lynch et al 2015 (2)

Chromatin Changes at the PPAR-c2 PromoterDuring Bone Marrow-Derived Multipotent StromalCell Culture Correlate With Loss of GeneActivation Potential

PATRICK J LYNCH ELAINE E THOMPSON KATHLEEN MCGINNIS YAZMIN I ROVIRA GONZALEZ

JESSICA LO SURDO STEVEN R BAUER DEBORAH A HURSH

Key Words Mesenchymal stromal cells bull Chromatin bull Gene expression regulation bull Celldifferentiation bull Epigenomics bull Immunomodulation

ABSTRACT

Bone marrow-derived multipotent stromal cells (BM-MSCs) display a broad range of therapeuti-cally valuable properties including the capacity to form skeletal tissues and dampen immunesystem responses However to use BM-MSCs in a clinical setting amplification is requiredwhich may introduce epigenetic changes that affect biological properties Here we used chromatinimmunoprecipitation to compare post-translationally modified histones at a subset of gene pro-moters associated with developmental and environmental plasticity in BM-MSCs from multipledonors following culture expansion At many locations we observed localization of both transcrip-tionally permissive (H3K4me3) and repressive (H3K27me3) histone modifications These chromatinsignatures were consistent among BM-MSCs from multiple donors Since promoter activity dependson the relative levels of H3K4me3 and H3K27me3 we examined the ratio of H3K4me3 toH3K27me3 (K4K27) at promoters during culture expansion The H3K4me3 to H3K27me3 ratioswere maintained at most assayed promoters over time The exception was the adipose-tissue spe-cific promoter for the PPAR-c2 isoform of PPAR-c which is a critical positive regulator of adipogene-sis At PPAR-c2 we observed a change in K4K27 levels favoring the repressed chromatin stateduring culture This change correlated with diminished promoter activity in late passage cellsexposed to adipogenic stimuli In contrast to BM-MSCs and osteoblasts lineage-restricted preadipo-cytes exhibited levels of H3K4me3 and H3K27me3 that favored the permissive chromatin state atPPAR-c2 These results demonstrate that locus-specific changes in H3K4me3 and H3K27me3 levelscan occur during BM-MSC culture that may affect their properties STEM CELLS 2015332169ndash2181

INTRODUCTION

Bone marrow mesenchymal stromal or stemcells (BM-MSCs) are nonhematopoietic multipo-tent cells of the bone marrow Initially identi-fied as fibroblast colony-forming adherent cellsthey give rise to tissues of the bone upontransplantation [1 2] Cultured BM-MSCs areexpandable to large numbers [3] able to differ-entiate along the adipogenic osteogenic andchondrogenic pathways [4] and mitigate theactivity of immune cells [5] These propertieshave motivated numerous clinical studies [6]

Clinical applications require amplification ofBM-MSCs from multiple marrow isolates ordonors however prolonged culture leads to aprogressive reduction in proliferation kineticsdifferentiation potential and colony-forming effi-ciency [7ndash10] Morphological changes includingincreased cell size [11ndash13] and global changesin gene expression [11 14ndash17] accompanylong-term expansion Additionally donor or cell

isolation variability may affect the properties ofBM-MSCs [18ndash21] These sources of variationmay contribute to inconclusive clinical resultsthus slowing development of therapies

Preservation of certain biological functionsmay rely on maintenance of epigenetic chromatinprofiles at gene loci associated with them Spe-cific post-translational histone modificationscolocalize with cis-regulatory elements and delin-eate their activity (reviewed in refs [22 23])Acetylation of histone H3 at lysine 9 (acH3K9)and trimethylation at lysine 4 (H3K4me3) occursat the 50 end of most transcriptionally activegenes [24ndash28] Conversely trimethylations atlysine 27 (H3K27me3) and lysine 9 (H3K9me3)are associated with gene silencing and regulatinggene expression during development [24 28ndash32]Regions of H3K27 methylation expand during cel-lular differentiation and are thought to restrictplasticity by limiting gene activation [33 34] Fur-thermore increased H3K27me3-modified nucleo-somes correlate with aging of muscle stem cells

Cellular and Tissue TherapiesBranch Division of Cellularand Gene Therapies Centerfor Biologics Evaluation andResearch US Food and DrugAdministration BethesdaMaryland USA

Correspondence Deborah AHursh PhD Division of Cellularand Gene Therapies Center forBiological Evaluation andResearch US Food and DrugAdministration 10903 NewHampshire Ave Bldg 72 Rm3216 Silver Spring Maryland20993-0002 USA Telephone240ndash402-9597 Fax 301-595-1093 E-mail DeborahHurshfdahhsgov

Received July 11 2014accepted for publication January6 2014 first published online inSTEM CELLS EXPRESS March 312015

VC AlphaMed Press1066-50992015$30000

httpdxdoiorg101002stem1967

STEM CELLS 2015332169ndash2181 wwwStemCellscom VC AlphaMed Press 2015

STEM CELL TECHNOLOGY EPIGENETICS

GENOMICS PROTEOMICS AND METABONOMICS

[35] We reasoned that similar changes in chromatin structuresduring long-term culture of BM-MSCs could alter plasticity andbehavior

In this study we compared the histone modifications nearselect transcriptional start sites (TSSs) in BM-MSCs derivedfrom multiple donors following cell culture expansion Weinterrogated genes involved in differentiation immunomodu-lation and cell cycle control Site-specific chromatin signatureswere consistent among donors Furthermore histone modifi-cation patterns remained stable at most locations during long-term culture An exception was the master adipogenic tran-scription factor peroxisome proliferator activated receptor-c2(PPAR-c2) Here the relative levels of H3K4me3 to H3K27me3shifted during culture toward the repressive H3K27me3-enriched state Additionally this chromatin signature distin-guished BM-MSCs from adipose tissue precursor cells wherethe levels of H3K27me3 were below background Finally acti-vation potential of PPAR-c2 was limited in late passage BM-MSCs Together these data indicate that changes in histonemodifications during extended culture correlate with changesto gene activation potential in a locus-specific manner

MATERIALS AND METHODS

Cells and Culture Conditions

BM-MSCs from six donors were purchased from AllCells(Alameda CA httpwwwallcellscom) and Lonza (AllendaleNJ httpwwwlonzacom) (Table 1) All BM-MSCs used herewere previously expanded characterized and cryopreservedfor experimentation [36 37] Cells were cultured in completeculture medium (CCM) composed of a-minimum essentialmedium (Invitrogen) with 1 L-glutamine (Invitrogen Carls-bad CA httpwwwinvitrogencom) 1 penicillin and strep-tomycin (Invitrogen) and 165 fetal bovine serum (FBS JMBioscience San Diego CA httpwwwjmbiosciencecom) at37C and 5 CO2 Cells were passaged using trypsin (025trypsinEDTA Invitrogen) and cryopreserved in CCM with 30FBS and 5 dimethyl sulfoxide (Sigma-Aldrich St Louishttpwwwsigmaaldrichcom) Cryopreserved BM-MSCs werethawed plated at 5000ndash6000 cells per cm2 and cultured for48 hours before collection for chromatin immunoprecipitation(IP) or RNA analyses Adult human osteoblasts and preadipo-cytes (Cell Applications San Diego CA httpwwwcellappli-cationscom) derived from three donors each were culturedaccording to the manufacturerrsquos instructions Adipogenic dif-ferentiation of BM-MSCs was performed by culturing cells for21 days in induction medium (NHAdipoDiff Miltenyi BiotecBergisch Gladbach Germany httpwwwmiltenyibioteccom)as described previously [36] Preadipoctyes were differenti-ated by incubating cells for 10 days in adipocyte differentia-tion medium (Cell Applications)

Chromatin IP

Chromatin IP was performed as described [38] with minormodifications 25 3 105 cells and 5 mL of rabbit polyclonalantibodies to histone H3 acetyl-K9 histone H3 trimethyl-K4histone H3 trimethyl-K27 (06ndash942 07ndash473 or 07ndash449 Milli-pore Billerica MA httpwwwmilliporecom) and histoneH3 trimethyl-K9 (ab-8898 Abcam Cambridge UK httpwwwabcamcom) were used per IP Cells were crosslinked

with 1 formaldehyde for 10 minutes and quenched with125 mM glycine Crosslinked cells were washed twice in cold-phosphate-buffered saline (PBS) and lysed in lysis buffer(50 mM Tris-HCl pH 80 10 mM EDTA 1 SDS 20 mM Na-Butyrate 1 mM Phenylmethylsulfonylfluoride (PMSF) 2 mgmL pepstatin A 1 mgmL aprotinin and 13 complete prote-ase inhibitors Roche Diagnostics Basel Switzerland httpwwwroche-applied-sciencecom) on ice for 10 minutesLysates were sonicated on ice to achieve an average chroma-tin fragment length of lt700 bp and spun at 16000g for 10minutes at 4C Supernatants were diluted 10-fold in RIPAbuffer (10 mM Tris pH 75 1 mM EDTA 05 mM EGTA 1Triton X-100 01 SDS 01 Na-Deoxycholate 140 mM NaCl20 mM Na-Butyrate 1 mM PMSF 2 mgmL pepstatin A 1 mgmL aprotinin and 13 complete protease inhibitors Roche)Chromatin aliquots were incubated overnight at 4C with anti-bodies and 25 mL magnetic Dynabeads Protein-A (Invitrogen)Beads were washed three times in RIPA buffer and once inTris-EDTA pH 80 and resuspended in 500 mL of elutionbuffer (20 mM Tris-HCl pH 75 5 mM EDTA 50 mM NaCl 1SDS and 50 mgmL protease K Invitrogen) Crosslinks werereversed and proteins digested for 25 hours at 68C Super-natants were collected and DNA was isolated by phenol-chloroform isoamyl alcohol extraction followed by ethanolprecipitation resuspended in 100 mL of 10 mM Tris-HCl pH75 and analyzed by quantitative real-time polymerase chainreaction (PCR) using SYBR Green (BioRad Hercules CAhttpwwwbio-radcom) For PCR 5 mL of threefold dilutedchromatin IP DNA was used for each PCR reaction and com-pared to a dilution curve prepared from genomic DNA Rela-tive IP values were determined by taking the ratio of themean chromatin IP value to the mean input control valueUnless otherwise indicated reported values represent aver-ages of three IP quantified in duplicate PCR reactions Pairs ofoligonucleotides within 500 base pairs of TSSs were selectedbased on performance in amplifying a dilution series ofgenomic DNA Sequences and locations of the oligonucleo-tides are given in Table 2 For ChIP-chip 10 ng of immunopre-cipitated and input DNA was amplified using the GenomePlexWhole Genome Amplification kit (Sigma) labeled with Cy3and Cy5 dyes respectively and hybridized to NimbleGen33720K human RefSeq promoter arrays (Roche NimblegenMadison WI httpwwwnimblegencom) Data were nor-malized using MA2C version pMA2C 113 with the robustC52 method [39] Three biological and two technical repli-cates were combined into a moderated t-statistic with a blockdesign using Limma 3144 [40] in R version 2153 Posteriorprobabilities were calculated with iChip version 1120 using afirst-order Ising model with b 525 [41 42] and peaks wereselected using an false discovery rate (FDR) cutoff of 001maximum gap width of 300 bp minimum size of 200 bp and

Table 1 Summary of BM-MSC donors

Identification Gender Age Source

110877 Male 22 LonzaPCBM 1662 Female 31 All Cells167696 Female 22 LonzaPCBM 1632 Male 24 All Cells8F3560 Female 24 LonzaPCBM 1655 Female 47 All Cells

2170 Chromatin Dynamics of BM-MSCs

VC AlphaMed Press 2015 STEM CELLS

25 bp extensions Enriched promoters were identified usingCEAS version 102 using HG18 assembly [43] Y chromosomepromoters were excluded H3K27me3 and H3K4me3 wereexamined from 3000 or 2000 bp upstream respectively to800 bp downstream of TSSs Functional analyses were per-formed with ingenuity pathway analysis (IPA Qiagen RedwoodCity wwwqiagencomingenuity) and gene ontology (GO) analy-sis in DAVID version 27 [44 45] The significance threshold forIPA and GO was a Benjamini-Hochberg corrected p-valuelt 01The data discussed in this publication have been deposited inNCBIrsquos Gene Expression Omnibus (GEO) and are accessiblethrough GEO Series accession number GSE64172 (httpwwwncbinlmnihgovgeoqueryacccgiacc5 GSE64172)

Sequential Chromatin IP

Sequential chromatin IP experiments were performed asdescribed above Steps were added to crosslink the antibodies forthe first IP to the beads and to preclear unbound antibodiesbetween the first and second IP reactions [46] Antibodies for thefirst IP were dialyzed into 01 M Na-phosphate pH 74 and cross-linked overnight to Dynabeads M-280 tosylactivated magneticbeads (Invitrogen) according to the manufacturerrsquos instructionsChromatin from 1 3 106 cells was prepared incubated overnightwith 25 mL of antibody-bound beads and washed as describedabove Chromatin-DNA complexes were eluted in 100 mL using50 mM NaHCO3 01 SDS for 30 minutes at RT and diluted 10-fold in RIPA buffer Residual IgG antibodies were removed byincubation with Protein-A Dynabeads (Invitrogen) for 2 hours at4C Supernatants were collected and the second round of IP wasperformed using a different antibody or empty bead controls Allsteps for the second IP were performed as described above DNAwas quantified by real-time PCR as described above except that5 mL of undiluted IP DNA was used for PCR reactions and relativeIP values were determined by taking the ratio of the meanantibody-precipitated value to the mean empty-bead controlvalue Reported values represent the averages of two or threesequential IPs quantified in duplicate PCR reactions

Statistical Analyses

To test the hypothesis that chromatin IP signal ratios of his-tone H3K4me3 to H3K27me3 (K4K27) changed between pas-

sages promoters were initially screened for detectibleH3K27me3 and H3K4me3 on one BM-MSC donor The IP signalswere considered detectible enough for further analysis if themean of the technical replicates in a promoter region wasgreater than the mean at the reference locus To evaluate thesignificance of changes in gene expression between BM-MSCpassages repeated measures ANOVAs were run on the aver-aged technical replicates of the K4K27 ratio and on the log10-mRNA levels for each locus using SAS software version 94 ofthe SAS system for Windows (Copyright 2012 SAS Institute IncSAS and all other SAS Institute product or service names areregistered trademarks or trademarks of SAS Institute Cary NC)To correct for multiple comparisons the familywise error ratewas set to 005 using the Benjamini-Hochberg procedure [47]

Reverse Transcription PCR

RNA was isolated using RNeasy columns (Qiagen Hilden Ger-many httpwww1qiagencom) treated with DNase and con-verted to cDNA using QuantiTect Reverse Transciption kit(Qiagen) Resulting cDNA products prepared from 100 ng ofRNA were assessed in quantitative real-time PCR reactions usingpredesigned TaqMan assays (Life Technologies Rockville MDhttpwwwlifetechcom) listed in Supporting Information Table1 Data analyses were performed using qBase software [48 49]Target gene expression was normalized to the mean of threeinternal control genes (UBC IPO8 and SDHA) and then scaledto expression levels of commercially available human referencetotal RNA (Clontech Palo Alto CA httpwwwclontechcom)Reported values represent the averages from two experimentalreplicates quantified in duplicate PCR reactions

RESULTS

Promoters that Regulate DifferentiationImmunomodulation and the Cell Cycle of BM-MSCsAre Enriched with Both Permissive and RepressiveHistones

BM-MSCs are considered therapeutically valuable due to theirplasticity anti-inflammatory activity and ease of expansionWe used chromatin IP to determine whether gene promoters

Table 2 Chromatin immunoprecipitation PCR primers

Gene Forward primer (5rsquo-3rsquo) Reverse primer (5rsquo-3rsquo) Amplicon site[1]

Ref Locus AGGCCCAGACTCACTCTTCTCA CCCTGAACTGGAGCTACTGGAA (2)8198a

GAPDH GCGCCCCCGGTTTCTATA TCACCTGGCGACGCAAA OverlappingPPAR-c2 CAAGTCTTGCCAAAGCAGTGAA GAATTGGCTGGCACTGTCCTA (2)152CEBPa AGCACGAGACGTCCATCGA AACAGGTCGGCCAGGAACT (1) 208LPL CAGCTAAACTTTCCCTCCTTGGA CCCCCTGTCTAAGCACCAAA (2)121RUNX2 GCTATATCCTTCTGGATGCCAGG GTGGCTTTTCCCCCTTGC (2)254SP7 TCCGCTGGGAAAGCTGTAAT AGAGGGAGGGAGAATGGGAG (1) 455BGLAP AAGAGCCGGGCAGTCTGATT TAGGCCAAACCCCAAAGGATAT (2)188ALPL AGGTAAGGATTCGACGCTG CTGCCATTAAAGTTCAACCAC (1) 306IDO1 GAGTTTAGGACTGCAGCCTTCATT CAGGTGGCCGGAGAAGAAC (2) 248HGF CTAAACCCCTAGAGAACCTGTGTCA CAAATGTGCCCCAGCTCCTA (2) 458CDKN2A GGAATCAGGTAGCGCTTCGA TCGCCAGGAGGAGGTCTGT (1) 500

Measured in basepairs from amplicon midpoint to the transcription start site (TSS) of the represented geneaMeasured in basepairs from the TSS of SMARCA4 which is the closest adjacent geneAbbreviations Ref reference GAPDH glyceraldehyde-3-phosphate dehydrogenase PPAR-c2 peroxisome proliferator activated receptor-gamma2 CEBPa CCAAT enhancer-binding protein-alpha LPL lipoprotein lipase RUNX2 runt-related transcription factor 2 SP7 Sp7 transcription fac-tor BGLAP bone gamma-carboxyglutamate (gla) protein ALPL alkaline phosphatase IDOl Indoleamine 23-dioxygenase 1HGF hepatocytegrowth factor CDKN2A cyclin-dependent kinase inhibitor 2A SMARCA4 SWISNF-related matrix associated actin dependent regulator of chro-matin subfamily a member 4

Lynch Thompson McGinnis et al 2171

wwwStemCellscom VC AlphaMed Press 2015

important for these properties are enriched by transcription-ally permissive (acH3K9 and H3K4me3) or repressive(H3K27me3 and H3K9me3) histone modifications in donor-derived BM-MSCs (Table 1) To assign background levels forchromatin IP values at promoters a reference locus specificfor an intergenic region located more than 8 kb pairs fromthe nearest gene was included (Table 2) This region waspoorly associated with acH3K9 H3K4me3 and H3K27me3(Fig 1Andash1C) Promoter regions were assessed using primersequences located within 500 base pairs of TSSs and wereconsidered enriched for these histone modifications whentheir mean chromatin IP values exceeded those at this refer-

ence locus Glyceraldehyde-3-phosphate dehydrogenase(GAPDH) was strongly enriched with acH3K9 and H3K4me3but lacked H3K27me3 and H3K9me3 as expected for a consti-tutively active housekeeping gene This locus was used toassess background levels for H3K9me3

We screened the promoter regions of 10 genes identifiedas having important roles in adipogenic and osteogeneic dif-ferentiation immune plasticity and cell division in BM-MSCs(Table 2) for association with the selected histones Six wereenriched for acH3K9 in undifferentiated MSCs relative to thereference locus (Fig 1A) Of the three adipogenic genesassayed acH3K9 associated with CCAAT enhancer-binding

Figure 1 Chromatin signatures at gene promoters important for downstream bone marrow-derived multipotent stromal cells (BM-MSC) function (A) Acetylation of H3K9 which is associated with transcriptionally permissive chromatin at chromatin IP control loci(blue bars) lineage-specific promoters associated with expression in fat (yellow bars) and bone (green bars) tissues immunomodulatorypromoters (red bars) and a cell-cycle control promoter (purple bar) in BM-MSCs of a single donor (110877) following three cell culturepassages DNA coprecipitated with an antibody recognizing acetylated H3K9 was analyzed by quantitative real-time polymerase chainreaction (PCR) with primers specific for sequences within 500 base pairs of transcription start site (TSSs) for genes indicated on the x-axis Primers recognizing an intergenic region several kilobases from the nearest gene were included as an internal control (Ref Locus)Values shown on the y-axis represent the average of three IP analyzed in duplicate PCR reactions and are expressed as the fold-enrichment over the signal generated by 2 of the input material Error bars indicate SD (B) Trimethylation of H3K4 which is associ-ated with transcriptionally permissive promoters at lineage-specific immunomodulatory and cell-cycle control promoters DNA copreci-pitated with an antibody recognizing H3K4me3 from the same samples collected for panel A was analyzed and presented as describedabove (C) Trimethylation of H3K27 which is associated with transcriptionally restrictive chromatin at lineage-specific immunomodula-tory and cell-cycle control promoters DNA coprecipitated with an antibody recognizing H3K27me3 from the same samples collected for(A) was analyzed and presented as described above (D) Trimethylation of H3K9 which is associated with transcriptionally restrictivechromatin at lineage-specific immunomodulatory and cell-cycle control promoters DNA coprecipitated with an antibody recognizingH3K9me3 from the same samples collected for (A) was analyzed and presented as described above Abbreviations ALPL alkaline phos-phatase BGLAP bone gamma-carboxyglutamate (gla) protein CDKN2A cyclin-dependent kinase inhibitor 2A CEBPa CCAAT enhancer-binding protein-a GAPDH glyceraldehyde-3-phosphate dehydrogenase HGF hepatocyte growth factor IP immunoprecipitation IDO1indoleamine 23-dioxygenase 1 LPL lipoprotein lipase PPAR-c2 peroxisome proliferator activated receptor-c2 RUNX2 runt-related tran-scription factor 2 SP7 Sp7 transcription factor



protein-a (CEBPa) but not PPAR-c2 or lipoprotein lipase (LPL)Of the four osteogenic genes assayed H3K9 was acetylated atthree including runt-related transcription factor 2 (RUNX2)bone gamma-carboxyglutamate (gla) protein (BGLAP alsoknown as osteocalcin) and alkaline phosphatase (ALPL) Thelevels of acH3K9 at the osteogenic Sp7 transcription factor(Sp7 also known as osterix) were similar to those observed atthe reference locus Two genes associated with immunomodu-lation in BM-MSCs indoleamine 23-dioxygenase 1 (IDO1) andhepatocyte growth factor (HGF) were deacetylated and acety-lated at H3K9 respectively Finally the cyclin-dependentkinase inhibitor 2A (CDKN2A commonly referred to as p16-

INK4A) which is a known target of epigenetic regulationinvolved in cell cycle control [50 51] was enriched foracH3K9 (Fig1A)

Consistent with previous reports suggesting that H3K4 istrimethylated near the TSS of most genes [27] all promoterregions investigated here were enriched for H3K4me3 relativeto the reference locus (Fig 1B) The lowest levels of H3K4me3occurred at PPAR-c2 and Sp7 yet both were approximatelyfourfold higher than those observed at the reference locusNotably although primer sequences were selected based ondistances to TSSs within assay resolution variable levels ofenrichment between promoters reflect both the stability ofthe histone modifications and their proximity to primersequences

H3K27me3 associated with eight genes including all threeadipogenic genes (PPAR-c2 CEBPa and LPL) Sp7 ALPL IDO1HGF and CDKN2A (Fig 1C) Only the osteogeneic RUNX2 andBGLAP promoters displayed a state characterized by theabsence of H3K27me3 The heterochromatin mark H3K9me3also associated with the same eight promoters as H3K27me3and also at low levels at RUNX2 and BGLAP above thoseobserved at GAPDH (Fig 1D)

The presence of modified histones with opposing roles intranscription at the same locations may reflect heterogeneitywithin the cell population To address this possibility weperformed sequential chromatin IP experiments FirstH3K4me3-associated chromatin was immunoprecipitated fol-lowed by a second round of chromatin IP on the H3K4me3-enriched chromatin fraction using antibodies that recognizeH3K27me3 The GAPDH promoter region was not enriched inthe sequential IP samples at levels above the reference locus(Supporting Information Fig 1A) demonstrating that theassays excluded promoters harboring only H3K4me3 modifi-cations The lineage-specific promoters for PPAR-c2 CEBPaLPL Sp7 and ALPL were coenriched with H3K4me3 andH3K27me3 above background Additionally regions near theTSS for IDO1 HGF and CDKN2A were present above back-ground Similar results were observed in the reciprocalexperiment wherein H3K27me3 was immunoprecipitated firstfollowed by H3K4me3 (Supporting Information Fig 1B)These data suggest that H3K4me3 and H27me3 antibodiesprecipitated common fragments of DNA near thesepromoters

Histone Modifications Near TSSs Are Similar AmongDifferent BM-MSCs Donors

We compared the relative levels of modified histones in BM-MSCs derived from five additional donors (Table 1) Cells fromthese donors and expansion lots were characterized previously

for proliferation kinetics clonogenicity differentiation capacitygene expression and protein expression [36 37 52ndash54] Vari-ability in the levels of acH3K9 H3K4me3 H3K27me3 andH3K9me3 signals was observed among donors (SupportingInformation Figs S2ndashS5) H3K27me3 poorly associated withIDO1 and HGF in most donors Likewise low levels ofH3K9me3 at or near background were observed at RUNX2 andBGLAP in some donors However the profile of histone marksshown in Figure 1 was largely conserved in cells from multipledonors To interrogate promoters genome-wide we also exam-ined the profiles of H3K4me3 and H3K27me3 in BM-MSCs byhybridizing ChIP DNA to microarrays tiling human promotersequences Data from three donors (8F3560 1632 and167696) were combined and a total of 12709 (59) promoterswith H3K4 methylation 6636 (31) with H3K27 methylationand 2329 promoters (11) with both histone marks wereidentified (Supporting Information Table 2) Comparison ofChIP-chip results to the data in Figure 1 showed agreement atmost locations although some promoters were not detectedon the array which lacks the sensitivity of quantitative real-time PCR (Supporting Information Table 3) GO functional anal-ysis demonstrated that H3K4 methylation was significantlyenriched primarily on promoters associated with biosyntheticand metabolic processes transcription macromolecule biosyn-thesis and cell division whereas H3K27 and dual-methylationwas significantly enriched on promoters associated with devel-opmental processes (Supporting Information Tables 4ndash6) Path-way enrichment analysis of dual-marked promoters with IPAdemonstrated significant enrichment for the pathwayldquotranscriptional regulation in embryonic stem cellsrdquo (plt 2273 1027 Supporting Information Table 7)

Culture Expansion Affects H3 Methylation at thePPAR-c2 Promoter

The activity state of chromatin is influenced by the relativelevels of permissive and repressive histones [55ndash57] Thus weaddressed whether the ratios of H3K4me3 to H3K27me3 (K4K27) are maintained during culture expansion of BM-MSCsH3K4me3 and H3K27me3 levels were assessed in five donorsfollowing three five and seven passages To ensure thatchanges favoring H3K4me3 or H3K27me3 were representedwith equal magnitudes on the graph the K4K27 IP ratioswere expressed as binary logarithms BM-MSCs from all fivedonors tested showed a relatively constant K4K27 ratio ateach cell culture passage for seven of the eight promotersexamined (Fig 2Andash2E) An exception was the adipogenicPPAR-c2 promoter where a more than twofold decrease inthe log2 value of K4K27 was observed between the third andfifth cell culture passages (Fig 2F) The changes in mean IPsignal ratio at PPAR-c2 between early and late passage werestatistically significant (F(28)5 243 plt 0004) In contrastno significant changes were observed at any of the other pro-moters queried The K4K27 ratio at PPAR-c2 did not changefollowing the fifth passage implying that a detectable shift inthe balance of H3K4me3 and H3K27me3 at this locusoccurred prior to passage 5 These results suggest thatdynamic methylation favoring the transcriptionally repressivestate occurs at the PPAR-c2 promoter in BM-MSCs duringextended cell culture passaging We assessed the levels ofgene expression in undifferentiated BM-MSCs at each passageby quantitative reverse transcriptase PCR (RT-PCR) In



agreement with a change in histone methylation levels weobserved a significant loss of PPAR-c transcripts with passageacross four donor expansion lots (F(26)5 6482 plt 0001)

(Fig 3A) In contrast consistent changes were not observedfor the other genes queried with detectable expression inBM-MSCs (Fig 3Bndash3E)

Figure 2 Balance of H3K4me3 and H3K27me3 levels at promoters during prolonged culture of bone marrow-derived multipotent stro-mal cells (BM-MSCs) (A) Relative associations of H3K4me3 and H3K27me3 at indicated promoters following 3 5 and 7 cell culture pas-sages of BM-MSCs from donor 110877 Values plotted on the y-axis represent the log-base 2 enrichment of the average H3K4me3 IPsignal relative to the average H3K27me3 IP signal from three IP (BndashE) Relative associations of H3K4me3 and H3K27me3 were assessedand analyzed as in (A) for samples collected from BM-MSC donors 1662 (B) 167696 (C) 1632 (D) and 8F3560 (E) (F) Mean foldchange in the ratios of H3K4me3 to H3K27me3 between cell culture passages 3 and 5 passages 5 and 7 and passages 3 and 7 amongfive donors Error bars indicate SDs A repeated measures ANOVA was conducted on each promoter region to compare differences inthe K4K27 ratio between passages In order to correct for multiple comparisons the familywise error rate was set to 005 using theBenjamini-Hochberg procedure [47] The only significant change in K4K27 ratio with passage was in the PPAR-c2 promoter region (F(28)5 2450 plt 00004) The ratio decreased significantly from passage 3 to passage 5 with no further measurable change from passage5 to passage 7 Abbreviations ALPL alkaline phosphatase CDKN2A cyclin-dependent kinase inhibitor 2A CEBPa CCAAT enhancer-binding protein-a HGF hepatocyte growth factor IDO1 indoleamine 23-dioxygenase 1 IP immunoprecipitation LPL lipoprotein lipasePPAR-c2 peroxisome proliferator activated receptor-c2 SP7 Sp7 transcription factor



The Chromatin State at PPAR-c2 DistinguishesLineage-Restricted Preadipocytes from Osteoblasts

To explore whether the chromatin profiles observed at fatand bone-specific genes in undifferentiated BM-MSCs aremaintained in lineage-committed cells chromatin IP was per-formed in preadipocytes and osteoblasts We examined thesubset of lineage-specific genes that were enriched for bothH3K27me3 and H3K4me3 in undifferentiated BM-MSCs Incontrast to BM-MSCs and osteoblasts PPAR-c2 was acetylatedat H3K9 in preadipocytes (Fig 4A compare to Fig 1A)H3K4me3 associated with PPAR-c2 in preadipocytes at levelsthreefold higher than those observed in osteoblasts (Fig 4B)Furthermore the association of H3K27me3 with PPAR-c2

observed in BM-MSCs and osteoblasts was not detectedabove background in preadipocytes (Fig 4C compare to Fig1C) H3K9me3 marks were also observed in osteoblasts at lev-els more than threefold higher compared to preadipocytes(Fig 4D) However CEBPa LPL and SP7 were enriched bythe same histone modifications in all three cell types and atsimilar levels ALPL also associated with all three histone mod-ifications in each cell type but the levels of acH3K9 andH3K4me3 at ALPL were slightly higher in osteoblasts relativeto BM-MSCs and preadipocytes H3K27me3 levels at ALPL

were also reduced in osteoblasts relative to preadipocytes(Fig 4C) To determine whether the loss of repressive histonesat PPAR-c2 in preadipocytes was accompanied by changes ingene expression mRNA from osteoblasts preadipocytes andpreadipocytes grown in adipogenesis-inducing medium wasanalyzed by quantitative RT-PCR Consistent with the chroma-

tin IP results PPAR-c expression was upregulated in preadi-poctyes compared to osteoblasts (Fig 4E) whereas CEBPaand LPL transcripts were upregulated in differentiated cellsbut not osteoblasts or preadipocytes (Fig 4F 4G) No differ-ence in the levels of expression of ALPL or SP7 was detectedbetween the cell types (Fig 4H 4I) Thus osteoblasts and pre-adipocytes are similar at the level of chromatin and transcrip-tion at most of the lineage-specific genes examined here butdiffer in these properties near the PPAR-c2 locus

Activation of Adipogenic Promoters Is DiminishedUpon Culture Expansion of BM-MSCs

We considered that the change in histone modifications atPPAR-c2 at higher cell culture passages coincides with achange in gene activation potential We next examined thetranscription of adipogenic genes following three and sevencell culture passages of BM-MSCs from donors 110877 1662167696 and 8F3560 Cells were cultured for 3 weeks inadipogenesis-promoting medium and the expression of PPAR-

c CEBPa and LPL was determined by quantitative RT-PCRExpression of PPAR-c was induced in all donors and passagesrelative to untreated BM-MSCs (Fig 5A compare to Fig 3A)however the levels of transcription were consistently reducedin cells from the later passage Similar results were observedin three of four donor expansion lots for CEBPa (Fig 5B) andLPL (Fig 5C) the latter of which was undetectable inuntreated BM-MSCs Notably levels of transcript were similarbetween passages of BM-MSCs from donor 8F3560 BM-MSCsfrom these donors and passages and taken from the same

Figure 3 Expression of genes associated with both H3K4me3 and H3K27me3 during culture of bone marrow-derived multipotent stro-mal cells (BM-MSCs) (A) Quantitative reverse transcriptase polymerase chain reaction analysis of PPAR-c mRNA in BM-MSC donors110877 (blue diamond) 1662 (red square) 167696 (green triangle) and 8F3560 (purple circle) following 3 (P3) 5 (P5) and 7 (P7) cellculture passages Levels of expression were first normalized to the mean expression of three internal reference genes (UBC IPO8 andSDHA) and compared to levels from a human reference RNA standard (BndashE) Expression levels for CEBPa ALPL HGF and CDKN2A wereassessed as in (A) PPAR-c had a significant decrease in expression across passages (F(26)5 6482 plt 0001) Abbreviations ALPL alka-line phosphatase CDKN2A cyclin-dependent kinase inhibitor 2A CEBPa CCAAT enhancer-binding protein-a HGF hepatocyte growthfactor PPAR-c peroxisome proliferator activated receptor-c



expansion lots were previously differentiated using the proto-col reported here and assayed for quantitative adipogenesis[36] In agreement with our quantitative RT-PCR results mod-erate adipogenic potential reported in 110877 1662 and

167696 BM-MSCs at passage three was significantly dimin-ished in each of these donors by passage 7 whereas BM-MSCs from donor 8F3560 showed only weak differentiationpotential at both passages [36]

Figure 4 Chromatin signatures at lineage-specific promoters in hOB and hPAD (A) Relative association of acH3K9 with lineage-specificpromoters in hOB (green bars) and hPAD (yellow bars) DNA associated with acH3K9 was isolated by chromatin immunoprecipitation(IP) and quantified by real-time polymerase chain reaction (PCR) using primers specific for the promoter regions indicated Data wereanalyzed as in Fig 1 and represent the averages of two IP quantified in duplicate PCR reactions Error bars represent SDs (B) Relativeassociation of H3K4me3 with lineage-specific promoters in hOB and hPAD H3K4me3-associated DNA was isolated in the same experi-ments and analyzed as in (A) (C) Relative association of H3K27me3 with lineage-specific promoters in hOB and hPAD H3K27me3-associated DNA was also isolated in the same experiments and analyzed as described in (A) (D) Relative association of H3K9me3 withlineage-specific promoters in osteoblasts and preadipocytes H3K27me3-associated DNA was also isolated in the same experiments andanalyzed as described in (A) (EndashI) Gene expression levels in hOB hPAD and hPAD Diff (red bars) were assessed and analyzed as abovefor expression of PPAR-c (E) CEBPa (F) LPL (G) ALPL (H) and SP7 (I) Abbreviations ALPL alkaline phosphatase CEBPa CCAATenhancer-binding protein-a hOB osteoblast hPAD preadipocyte hPAD diff differentiated preadipocytes LPL lipoprotein lipase PPAR-cperoxisome proliferator activated receptor-c SP7 sp7 transcription factor



Figure 5 Adipogenic gene activation potential in early and late passage bone marrow-derived multipotent stromal cells (BM-MSCs) (AndashC) Quantitative reverse transcriptase polymerase chain reaction (RT-PCR) analysis of PPAR-c (A) CEBPa (B) and LPL (C) expression in dif-ferentiated BM-MSCs from donors 110877 1662 167696 and 8F3560 BM-MSCs were cultured for 3 (P3 AdipoDiff black bars) or 7 (P7AdipoDiff red bars) passages in complete culture medium (CCM) and then treated with adipogenesis-inducing medium for 21 days Geneexpression was assessed in the treated cells as described in Fig 3 LPL expression was not detected (ND) in passage 7 cells from donors1662 and 8F3560 (D) Relative associations of H3K4me3 and H3K27me3 at adipogenic genes in BM-MSCs from donor 110877 grown inadipogenesis-inducing medium following 3 (black bars) and 7 (red bars) cell culture passages Relative associations of H3K4me3 andH3K27me3 in BM-MSCs from donor 110877 grown in CCM to passage 3 (blue bars) and passage 7 (green bars) were assessed in parallelcultures as controls Values plotted on the y-axis represent the enrichment of the average H3K4me3 immunoprecipitation (IP) signal relativeto the average H3K27me3 IP signal from 2 IP analyzed in duplicate PCR reactions (EndashG) Relative associations of H3K4me3 and H3K27me3at adipogenic genes in BM-MSCs from donors 8F3560 (E) 1662 (F) and 167696 (G) grown in adipogenesis-inducing medium following 3and 7 cell culture passages and in parallel cultures grown in CCM to 3 and 7 passages H3K4me3 and H3K27me3 levels were assessed andanalyzed as in (D) Abbreviations CEBPa CCAAT enhancer-binding protein-a LPL lipoprotein lipase PPAR-c peroxisome proliferator acti-vated receptor-c



We addressed whether reduced gene activation isreflected by histone modifications at these promoters uponadipogenic differentiation In early passage BM-MSCs fromdonor 110877 an increase in K4K27 was observed at PPAR-

c2 and CEBPa (Fig 5D compare P3 Undiff to P3 AdipoDiff)indicative of promoter activation These promoters were alsoactivated in late passage BM-MSCs following adipogenicinduction However compared to early passage cells the lev-els of K4K27 were lower in later passage cells at both PPAR-

c2 and CEBPa In contrast the K4K27 ratio at LPL was similarin undifferentiated and differentiated BM-MSCs at early andlate passages We also assayed K4K27 levels under the sameconditions in BM-MSCs from donors 8F3560 (Fig 5E) 1662(Fig 5F) and 167696 (Fig 5G) Similar to 110877 BM-MSCsthe K4K27 levels in these BM-MSCs increased following adi-pogenic induction at PPAR-c2 and CEBPa in early passagecells and to a lesser degree in late passage cells In summaryour results suggest that extended culture of BM-MSCs leadsto a loss of activation potential at the levels of chromatin andtranscription for these adipogenic promoters

DISCUSSION

Therapeutic properties of cultured BM-MSCs including theirplasticity and ability to blunt immune system activity varybetween cell sources and culture conditions Some of thiscomplexity may reflect epigenetic differences Our analysis ofchromatin structures near the TSSs of genes important forBM-MSC functions found that several were associated withboth transcriptionally permissive H3K4me3 and repressiveH3K27me3 histone modifications This combination was con-sistent among BM-MSCs from multiple donors and maintainedat all but one location during proliferation The exception wasthe master adipogenic transcription factor PPAR-c2 whichchanged to favor the repressive chromatin state This corre-lated with a loss of differentiation and gene activation poten-tial in extensively cultured cells Our results support theconcept of locus-specific epigenetic change contributing tofunctional decline in cultured BM-MSCs

Historically H3K4me3 was thought to mark transcription-ally active promoters whereas H3K27me3 delineated domainsof transcriptionally repressive heterochromatin Promoterssimultaneously marked by these functionally opposed methyl-ations have since been identified in both stem and terminallydifferentiated cell types and are enriched for genes associatedwith cell-fate specific processes that are expressed at low orundetectable levels [28 58ndash62] Our ChIP-chip results exhib-ited similar enrichment of developmental processes in BM-MSCs (Supporting Information Tables 5ndash7) Bivalent chromatinis hypothesized to poise or prime genes for expression inresponse to environmental cues Molecular mechanisms ofbivalency remain incompletely understood and their impor-tance to development is unclear (reviewed in ref [63]) None-theless comodification of promoters is indicative of poorlyexpressed genes that are regulated in a dynamic cell specificmanner

We found that H3K4me3 and H3K27me3 both localizenear TSSs of many lineage-specific genes in BM-MSCs (Fig1B 1C) However we observed no evidence of H3K27me3enrichment at the osteogenic RUNX2 and BGLAP promoters

(Fig 1C) RUNX2 is a master transcription factor for osteo-genesis whose expression is tightly regulated during develop-ment and BGLAP is a downstream target of RUNX2

preferentially expressed in mature osteoblasts (reviewed inreference [64]) Both genes exhibited strong enrichment foracetylated H3K9 and trimethylated H3K4 histones and lowlevels of H3K9me3 (Fig 1A 1B 1D) RUNX2 and OC (BGLAP)promoter sequences are enriched by H3K27me3 in MSCsselected for Stro-11 expression [65] As we used a relativelystringent method for assigning background our data do notexclude the possibility that RUNX2 and BGLAP are methyl-ated at H3K27 in some cells However the robust levels ofacH3K9 and H3K4me3 observed at RUNX2 and BGLAP in thisstudy suggest that the transcriptionally permissive conforma-tion is the predominant chromatin state in BM-MSCs derivedand grown under the conditions reported here Both markswere also observed in genes not involved in lineage specifi-cation The cell-cycle control gene CDKN2A strongly enrichedboth histone marks Expression of CDKN2A is downregulatedby H3K27me3 in actively dividing cells and upregulated fol-lowing the loss of H3K27me3 in growth-arrested cells [5066] We found evidence of colocalization in the promoterregions for the immunomodulatory genes IDO1 and HGFwhich are upregulated upon exposure to proinflammatorycytokines [67 68] Thus in addition to developmentH3K4me3 and H3K27me3 may coincide near genes involvedin other cellular properties

BM-MSCs are heterogeneous in culture raising the ques-tion as to whether H3K4me3 and H3K27me3 co-occupythese locations in the same cells or reflect distinct subpopu-lations We sequentially precipitated chromatin with bothantibodies and found evidence that they enrich commonfragments of DNA encompassing all locations assayed (Sup-porting Information Fig 1) Although all sites queried weredetected above background levels low levels of coprecipita-tion were observed at some locations (such as HGF) Variablelevels of coprecipitation may reflect transient nonoverlappingpeaks of enrichment Occurrences of comodified promoterregions with partially overlapping domains of H3K4me3 andH3K27me3 domains were reported previously [61] Adjacentdomains of H3K4me3 and H3K27me3 are invoked for a roleof H3K27me3 in restricting RNA polymerase elongation [63]Another possibility is that H3K4me3 and H3K27me3 como-dify promoters in a subpopulation of cells Regardless ourdata suggest that H3K4me3 and H3K27me3 occur simultane-ously in proximity to one another in a given cell at thesepromoters in BM-MSCs

The ratios of H3K4me3 to H3K27me3 contribute to thevariable levels of chromatin activity and gene expression [56]Higher ratios of H3K4me3 to H3K27me3 positively correlatewith stochastic production of mRNA transcripts from comodi-fied genes in embryonic stem (ES) cells [55] Mechanisms thatlimit H3K27me3 loading onto H3K4me3-marked genes wereidentified in ES cells where they are proposed to set a properthreshold for gene activation at comodified sites [69] Thusthe K4K27 ratios may provide a measure of activation poten-tial In line with this view our chromatin IP data revealedasymmetric enrichment of H3K4me3 and H3K27me3 at sev-eral loci PPAR-c2 LPL and SP7 displayed high H3K27me3 rel-ative to H3K4me3 in most donors and passages of BM-MSCs(Fig 2) In contrast equal or elevated levels of H3K4me3



occurred at all other sites Four of five genes that favoredH3K4me3 (CEBPa ALPL HGF and CDKN2A) also enrichedacH3K9 whereas this mark was absent from genes that pref-erentially associated with H3K27me3 (compare Fig 1A to 2A)

The ability of BM-MSCs to maintain a specific balancebetween transcription-promoting H3K4me3 and repressingH3K27me3 marks during prolonged culture may be crucial forpreserving certain functions We found the levels of K4K27were maintained at most but not all TSSs during prolongedculture of BM-MSCs from multiple donors (Fig 2Andash2E) A sig-nificant decrease in K4K27 value occurred at PPAR-c2 In con-trast changes in these ratios at all other genes wereinconsistent between donors (Fig 2F) This decrease wasdetected between passages 3 and 5 but not after passage 5Consistent with the change in K4K27 at PPAR-c2 withincreasing passage we observed a concomitant and significantreduction in detectable transcripts at this site (Fig 3) Thesetranscripts continued to decline after passage 5 which mayreflect activity of other regulatory mechanisms in addition toH3K4me and H3K27me3 A prior study examining H3K4me3and H3K27me3 at adipogenic promoters including PPAR-c2

and LPL reported that these modifications are maintained atlineage-specific promoters in adipose tissue stem cellsbetween 12 and 30 cell culture passages [70] This differencelikely reflects inherent differences between BM-MSC and adi-pose tissue stem cell cultures However we also observedconsistent levels of these modifications following the fifth cellculture passage of BM-MSCs

Unlike BM-MSCs preadipocytes and osteoblasts are com-mitted to differentiation along the adipogenic and osteogenicpathway respectively We observed similar chromatin signa-tures at most lineage-specific promoter regions in both celltypes (Fig 4Andash4D) However in contrast to osteoblasts weobserved no H3K27me3 and lower levels of H3K9me3 atPPAR-c2 in preadipocytes Furthermore acH3K9 and H3K4me3levels were higher in preadipoctyes These results agree withprevious studies demonstrating that preadipocytes lackH3K27me3 at PPAR-c2 [71 72] In agreement with the chro-matin profiles an increase in expression of PPAR-c wasobserved in preadipocytes but not at other genes queried(Fig 4Endash4I) Our data are consistent with PPAR-c2 promoteractivation as an early event for adipogenic commitment

Adipogenic differentiation of BM-MSCs results in turnoverof H3K4me3 and H3K27me3 at PPAR-c2 to a conformationfavoring transcriptional activation (Fig 5) These results are con-sistent with prior studies in stem and precursor cells showingthat adipogenesis is associated with a gain in permissive his-tone modifications and loss of repressive marks at some adipo-genic promoters including PPAR-c2 [65 70ndash72] In agreementwith studies in adipose tissue stem cells [70] our data suggestthat prolonged culture of BM-MSCs leads to diminished turn-over of H3K4me3 and H3K27me3 modifications at PPAR-c2

concomitant with diminished expression (Fig 5) BM-MSCsfrom one of the donors assayed (8F3560) exhibited a subtlechange in activated PPAR-c expression between passagesQuantitative adipogenesis experiments demonstrated that cellscapable of forming mature adipocytes were especially rare inthe expansion we prepared from this donor (8F3560) regardlessof cell culture passage [36] However changes in K4K27observed in this donor were similar to changes in otherdonors Thus while H3K4me3 and H3K27me3 levels are subject

to change with passage at PPAR-c2 they do not necessarilypredict differences between donor lot expansions

We have presented evidence that histone modificationsare largely maintained in culture-amplified BM-MSCs how-ever site-specific changes of the distribution of H3K27me3 dooccur during cell culture expansion and may affect the behav-ior of these cells Microscopically visible heterochromaticstructures have been observed to form as fibroblasts enterinto cellular senescence providing a link between heterochro-matin and cell aging [73] Liu reported a correlation betweenaging of cells and accumulation of H3K27me3 in quiescentmuscle stem cells [35] Genome-wide chromatin IP studiesindicate that heterochromatin domains including H3K27me3expand to cover an increasing percentage of the genome dur-ing differentiation [33 34 74] Hence expanded H3K27me3domains correlate with a loss in cellular plasticity Theseobservations highlight the role of H3K27me3 and heterochro-matin more broadly in determining the cell fate potential ofstem and progenitor cells The identification of additional locisubject to changes in K4K27 levels may provide novel candi-dates for quality attributes in BM-MSCs

CONCLUSIONS

Our results indicate that during expansion of BM-MSC popula-tions the profiles of histone modifications at several pro-moters important for cell function are maintained among apanel of expansion lots from multiple cell donors An impor-tant exception is PPAR-c2 which shows a change in chromatinstructure favoring the repressed state and a concomitant lossof gene activation potential with increased time in culture

ACKNOWLEDGMENTS

Patrick Lynch Elaine Thompson Kathleen McGinnis and Yaz-min Rovira Gonzalez were supported by appointments to theResearch Participation Program at the Center for BiologicsEvaluation and Research administered by the Oak Ridge Insti-tute for Science and Education through an interagency agree-ment between the US Department of Energy and the USFood and Drug Administration We thank the members of theFDArsquos MSC Consortium for their valuable insights and discus-sions of this work We also thank Drs Carl Gregory MarkMortin Bharat Joshi Malcolm Moos and Kristen Nickens forcritical reviews of this manuscript and Brian Stultz for techni-cal support This project was supported by grants from theUS Food and Drug Administration Modernizing Science Initia-tive and the Medical Countermeasures Initiative

AUTHOR CONTRIBUTIONS

PJL conception and design collection and assembly of datadata analysis and interpretation manuscript writing and finalapproval of manuscript EET assembly of data data analysisand interpretation bioinformatics manuscript writing andfinal approval of manuscript KM and YIRG collection andassembly of data data analysis and interpretation and finalapproval of manuscript JLS provision of study material orpatients and final approval of manuscript SRB conceptionand design provision of study material or patients adminis-trative support and final approval of manuscript DAH



conception and design financial support administrative sup-port data analysis and interpretation manuscript writing andfinal approval of manuscript

DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST

The authors indicate no potential conflicts of interest

REFERENCES

1 Friedenstein AJ Chailakhjan RK LalykinaKS The development of fibroblast colonies inmonolayer cultures of guinea-pig bone mar-row and spleen cells Cell Tissue Kinet 19703393ndash403

2 Friedenstein AJ Chailakhyan RK LatsinikNV et al Stromal cells responsible for transfer-ring the microenvironment of the hemopoietictissues Cloning in vitro and retransplantationin vivo Transplantation 197417331ndash340

3 Sensebe L Bourin P Tarte K Good man-ufacturing practices production of mesenchy-mal stemstromal cells Hum Gene Ther20112219ndash26

4 Pittenger MF Mackay AM Beck SCet al Multilineage potential of adult humanmesenchymal stem cells Science 1999284143ndash147

5 Di Nicola M Carlo-Stella C Magni Met al Human bone marrow stromal cells sup-press T-lymphocyte proliferation induced bycellular or nonspecific mitogenic stimuliBlood 2002993838ndash3843

6 Lalu MM McIntyre L Pugliese C et alSafety of cell therapy with mesenchymalstromal cells (SafeCell) A systematic reviewand meta-analysis of clinical trials PLoS One20127e47559

7 Banfi A Muraglia A Dozin B et al Prolif-eration kinetics and differentiation potentialof ex vivo expanded human bone marrowstromal cells Implications for their use incell therapy Exp Hematol 200028707ndash715

8 Bonab MM Alimoghaddam K Talebian Fet al Aging of mesenchymal stem cell invitro BMC Cell Biol 2006714

9 Bruder SP Jaiswal N Haynesworth SEGrowth kinetics self-renewal and the osteo-genic potential of purified human mesenchy-mal stem cells during extensive subcultivationand following cryopreservation J Cell Biochem199764278ndash29410 Digirolamo CM Stokes D Colter D et alPropagation and senescence of human mar-row stromal cells in culture A simple colony-forming assay identifies samples with thegreatest potential to propagate and differen-tiate Brit J Haematol 1999107275ndash28111 Wagner W Horn P Castoldi M et alReplicative senescence of mesenchymal stemcells A continuous and organized processPLoS One 20083e221312 Mets T Verdonk G In vitro aging ofhuman bone marrow derived stromal cellsMech Ageing Dev 19811681ndash8913 Colter DC Sekiya I Prockop DJ Identifi-cation of a subpopulation of rapidly self-renewing and multipotential adult stem cellsin colonies of human marrow stromal cellsProc Natl Acad Sci USA 2001987841ndash784514 Larson BL Ylostalo J Prockop DJ Humanmultipotent stromal cells undergo sharp tran-sition from division to development in cul-ture Stem Cells 200826193ndash20115 Larson BL Ylostalo J Lee RH et al Sox11is expressed in early progenitor human multi-

potent stromal cells and decreases withextensive expansion of the cells Tissue EngPart A 2010163385ndash339416 Schallmoser K Bartmann C Rohde Eet al Replicative senescence-associated geneexpression changes in mesenchymal stromalcells are similar under different culture con-ditions Haematologica 201095867ndash87417 Ren J Stroncek DF Zhao Y et al Intra-subject variability in human bone marrowstromal cell (BMSC) replicative senescenceMolecular changes associated with BMSCsenescence Stem Cell Res 2013111060ndash107318 Dexheimer V Mueller S Braatz F et alReduced reactivation from dormancy butmaintained lineage choice of human mesen-chymal stem cells with donor age PLoS One20116e2298019 Zhou S Greenberger JS Epperly MWet al Age-related intrinsic changes in humanbone-marrow-derived mesenchymal stemcells and their differentiation to osteoblastsAging Cell 20087335ndash34320 Muschler GF Boehm C Easley K Aspira-tion to obtain osteoblast progenitor cellsfrom human bone marrow The influence ofaspiration volume J Bone Joint Surg 1997791699ndash170921 Phinney DG Kopen G Righter W et alDonor variation in the growth properties andosteogenic potential of human marrow stro-mal cells J Cell Biochem 199975424ndash43622 Kouzarides T Chromatin modificationsand their function Cell 2007128693ndash70523 Rada-Iglesias A Wysocka J Epigenomicsof human embryonic stem cells and inducedpluripotent stem cells Insights into pluripo-tency and implications for disease GenomeMed 201133624 Barski A Cuddapah S Cui K et al High-resolution profiling of histone methylations inthe human genome Cell 2007129823ndash83725 Bernstein BE Kamal M Lindblad-Toh Ket al Genomic maps and comparative analy-sis of histone modifications in human andmouse Cell 2005120169ndash18126 Ernst J Kheradpour P Mikkelsen TSet al Mapping and analysis of chromatinstate dynamics in nine human cell typesNature 201147343ndash4927 Guenther MG Levine SS Boyer LA et alA chromatin landmark and transcription ini-tiation at most promoters in human cellsCell 200713077ndash8828 Mikkelsen TS Ku M Jaffe DB et alGenome-wide maps of chromatin state inpluripotent and lineage-committed cellsNature 2007448553ndash56029 Cao R Wang L Wang H et al Role ofhistone H3 lysine 27 methylation inPolycomb-group silencing Science 20022981039ndash104330 Czermin B Melfi R McCabe D et alDrosophila enhancer of ZesteESC complexeshave a histone H3 methyltransferase activitythat marks chromosomal Polycomb sites Cell2002111185ndash196

31 Kuzmichev A Nishioka K Erdjument-Bromage H et al Histone methyltransferaseactivity associated with a human multiproteincomplex containing the Enhancer of Zesteprotein Genes Dev 2002162893ndash290532 Muller J Hart CM Francis NJ et al His-tone methyltransferase activity of a Drosoph-ila Polycomb group repressor complex Cell2002111197ndash20833 Xie W Schultz MD Lister R et al Epige-nomic analysis of multilineage differentiationof human embryonic stem cells Cell 20131531134ndash114834 Hawkins RD Hon GC Lee LK et al Dis-tinct epigenomic landscapes of pluripotentand lineage-committed human cells CellStem Cell 20106479ndash49135 Liu L Cheung TH Charville GW et alChromatin modifications as determinants ofmuscle stem cell quiescence and chronologi-cal aging Cell Rep 20134189ndash20436 Lo Surdo JL Millis BA Bauer SR Auto-mated microscopy as a quantitative methodto measure differences in adipogenic differ-entiation in preparations of human mesen-chymal stromal cells Cytotherapy 2013151527ndash154037 Lo Surdo JL Bauer SR Quantitativeapproaches to detect donor and passage dif-ferences in adipogenic potential and clonoge-nicity in human bone marrow-derivedmesenchymal stem cells Tissue Eng Part CMethods 201218877ndash88938 Dahl JA Collas P Q2ChIP a quick andquantitative chromatin immunoprecipitationassay unravels epigenetic dynamics of devel-opmentally regulated genes in human carci-noma cells Stem Cells 2007251037ndash104639 Song JS Johnson WE Zhu X et alModel-based analysis of two-color arrays(MA2C) Genome Biol 20078R17840 Smyth GK Limma linear models formicroarray data In Gentleman R Carey VDudoit S Irizarry R Huber W eds Bioinfor-matics and Computational Biology SolutionsUsing R and Bioconductor New York NYSpringer 2005 39742041 Mo Q Liang F Bayesian modeling ofChIP-chip data through a high-order Isingmodel Biometrics 2010661284ndash129442 Mo Q Liang F A hidden Ising model forChIP-chip data analysis Bioinformatics 201026777ndash78343 Shin H Liu T Manrai AK et al CEAS cis-regulatory element annotation system Bioin-formatics 2009252605ndash260644 Huang da W Sherman BT Lempicki RASystematic and integrative analysis of largegene lists using DAVID bioinformatics resour-ces Nat Protoc 2009444ndash5745 Huang da W Sherman BT Zheng X et alExtracting biological meaning from largegene lists with DAVID Curr Protoc Bionifor-matics 200946 Vastenhouw NL Zhang Y Woods IGet al Chromatin signature of embryonic plu-ripotency is established during genome acti-vation Nature 2010464922ndash926



47 Benjamini Y Hochberg Y Controlling thefalse discovery ratemdashA practical and power-ful approach to multiple testing J R Stat SociSeries B-Meth 199557289ndash30048 Hellemans J Mortier GF De Paepe AFet al qBase relative quantification frameworkand software for management and auto-mated analysis of real-time quantitative PCRdata Accurate normalization of real-timequantitative RT-PCR data by geometric aver-aging of multiple internal control genes(1465ndash6914 (Electronic))49 Vandesompele J De Preter KF Pattyn FFet al Accurate normalization of real-timequantitative RT-PCR data by geometric aver-aging of multiple internal control genes(1465ndash6914 (Electronic))50 Bracken AP Kleine-Kohlbrecher DDietrich N et al The Polycomb group pro-teins bind throughout the INK4A-ARF locusand are disassociated in senescent cellsGenes Dev 200721525ndash53051 Serrano M Hannon GJ Beach D A newregulatory motif in cell-cycle control causingspecific inhibition of cyclin DCDK4 Nature1993366704ndash70752 Bellayr IH Catalano JG Lababidi S et alGene markers of cellular aging in humanmultipotent stromal cells in culture StemCell Res Ther 201455953 Mindaye ST Ra M Lo Surdo JL et alGlobal proteomic signature of undifferentiatedhuman bone marrow stromal cells Evidencefor donor-to-donor proteome heterogeneityStem Cell Res 201311793ndash80554 Mindaye ST Ra M Lo SJ et al Improvedproteomic profiling of the cell surface ofculture-expanded human bone marrowmultipo-tent stromal cells J Proteomics 2013781ndash1455 De Gobbi M Garrick D Lynch M et alGeneration of bivalent chromatin domains

during cell fate decisions Epigenetics Chro-matin 20114956 Roh TY Cuddapah S Cui K et al Thegenomic landscape of histone modificationsin human T cells Proc Natl Acad Sci USA200610315782ndash1578757 Sadreyev RI Yildirim E Pinter SF et alBimodal quantitative relationships betweenhistone modifications for X-linked and auto-somal loci Proc Natl Acad Sci USA 20131106949ndash695458 Azuara V Perry P Sauer S et al Chroma-tin signatures of pluripotent cell lines NatCell Biol 20068532ndash53859 Bernstein BE Mikkelsen TS Xie X et alA bivalent chromatin structure marks keydevelopmental genes in embryonic stemcells Cell 2006125315ndash32660 Pan G Tian S Nie J et al Whole-genome analysis of histone H3 lysine 4 andlysine 27 methylation in human embryonicstem cells Cell Stem Cell 20071299ndash31261 Zhao XD Han X Chew JL et al Whole-genome mapping of histone H3 Lys4 and 27trimethylations reveals distinct genomic com-partments in human embryonic stem cellsCell Stem Cell 20071286ndash29862 Mohn F Weber M Rebhan M et al Lin-eage-specific polycomb targets and de novoDNA methylation define restriction andpotential of neuronal progenitors Mol Cell200830755ndash76663 Voigt P Tee WW Reinberg D A doubletake on bivalent promoters Genes Dev 2013271318ndash133864 Liu TM Lee EH Transcriptional regula-tory cascades in Runx2-dependent bonedevelopment Tissue Eng Part B Rev 201319254ndash26365 Hemming S Cakouros D Isenmann Set al EZH2 and KDM6A act as an epigenetic

switch to regulate mesenchymal stem celllineage specification Stem Cells 201432802ndash81566 Jacobs JJ Kieboom K Marino S et alThe oncogene and Polycomb-group genebmi-1 regulates cell proliferation and senes-cence through the ink4a locus Nature 1999397164ndash16867 English K Barry FP Field-Corbett CP et alIFN-gamma and TNF-alpha differentially regu-late immunomodulation by murine mesenchy-mal stem cells Immunol Lett 200711091ndash10068 Ryan JM Barry F Murphy JM et alInterferon-gamma does not break but pro-motes the immunosuppressive capacity ofadult human mesenchymal stem cells ClinExp Immunol 2007149353ndash36369 Jia J Zheng X Hu G et al Regulation ofpluripotency and self- renewal of ESCsthrough epigenetic-threshold modulation andmRNA pruning Cell 2012151576ndash58970 Noer A Lindeman LC Collas P HistoneH3 modifications associated with differentia-tion and long-term culture of mesenchymaladipose stem cells Stem Cells Dev 200918725ndash73671 Mikkelsen TS Xu Z Zhang X et al Com-parative epigenomic analysis of murine andhuman adipogenesis Cell 2010143156ndash16972 Wang L Xu S Lee JE et al Histone H3K9methyltransferase G9a represses PPARgammaexpression and adipogenesis EMBO J 20133245ndash5973 Narita M Nunez S Heard E et al Rb-mediated heterochromatin formation andsilencing of E2F target genes during cellularsenescence Cell 2003113703ndash71674 Zhu J Adli M Zou JY et al Genome-wide chromatin state transitions associatedwith developmental and environmental cuesCell 2013152642ndash654

See wwwStemCellscom for supporting information available online



[35] We reasoned that similar changes in chromatin structuresduring long-term culture of BM-MSCs could alter plasticity andbehavior

In this study we compared the histone modifications nearselect transcriptional start sites (TSSs) in BM-MSCs derivedfrom multiple donors following cell culture expansion Weinterrogated genes involved in differentiation immunomodu-lation and cell cycle control Site-specific chromatin signatureswere consistent among donors Furthermore histone modifi-cation patterns remained stable at most locations during long-term culture An exception was the master adipogenic tran-scription factor peroxisome proliferator activated receptor-c2(PPAR-c2) Here the relative levels of H3K4me3 to H3K27me3shifted during culture toward the repressive H3K27me3-enriched state Additionally this chromatin signature distin-guished BM-MSCs from adipose tissue precursor cells wherethe levels of H3K27me3 were below background Finally acti-vation potential of PPAR-c2 was limited in late passage BM-MSCs Together these data indicate that changes in histonemodifications during extended culture correlate with changesto gene activation potential in a locus-specific manner

MATERIALS AND METHODS

Cells and Culture Conditions

BM-MSCs from six donors were purchased from AllCells(Alameda CA httpwwwallcellscom) and Lonza (AllendaleNJ httpwwwlonzacom) (Table 1) All BM-MSCs used herewere previously expanded characterized and cryopreservedfor experimentation [36 37] Cells were cultured in completeculture medium (CCM) composed of a-minimum essentialmedium (Invitrogen) with 1 L-glutamine (Invitrogen Carls-bad CA httpwwwinvitrogencom) 1 penicillin and strep-tomycin (Invitrogen) and 165 fetal bovine serum (FBS JMBioscience San Diego CA httpwwwjmbiosciencecom) at37C and 5 CO2 Cells were passaged using trypsin (025trypsinEDTA Invitrogen) and cryopreserved in CCM with 30FBS and 5 dimethyl sulfoxide (Sigma-Aldrich St Louishttpwwwsigmaaldrichcom) Cryopreserved BM-MSCs werethawed plated at 5000ndash6000 cells per cm2 and cultured for48 hours before collection for chromatin immunoprecipitation(IP) or RNA analyses Adult human osteoblasts and preadipo-cytes (Cell Applications San Diego CA httpwwwcellappli-cationscom) derived from three donors each were culturedaccording to the manufacturerrsquos instructions Adipogenic dif-ferentiation of BM-MSCs was performed by culturing cells for21 days in induction medium (NHAdipoDiff Miltenyi BiotecBergisch Gladbach Germany httpwwwmiltenyibioteccom)as described previously [36] Preadipoctyes were differenti-ated by incubating cells for 10 days in adipocyte differentia-tion medium (Cell Applications)

Chromatin IP

Chromatin IP was performed as described [38] with minormodifications 25 3 105 cells and 5 mL of rabbit polyclonalantibodies to histone H3 acetyl-K9 histone H3 trimethyl-K4histone H3 trimethyl-K27 (06ndash942 07ndash473 or 07ndash449 Milli-pore Billerica MA httpwwwmilliporecom) and histoneH3 trimethyl-K9 (ab-8898 Abcam Cambridge UK httpwwwabcamcom) were used per IP Cells were crosslinked

with 1 formaldehyde for 10 minutes and quenched with125 mM glycine Crosslinked cells were washed twice in cold-phosphate-buffered saline (PBS) and lysed in lysis buffer(50 mM Tris-HCl pH 80 10 mM EDTA 1 SDS 20 mM Na-Butyrate 1 mM Phenylmethylsulfonylfluoride (PMSF) 2 mgmL pepstatin A 1 mgmL aprotinin and 13 complete prote-ase inhibitors Roche Diagnostics Basel Switzerland httpwwwroche-applied-sciencecom) on ice for 10 minutesLysates were sonicated on ice to achieve an average chroma-tin fragment length of lt700 bp and spun at 16000g for 10minutes at 4C Supernatants were diluted 10-fold in RIPAbuffer (10 mM Tris pH 75 1 mM EDTA 05 mM EGTA 1Triton X-100 01 SDS 01 Na-Deoxycholate 140 mM NaCl20 mM Na-Butyrate 1 mM PMSF 2 mgmL pepstatin A 1 mgmL aprotinin and 13 complete protease inhibitors Roche)Chromatin aliquots were incubated overnight at 4C with anti-bodies and 25 mL magnetic Dynabeads Protein-A (Invitrogen)Beads were washed three times in RIPA buffer and once inTris-EDTA pH 80 and resuspended in 500 mL of elutionbuffer (20 mM Tris-HCl pH 75 5 mM EDTA 50 mM NaCl 1SDS and 50 mgmL protease K Invitrogen) Crosslinks werereversed and proteins digested for 25 hours at 68C Super-natants were collected and DNA was isolated by phenol-chloroform isoamyl alcohol extraction followed by ethanolprecipitation resuspended in 100 mL of 10 mM Tris-HCl pH75 and analyzed by quantitative real-time polymerase chainreaction (PCR) using SYBR Green (BioRad Hercules CAhttpwwwbio-radcom) For PCR 5 mL of threefold dilutedchromatin IP DNA was used for each PCR reaction and com-pared to a dilution curve prepared from genomic DNA Rela-tive IP values were determined by taking the ratio of themean chromatin IP value to the mean input control valueUnless otherwise indicated reported values represent aver-ages of three IP quantified in duplicate PCR reactions Pairs ofoligonucleotides within 500 base pairs of TSSs were selectedbased on performance in amplifying a dilution series ofgenomic DNA Sequences and locations of the oligonucleo-tides are given in Table 2 For ChIP-chip 10 ng of immunopre-cipitated and input DNA was amplified using the GenomePlexWhole Genome Amplification kit (Sigma) labeled with Cy3and Cy5 dyes respectively and hybridized to NimbleGen33720K human RefSeq promoter arrays (Roche NimblegenMadison WI httpwwwnimblegencom) Data were nor-malized using MA2C version pMA2C 113 with the robustC52 method [39] Three biological and two technical repli-cates were combined into a moderated t-statistic with a blockdesign using Limma 3144 [40] in R version 2153 Posteriorprobabilities were calculated with iChip version 1120 using afirst-order Ising model with b 525 [41 42] and peaks wereselected using an false discovery rate (FDR) cutoff of 001maximum gap width of 300 bp minimum size of 200 bp and

Table 1 Summary of BM-MSC donors

Identification Gender Age Source

110877 Male 22 LonzaPCBM 1662 Female 31 All Cells167696 Female 22 LonzaPCBM 1632 Male 24 All Cells8F3560 Female 24 LonzaPCBM 1655 Female 47 All Cells











RESULTS























































DISCUSSION


















CONCLUSIONS


ACKNOWLEDGMENTS









REFERENCES




























RESULTS























































DISCUSSION


















CONCLUSIONS


ACKNOWLEDGMENTS









REFERENCES

































































DISCUSSION


















CONCLUSIONS


ACKNOWLEDGMENTS









REFERENCES




























CONCLUSIONS


ACKNOWLEDGMENTS









REFERENCES























REFERENCES




















lynch et al 2015 (2)

Documents