la cardiologia preventiva nella pratica clinica le basi: genetica anmco - corso intramurale firenze...
TRANSCRIPT
![Page 1: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/1.jpg)
La cardiologia preventiva nella pratica clinica
Le basi: genetica
ANMCO - Corso Intramurale
Firenze 22-24 ottobre, 2001
Eloisa Arbustini, IRCCS San Matteo, Pavia
![Page 2: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/2.jpg)
Le malattie cardiovascolari rappresentano la più importante causa di morbidità e mortalità
• Cardiopatia ischemica: acuta e cronica
• Scompenso
• Aritmie
• Ipertensione
• Stroke
• Vasculopatie periferiche
![Page 3: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/3.jpg)
1950-53
1960-62
1993
years males females
63.6
67.2
74.1
67.2
72.3
80.5
ISTAT Italian populationlife expectancy at birth
![Page 4: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/4.jpg)
La genetica classica: si rivolge alla trasmissione dei tratti/caratteri:
anamnesi familiaremisura di parametri biochimici
Per cardiopatia ischemica
Per vasculopatia aterosclerotica
Per fattori di rischio:
Colesterolemia, glicemia, ipertensione, omociteinemia, ipercoagulabilità
![Page 5: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/5.jpg)
Familiarità evidence-based
• Deve essere documentata: – Da report ancora disponibili– Da diagnosi ottenute in ambiente ospedaliero– Da referti autoptici
Se non è documentata o attendibile è opportuno segnalarne l’incertezza
![Page 6: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/6.jpg)
Familiarità Evidence-based• Nonni: dati sulle cause di decesso devono essere
documentati
• Genitori:– Contestualizzare il periodo degli eventi riferiti, la
sede in cui sono stati osservati o si sono verificati, chi e come li ha diagnosticati
• Fratelli/sorelle:– Molto più attendibile rispetto a quella dei genitori,
anche se solo riferita
![Page 7: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/7.jpg)
Costruire l’albero geneaologico: tradurre graficamente la storia della
famiglia• E’ graficamente utile
• E’ appropriata una rappresentazione grafica di malattie multifattoriali in modo analogo a quello delle malattie monogeniche?
• Non esitono malattie multifattoriali definibili autosomiche dominanti o recessive o legate all’X, o matrilineari come le malattie monogeniche
![Page 8: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/8.jpg)
Costruire l’albero genealogico
• Esistono malattie metaboliche monogeniche che correttamente possono essere rappresentate con alberi classici:
• FH
• Alcune forme di diabete
• Ipertensione arteriosa in sindromi precise
![Page 9: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/9.jpg)
L’anamnesi familiare e gli alberi genealogici
Coppie di fratelli
![Page 10: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/10.jpg)
?
?
Paziente deceduto in ospedale con diagnosi accertata di infartoall’età di 51 anni
Deceduto a domicilio improvvisamente
a 62 anni
Paziente di 49 anniChe si presenta con Angina instabile
L’anamnesi familiare e gli alberi genealogici
![Page 11: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/11.jpg)
?
?
Paziente deceduto in ospedale con diagnosi accertata di infartoall’età di 51 anni
Deceduto a domicilio improvvisamente
a 62 anni
Paziente di 49 anniChe si presenta con Angina instabile
Ipertensione
NIDDM
Ipertensione
Fumo
![Page 12: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/12.jpg)
?
?
“morto di cuore”Abbastanza giovane
Morto di ca polmonareMa soffriva di cuore Aveva il
colesterolo
Hanno il colesterolo
I cugini vivono in un’altra cittàNon ci vediamo da tempo
L’anamnesi familiare e gli alberi genealogici
![Page 13: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/13.jpg)
IMA
SCC POST-ISCHEMICO
30aa SD 26aa,Rottura di cuore
38aa, ictus
![Page 14: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/14.jpg)
Fenotipo del nonno: alto,magro, con le mani lunghe, aveva tutti i vasi chiusi
Dissecazione Ao a 59 aaIpercolesterolemia a 61 aa
59aa 55aa
cancro
IMA a 56 aa
Iperomocisteinemia con mut. MTHFR
![Page 15: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/15.jpg)
IMA; 48aa
SD; 53aaIMA; 48aa
La familiarità può essere derivata da entrambi i genitori
![Page 16: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/16.jpg)
Genetica molecolare
• Geni
• Analisi
• Sequenza
• Varianti alleliche
• “polimorfismi”: >1%
• Distribuzione nella popolazione
![Page 17: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/17.jpg)
Malattie monogeniche vs malattie multifattoriali, complesse
• In una malattia monogenica, il difetto è suff. per causare il fenotipo
• In una malattia multifattoriale devono combinarsi gli effetti prodotti da più fattori genetici e da fattori esogeni/ambientali: ciascun fattore è contributore ma non suff. a generare il fenotipo
![Page 18: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/18.jpg)
Genes and CAD
• RAS
• Coagulation cascade
• Cholesterol
• Diabetes
• Inflammations
• Adrenergic receptors
• Hypertension
• aging
![Page 19: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/19.jpg)
La maggior parte degli studi disponibili è di
tipo caso-controllo• Primo studio: Cambien 1992: polimorfismo
ACE ID controlla circa il 50% dei livelli circolanti di ACE
• Da quel primo studio, centinaia di altri studi condotti sul genotipo ID del gene dell’ACE
• Nessuno è risultato conclusivo
• L’argomento è ancora oggetti di ricerca
![Page 20: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/20.jpg)
Metabolismo lipidico
• Malattie monogeniche: ipercolesterolemia familiare da difetto del recettore LDL
• Dislipidemie combinate
• Difetti legati alle lipoproteine
• Lp(a)
![Page 21: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/21.jpg)
Metabolismo lipidico
Fattori geneticamente determinati
Fattori esogeni: dieta, stili di vita
![Page 22: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/22.jpg)
Ipercolesterolemia familiare
![Page 23: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/23.jpg)
INTERMEDIATE PHENOTYPE:> LDL cholesterol
Ultimate phenotype CAD
GenotypesLDL cholesterol:
Apo-B, Apo-E
Exogenous factorsdiet, life style
![Page 24: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/24.jpg)
LDL cholesterol: gene variants
• Apo-B gene– XbaI, EcoRI, in CAD– MspI: OR 1.18; 95%CI: 1.01-1.39
(Atherosclerosis, 1998;141:167-75
• Apo-E gene– Polimorphisms 2, 3, 4:
• 2 <ApoE, total cholesterol, and HDL Cholesterol
• 3 frequent allele, intermediate levels
• 4 > ApoE, Total Cholesterol, and HDL Cholesterol
![Page 25: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/25.jpg)
ApoE Isoforms: isoelectic focusing E2(0), E3(+1), E4(+2)
Epsilon2: --->Arg158CysLys156GlnArg145CysArg136Ser
Epsilon4: Arg158Cys
![Page 26: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/26.jpg)
ApoE: Epsilon4 - Risk of CAD
• Independent on age and LDL cholesterol
• OR: from 1.26 in metanalysis of 6355 pts to 2.74 in a small japanese population
• In families and twins: low HDL cholesterol: 35-50% genetic contribution and risk of early CAD
![Page 27: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/27.jpg)
ApoE gene Polymorphisms
• CAD• Alzheimer S
• Creutzfeld-Jacob S
• Familial amyloidotic polyneuropathy
• Down Syndrome
• Vascular dementia
• Age-related memory decline
• Autosomal dominant amyotrophic lateral sclerosis
• Schizophrenia
• Hungtington D
• Fetal Iodin Deficiency disorder (endemic cretinism9
You are epsilon 4:Make your choice
![Page 28: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/28.jpg)
Paraoxonase
• Paroxonase: shows clear-cut mendelian polymorphism, is an arylesterase,
• arylesterase activity, measured with phenylacetate as substrate, is determined by the same locus as paraoxonase.
• both activities are expressed by a single enzyme.
• Protects against CAD by destroying proinflammatory oxidized lipids in LDL
• Disorders:
– Cystic fibrosis
– Detoxification of organophosphate insecticides
– CAD
![Page 29: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/29.jpg)
Paraoxonase deficient mice
• Unable to prevent LDL oxidation in cocoltured cell model of the arterial wall
• Effects on both LDL and HDL isolated from PON 1 KO mice
![Page 30: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/30.jpg)
Gln191Arg
Met54Leu
- 108 regulatory region
Paraoxonase genotypes ---> different enzymatic activity:Gln191Arg: rapid hydrolization, lower activity (22.8%),
> vulnerability to toxic agents
Linkage disequilibrium
![Page 31: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/31.jpg)
ACE/AMI/ID
ACE/CAD/ID/ n =18.325
ACE/AMI/ n = 11050
ACE/fam.CAD/ n = 1709
APOE/CAD/Clin.
APOE/CAD/Angio
gene cases/#of studies
ctls/# of studies
OR 95%CI
3394
9 studies
5 studies
5497 1.26
1.32
1.45
2.76
1.26
1.11
1.15-1.39
1.21-1.45
1.29-1.62
1.09-2.58
1.13-1.41
0.88-1.40
META-ANALYSIS ACE I/D AND APOE
![Page 32: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/32.jpg)
Costi/benefici
*es. ACE I/D49.959 in meta-analisi(J Hypertension 1997)
costi tecnici estrazione DNA e genotipo con doppia copia di primers per DD: £ 30.000/caso
£1.500.000.000
![Page 33: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/33.jpg)
Arch Intern Med 2001 Jul 9;161(13):1589-94
Hyperhomocystinemia: a risk factor or a consequence of coronary heart disease?
Knekt P, et al.
This prospective study does not support the hypothesis that a high concentration of serum homocysteine is a risk factor
for coronary events in a population free of heart disease. However, it does suggest that mild hyperhomocystinemia predicts
secondary coronary events in men with heart disease, possibly as a consequence of atherosclerotic changes.
![Page 34: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/34.jpg)
J Am Coll Cardiol 2001 Jun 1;37(7):1858-63
A randomized double-blind placebo-controlled trial of the effect of homocysteine-lowering
therapy with folic acid on endothelial function in patients with coronary artery disease.
Thambyrajah J et al.
![Page 35: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/35.jpg)
Homocysteine: sulfur-containig, non- proteinogenic AA biosynthesized from methionine:•To be remethylated to methionine•To enter the Cys biosynthetic pathway•To be released into extracellular medium
![Page 36: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/36.jpg)
protein damage
![Page 37: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/37.jpg)
Homocysteine Induces Expression and Secretion of Monocyte Chemoattractant Protein-1
and Interleukin-8 in Human Aortic Endothelial Cells
Circulation 2001;103:2717
![Page 38: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/38.jpg)
Homocysteine Induces Expression and Secretion of Monocyte Chemoattractant Protein-1
and Interleukin-8 in Human Aortic Endothelial Cells
Circulation 2001;103:2717
![Page 39: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/39.jpg)
Hyperhomocysteinemia• Folate and cobalamine deficiency
• Pregnancy complications
• Rheumatoid artritis
• CRF, dyalisis, renal transplant
• Inflammatory bowel disease
• Diabetes mellitus and Insulin resistance syndrome
• Neuronal tube defects
• Mental disorders
• Cognitive impairment in elderly
• Psoriasis
• Tumors
• CV diseases
![Page 40: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/40.jpg)
VII
VIIa
VIIa / TF
TF XI
XIa
T
IX IXa
VIII VIIIaT
IXa / VIIIa
X Xa
Va VT
Xa / Va
IIIIa
fibrinogeno
fibrinaMT
M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 41: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/41.jpg)
Polimorfismo f. VII
Iacoviello L, N Engl J Med 1998;338:79-85
R 353 Q: RR / RQ / QQRegione ipervariabile 4: H7H7 / H6H7/ H6H6 / H7H5 / H6H5
0 diminuito 1 aumentato 10
rischio di IMA
RQH6H6
RRH6H7
RQH6H7
RRH7H7
RQH7H7
QQH7H7
140
120
100
80
60
40
20
0
f. V
II a
ct.
RR QQ H6H6 H7H7
*** **
M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 42: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/42.jpg)
C C
*
*
*
RGD*
*N N
PlA1 PlA2
(Leu 33 Pro)
Pena Penb
(Arg 143 Glu)
Ca++
Ca++
Ca++
Ca++
Ca++
dodecapeptide (294 - 314)
*Baka Bakb
(Ser 843 Ile)
CA(Arg 489 Glu)
Sr(Arg 636 Cys)
Gp IIb/IIIa
MoPro 406 Ala
M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 43: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/43.jpg)
Metanalisi dell’associazione tra polimorfismo PlA2 e IMA
Zhu MM Am J Cardiol 2000; 86:1000-1005
confronto studi pz OR pooled (95% CI) p
Pl A2A2/A1A2 vs PlA1A1 25 10.638 1.06 (0.97-1.16) 0.2
Pl A2A2 vs Pl A1A1 20 7.444 0.89 (0.68-1.17) 0.5
Pl A2A2 vs Pl A1A2/A1A1 20 9.987 0.88 (0.67-1.15) 0.4
M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 44: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/44.jpg)
PAI-1
4 G ACACGTGGGGACTCAGattivatore - 672 aumento della
velocità di trasmissione
5 G ACACGTGGGGGACTCAGattivatore - 672 normale
velocità di trasmissione
REPRESSORE
le citochine infiammatorie o i lipidi plasmatici (TGC, VLDL), in presenzadel genotipo 4G/4G, aumentano ulteriormente la produzione di PAI-1
M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 45: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/45.jpg)
Metanalisi del polimorfismo 4G/5G del PAI-1
Iacoviello L. Thromb Haem 1998;80:1029-30
Studi retrospettivi caso-controlloin popolazioni a basso rischio
Studi prospettici caso-controlloin popolazioni a basso rischio
Studi retrospettivi caso-controlloin popolazioni ad alto rischio
totale
0 1 2 3 4M. Tubaro, Corso ANMCO di Epidemiologia Genetica
![Page 46: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/46.jpg)
Varianti alleliche in geni codificanti per citochine,
mediatori della flogosi• crescente ruolo delle citochine e dei mediatori
della risposta infiammatoria nella patogenesi della cardiopatia ischemica
• TNF, TNFreceptor, IL8, RANTES, MCP1, etc.
• Ogni gene codificante per un fattore di flogosi è un potenziale candidato.
![Page 47: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/47.jpg)
L’aterosclerosiè una malattia infiammatoria
Chemokines
I meccanismi biologici che la governano sono quelli della flogosi
![Page 48: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/48.jpg)
La complessa rete del sistema di interazione cellulare nella flogosi
![Page 49: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/49.jpg)
MCP-1 gene regulatory region at -2518. 1: MWM; 2: G/G; 3: A/G; 4: A/A.
RANTES pm region. 1:MWM; 2: R -403 A/A; 3: R -403 G/A; 4: R -403 G/G; 5; R -28 G/G; 6; R -28 C/G; 7: R -28 C/C;
Inflammation mediators
![Page 50: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/50.jpg)
Per vedere questa immagineoccorre QuickTime™ e un
decompressore Photo - JPEG.
Extracellular
2AR: small MW ligands bind to sites within the hydrophobic core formed by TM -helices. Belongs to a major subfamily of CPCR: signal transduction
![Page 51: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/51.jpg)
Genotype Frequency Distributions and Allele Frequencies of the Ser49Gly and Gly389Arg Polymorphisms of the ß1-Adrenergic Receptor Gene in Controls
and Hypertensives Categories
Controls (n=265), n (%) Hypertensives (n=292), n (%) P
Arg389Gly Arg/Arg 134 (50.6) 192 (65.8) 0.0012 Gly/Arg 110 (41.5) 86 (29.5) ... Gly/Gly 21 (7.9) 14 (4.8) ... Arg 378 (71.3) 470 (80.5) 0.0003 Gly 152 (28.7) 114 (19.5) ...Ser49Gly Ser/Ser 193 (72.8) 199 (68.2) ... Ser/Gly 66 (24.9) 81 (27.7) ... Gly/Gly 6 (2.3) 12 (4.1) 0.31 Ser49 452 (85.3) 479 (82) ... Gly49 78 (14.7) 105 (18) 0.14
![Page 52: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/52.jpg)
Genetica e IpertensioneRicerca di Geni Candidati
5. ADDUCINA (ADD)
– Proteina eterodimerica della membrana cellulare che regola il trasporto ionico agendo sull’actina del citoscheletro: favorisce il legame spectrina-actina mediato dalla calcio-calmodulina.
– Subunità (ADD1, 4p16.3) e subunità (ADD2, 2p14-p13).
– Cusi D et al., Lancet 1997: linkage tra locus ADD1 e ipertensione essenziale.
– Schork NJ et al., Am J Hypertens 2000; Bray MS et al., Am J Hypertens 2000; Ranade K et al., Am J Hypertens 2000; Province MA et al., Am J Hypertens 2000; Barlassina C et al., Am J Hypertens 2000; Boerwinkle E. Am J Hypertens 2000; Bianchi G and Cusi D. Am J Hypertens 2000: influenza del polimorfismo Gly460Trp di ADD1 sui livelli di pressione arteriosa e sulla presenza di ipertensione arteriosa in popolazione di diverse etnie: suggerita associazione della variante allelica 460Trp con ipertensione in alcune popolazione e in altre no.
A. Repetto, Corso ANMCO di Epidemiologia Genetica
![Page 53: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/53.jpg)
Genetica e Ipertensione
Risultati promettenti da studi di linkage e di associazione ma necessarie ulteriori indagini.Inconsistenza e difficile riproducibilità di alcuni risultati confermano ulteriormente la complessità del disordine.
A. Repetto, Corso ANMCO di Epidemiologia Genetica
![Page 54: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/54.jpg)
Genetica e Ipertensione
IPERTENSIONE ARTERIOSA=
MALATTIA “DELLE ARTERIE”
DANNO D’ORGANO
FENOTIPO INTERMEDIOcome indice importante di diagnosi precoce
A. Repetto, Corso ANMCO di Epidemiologia Genetica
![Page 55: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/55.jpg)
From single studies done in small and large series to meta-
analyses
Strategies: small series --> better clinical definition
Power: > large series, multicentric studies: ratial, ethnical differences
![Page 56: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/56.jpg)
OR for CAD and stroke: factor II (G20210A and AA genotypes).
OR for CADand stroke for factor V (G1691A and AA genotypes).
factor VII (353RQ and QQ genotypes).
GP IIIa (PIA1/A2 and A2/A2 genotypes).
MTHFR (677TT genotypes).
SNIPS and CADAJC, 2001
![Page 57: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/57.jpg)
From genotyping to functional studies
Experimental setting to understand the potential links among different
risk factors
![Page 58: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/58.jpg)
Protein studies
• Sequencing
• Domains
• Modelling
• Interactions
![Page 59: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/59.jpg)
Per vedere questa immagineoccorre QuickTime™ e un
decompressore GIF.
7 transmebrane motif receptor (beta receptors)
![Page 60: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/60.jpg)
Chain A
Chain B
Chain C
Ligands
Ligands
TNF R associated factor 2 in complex with a 17-residue cd40 peptide
![Page 61: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/61.jpg)
Chain: L ( 36 residues ) - [K&S: 1 helix ] Chain: H ( 150 residues ) - [K&S: 3 helices, 7 strands ] Chain: E ( 109 residues ) - [K&S: 3 helices, 5 strands ] Chain: F ( 11 residues ) Chain: J ( 36 residues ) - [K&S: 1 helix ] Chain: K ( 259 residues ) - [K&S: 5 helices, 13 strands ] Chain: G ( 11 residues ) Chain: M ( 36 residues ) - [K&S: 3 helices ] Chain: N ( 259 residues ) - [K&S: 5 helices, 12 strands ] Chain: I ( 11 residues ) - [K&S: 1 helix ]
Thrombin complex with fibrinopeptide alpha (residues 7 - 16) (three complexes - one with epsilon-thrombin and two with alpha-thrombin)
![Page 62: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/62.jpg)
Main-chain trace Chain: A ( 357 residues ) - [K&S: 11 helices, 15 strands ] Chain: P ( 15 residues ) - [K&S: 1 strand ]
* Ligands (shown as all atoms) Ligand: SEO
Human plasminogen activator inhibitor-2.
![Page 63: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/63.jpg)
Genetic + environmental factors or gender
• Genotypes in smokers
• Genotypes in females
• Genotypes in more than one gene + life style
• Aims: to test the reciprocal effects
![Page 64: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/64.jpg)
Interazione tra polimorfismi genici e fattori esogeni ambientali
es.*beta-chain fibrinogen + HP infezione
* NOS genotype + fumo
![Page 65: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/65.jpg)
Same gene polymorphisms increase the risk for a series of
different disorders
![Page 66: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/66.jpg)
RAS LDLr Hcys Beta2AR TNF
ApoE Ils
Hundreds of SNPS
![Page 67: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/67.jpg)
Future
• Pharmacogenetics
• Genotype guided treatments
• Genotype-bsed trials
• Individual genetic risk
![Page 68: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/68.jpg)
MICROARRAY TECHNOLOGY
Gene expression analysisMutation screening GeotypingProtein studies Antibody study
![Page 69: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/69.jpg)
DNA CHIPS
The term DNA Chip refers to miniaturised arrays of nucleic acid segments anchored on glass supports no larger than a microscope slide.- cDNA microarrays- Oligonucleotide microarrays
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 70: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/70.jpg)
TECHNICAL FOUNDATIONS
The field has evolved from Edwin Southern one quarter of century ago:labelled nucleic acid molecules could be used to interrogate nucleic acid molecules attached to a solid support.
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 71: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/71.jpg)
MICROCHIP:Affymetrix
MICROCHIP:Nanogen
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 72: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/72.jpg)
MEDWAY ADVANCE 2000 - I
DEPOSITION OF PRE-SYNTHESIZED OLIGONUCLEOTIDES
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 73: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/73.jpg)
C6 aminolink
C18 spacer
TGCATATAGAGACGAGAAGGGG
TGCATATAGAGACGAGAAGGGG
TGCATATAGAGACGAGAAGGGG
TGCATATAGAGACGAGAAGGGG
C C T TGG A A
G/G G/A A/A
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 74: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/74.jpg)
cell culture or tissue sample
total RNA isolation
DNP and Biotin cDNA
co-hybridization
TSA fluorescence detection
imaging and data analysis
Expression profiling
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 75: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/75.jpg)
MICROARRAY:expression profiling
Non affected Affected
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 76: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/76.jpg)
Application of Microarrays
1) Gene Expression and Discovery (Which genes are expressed and to what magnitude?)
2) Predicting gene function
3) Linking cell pathways
4) “Fingerprint” of celluar or disease phenotype
5) Drug discover and drug target validation
![Page 77: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/77.jpg)
MICROARRAY: expression profiling
Melanoma vs. normal
P.Gasparini, Corso ANMCO di Epidemiologia Genetica
![Page 78: La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,](https://reader037.vdocuments.pub/reader037/viewer/2022103113/5542eb4e497959361e8bc997/html5/thumbnails/78.jpg)
Per maggiori informazioni
• Le diapositive del corso extramurale ANMCO di epidemiologia genetica svoltosi a Roma il 13 e 14 ottobre 2001 sono consultabili al sito dell’ANMCO
• Area Genetica presso: [email protected]