval brain of the silkworm, Bombyx

mori, and their expression analysis. Zoolog Sci 29(5): 333-339

Saunders DS (2005) Erwin Bunning and Tony Lees, two giants of chronobiology, and

the problem of time measurement in insect photoperiodism. J Insect Physiol 51(6):

599-608

Sauman I, Reppert SM (1996) Molecular characterization of prothoracicotropic

hormone (PTTH) from the giant silkmoth Antheraea pernyi: developmental

appearance of PTTH-expressing cells and relationship to circadian clock cells in

central brain. Dev Biol 178: 418-429

Sedlak BJ (1981) An ultrastructural study of neurosecretory fibers within the corpora

allata of Manduca sexta. Gen Comparat Endocrinol 44: 207-218

Sehadova H, Markova EP, Sehnal F, Takeda M (2004) Distribution of circadian

clock-related proteins in the cephalic nervous system of the silkworm, Bombyx

mori. J Biol Rhythms 19(6): 466-82

Shao QM, Fouda MMA, Takeda M (2010) Serotonin and two putative serotonin

receptors-like immunohistochemical reactivities in the ground crickets

57

Dianemobius nigrofasciatus and Allonemobius allardi. J Insect Physiol 56:

1576-1586

Shirai Y, Shimazaki K, Iwasaki T, Matsubara F, Aizono Y (1995) The in vitro release

of prothoracicotropichormone (PTTH) from the brain-corpus cardiacum-corpus

allatum complex of silkworm, Bombyx mori. Comp Biochem Physiol C 110:

143-148

Shirai Y, Iwasaki T, Matsubara F, Aizono Y (1994) The carbachol-induced release of

prothoracicotropic hormone from brain-corpus cardiacum-corpus allatum complex

of the silkworm, Bombyx mori. J Insect Physiol 40: 469-473

Shionoya M, Matsubayashi H, Asahina M, Kuniyoshi H, Nagata S, Riddiford LM

(2003) Molecular cloning of the prothoracicotropic hormone from the tobacco

hornworm, Manduca, sexta. Insect Biochem Molec Biol 33: 795-801

Takeda M, Hiragaki S, Bembenek J, Tsugehara T, Tohno Y, Matsumoto M, Ichihara

N (2011) Photoperiodic system for pupal diapause in Antheraea pernyi: clock,

counter, endocrine switch and roles of indolamine pathways. Int. J. Wild Silkmoth

& Silk 16: 97-109

Takeda M, Matsumoto M, Tohno Y (1997) Diapause intensity and ecdysiotroph:

comparisons between two Antheraea species (Lepidoptera: Saturniidae) having

summer and winter diapause at pupae. Eur J Entomol 94: 67-73

58

Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of

the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin

in phototactic behavior. Cell Mol Life Sci 67: 2467-2479

Tschuch, C., Schulz, A., Pscherer, A., Werft, W., Benner, A., Hotz-Wagenblatt, A.,

Barrionuevo, L.S., Lichter, L., Mertens, D. (2008). Off-target effects of siRNA

specific for GFP. BMC. Mol. Biol. 9, 60.

Truman JW (1971) The role of the brain in the ecdysis rhythm of silkmoths:

comparison with the photoperiodic termination of diapause. In Biochronometry, M.

Menaker, ed. (Washington: National Academy of Sciences press). pp. 483-504

Tomioka K, Ideka M, Nagao T, Tamotsu S (1993) Involvement of serotonin in the

circadian rhythm of an insect visual system. Naturwissenschaften. 80: 137-139

Uno T, Sakamoto K, Isoyama Y, Hiragaki S, Uno Y, Kanamaru K, Yamagata H,

Takagi T, Mizoguchi A, Takeda M (2013) Relationship between the expression of

Rab family GTPases and neuropeptide hormones in the brain of Bombyx mori.

Histochem. Cell Biol 139: 299–308

Veerman A, Vaznunes M (1980) Circadian rhythmicity participates in the

photoperiodic determination of diapause in spider mites. Nature 287: 140-141

von Nickisch-Rosenegk E, Krieger J, Kubick S, Laage R, Strobel J, Strotmann J, Beer

H (1996) Cloning of biogenic amine receptors from moths (Bombyxi mori and

59

Heliothis virescens). Insect Biochem Molec Biol 26: 817-827.

Williams CM, Adkisson PL (1964a) Photoperiodic control of pupal diapause in the

silkworm, Antheraea pernyi. Science 144: 569

Williams CM, Adkisson PL (1964b) Physiology of insect diapause. XIV. An

endocrine mechanism for the photoperiodic control of pupal diapause in the oak

silkworm, Antheraea pernyi. Biol Bull 127: 511-525

Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment

in Drosophila. Neuron 47: 115-127

Yuan Q, Joiner WJ, Sehgal A (2006) A sleep-promoting role for the Drosophila

serotonin receptor 1A. Curr Biol 16: 1051-1062

Zavodska R, Sauman I, Sehnal F (2003) Distribution of PER protein,

pigment-dispersing hormone, prothoracicotropic hormone, and eclosion hormone in

the cephalic nervous system of insects. J Biol Rhythms 18: 106-122

60

Chapter 3: Serotonin receptor 2a regulates royalactin production in the

honeybee, Apis mellifera

3.1 Abstract

The proportion of royal jelly (RJ) to honey-pollen mixture determines the fate of

females for two reproductive castes: the queen and worker. A 57-kDa protein

(designated as royalactin, RA), a main RJ protein component, induces queen

production. It increases adult body size and induces ovarian development and

shortened developmental time in honey bees. However, it is not known what regulates

royalactin production in worker bees and how abundant the RJ production is when the

workers reach the age of 20 days. We examined the hypothesis that indolamine

metabolism may regulate this shift. A genome database showed four types of 5HTR in

Apis mellifera. qPCR results showed that only Am5HTR2a mRNA level fluctuated in

parallel with RA mRNA fluctuation, but that other Am5HTRs (5HTR1, 5HTR2b and

5HTR7) did not change, not only in the brain but also in the hypopharyngeal gland

(HG). This means that Am5HTR2a is also present in the HG. The injection of

dsRNA5HTR2a reduced mRNA

RA in the brain, indicating that Am5HTR2a is essential for

RA synthesis. This conclusion was supported by the findings upon injection of

5,7-DHT. After the injection of melatonin and 5,7-DHT, the level of RA was also

pharmacologically reduced, but after the injection of 5HT, it was increased.

Keywords: royal jelly, royalactin, serotonin receptor (5HTR), serotonin (5HT)

61

3.2 Introduction

The honey bee was the first animal to be domesticated, enriching human life by

its products. It has also enriched plant diversity via its role as a pollinator. (Michener,

2000). It is a highly social animal with an elaborate communication system among

hive mates, dance language, for precise sun-oriented navigation and memory aided by

the circadian system, namely Zeitgedachtnis. It has a unique sex determination system,

haplodiploidy. Haploids become males and diploids females (Naito and Suzuki, 1991).

Females further undergo caste differentiation either to a queen or to non-reproducing

workers. This caste differentiation is determined by the composition of the diet that

young workers prepare for nursing the young. When the larvae are fed a diet with

high royal jelly (RJ) content, they are destined to become queens, but when they are

fed a low-RJ-content diet, they become workers (Tublitz et al., 1991; Nassel, 1993).

An inhibitor of DNMT2 blocks worker production. Therefore, an epigenetic

mechanism makes workers. The major RJ protein (MRJP) is called royalactin (RA).

RJ is secreted by the hypopharyngeal gland (HG) of nurse bees at an age of 3 through

20 days (Knecht and Kaatz, 1990; Albert et al., 1999; Kamakura, 2011). However, the

RA production is turned off when the nurse reaches the age of 20 days, after which

these workers become foragers. Behavioral repertoires gradually change with age: cell

cleaning, capping brood, queen tending, comb building, RJ production, pollen

processing, hive cleaning, honey processing, guarding and foraging, in this sequence.

This is called age polyethism or division of labor (Roesch, 1952; Lindauer, 1952;

Ribbands, 1952; Sakagami, 1953; Sekiguchi and Sakagami, 1966; Seeley, 1982;

62

Winston and Punnett, 1982). Conventionally, this was considered to be under JH

control, but recently Gene Robinson’s group showed that CA removal in the early

stage did not change this pattern (Fahrbach, 2003), which refuted the JH control

hypothesis. We focus on the mechanism that controls RJ production since foragers

never produce RJ and the nurse/forager transition is most clearly and quantitatively

recognized to be associated with this production.

RA is a monomeric protein that reduces developmental time and increases the

weight of an adult and ovary size (Kamakura, 2011). It exhibits epidermal growth

factor (EGF)-like effects on rat hepatocytes (Kamakura et al., 2001; Kamakura, 2002).

Royalactin and recombinant royalactin (E-royalactin; 47 kDa) were shown to increase

the juvenile hormone titer that commits the fourth larval instar to develop into a queen

(Wirta and Beetsma, 1972). This notion was supported by the finding that, in

Drosophila, RA increased the body size, cell size and fecundity, extended the lifespan

and reduced developmental time (Kamakura, 2011). However, the mechanism of

accelerated development remains unclear.

In our precious investigation, exogenous melatonin connected nurse bees to

foragers (unpublished data). A logical extension of this, we focused on serotonin

(5-hydroxytryptamine, 5HT) receptors for endocrine factor that makes the worker be

engaged in nursing tasks. 5HT acts as a neurotransmitter in most animal phyla. It

controls and modulates a variety of important physiological and behavioral processes

(Weiger, 1997), and dysfunction in the serotonergic system has been linked to several

63

human disease states (Blenau and Thamm, 2011). Serotonergic neurons regulate

physiological functions and changes in behavior in insects and related phyla (Kravits,

2000; Blenau and Baumann, 2001; Orchard, 2006; Scheiner et al., 2006; Kloppenburg

and Mercer, 2008) including the honey bee (Schurmann and Klemm, 1984; Seidel and

Bicker, 1996). The 5HT level changes with aging (Taylor et al., 1992;

Wagener-Hulme et al., 1999), as does the melatonin level (Yang et al., 2007)

The invertebrate serotonergic system might be complex (Blenau and Baumann,

2001; Hauser et al., 2006). In Drosophila melanogaster, four 5HTRs are considered to

be orthologs of the mammalian 5HTR1A, 5HTR2 and 5HTR7 (Thamm et al., 2010).

Dm5HTR1A regulates sleep, learning and memory (Yuan et al., 2006). Dm5HTR1B is

expressed in clock neurons and alterations of its levels affect molecular and

behavioral responses of the clock to light (Yuan et al., 2005). We have also

demonstrated that 5HT/serotonin receptor B (5HTRB) locks the ecdysiotroph in the

silkmoth, Antheraea pernyi (Wang et al., 2013).

3.3 Materials and Methods

3.3.1 Animals

The honey bee (A. mellifera) used in the biochemical assay were collected at the

Kobe University’s experimental garden. Newly emerged adults were sampled from

the main hive and transferred to an observation hive, marked with number tag.

Bees were dissected in phosphate buffered saline (PBS), brain and HG were

64

removed during dissection and stored at -800C until 5HTR mRNA was quantified.

3.3.2 Isolation of total RNA and cDNA synthesis

Total RNA was isolated from the brains of A. mellifera with RNAiso Plus

reagent (Takara, Japan), according to manufacturer’s instruction. Total RNA from the

brain (1 μg) was reverse-transcribd in 7 microlitre Nuclease-free water and 2

microlitre 5xRT Master Mix using ReverTra Ace kit (Toyobo co. Ltd., Osaka, Japan).

Reverse transcription was carried out at 65oC for 5 minutes, 37

oC for 15 minutes, 50

oC for 5minutes, 98

oC for 5minutes and then incubated at 4

oC.

3.3.3 Preparation and injection of dsRNA

PCR product of 202bp for Am5HTR2a (accession number NM_001202460.1)

was prepared by gene specific primers (Am5HTR2a-T7-F, Am5HTR2a-T7-R) (Table 1)

in which T7 promotor was attached to the 5’ end of each primer. Incubation of the

purified PCR product at 370C for 4 hours with MEGAscript RNAi kit (Ambion, CA,

USA) according to the manufacturer’s instructions, and then dsRNA was synthesized

from that. The control dsRNA was generated from GFP gene of jellyfish

(dsRNAGFP

). The dsRNAGFP

should have no effect on the target gene (Tschuch et al.,

2008). The dsRNA and Metafectene PRO (Biontex, Planegg, Germany) were mixed

in the ratio of 1:1 (v : v) before injection. 750 ng of dsRNA was injected per bee.

3.3.4 qRT-PCR

65

The qRT-PCR was performed with the SYBR® Green and THUNDERBIRD

TM

qPCR Mix (Toyobo Co. Ltd., Osaka, Japan). The forward and reverse primers were

designed as mentioned in Table 1. To confirm the specificity of the PCR products,

melting curves were determined using the software ABI 7000 Sequence Detection

System (Applied Biosystems, Foster City, CA, USA). Amplification reaction

contained 2.5 µl cDNA and 22.5µl PCR master mix (MIX, nuclease-free water,

primers and ROX dye). Cycling parameters were 95°C for 1 min to activate DNA

polymerase, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. For

expression levels of each transcript, the rp49 (accession number AF441189) mRNA

was used as the internal control. For Am5HTR2a gene, the primers used in qRT-PCR

(Table 1) were designed outside the region of knocking down for RNAi. The size of

PCR product was 222 bp for 5HTR1, 209 bp for Am5HTR2a, 212 bp for Am 5HTR2b,

and 208 bp for Am5HTR7.

3.3.5 PCR

For analysis of the Am5HTR2a at different ages, bees of particular age groups

were caught. For current study on the Am5HTR2a effect on the RJ synthesis, bees

were also caught to that dsRNA5HTR2a or 5,7-dihydroxytryptamine (5,7-DHT) were

injected by a microsyringe (Hamilton 10µl). Quantitative analysis of RA gene

expression was conducted by PCR with the primers shown in Table 1. PCR reactions

were performed using the kit of KOD FX (Toyobo co. Ltd., Japan, KFX-101)

according to the manufacturer’s instructions. The PCR products were

66

size-fractionated in a 1% agar gel.

3.3.6 5HT, melatonin and 5,7-DHT injection

0.1, 1 and 10 pmol of 5HT in 5 µl of D.W. and melatonin in 5µl of ethanol were

injected using a micro-syringe into each bee. 0.1, 1 and 10 pmol of 5,7-DHT (Sigma,

USA) in 5 µl of distill water were injected using a micro-syringe into each bee as

mentioned above. The same volume of D.W. or ethanol was injected into a bee as a

control group. Insects were dissected 24 hour after injection and total RNA was

extracted from the brain and HG, then gene expression was analyzed by using PCR.

3.3.7 Statistical analysis

The results are expressed as mean ± S.E.M. p＜0.05 was considered as the level

of significant difference between means by one-way ANOVA (Fisher’s LSD).

3.4 Results

3.4.1 mRNA level of Am5HTRs in the brain and HG

Our focus here is to clarify the role and mechanism of 5HTR2a binding in the RA

production in A. mellifera. We first retrieved sequences of four 5HTRs, for each of

which we quantified the mRNA level at different ages after adult emergence. The

bees were marked from the first day of adult life and, 3, 6, 11, 16, 21 and 23 days

thereafter, the relative levels of mRNAs of the four Am5HTRs were examined. In the

brain, the levels of Am5HTR2a mRNA in 11- and 16-day-old bees were significantly

67

higher than in those aged 3, 21 and 23 days old. However, the levels of Am5HTR1,

Am5HTR2b and Am5HTR7 mRNAs showed no change among the different age groups

(Fig. 1A).

Subsequent analysis by PCR revealed that the highest level of Am5HTR2a

expression was also found in the HG of 6-, 11- and to a less or extent 16-day-old bees.

However, thereafter, no detection occurred (Fig. 1B). In the brain and HG, 5HTR2a

expression was increased by 5HT injection, in contrast, melatonin injection decreased

5HTR2a expression (Fig. 2A, B).

68

Table 1. A list of primers used in the experiments. Underlined sequences are the T7

promoter.

Name Sequence of the primers

5HTR2A-T7-F TAATACGACTCACTATAGGGAGACTACGGAGGATCTGACTATCTCTTG

5HTR2A-T7-R TAATACGACTCACTATAGGGAGAAGAGACAAAAGGAAGTAATTGGTGA

5HTR1A-F CTACCCCTGTTGGTTATTCTATTCC

5HTR1A-R GTTGTAAGACGACGATTTCTCAGG

5HTR2a-F TCTTCATGTTCGTGCTCTGC

5HTR2a-R CCTGGAACACTTGCACTTCA

5HTR2b-F ACGAGCTGAATTCCGTTGTC

5HTR2b-R GCTGCGTACTGTCGTTTGGT

5HTR7-F GTGATGTGATAGTTCATTGCGTTAC

5HTR7-R AGTCATTATCCGGATTGAACGTGT

GFP-T7-F TAATACGACTCACTATAGGGAGACCTGAAGTTCATCTGCACCAC

GFP-T7-R TAATACGACTCACTATAGGGAGAACGAACTCCAGCAGGACCAT

Royalactin-F AATGTAAACGAATTGATATTGAACA

Royalactin-R ATTCATAATGGAAAGAAATTTCGAG

RP49-F TCGTCACCAGAGTGATCGTT

RP49-R CCCATGAGCAATTTCAGCAC

69

Fig. 1 Relative mRNA levels of Am5HTRs in the brain after adult emergence and

expression analysis of Am5HTR2a gene transcription in the HG. (A) mRNA level

of Am5HTRs in the brain as determined by real time PCR 3, 6, 11, 16, 21 and 23 days

after adult emergence. PCR products were subjected to agarose gel electrophoresis,

and the image is representative of 3 independent expriments. The primers are listed in

Table 1. The results are presented as the mean ± S.E.M. from three independent

experiments. Asterisks indicate significant difference from 3-day incubation by

one-way ANOVA (Fisher's LSD). p<0.05. (B) Expression analysis of Am5HTR2a

gene transcription in the HG.

70

Fig. 2 Relative mRNA level of 5HTR2a after injection of 5HT/melatonin. (A)

Relative mRNA level of 5HTR2a in the brain. (B) Relative mRNA level of 5HTR2a in

the HG.

71

3.4.2 Effects of RNAi against Am5HTR2a on royalactin in the brain

To identify the function of Am5HTR2a, 11-day-old honeybees were injected with

dsRNA5HTR2a and transferred to an observation hive. The level of Am5HTR2a mRNA

was significantly lower 24 hours after the injection of dsRNA5HTR2a (Fig. 3). The

injection of dsRNAGFP

had no effect on the transcription level of Am5HTR2a genes

(Fig. 3). This result indicates that RNAi acted specifically. RA level was gradually

reduced 24 hours, 48 hours and 72 hours after the bees were injected with

dsRNA5HTR2a (Fig. 4A).

Fig. 3 RNAi against Am5HTR2a. Relative mRNA level of Am5HTR2a in the brain of

11-day-old intact bee (control) and in bee injected with either dsRNAGFP

or

dsRNA5HTR2a. The level of Am5HTR2a mRNA was measured by q-PCR with total

RNA extracted from brains collected at 0, 24, 48 and 72 h. The results are presented

as the mean ± S.E.M. from three independent experiments and the differences were

not significant from the control by one-way ANOVA (Fisher's LSD).

72

Fig. 4 Expression analysis of royalactin gene after injection of dsRNA5HTR2a. PCR

amplification of RA repetitive region was performed with different templates (after

injection of dsRNA5HTR2a): lane 1, 0 hours, lane 2, 24 hours, lane 3, 48 hours, lane 4,

72 hours.

3.4.3 Effect of 5HT pharmacology on royalactin

The injection of 0.1-10 pmoles 5HT also up-regulated RA transcription, not only

in the brain but also in the HG of 11-day-old bees. However, the injection of 0.1-10

pmol melatonin shut down the RA expression (Fig. 5A, B). RA transcription in the

brain and HG also increased after the injection of 5HT to 21-day-old bees (Fig. 6A,

B). This shows that the effect of 5HT is reversible, but not that it is due to low

melatonin content. In addition, 10 pmol 5,7-DHT injected into 11-day-old nurse bees

decreased the RA transcript in the brain (Fig. 7A). In the HG, RA transcription clearly

decreased in a dose-dependent manner (Fig. 7B).

73

Fig. 5 PCR amplification of RA. Eleven-day-old bees were injected with 5HT and

melatonin at three doses. Cont., untreated. M, mock injection with 5 µl of distilled

water or 1% ethanol. 5HT, injected with 5HT dissolved in the same volume as in the

mock. Melatonin, injection with melatonin dissolved in the same volume as the mock.

(A) Relative mRNA level of RA in the brain. (B) Relative mRNA level of RA in the

HG.

74

Fig. 6 Relative mRNA level of RA after injection of 5HT. Twenty-one-day-old

bees were injected with 5HT at three does. Cont., untreated. M, mock injection with 5

µl of distilled water. 5HT, injected with 5HT dissolved in the same volume as in the

mock. (A) Relative mRNA level of RA in the brain. (B) Relative mRNA level of RA

in the HG.

75

Fig. 7 PCR amplification of RA after depletion of indolamines. Eleven-day-old

bees were injected with 5,7-DHT at three doses. Cont., untreated. M, mock injection

with 5 µl of distilled water. 5,7-DHT, injected with 5,7-DHT dissolved in the same

volume as in the mock. (A) PCR amplification of RA in the brain. (B) PCR

amplification of RA in the HG.

76

3.5 Discussion

5HT modulates physiological states and behaviors such as motor behavior and

sensory responses in the honeybee (Erber et al., 1993; Erber and Kloppenburg, 1995;

Blenau and Erber, 1998). The present focused on the relationship between the

Am5HTR2a and RA production in A. mellifera. To test the hypothesis that 5HT

regulates RA production via Am5HTR2a, we analyzed the mRNA level of Am5HTR2a

and royalactin in the brain and HG of different ages nurse bees.

The HG in the head of honey bees (Deseyn and Billen, 2005) and most of the

major royal jelly proteins (MRJPs) were secreted from here in the head of nurse bees

(Klaudiny et al., 1994; Kubo et al., 1996). However, Peixoto et al. (2009) also showed

MRJP1 in the mushroom bodies, optic lobe and antennal lobe. It is known that the

mushroom bodies are centers for olfactory and visual perception. And the localization

of MRJP1 in the optic lobe suggests multiple functions of MRJP1 in the nervous

system. In antennal lobe, the glomerule-receive impulses from chemosensory axons

and then transmit to terminal olfactory receptors, which finally carry it to the

mushroom bodies (Kloppenburg, 1995; Galizia and Menzel, 2000; Menzel and Giurfa,

2001). However, the effect MRJP transcript in the brain remains unknown.

Four kinds of Am5HTRs were known from the bee genome (Blenau and Thamm,

2011). In the nurse bee, our results showed a fluctuation only in the level of

Am5HTR2a mRNA in the HG.

77

In the honeybee, Am5HTR1A (Thamm et al., 2010) and Am5HTR7 (Schlenstedt et

al., 2006) have been characterized at the molecular level. Am5HTR1A is a receptor that

is almost exclusively expressed in the central nervous system (CNS). It is involved in

phototactic behavior, learning and memory (Thamm et al., 2010). Am5HTR7, was the

first 5HTR in the honeybee to be molecularly characterized, of that expression was

investigated by RT-PCR, in situ hybridization and western blotting (Schlenstedt et al.,

2006). Am5HTR7 was not only detected in the brain but also in the Malpighian

tubules (Schlenstedt et al., 2006). Recently, Am5HTR2a and Am5HTR2b were cloned

from A. mellifera (Hauser et al., 2006). Current knowledge of Am5HTR2 in the

honeybee is limited.

In the brain, mRNA level of Am5HTR2a was changed, and the same fluctuations

also occur in the HG. After injection dsRNA5HTR2a, RA mRNA decreased. All these

finding indicates that Am5HTR2a may be involved in the regulation of RA production.

During insect development, 5HT-like immunoreactivity was detectable in many

outgrowing serotonergic neurons, such as pars intercerebralis neurons before the

neuritis reached their target neuropils (Seidel and Bicher, 1996). The presence of 5HT

in outgrowing neurites suggests that it modulates neural outgrowth. In second instar D.

melanogaster, serotonergic varicosities selectively decreased by the addition of

exogenous 5HT (Sykes and Condron, 2005). The serotonergic down neurons

innervating D. melanogaster gut show an increase in branching in the dopa

decarboxylase mutant (Budnik et al., 1989). Therefore, 5HT had influence on

morphogenesis in the insect nervous system. In our results, after injection 5,7-DHT

78

lead to the reduction of RA. This means that 5HT also influences RA production, and

therefore exerts indirect effects on morphogenesis.

In conclusion, 5HT regulates RA production via 5HTR2a in the brain and HG of

A. mellifera. Melatonin injection shuts down RA expression, suggesting the critical

role of arylalkylamine N-acetyltransferase (aaNAT) in the regulation of polyphenism

in A. mellifera. This is indeed the efficient mechanism to convert between discrete

phenotypes that are mutually exclusive, since aaNAT affects the relative dominance

of 5HT and melatonin in an antagonistic fashion.

79

3.6 References

Albert S, Klaudiny J, Simuth J (1999) Molecular characterization of MRJP3, highly

polymorphic protein of honeybee (Apis mellifera) royal jelly. Insect Biochem Mol

Bio 29: 427-434

Blenau W, Baumann A (2001) Molecular and pharmacological properties of insect

biogenic amine receptors: lessons from Drosophila melanogaster and Apis

mellifera. Archives Insect Biochem Physio 48: 13-38

Blenau W, Erber J (1998) Behavioural pharmacology of dopamine, serotonin and

putative aminergic ligands in the mushroom bodies of the honeybee (Apis

mellifera). Behav Brain Res 96: 115-124

Blenau W, Markus T (2011) Distribution of serotonin (5-HT) and its receptors in the

insect brain with focus on the mushroom bodies. Lessons from Drosophila

melanogaster and Apis mellifera. Arthropod Struct Dev 40: 381-394

Budnik V, Wu CF, White K (1989) Altered branching of serotonin-containing

neurons in Drosophila mutants unable to synthesize serotonin and dopamine. J

Neurosci 9: 2577-2866

Deseyn J, Billen J (2005) Age-dependent morphology and ultrastructure of the

hypopharyngeal gland of Apis mellifera workers (Hymenoptera, Apidae).

Apidologie 36: 49-57

80

Erber J, Kloppenburg P (1995) The modulatory effects of serotonin and octopamine

in the visual system of the honey bee (Apis mellifera L.). I. Behavioral analysis of

the motion-sensitive antennal reflex. J Comp Physiol A 176: 111-118

Erber J, Kloppenburg P, Scheidler A (1993) Neuromodulation by serotonin and

octopamine in the honeybee: behavior, neuroanatomy and electrophysiology.

Experientia 49: 1073-1083

Fahrbach SE, Farris SM, Sullivan JP, Robinson GE (2003) Limits on volume changes

in the mushroom bodies of the honey bee brain. J Nurobiol 57: 141-151.

Galizia CG, Menzel R (2000) Odour perception in honeybees: coding information in

glomerular patterns. Curr opini Neurol 10: 504-510

Hauser F, Cazzamali G, Williamson M, Blenau W, Grimmelikhuijzen CJ (2006) A

review of neurohormone GPCRs present in the fruitfly Drosophila melanogaster

and the honey bee Apis mellifera. Prog Neurobio 80:1-19

Kamakura M (2002) Signal transduction mechanism leading to enhanced proliferation

of primary cultured adult rat hepatocytes treated with royal jelly 57-kDa protein. J

Biochem 132: 911-919

Kamakura M (2011) Royalactin induces queen differentiation in honeybees. Nature

473: 478-483.

Kamakura M (2011) Royalactin induces queen differentiation in honeybees. Nature

81

473:478-483.

Kamakura M, Suenobu N, Fukushima M (2001) 57-kDa protein in royal jelly

enhances proliferation of primary cultured rat hepatocytes and increases albumin

production in the absence of serum. Biochem Biophys Res Commun 282: 865-874

Kloppenburg P (1995) Anatomyof the antennal motoneurons in the brain of the

honeybee (Apis mellifera). J Comp Neurol 363: 333-343

Kloppenburg P, Mercer AR (2008) Serotonin modulation of moth central olfactory

neurons. Annual Review of Entomology 53: 179-190

Knecht D, Kaatz HH (1990) Patterns of larval food production by hypopharyngeal

gland in adult worker honey bees. Apidologie 27: 457-468

Kravitz EA (2000) Serotonin and aggression: insights gained from a lobster model

system and speculations on the role of amine neurons in a complex behavior. J

Comp Physio A 186: 221-238

Lindauer M (1952) Ein beitrag zur frage der arbeitsteikung im bienenstaat. Z Vergl

Physiol 34: 299-345.

Menzel R, Giurfa M (2001) Cognitive architecture of a mini-brain: the honeybee.

trends cogn sci 5: 62-71

Michener CD (2000) The bee of the world. Baltimore: Johns Hopkins Univerisity

82

Press

Naito T, Suzuki H (1991) Sex determination in the sawfly, Athalia rosae ruficornis

(Hymenoptera): occurrence of triploid males. J Hered 82,: 101-104.

Nassel R (1993) Neuropeptides in the insect brain: a review. Cell Tissue Res 273:

1-29

Orchard I (2006) Serotonin: a coordinator of feeding-related physiological events in

the blood-gorging bug, Rhodnius prolixus.Comp Biochem Physiol A 144: 316-324

Peixoto LG, Calabria LK, Garcia L, Capparelli FE, Goulart LR, Sousa MV, Espindola

FS (2009) Identification of major royal jelly proteins in the brain of the honeybee

Apis mellifera. J Insect Physiol 55(8): 671-677

Ribbands CR (1952) Division of labour in the honeybee community. Proc Roy Soc

London (B) 140: 32-42.

Roesch GA (1925) Untersuchungen ueber die arbeitsteilung im bienenstaat, I. Teil:

Die taetigkeiten im normalen bienenstaate und ihre beziehungen zum Alter der

Arbeitsbienen. Z Vergl Physiol 2: 571-631.

Sakagami SF (1953) Untersuchungen ueber die Arbeitsteilung in einem Zwergvolk

der Honigbiene: Beitraege zue Biologie des Bienenvolkes, Apis mellifera L. I. Jap J

Zool 11: 117-185.

83

Scheiner R, Baumann A, Bienau W (2006) Aminergic control and modulation of

honeybee behavior. Curr Neuropharmacol 4: 259-276

Schlenstedt J, Balfanz S, Baumann A, Blenau W (2006) Am5-HT7: molecular and

pharmacological characterization of the first serotonin receptor of the honeybee

(Apis mellifera). J Neurochemi 98: 1985-1998

Schurmann FW, Klemm N (1984) Serotonin-immunoreactive neurons in the brain of

the honeybee. J Comp Neurol 225: 570-580

Seeley TD (1982) Adaptive significance of the age polyethism schedule in honeybee

colonies. Behav Ecol Sociobiol 11: 287-293.

Seidel C, Bicker G (1996) The developmental expression of

serotonin-immunoreactivity in the brain of the pupal honeybee. Tissue Cell 28:

663-672

Sekiguchi K, Sakagami SF (1966) Structure of foraging population and related

problems in the honeybee, with considerations on the dividion of labor in the bee

colonies. Hokkaido Nat Agric Exp Sta Rep 69: 1-65.

Sykes PA, Condron BG (2005) Development and sensitivity to serotonin of

Drosophila serotonergic varicosities in the central nervous system. Develop Biol

286: 207-216

Taylor DJ, Robinson GE, Logan BJ, Laverty R, Mercer AR (1992) Changes in brain

84

amine levels associated with the morphological and behavioural development of the

worker honeybee. J Comp Physio A 170:715-721

Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of

the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin

in phototactic behavior. Cell Mol Life Sci 67: 2467-2479

Tschuch C, Schulz A, Pscherer A, Werft W, Benner A, Hotz-Wagenblatt A,

Barrionuevo LS, Lichter L, Mertens D (2008) Off-target effects of siRNA specific

for GFP. BMC Mol Biol 9: 60

Tublitz N, Brink D, Broadie KS, Loi PK, Sylwester AW (1991) From behavior to

molecules: an integrated approach to the study of neuropeptides. Trends Neurosci

14: 254-259.

Wagener-Hulme C, Kuehn JC, Schulz DJ, Robinson GE (1999) Biogenic amines and

division of labor in honey bee colonies. J Comp Physio A 184: 471-479

Wang QS, Mohamed AAM, Takeda M (2013) Serotonin receptor B may lock the gate

of PTTH release/synthesis in the Chinese silk moth, Antheraea pernyi; a diapause

initiation/maintenance mechanism? Plos One 8: e79381.

Winston ML (1987) The biology of the honey bee. Cambridge, Mass, Harvard

University Press, 281pp.

Winston ML, Punnett, E.N. Factors determining temporal division of labor in bees.

85

Can J Zool 60: 2947-2952.

Wirtz P, Beetsma J (1972) Induction of caste differentiation in the honeybee (Apis

mellifera L.) by juvenile hormone. Entomol. Exp. Appl. 15: 517-520

Yang L, Qin Y, Li X, Song D, Qi, M (2007) Brain melatonin content and polyethism

in adult workers of Apis mellifera and Apis cerana (Hym., Apidae). J Appl

Entomol 131: 734-739.

Yuan Q, Joiner WJ, Sehgal A (2006) A sleep-promoting role for the Drosophila

serotonin receptor 1A. Current Bilology 16: 1051-1062.

Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment

in Drosophila. Neuron 47: 115-127.

86

Chapter 4: Summary

Serotonin is an important biogenic amine that plays a key role in the regulation

and modulation of many physiological and behavioural processes in vertebrates and

invertebrates. These functions are mediated through the binding of serotonin to its

receptors. In vertebrates, the serotonin receptors (5HTRs) were classified into seven

groups on the basis of sequence homology, signaling properties, gene organization

and pharmacological properties. These receptors play different roles in the nervous

system. In insects, the serotonergic system seems to be similarly complex. Most of

5HTRs evolved before the divergence of invertebrate and vertebrate branches. Most

of 5HTRs were located in the brain of insects. The apparent role of 5HTRs can be

related to physiological functions and behavior, such as sleep, learning, memory,

circadian light sensitivity and so on. Here, we showed 5HTR plays important roles in

photoperiodism of Antheraea pernyi and polyethism in Apis mellifera.

The experiment in chapter 2 provides evidence that 5HTRB may lock the gate of

PTTH release/synthesis in the A. pernyi. First, we showed that 5HTRB-like

immunohistochemical reactivities (-ir) were co-localized with prothoracicotropic

hormone (PTTH)-ir at the dorsolateral region of the protocerebrum (DL) and eclosion

hormone (EH)-ir at DC and SOG. Transcription of 5HTRB gene is under

photoperiodic regulation: it was higher under LD 12:12 than under LD 16:8.

Therefore 5HTRB may affect the PTTH release/synthesis. Second, dsRNA5HTRB was

injected into pupa under LD 16:8 and LD 12:12. The result showed that dsRNA5HTRB

87

induced early diapause termination. Furthermore, we showed that the injection of

dsRNA5HTRB induced PTTH and EH accumulation. Therefore, we conclude that

5HTRB binding suppresses PTTH and EH synthesis and release.

Luzindole and serotonin (5HT) were co-injected under LD 16:8, the results show

that 5HT maintains diapause. This conclusions was supported by the injection of

5,7-dihydroxytryptamine (5,7-DHT) into diapause pupae under LD 12:12. This

pharmacological treatment result in earily diapause termination even under LD 12:12.

This may be the mechanism of diapause induction and maintenance at pupal stage.

The experiments described in chapter 3 showed that Am5HTR2a mRNA level

fluctuated in honeybee A. mellifera while, other Am5HTRs (5HTR1, 5HTR2b and

5HTR7) did not change along aging, not only in the brain but also in the

hypopharygeal gland (HG). This is the first demonstration of 5HT in the HG. By

injection of dsRNA5HTR2a into nurse bees, royalactin mRNA accumulation was

reduced in the brain, indicating that Am5HTR2a binding stimulates royalactin

synthesis. It means that 5HT regulates royalactin synthesis. This conclusion was

supported by injection of 5,7-DHT. After injection of 5,7-DHT, the level of royalactin

transcript was also reduced, in the brain and HG. However, the royalactin transcript

was increased, when after injection 5HT. Melatonin injection also suppressed

royalactin production.

The present study strongly suggests that 5HTRs regulate a variety of

physiological functions and behaviors in insects. Our data demonstrated that 5HTRB

88

binding induced pupal diapause in A. pernyi. However, the roles of 5HTRA were still

unclear. In A. mellifera, 5HTR binding regulates polyphenism. However, it is unclear

how 5HTR2a controls the royalactin.

In summary, 5HT and 5HTR play regulatory roles in the shift between two

phenotypes not only in the brain but also in the other tissues both in A. pernyi and A.

mellifera (Fig. 1). Therefore, this may be a general switch mechanism in

polyphenism.

89

Fig. 1 5HT and 5HTR regulate of royalactin and wax in A. mellifera.

90

Acknowledgments

First of all, I would like to express my deepest appreciation to Kobe University

and JGC-S scholarship foundation for exempting me from tuition and providing

scholarship, respectively. I have been benefited tremendously from the comments and

suggestions of my supervisor Prof. Makio Takeda, who gave me the chance to study

in Japan. Without his inspiration and explaining things clearly, this thesis would have

never been completed. He is not like other people. He is not to teach and tell us how

to do it, but inspired us how to think. This laid an important foundation for us to

become a really good self-standing researcher. I want thank associate Prof. Katsuhiko

Sakamoto, who taught me kindly about experimental techniques, giving wise advices,

helping, and encouragement, without his help I could not obtained these results. I

would like to express my profound appreciation to Prof. Ohtani who taught me

marking and observing the honeybee.

I also want to thank Drs. Qimiao Shao, Moon Soo Park, Yoshiki Nagaba, Mr.

Zhuqing He and Mr. Yuichi Egi, for their helps. I would like to express my deepest

appreciation to Dr. Maged Mohammad Ali Fauda for teaching immunohistochemistry,

Mr. Ahmed Abdulfattah Mohammad for teaching RNAi, Mr. Hiroyuki Nobada for

teaching qRT-PCR. Special thanks go to Dr. Azam Mikani, Ms. Naznin Nahar, Ms.

Xiaoting Li, Ms. Yangfan and Mr. Ahmed who played important roles along the time

when I am steady in Japan. We are providing encouragement to each other at those

times. I will always be in mind with their friendship.

Here I want to mention that I have spent very diverse life in Japan, that also due

91

to my friends: Mr. Songyan Jiang, Mr. Ryouhei Nishio and my “Japanese mother”.

At last, I want to express my thanks to my parents, without them I will have no

chance in doing anything. Then I would like to express my deepest gratitude to my

husband, Tianshun Zhang, who is now a doctor course student in the laboratory of

Biochemistry Frontiers of Kobe University. Due to his kind, patience, love,

understanding and support, I could complete my doctor course study.