Novel Antifungal Compound Z-705 Specifically Inhibits ProteinKinase C of Filamentous Fungi

Asumi Sugahara,a Akira Yoshimi,b Fumio Shoji,a Tomonori Fujioka,c Kiyoshi Kawai,c Hideaki Umeyama,d

Katsuichiro Komatsu,e Masaru Enomoto,f Shigefumi Kuwahara,f Daisuke Hagiwara,b,g,h Takuya Katayama,i,j

Hiroyuki Horiuchi,i,j Ken Miyazawa,a Mayumi Nakayama,a,k Keietsu Abea,b,k

aLaboratory of Applied Microbiology, Department of Microbial Biotechnology, Graduate School of Agricultural Sciences, Tohoku University, Sendai, Miyagi, JapanbABE-project, New Industry Creation Hatchery Center, Tohoku University, Sendai, Miyagi, JapancKumiai Chemical Industry Co., Ltd., Tokyo, JapandSchool of Pharmaceutical Sciences, Kitasato University, Tokyo, JapaneIn-Silico Sciences, Inc., Tokyo, JapanfLaboratory of Applied Bioorganic Chemistry, Graduate School of Agricultural Sciences, Tohoku University, Sendai, Miyagi, JapangFaculty of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, JapanhMedical Mycology Research Center, Chiba University, Chiba, JapaniDepartment of Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, JapanjCollaborative Research Institute for Innovative Microbiology, The University of Tokyo, Tokyo, JapankDepartment of Microbial Resources, Graduate School of Agricultural Science, Tohoku University, Sendai, Miyagi, Japan

ABSTRACT The cell wall integrity signaling (CWIS) pathway is involved in fungalcell wall biogenesis. This pathway is composed of sensor proteins, protein kinase C(PKC), and the mitogen-activated protein kinase (MAPK) pathway, and it controls thetranscription of many cell wall-related genes. PKC plays a pivotal role in this path-way; deficiencies in PkcA in the model filamentous fungus Aspergillus nidulans andin MgPkc1p in the rice blast fungus Magnaporthe grisea are lethal. This suggests thatPKC in filamentous fungi is a potential target for antifungal agents. In the presentstudy, to search for MgPkc1p inhibitors, we carried out in silico screening by three-dimensional (3D) structural modeling and performed growth inhibition tests for M.grisea on agar plates. From approximately 800,000 candidate compounds, we se-lected Z-705 and evaluated its inhibitory activity against chimeric PKC expressed inSaccharomyces cerevisiae cells in which the kinase domain of native S. cerevisiae PKCwas replaced with those of PKCs of filamentous fungi. Transcriptional analysis ofMLP1, which encodes a downstream factor of PKC in S. cerevisiae, and phosphoryla-tion analysis of the mitogen-activated protein kinase (MAPK) Mpk1p, which is acti-vated downstream of PKC, revealed that Z-705 specifically inhibited PKCs offilamentous fungi. Moreover, the inhibitory activity of Z-705 was similar to that of awell-known PKC inhibitor, staurosporine. Interestingly, Z-705 inhibited melanizationinduced by cell wall stress in M. grisea. We discuss the relationships between PKCand melanin biosynthesis.

IMPORTANCE A candidate inhibitor of filamentous fungal protein kinase C (PKC),Z-705, was identified by in silico screening. A screening system to evaluate the ef-fects of fungal PKC inhibitors was constructed in Saccharomyces cerevisiae. Using thissystem, we found that Z-705 is highly selective for filamentous fungal PKC in com-parison with S. cerevisiae PKC. Analysis of the AGS1 mRNA level, which is regulatedby Mps1p mitogen-activated protein kinase (MAPK) via PKC, in the rice blast fungusMagnaporthe grisea revealed that Z-705 had a PKC inhibitory effect comparable tothat of staurosporine. Micafungin induced hyphal melanization in M. grisea, and thismelanization, which is required for pathogenicity of M. grisea, was inhibited by PKCinhibition by both Z-705 and staurosporine. The mRNA levels of 4HNR, 3HNR, and

Citation Sugahara A, Yoshimi A, Shoji F, FujiokaT, Kawai K, Umeyama H, Komatsu K, EnomotoM, Kuwahara S, Hagiwara D, Katayama T,Horiuchi H, Miyazawa K, Nakayama M, Abe K.2019. Novel antifungal compound Z-705specifically inhibits protein kinase C offilamentous fungi. Appl Environ Microbiol85:e02923-18. https://doi.org/10.1128/AEM.02923-18.

Editor Irina S. Druzhinina, Nanjing AgriculturalUniversity

Copyright © 2019 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Keietsu Abe,kabe@niche.tohoku.ac.jp.

A.S. and A.Y. contributed equally to this work.

Received 6 December 2018Accepted 4 March 2019

Accepted manuscript posted online 22March 2019Published

BIOTECHNOLOGY

crossm

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 1Applied and Environmental Microbiology

2 May 2019

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

SCD1, which are essential for melanization in M. grisea, were suppressed by bothPKC inhibitors.

KEYWORDS PKC inhibitor, cell wall integrity signaling, filamentous fungi, in silicoscreening, protein kinase C

Cells of eumycetes, including those of baker’s yeast (Saccharomyces cerevisiae) andfilamentous fungi, are covered with cell walls composed of polysaccharides, such as

glucan, chitin, and mannan (1–3). Cell walls not only protect the cells and maintain theirshapes but also transmit extracellular information into the cells in collaboration withcell membrane proteins. The cell wall structures and compositions in plants andprokaryotes differ from those in fungi. Thus, proteins related to biosynthesis of fungalcell walls and signal transduction pathways involved in cell wall biogenesis are poten-tial targets for antifungal drugs (4, 5).

In both yeast and filamentous fungi, orthologous cell wall integrity signaling (CWIS)pathways are involved in cell wall construction (6, 7). The CWIS pathway is wellcharacterized in S. cerevisiae (8, 9). It consists of several cell surface sensor proteins andsignaling proteins, such as protein kinase C (PKC) and components of a mitogen-activated protein kinase (MAPK) cascade (9, 10). When cells are exposed to hightemperature, low osmotic pressure, or other factors that perturb the cell wall, thesensor proteins sense and transmit signals via GDP/GTP exchange factors, Rom1p andRom2p, to the downstream small G-protein Rho1p (9, 11). The signaling from Rho1pproceeds through Pkc1p and a MAPK cascade (9, 10). The MAPK cascade is a linearpathway composed of the MAPK Bck1p (12), a pair of redundant MAPKs, Mkk1p andMkk2p (13), and the MAPK Mpk1p/Slt2p (13). Phosphorylated Mpk1p is translocated tothe nuclei and activates the transcription factors Rlm1p and the Swi4p-Swi6p complex.These factors regulate the transcription of most genes involved in cell wall biogenesis,including those for �-1,3-glucan synthases and chitin synthases (13). In filamentousAspergillus spp., genes encoding proteins homologous to the constituents of the yeastCWIS pathway have been identified by genome sequencing (6). However, functionalanalyses of individual genes revealed some differences between the CWIS pathways ofyeast and filamentous fungi, e.g., in the target genes (7, 14, 15).

Among the signaling proteins, PKC plays a central role in the CWIS pathway. PKC haspleiotropic effects, including MAPK cascade activation in this pathway. Loss of Pkc1pfunction in S. cerevisiae results in cell lysis because of a deficiency in cell wall construc-tion, and the Pkc1p-deficient strain grows only on osmotically supported medium (16).In filamentous fungi, no PKC deletion strains have been isolated, and thus PKC ispredicted to be essential for normal growth (17–19). Because of its functional impor-tance, PKC is a potential target of antifungal agents. PKC is essential for growth in therice blast pathogen Magnaporthe grisea (20). Mps1p of M. grisea, a homologue of S.cerevisiae Mpk1p, is essential for pathogenicity (21). The Mps1p MAPK cascade of M.grisea regulates the transcription of the AGS1 gene, which is involved in �-1,3-glucansynthesis; this glucan is a stealth factor that conceals the cell wall of infectious hyphaeand thus prevents recognition by hosts (22).

In the present study, we carried out in silico screening of a chemical library todevelop a specific inhibitor of M. grisea PKC (MgPkc1p) and selected 66 out ofapproximately 800,000 compounds. Antifungal activities of 27 commercially availablecompounds of the 66 compounds were examined on plates, and the compound withthe highest antifungal activity, Z-705 (Fig. 1), was selected as a candidate. To establishan in vivo evaluation system for Z-705, we used S. cerevisiae cells in which the kinasedomain of native PKC was replaced with those derived from M. grisea and the modelfilamentous fungus Aspergillus nidulans. In this system, we analyzed the effect of Z-705on phosphorylation levels of Mpk1p, which is phosphorylated and activated down-stream of Pkc1p, and demonstrated that Z-705 is a specific inhibitor of filamentousfungal PKC. We revealed that Z-705 inhibits the growth of M. grisea and S. cerevisiae

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 2

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

cells expressing the chimeric PKCs; the PKC inhibitory effect of Z-705 was comparableto that of staurosporine (STS), a well-known potent inhibitor of PKC.

RESULTSIn silico screening for the inhibitors of PKC of filamentous fungi. To identify the

M. grisea gene for PKC, the M. grisea genome database was searched using BLASTN withA. nidulans pkcA (AN0106) (17). The MGG_08689.6 gene (GenBank accession no.XM_003719244) showed the highest sequence identity and was designated Mgpkc1.The putative protein (1,160 amino acid residues) encoded by Mgpkc1 showed consid-erable sequence similarity to the C-terminal (catalytic) domain of human PKC� (Pro362to the C terminus; Fig. 2A). We regarded the corresponding region of MgPkc1p (Pro839to the C terminus) as the catalytic domain (CD; Fig. 2A). Next, we modeled the structureof the MgPkc CD on the basis of the three-dimensional (3D) structures of human PKC�II,human PKC�, and human PKC� and then performed in silico screening for MgPkc1pinhibitors (Fig. 2B). For candidates, we considered compounds that could bind to theATP-binding pocket of MgPkc1p in docking simulations (Fig. 2B). Among 800,000compounds, 66 structurally different compounds were selected, and the 27 of themthat were commercially available were used in a growth inhibition test against M.grisea. Z-705 was most effective, with a growth inhibition rate of 54.9% at 50 �g/ml (Fig.S1). We also evaluated Z-705 binding to the purified recombinant kinase domain ofhuman PKC�, which is classified, together with PKC�II, as a classical PKC, whereas PKC�

is classified as a novel PKC, and PKC� as an atypical PKC (23). Since PKC� is inhibited bySTS, its activity can be easily evaluated. STS increased the fluorescence polarization (FP)values in a concentration-dependent manner, indicating inhibition of PKC� activity (Fig.S2). Z-705 did not affect FP values and thus did not inhibit PKC� activity (Fig. S2). Noinhibitory effect of Z-705 against rice blast fungus on rice leaves was observed (TableS1). Therefore, it seemed necessary to improve Z-705 activity by its structural modifi-cation and also to develop a high-throughput screening system to evaluate theinhibitory effects of the compounds.

Construction of yeast strains expressing yeast-filamentous fungal chimericPKC. In comparison with S. cerevisiae, filamentous fungi usually grow slowly; it is moredifficult to genetically modify them, and they have higher efficiencies of drug excretion.Therefore, we decided to construct an evaluation system using S. cerevisiae, which is,together with filamentous fungi, classified as a eumycete. We constructed S. cerevisiaestrains expressing chimeric yeast-filamentous fungal PKC (YF-PKC strains), in which thekinase domain of yeast PKC was substituted with that of PKC from filamentous fungi(Fig. 3A). The yeast strains that harbored the kinase domains derived from A. nidulans,M. grisea, and S. cerevisiae were named YF-PKC_AN, YF-PKC_MG, and YF-PKC_SC,respectively. Although the YF-PKC_SC strain had the wild-type yeast PKC sequence, itwas used as a control for chimeric PKCs with the same construction elements.

The correct integration of the cassettes was confirmed by PCR (Fig. S3A) andSouthern blot analysis (Fig. S3B and C). PCR with a primer set corresponding to theupstream and downstream regions of the integrated cassette amplified a 4.5-kbfragment from the wild-type (WT; strain BY4741) genome and 6.3-kb fragments fromthe genomes of the YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains (Fig. S3A-a). PCRwith primers designed from the ScPkc1 gene amplified 3.5-kb fragments from the WTand YF-PKC_SC strains, but no bands were detected in the YF-PKC_MG and YF-PKC_ANstrains (Fig. S3A-b). This result indicated the absence of residual ScPkc1 in YF-PKC_MG

FIG 1 Chemical structure of Z-705.

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 3

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

and YF-PKC_AN. PCR with primers specific to the kinase domains of M. grisea or A.nidulans amplified 3.5-kb fragments in YF-PKC_MG (Fig. S3A-c) and YF-PKC_AN (Fig.S3A-d), but not in WT or YF-PKC_SC (Fig. S3A-c and A-d).

Southern blot analysis with probe 1 (Fig. S3B) detected 6.3-kb fragments in theYF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains, but not in the WT strain (Fig. S3C,upper panel). Probe 2 (Fig. S3B) detected a 4.3-kb fragment in the WT strain (Fig. S3C,lower panel, lane 1) but 6.3-kb fragments in YF-PKC_SC, YF-PKC_MG, and YF-PKC_ANstrains (Fig. S3C, lower panel, lanes 2 to 4). Unexpectedly, all strains contained 8.3-kbfragments, consistent with the presence in each genome of a region with sequencesimilarity to probe 2 (Fig. S3C). In addition, the correct concatenation of the integratedDNA region was confirmed by sequencing (data not shown). Taken together, the dataconfirmed that the cassettes for the chimeric PKCs were correctly integrated into the S.cerevisiae genome.

FIG 2 In silico screening of fungal PKC inhibitors. (A) Alignment of the amino acid sequences of MgPkc1p and human PKC�. Asterisk,identical residue; colon, highly similar residue; period, weakly similar residue; hyphen, deletion. (B) Three-dimensional model with ligandsdocked to MgPkc1p. Red, �-helix; cyan, �-sheet; white, random structure. Magenta sticks indicate seven ligands. Ligands bind along theright antiparallel �-sheet.

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 4

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Test for sensitivity of the YF-PKC expressing strains to Z-705. To assess theinhibitory effects of Z-705 on fungal PKCs in vivo, we used the WT yeast strain and theYF-PKC strains in plate and liquid cultures. In plate culture, the growth of the YF-PKC_MG and YF-PKC_AN strains was inhibited more severely by Z-705 (15.5 to 124 �M;6.25 to 50 �g/ml) than that of the WT and YF-PKC_SC strains (Fig. 3B and S4), whereasno differences were detected between WT and the YF-PKC strains on the mediumcontaining dimethyl sulfoxide (DMSO), which was the solvent for Z-705 (Fig. 3B and S4).Similarly, in liquid culture, the YF-PKC_MG and YF-PKC_AN strains were inhibited moreseverely by Z-705 in comparison with the WT and YF-PKC_SC strains, whereas nodifferences were detected between the WT and YF-PKC strains in the medium contain-ing DMSO (Fig. 3C and S5).

Effect of Z-705 on mRNA level of the downstream PKC target, MLP1, in S.cerevisiae expressing YF-PKCs. To elucidate the specific inhibitory effect of Z-705 onfungal PKCs, we used the YF-PKC strains to analyze the mRNA levels of a gene whosetranscription is under the control of CWIS downstream of PKC. In the CWIS pathway ofS. cerevisiae, Pkc1p regulates the mRNA level of MLP1, which encodes a paralog of theMAPK Mpk1p (9). The mRNA level of S. cerevisiae MLP1 is also upregulated by treatmentwith the �-1,3-glucan synthase inhibitor micafungin (MCFG) (7). When the mRNA level

FIG 3 Sensitivity of the S. cerevisiae wild-type and yeast-filamentous fungal chimeric PKC (YF-PKC) strainsto Z-705. (A) Construction of YF-PKC cassettes. KanMX, Geneticin resistance marker. (B) Sensitivity toZ-705 of the S. cerevisiae wild-type (WT; strain BY4741) and YF-PKC strains (SC, MG, and AN) on platecultures. Serial 10-fold dilutions of cell suspensions were spotted onto synthetic galactose minimalmedium (SG; Gal 1%) plates containing or not containing dimethyl sulfoxide (DMSO) or Z-705, and theplates were incubated at 30°C for 60 h. (C) Sensitivity to Z-705 of the S. cerevisiae wild-type and YF-PKCstrains in liquid cultures. Cells were inoculated into SG liquid medium (Gal 1%) containing DMSO or Z-705and incubated at 30°C for 96 h. In panel C, the optical density at 660 nm (OD660) was measured every6 h (24 h to 96 h).

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 5

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

of MLP1 is increased by cell wall stress (7), MLP1 mRNA level should be decreased if PKCactivity is inhibited by Z-705. Thus, we used the mRNA levels of MLP1 as a proxy for theeffect of Z-705 on chimeric PKCs. Quantitative reverse transcription-PCR (qRT-PCR)analysis revealed that treatment with 1% DMSO, which was used as the solvent for bothMCFG and Z-705, increased the MLP1 mRNA level (Fig. S6A and B) regardless of the5 �g/ml MCFG treatment (Fig. S6B). Therefore, we concluded that DMSO induces cellwall stress and stimulated the cells with DMSO. The MLP1 mRNA levels were increasedby treatment with 1% DMSO for 30 min; the increase was greater in the WT andYF-PKC_SC strains than in the YF-PKC_MG and YF-PKC_AN strains (Fig. S6A). Theaddition of 124 �M Z-705 suppressed the DMSO-dependent increase in MLP mRNAlevels in all four strains (Fig. S6A). When the cells were treated with 5% DMSO, theincreased levels of MLP1 mRNA were similar in all four strains (Fig. 4). The addition of15.5 �M Z-705 significantly suppressed the DMSO-dependent upregulation of the MLP1mRNA in only the YF-PKC_MG and YF-PKC_AN strains (Fig. 4). This result suggested thatZ-705 specifically inhibited the activity of filamentous fungal chimeric PKCs, suppress-ing DMSO-dependent upregulation of the MLP1 mRNA.

Effect of Z-705 on phosphorylation levels of MAPK Mpk1p in the YF-PKCstrains. To evaluate the effect of Z-705 on the downstream signaling pathway of PKC,we analyzed the phosphorylation levels of Mpk1p. In the CWIS pathway of S. cerevisiae,Mpk1p acts downstream of PKC, and Mpk1p phosphorylation is regulated by PKCactivation (9). In addition, the levels of Mpk1p phosphorylation in S. cerevisiae areincreased after treatment with Congo red (CR), indicating that CR activates the CWISpathway (24–26). We analyzed the levels of Mpk1p phosphorylation in yeast cellsexpressing chimeric PKCs by Western blot analysis with anti-phospho-p44/42 antibody.CR treatment increased the levels of phosphorylated Mpk1p in the WT and in all YF-PKCstrains (Fig. 5A, left panel). Z-705 (7.77 �M; 3.125 �g/ml) suppressed the CR-inducedhyper-activation of Mpk1p only in the YF-PKC_MG and YF-PKC_AN strains (Fig. 5A, rightpanel), suggesting that Z-705 specifically inhibited the activity of the filamentous fungalPKC and suppressed Mpk1p activation.

Effect of staurosporine on Mpk1p phosphorylation in the YF-PKC strains. Wecompared the effects of Z-705 and STS, which inhibits a wide range of PKCs (fromeukaryotic microorganisms to humans [27–29]), on Mpk1p phosphorylation in yeaststrains treated with CR to stimulate CWIS. Phosphorylation of Mpk1p in the wild-typestrain and all YF-PKC strains was suppressed by STS (6.70 �M; 3.125 �g/ml; Fig. 5B),whereas lower concentrations of STS had no such effect (Fig. S7).

Effect of Z-705 and STS on mRNA levels of the AGS1 gene in M. grisea. Toevaluate whether Z-705 inhibits PKC of M. grisea in vivo, we assessed mRNA levels of theAGS1 gene in M. grisea cells treated with Z-705. This gene encodes �-1,3-glucansynthase and is regulated via the Mps1p (an ortholog of Mpk1p of S. cerevisiae andMpkA of A. nidulans) MAPK cascade in the CWIS pathway (22). Because MCFG induces

FIG 4 Inhibition of MLP1 mRNA level by Z-705. Induction of the MLP1 transcript by cell wall stress isinhibited by Z-705. The wild-type (WT; BY4741) and YF-PKC (SC, MG, and AN) strains were incubated inSG (Gal 1%) containing 5% DMSO or 15.5 �M Z-705 for 30 min. The mRNA levels were determined byquantitative reverse transcription-PCR (RT-PCR) using specific primers (Table 2). Each value represents theratio of MLP1 expression relative to that of RPL28S in each strain. *, P � 0.05; **, P � 0.01 (Student’s t test).

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 6

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

cell wall stress and increases the mRNA level of A. nidulans agsB, which is an orthologof AGS1 of M. grisea (7, 30), we treated M. grisea mycelia with MCFG and analyzed theAGS1 mRNA level by qRT-PCR. Treatment with MCFG (0.01 �g/ml for 24 h) markedlyupregulated the AGS1 mRNA levels (Fig. 6A, left panel); surprisingly, it also clearlyinduced melanization of mycelia (Fig. 6B). Cotreatment with Z-705 (62.2 or 124 �M) andMCFG (0.01 �g/ml) for 24 h decreased the levels of the AGS1 mRNA by one-half ortwo-thirds, respectively (Fig. 6A, left panel). MCFG-induced melanization was sup-pressed by 124 �M Z-705 (Fig. 6B). Likewise, the induction of the AGS1 mRNA andmelanization induced by MCFG were suppressed by STS at 107 �M but not 53.6 �M(Fig. 6).

Effect of Z-705 and STS on mRNA levels of the genes involved in melaninbiosynthesis in M. grisea. Genes encoding 1,3,6,8-tetrahydroxy-naphthalene reduc-tase (4HNR), trihydroxy-naphthalene reductase (3HNR), and scytalone dehydratase(SCD1) are involved in the biosynthesis of 1,8-dihydroxynaphthalene (DHN) melanin inseveral plant pathogens, including M. grisea (31–34), and are regulated by orthologs ofMps1p (21, 31). We hypothesized that the 4HNR, 3HNR, and SCD1 transcripts are underthe control of the PKC pathway in M. grisea, and we used qRT-PCR to analyze their levelsin mycelia treated with or without Z-705 or STS. The mRNA levels of the three geneswere upregulated by MCFG (Fig. 7). Cotreatment with MCFG (0.01 �g/ml) and Z-705(62.2 or 124 �M) or STS (53.6 or 107 �M) for 24 h significantly suppressed the mRNAlevels of the three genes (Fig. 7).

Effect of Z-705 on mRNA levels of genes involved in �-1,3-glucan and melaninbiosynthesis in A. nidulans. To evaluate whether Z-705 inhibits PKC of A. nidulans invivo, we treated A. nidulans mycelia with MCFG (0.01 �g/ml for 24 h) and analyzed theagsB mRNA level by qRT-PCR. Surprisingly, this treatment reduced the agsB mRNA level(Fig. S8A), whereas cotreatment with MCFG and Z-705 (62.2 or 124 �M) restored it (Fig.S8A).

FIG 5 Inhibition of Mpk1p phosphorylation by Z-705 and STS. (A) Mpk1p phosphorylation is inhibited byZ-705. The wild-type (WT; BY4741) and YF-PKC (SC, MG, and AN) strains were incubated in yeastextract-peptone-dextrose (YPD) medium containing 1% DMSO (solvent for Z-705) or 7.77 �M Z-705 for30 min and then transferred for 60 min to YPD medium containing 100 �g/ml Congo red (CR). Mpk1pphosphorylation was detected by immunoblotting with anti-phospho-p44/42 MAPK antibody; anti-Mpk1p antibody was used to detect Mpk1p regardless of phosphorylation (loading control); H2A, histoneH2A. Ctrl indicates the standard sample, which was obtained from the WT treated with CR and usedthroughout this study. (B) Mpk1p phosphorylation is inhibited by STS. Cells were incubated in YPDmedium containing 1% DMSO (solvent for STS) or 6.70 �M STS at 30°C for 30 min and then transferredfor 60 min to YPD medium containing 100 �g/ml Congo red (CR). Mpk1p phosphorylation was detectedas described above.

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 7

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Magnaporthe grisea produces DHN-melanin, whereas A. nidulans produces 3,4-dihydroxyphenylalanine (DOPA) melanin (35). Tyrosinase encoded by melB is involvedin the biosynthesis of DOPA-melanin in Aspergillus oryzae (36). We used qRT-PCR toevaluate whether Z-705 affects the mRNA level of the melB ortholog in A. nidulans(AN7060). The mRNA level of the gene was increased by MCFG but reduced bycotreatment with MCFG and Z-705 (15.5 to 124 �M) for 24 h (Fig. S8B).

DISCUSSION

In the present study, using S. cerevisiae cells expressing yeast-filamentous fungalchimeric PKCs, we demonstrated that Z-705 (Fig. 1), a candidate antifungal compound,selectively inhibited PKCs of filamentous fungi. The inhibitory effect of Z-705 wascomparable to that of STS. The lack of differences in the growth rate among the S.cerevisiae wild type and three YF-PKC strains in the medium containing DMSO (Fig. 3Band C) indicated that YF-PKCs complemented PKC of S. cerevisiae. Z-705 inhibited thegrowth of the strains YF-PKC_MG (kinase domain from M. grisea) and YF-PKC_AN(kinase domain from A. nidulans) more strongly than that of the WT and YF-PKC_SCstrains (Fig. 3B and C), suggesting that Z-705 was selective against PKCs from filamen-tous fungi. Z-705 delayed the entry to exponential growth of the strains YF-PKC_MGand YF-PKC_AN but had no obvious effect on growth rate in the exponential phase oron cell density (Fig. 3C). Although the reason why Z-705 does not strongly inhibitgrowth is unknown, there may be a mechanism to overcome the inhibition of PKC by

FIG 6 Inhibitory effects of Z-705 and STS on AGS1 gene expression and hyphal melanization in M. grisea, induced by cell wall stress.(A) Mycelia of the wild-type strain (Guy11) were incubated in complete medium (CM) containing 0 (�) or 0.01 (�) �g/ml MCFG (MCFG),with or without 1% DMSO or with or without the indicated concentration of Z-705 or STS for 24 h. AGS1 mRNA levels were determinedby quantitative RT-PCR using specific primers (Table 2). (B) Melanization in the wild-type M. grisea Guy11 strain in liquid culture. Cellswere cultured in CM in the absence or presence of 0.01 �g/ml MCFG, with or without 1% DMSO, or with 1% DMSO and the indicatedconcentrations of Z-705 or STS, for 24 h.

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 8

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Z-705. Further study of the relationship between PKC inhibition by Z-705 and its effecton growth is needed.

We found that the solvent DMSO induced cell wall stress and increased the levels ofMLP1 mRNA (Fig. 4 and S6A), which encodes a downstream effector of PKC. Even a lowconcentration of Z-705 (15.5 �M) suppressed the increased MLP1 mRNA level in theYF-PKC_MG and YF-PKC_AN strains only (Fig. 4). This suggests that Z-705 has a greateraffinity for the kinase domain derived from the filamentous fungi than for that from S.cerevisiae. The analysis of Mpk1p phosphorylation also revealed that Z-705 was selec-tive against strains harboring YF-PKCs (Fig. 5A). The effective concentration of Z-705was lower in the Mpk1p phosphorylation analysis than in the analysis of MLP1 mRNAlevels, possibly because the activation of the MAPK cascade (Bck1p-Mkk1/2p-Mpk1p) isdirectly regulated by PKC (9) and is particularly susceptible to the effects of PKCinhibition.

Although both Z-705 and STS inhibited fungal PKCs, Z-705 was selective againstPKCs from filamentous fungi. The amino acid sequence identity between the kinasedomains of M. grisea MgPkc1p and A. nidulans PkcA is approximately 90%, and thatbetween the kinase domains of S. cerevisiae Pkc1p and those of PKCs of filamentousfungi is approximately 70%. These differences in the primary structure, in particular inthe ATP-binding pocket, may cause the difference in affinity for Z-705.

In M. grisea, the �-1,3-glucan synthase inhibitor MCFG increased the mRNA level ofAGS1, which encodes an �-1,3-glucan synthase (Fig. 6A). This effect indicated thatMCFG induced cell wall stress and activated the CWIS pathway, which increased thelevel of the AGS1 mRNA via the Mps1p MAPK cascade. The MCFG-induced upregulationof the AGS1 mRNA was suppressed by treatment with Z-705 (62.2 or 124 �M) or STS

FIG 7 Expression of the melanin biosynthesis genes SCD1, 3HNR, and 4HNR in M. grisea. Mycelia of thewild-type strain (Guy11) were incubated in CM containing 0.01 �g/ml MCFG and 1% DMSO, without orwith the indicated concentrations of Z-705 or STS for 24 h. The mRNA levels were determined byquantitative RT-PCR using specific primers (Table 2). Expression is shown relative to that of the ACTINgene under each condition. *, P � 0.05; **, P � 0.01 (Tukey’s multiple-comparison test).

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 9

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

(53.6 or 107 �M) (Fig. 6A). These results suggest that the inhibitory effect of Z-705 onPKC activity in M. grisea is comparable to that of STS, and that PKC regulates the Mps1pMAPK cascade in M. grisea. The inhibitory concentration of Z-705 for PKC activity in M.grisea was approximately 4 times that required to suppress the DMSO-induced upregu-lation of the MLP1 mRNA in S. cerevisiae YF-PKC strains. Comprehensive transcriptomicanalysis of M. grisea cells using RNA sequencing revealed that Z-705 upregulated thetranscripts of many genes encoding drug efflux transporters and cytochrome p450oxidoreductases, which are likely involved in detoxification (Table S2). The exposure ofhyphae to Z-705 may induce drug efflux and detoxification systems; consequently, theinhibitory effect of Z-705 might be lower in filamentous fungi in vivo than in S. cerevisiaeexpressing chimeric PKCs.

MCFG transiently upregulates the mRNA level of agsB (an A. nidulans gene for�-1,3-glucan synthase), which returns to the basal level by 120 min after the onset ofMCFG treatment (7). Long-term (24 h) treatment of A. nidulans with MCFG decreasedthe agsB mRNA level (Fig. S8A), probably because of the potent growth inhibition byMCFG. For an unknown reason, Z-705 prevented this decrease (Fig. S8A). Further studyof the relationship between agsB expression and PKC inhibition by Z-705 is necessary.MCFG-induced upregulation of the mRNA level of AN7060 (Fig. S8B), which is likelyinvolved in DOPA-melanin biosynthesis in A. nidulans (35, 36), was also suppressed byZ-705 (Fig. S8B), suggesting that inhibition of PKC by Z-705 would affect melanizationin A. nidulans, as it does in the case of M. grisea.

Melanization of the appressorium is required for pathogenicity of M. grisea (37). Inthe present study, we observed the induction of hyphal melanization by MCFG treat-ment in M. grisea and the suppression of this effect by high concentrations of Z-705 orSTS (Fig. 6B). To elucidate the relationships between PKC inhibition and the suppressionof melanization, we analyzed the mRNA levels of 4HNR, 3HNR, and SCD1, which areinvolved in melanin biosynthesis in plant-pathogenic fungi (31–33). We found that theMCFG-dependent upregulation of the three mRNA levels was suppressed by bothZ-705 and STS (Fig. 7). The expression of melanin biosynthetic genes is regulated by thetranscription factor Pig1p via Mps1p MAPK (32). On the basis of this previous report andour results, we hypothesized that PKC activates the Mps1p MAPK cascade and that theexpression of 4HNR, 3HNR, and SCD1 is regulated by Pig1p via Mps1p. A signalingmodel is shown in Fig. 8. Cell wall �-1,3-glucan acts as a stealth factor in M. grisea byblocking host recognition of fungal invasion and is required for infection of live ricecells (22, 38). The transcription of the AGS1 gene, which encodes �-1,3-glucan synthase,is regulated by the transcription factor Rlm1p via the MAPK Mps1p, and upstreamMAPK signaling in the CWIS pathway is regulated by PKC in M. grisea (Fig. 8; 22, 38).Because PKC regulates both melanization and �-1,3-glucan biosynthesis via the MAPKcascade, PKC is directly or indirectly associated with pathogenicity in this fungus. Inconclusion, PKC is a promising target for antifungal drugs, and Z-705, which inhibitsPKC activity, is a candidate fungicide for agricultural use. Improvement of antifungalactivity of Z-705 by chemical modification is necessary and is under way.

MATERIALS AND METHODSStrains, media, and growth conditions. Saccharomyces cerevisiae BY4741 (MATa; his3Δ1; leu2Δ0;

met15Δ0; ura3Δ0) was used as the wild-type strain (a kind gift from Kentaro Furukawa, University ofGothenburg, Sweden). All chimeric-PKC strains were derived from BY4741. All S. cerevisiae strains weregrown in yeast extract-peptone-dextrose (YPD; 1% yeast extract, 2% bactopeptone, and 2% glucose) orin synthetic galactose minimal medium (SG; 0.17% yeast nitrogen base without amino acids or ammo-nium sulfate, 0.5% ammonium sulfate, 0.07% drop-out mix supplement, and 1% galactose) at 30°C.Magnaporthe grisea Guy11 (a kind gift from Marie Nishimura, National Agriculture and Food ResearchOrganization, Japan) was used as a wild-type strain (39) and was grown in complete medium (CM, [40])at 24°C in constant darkness. A wild-type A. nidulans strain (FGSC A4) was obtained from the FungalGenetics Stock Center and was grown in Czapek-Dox medium (7). To test the growth-inhibitory effect ofthe chemicals, including Z-705, against M. grisea, potato dextrose agar medium (PDA; Becton, Dickinsonand Company, Sparks, MD) was used.

In silico screening. The model of the three-dimensional structure of MgPkc1p CD was constructedby using the PDFAMS Ligand and Complex modules (In-Silico Sciences, Inc.) on the basis of the crystalstructures of the A chain of human PKC�II complexed with a bisindolylmaleimide inhibitor (Protein Data

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 10

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Bank [PDB] identifier [ID] 2I0E), the A chain of the kinase domain of human PKC� in complex withNVP-XAA228 at a 2.32-Å resolution (PDB ID 2JED), and the A chain of the kinase domain of atypicalhuman PKC� (PDB ID 1ZRZ) as the templates. The model constructed using the A chain of 2JED, whichhas fewer atomic contacts between the ligand and the protein than in the other templates, was used forin silico screening. In silico prescreening using the ChooseLD method was run for 7,806 drugs in theComprehensive Medicinal Chemistry database (2007 edition; http://www.akosgmbh.de/accelrys/databases/cmc-3d.htm), using seven ligands as fingerprints. Then, we selected the predicted dockingstructures of 36 drugs that were estimated to fit best into the active site without short contact (close andrepulsive contact) between one atom of the ligand and another atom of the PKC receptor. Using thedocking structures of LG8_A_1701 in 2JED_A and the 36 drugs as fingerprints, in silico screening by theChooseLD method was run for 19,743 compounds with a Tanimoto coefficient of 60% or more and amolecular weight (MW) of 350 to 600 that were selected from the approximately 800,000 compounds inthe Available Chemicals Directory database (2008, 2nd edition; http://www.akosgmbh.de/accelrys/databases/acd.htm). As a result, 66 compounds with high fingerprint alignment scores (numbers ofcollision atoms less than 2.0 Å � 1, less than 2.2 Å � 3, and less than 2.4 Å � 5; 400 � molecular weight[MW] � 600; 0 � logP (partition coefficient) � 5; 2 � number of rings � 10; 0 � number of donor atomsper hydrogen bond � 5; 0 � number of accepting atoms per hydrogen bond) � 10; total Lennard-Jonespotential � 1.0E�02; presence of nitrogen or oxygen atoms within 1.5 Å from atomic coordinatesLG8L_5#O2 and LG8L_5#O1 and within 2.5 Å from LG8L_5#N2) were selected. The antifungal activities of27 compounds that were commercially available were evaluated against the rice blast fungus. Amongthem, the compound with the highest inhibitory effect on growth was Z-705.

Evaluation of the control value of Z-705. Rice seedlings at 4-leaf stage grown in 7.5-cm pots weresprayed with the tested agents (50 �g/ml, diluted from a 5-mg/ml stock solution in DMSO) supple-mented with 0.033% spreader (Kumiten; Kumiai Chemical Industry Co., Ltd., Tokyo, Japan). Seedlingssprayed with DMSO solution (1%) were used as untreated controls. BEAMzol (tricyclazole wettablepowder; Kumiai Chemical Industry Co., Ltd.) was used as the control agent. After air drying, a liquidconidial suspension of M. grisea (1 � 105 cells/ml supplemented with 0.02% Kumiten) was used to spraythe seedlings. The inoculated plants were incubated in a chamber with high humidity (100%) at 25°C inthe dark for 24 h and then transferred to a greenhouse with high humidity (100%) and incubated for5 days. Then, the lesions on 10 leaves per pot were counted, and the control value, which was used toexpress the disease inhibitory activity, was calculated using the following equation:

control value �%� � �1 –average number of lesions on treated plants

average number of lesions on untreated plants� 100

FIG 8 Model of cell wall integrity signaling in M. grisea. Pkc1 activates the Mps1 MAPK cascade, and theexpression of the 4HNR, 3HNR, and SCD1 genes is regulated by the transcription factor Pig1 via Mps1 (31).4HNR, 3HNR, and SCD1 are involved in melanin biosynthesis and are essential for infection (37). Theexpression of the AGS1 gene is predicted to be regulated by the transcription factor Rlm1 via Mps1.Ags1p synthesizes �-1,3-glucan, which acts as a stealth factor in M. grisea by blocking host recognitionof fungal invasion and is required for fungal infection of live rice cells (22, 38). The fact that expressionof both melanin and �-1,3-glucan biosynthetic genes is regulated by PKC in M. grisea suggests that PKCis directly or indirectly associated with the pathogenicity of this fungus (see details in the Discussion).

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 11

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Synthesis of Z-705. Initially, Z-705 was obtained from Peakdale Molecular, Ltd. (Peakdale SciencePark, Manchester, UK), but its production was suspended during our study. Therefore, we synthesizedZ-705 via the following three steps.

(i) Synthesis of compound 2, (1-(2-(trifluoromethyl)-1,6-naphthyridin-5-yl)piperidin-4-yl)methanol. Toa stirred solution of 5-chloro-2-(trifluoromethyl)-1,6-naphtidine (compound 1, Fig. S9) (83.0 mg, 0.357 mmol,prepared by using a reported procedure [41]) and 4-piperidinemethanol (61.7 mg, 0.536 mmol) in dry1,4-dioxane (2.5 ml) was added N,N-diisopropylethylamine (91.9 �l, 68.9 mg, 0.533 mmol) at room tem-perature under nitrogen atmosphere. After 3 h of refluxing, the mixture was cooled to room temperatureand poured into water. The resulting aqueous phase was extracted with ethyl acetate (EtOAc), and theextract was dried over sodium sulfate and filtered. The filtrate was concentrated by evaporation. Theresidue was purified by silica gel column chromatography (hexane:EtOAc, 1:1) to give 87.8 mg (79%) ofcompound 2 (Fig. S9).

(ii) Synthesis of compound 3, 5-(4-(bromomethyl)piperidin-1-yl)-2-(trifluoromethyl)-1,6-naphthyridine.To a stirred solution of compound 2 (Fig. S9) (5.00 g, 16.1 mmol) in dry dichloromethane (80 ml) weresuccessively added carbon tetrabromide (10.6 g, 32.1 mmol) and triphenylphosphine (8.47 g, 32.3 mmol)at 0°C under nitrogen atmosphere. The mixture was stirred overnight at room temperature and was thenpoured into water. The resulting aqueous phase was extracted with ethyl acetate, and the extract waswashed with saturated aqueous sodium chloride, dried over magnesium sulfate, and filtered. The filtratewas concentrated by evaporation. The residue was purified by silica gel column chromatography(hexane:EtOAc, 10:1) to give 3.87 g (64%) of compound 3 (Fig. S9).

(iii) Synthesis of compound 4, Z-705. To a stirred suspension of sodium hydride (2.00 g, 50.0 mmol;60% dispersion in liquid paraffin) in dry dimethylformamide (DMF) (160 ml) was added N-methyl-2-aminopyrimidine (8.00 g, 73.3 mmol) at 0°C under nitrogen atmosphere; the mixture was then stirred atroom temperature. After 45 min, compound 3 (Fig. S9) (14.0 g, 37.4 mmol) was added to the mixture at0°C, and then the mixture was warmed to 50°C, stirred for 2 h at 50°C, and poured into cold water. Theresulting aqueous phase was extracted with ethyl acetate, and the extract was washed with saturatedaqueous sodium chloride, dried over magnesium sulfate, and filtered. The filtrate was concentrated byevaporation. The residue was purified by silica gel column chromatography (hexane:EtOAc, 1:1) to give5.40 g (36%) of Z-705 (Fig. 1 and Fig. S9, compound 4).

Testing Z-705 by in vitro kinase assay of human PKC�. The reaction mixture (10 �l) contained 1 �l(0.1 ng) human PKC� (Invitrogen, Carlsbad, CA) in FP buffer (10 mM HEPES, 5 mM dithiothreitol (DTT),0.01% CHAPS [3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate]; pH 7.4), 1 �l of 1 �M PKCpeptide substrate (RFARKGSLRQKNV; Invitrogen), 2 �l of 0.5 mg/ml phosphatidylserine (Sigma-Aldrich,Steinheim, Germany) in PS buffer (for dissolving phosphatidyl serine; 10 mM HEPES, 0.3% Triton X-100;pH 7.4), 2 �l of staurosporine (PKC� inhibitor; 0.01 ng/ml to 100 �g/ml) or Z-705, 2 �l of 5 � kinase buffer(100 mM HEPES, 4.25 mM MgCl2, 0.5 mM CaCl2, 0.1% Brij35; pH 7.4), and 2 �l of 25 �M ATP. The mixturewas incubated for 1 h at 24°C, and the reaction was stopped with 10 mM EDTA. Then, 5 �l of anti-pSer(PKC) antibody (Invitrogen), 2 �l of PKC Far Red tracer (Invitrogen), and 3 �l of FP buffer were added.The mixture was incubated for 1 h at 24°C and transferred to 384-well glass-bottomed plates. The FPvalues were measured by fluorescence intensity distribution analysis-polarization (FIDA-PO) using asingle-molecule fluorescence detection system, MF-20 (Olympus, Tokyo, Japan).

Isolation of genomic DNA from S. cerevisiae. Genomic DNA was extracted from S. cerevisiae cellsfrozen in liquid nitrogen. Frozen cells were resuspended in 2 ml of solution I (1 M sorbitol, 100 mM EDTA;pH 8.0) containing 10 mg/ml Zymolyase (Nacalai Tesque, Kyoto, Japan), incubated at 37°C for 30 to60 min, and centrifuged at 16,873 � g for 1 min. The pellet was resuspended in 2 ml of solution II (50 mMTris-HCl, 20 mM EDTA; pH 8.0) and 200 �l of 10% SDS solution, and the suspension was incubated at 65°Cfor 30 min. Then, 800 �l of 5 M CH3COOK was added, and the mixture was incubated on ice for 30 to60 min and centrifuged at 16,873 � g for 10 min. A 1/10 volume of 3 M CH3COONa and an equal volumeof 2-propanol were added to the supernatant. After 5 min at room temperature, the mixture wascentrifuged at 16,873 � g at 4°C for 20 min. The pellet was rinsed with 80% ethanol, dried, and dissolvedin Tris-EDTA (TE) buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0).

Construction of yeast-filamentous fungal chimeric (YF-chimeric) PKC cassettes. We followed amodular cloning strategy (42). DNA fragments were amplified from yeast or filamentous fungal DNA orplasmid DNA by PCR with PrimeSTAR hot-start (HS) DNA polymerase (TaKaRa, Tokyo, Japan) and theprimers listed in Table 1. First, we constructed the following fragments. A fragment containing the entirePKC open reading frame was amplified from genomic DNA of S. cerevisiae using the primers KpnI-ScPkc1-F and ScPkc1-SphI-R (Fig. 3A, fragments A and B). Fragments corresponding to the regulatorydomain of PKC, which overlap the kinase domains of M. grisea PKC and A. nidulans PKC (fragment A, Fig.3A), were amplified from genomic DNA of S. cerevisiae using the primers KpnI-ScPkc1-F and ScPkc1-MgPkc1kinase-R or ScPkc1-AnPkcAkinase-R. Fragments containing the kinase domains of M. grisea PKCand A. nidulans PKC (fragment B, Fig. 3A) were amplified, respectively, from the plasmid pYES2-MgPkc1using the primers ScPkc1-MgPkc1kinase-F and MgPkc1-NotI-R and from the plasmid pYES2-AnPkcA usingthe primers ScPkc1-AnPkcAkinase-F and PkcA-XhoI-R. Fragments containing the ADH1 terminator-KanMX6 cassette (fragment C, Fig. 3A) were amplified from the plasmid pFA6A-3HA-kanMX6 (a kind giftfrom Takahiro Shintani, Tohoku University) using the primer sets ScPkc1-KanMX6-F and ScPkc1-KanMX6-R, MgPkc1-KanMX6-F and ScPkc1-KanMX6-R, or AnPkcA-KanMX6-F and ScPkc1-KanMX6-R (Table1). The 3=-flanking region (500 bp downstream from the PKC1 stop codon) of the S. cerevisiae PKC(fragment D, Fig. 3A) was amplified from genomic DNA using the primers KanMX6-3FL-F and ScPkc1-R(Table 1). To connect the regulatory domain of S. cerevisiae PKC (fragment A) and the kinase domain ofPKC of M. grisea or A. nidulans (fragment B), fusion PCR was used with the primers KpnI-ScPkc1-F and

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 12

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

ScPkc1-MgPkc1kinase-R or ScPkc1-AnPkcAkinase-R, respectively. Similarly, fragments C and D were fusedby PCR using the primer sets ScPkc1-KanMX6-F and ScPkc1-R, MgPkc1-KanMX6-F and ScPkc1-R, orAnPkcA-KanMX6-F and ScPkc1-R. The resulting fragments AB and CD were fused by PCR using theprimers SacI-ScPkc1-F and ScPkcI-NotI-R. The resulting chimeric PKC cassettes were subcloned intopYES2, and the sequences were confirmed. The cassettes were amplified by PCR from the plasmids usingthe primers SacI-ScPkc1-F and ScPkcI-NotI-R, and were introduced into S. cerevisiae BY4741 by the lithiumacetate method (43). The transformants in which the native PKC locus was replaced with the chimericPKC cassettes were selected on YPD agar containing G418 at 30°C for 5 days.

Correct integration of each cassette was confirmed by Southern blot analysis. Genomic DNA of eachchimeric strain was digested with XbaI. Fragments were separated on agarose gels and transferred ontomembranes, which were then hybridized with digoxigenin-labeled specific probes (Fig. S4B); the probeswere amplified by PCR using the primers listed in Table 1 and were labeled by using a digoxigenin(DIG)-High Prime DNA labeling and detection starter kit I (Roche Applied Science, Mannheim, Germany).

Testing sensitivity to Z-705 on solid medium. Wild-type BY4741 and S. cerevisiae strains expressingYF-chimeric PKC (YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains) were precultured to an optical densityat 660 nm (OD660) of 0.7 to 0.8 in 5 ml of YPD or YPD with G418 (final concentration 200 �g/ml) liquidmedium at 30°C with shaking at 160 rpm. Cells were inoculated in 50 ml of YPD liquid medium and weregrown to an OD660 of 0.8 at 30°C with shaking at 160 rpm, collected by centrifugation, and washed withSG liquid medium. Ten-fold serial dilutions of cell suspensions starting at the indicated concentrations(102 to 105 cells/ml; Fig. 3B and S4) were prepared in sterile SG medium. Each cell suspension was spottedonto SG medium and SG medium supplemented with DMSO (final concentration, 1%) or Z-705 (finalconcentrations, 3.89 to 124 �M). Z-705 was added to media from 100-fold concentrated stock solutionsin DMSO. Although Z-705 is not soluble at 124 �M and the medium becomes cloudy, Z-705 is soluble at62.2 �M and lower concentrations. The addition method was the same regardless of whether solid orliquid medium was used. The plates were incubated at 30°C for 60 h.

Testing sensitivity to Z-705 in liquid medium. The BY4741, YF-PKC_SC, YF-PKC_MG, and YF-PKC_AN strains were precultured, inoculated, grown, collected, and washed as above. Suspensions werediluted to 2 � 102 cells/�l with SG; 5 �l of each suspension (1 � 103 cells in total) was added to 200 �lof SG medium with DMSO (final concentration, 1%) or Z-705 (final concentrations, 3.89 to 124 �M) in a96-well microplate. The plate was incubated at 30°C for 96 h, and OD660 was measured every 6 h.

Preparation of total RNA from S. cerevisiae. The BY4741, YF-PKC_SC, YF-PKC_MG, and YF-PKC_ANstrains were precultured, inoculated, grown, collected, and washed as above. Cells were suspended to anOD660 of 2.0 in SG liquid medium. Each suspension (5 ml) was added to 5 ml SG with DMSO (finalconcentration, 1% or 5%) or Z-705 (final concentrations, 3.89 to 124 �M). Each culture was grown at 30°Cwith shaking at 160 rpm for 30 min. The cells were then collected and immediately frozen in liquidnitrogen. Cells of each strain were obtained from three independent cultures and were used for RNAisolation and subsequent cDNA synthesis (three biological replicates). Total RNA was extracted fromfrozen cells according to Collart and Oliviero (44).

Preparation of total RNA from M. grisea. Magnaporthe grisea mycelia were precultured in 5 mlliquid CM at 24°C with shaking at 125 rpm for 24 h. Mycelia were homogenized with a hand mixer (BraunHousehold, Hampshire, UK), inoculated in 100 ml of CM, and cultured at 24°C with shaking at 125 rpmfor 24 h. Mycelia were filtered through Miracloth (EMD Millipore Corp., Billerica, MA) and divided into 14equal parts, and wet weight was measured. Then, the mycelia were transferred to liquid CM containing0.01 �g/ml MCFG and 15.5 to 124 �M Z-705 or 13.4 to 107 �M STS or 0.1% DMSO and grown at 24°C withshaking at 125 rpm for 24 h. Mycelia were filtered through Miracloth, blotted with filter paper to remove

TABLE 1 Primers used for construction of YF-PKC strains

Primer no. Primer name Sequence (5= to 3=)1 KpnI-ScPkc1-F CCCGGTACCATGAGTTTTTCACAATTGGAG2 ScPkc1-SphI-R ATGTGCATGCTCATAAATCCAAATCATCTGG3 ScPkc1-MgPkc1kinase-R GCCAAGAAGTTGAAGTGGTCAAGTGAAACCTTACGACGTTTAGCCG4 ScPkc1-AnPkcAkinase-R AGCAAGGAAGTTGAAGTGGTCCAGTGAAACCTTACGACGTTTAGCCG5 ScPkc1-MgPkc1kinase-F CGGCTAAACGTCGTAAGGTTTCACTTGACCACTTCAACTTCTTGGC6 MgPkc1-NotI-R TTTTCCTTTTGCGGCCGCTCAATCAAAGTCTGCCGTG7 ScPkc1-AnPkcAkinase-F CGGCTAAACGTCGTAAGGTTTCACTGGACCACTTCAACTTCCTTGCT8 PkcA-XhoI-R CCGCTCGAGCTAAGCAAAATCCGCGGTG9 ScPkc1-KanMX6-F GCCAGATGATTTGGATTTATGAGGCGCGCCACTTCTAAATAAG10 ScPkc1-KanMX6-R CATGGCATGACCTTTTCTCAGTATAGCGACCAGCATTC11 MgPkc1-KanMX6-F CGTACACGGCAGACTTTGATTGAGGCGCGCCACTTCTAAATAAG12 AnPkcA-KanMX6-F CGTACACCGCGGATTTTGCTTAGGGCGCGCCACTTCTAAATAAG13 KanMX6-3FL-F GAATGCTGGTCGCTATACTGAGAAAAGGTCATGCCATG14 ScPkc1-R GTCCATTTATGCCGTATGTG15 SacI-ScPkc1-F GCGGAGCTCAGACCGCTCAACAAAGTCAG16 ScPkcI-NotI-R TTTTCCTTTTGCGGCCGCACTCTCGCGGATTTGATAGC17 probe1-F GAGGCCGCGATTAAATTCCAAC18 probe1-R CATGGCATGACCTTTTCTCAGTATAGCGACCAGCATTC19 probe2-F GGTAAACTGATTCACGCTAGAAG20 probe2-R CCGATATTACTATTCATGATTGCG

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 13

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

excess medium, frozen in liquid nitrogen, and ground into a fine powder with a mortar and pestle chilledwith liquid nitrogen. Mycelia obtained from three independent cultures were used for RNA isolation andsubsequent cDNA synthesis (three biological replicates). Total RNA was isolated from the powderedmycelia using Sepasol-RNA I Super (Nacalai Tesque).

Preparation of total RNA from A. nidulans. Conidia (5 � 107 cells) of the A. nidulans wild-type strain(FGSC A4) were inoculated into 100 ml of liquid Czapek–Dox medium and were cultured at 37°C withshaking at 160 rpm for 24 h. Mycelia were filtered through Miracloth (EMD Millipore), and wet weight wasmeasured. Then, the mycelia (100 mg wet weight) were transferred to 50 ml of liquid Czapek-Doxmedium containing 0.01 �g/ml MCFG and 15.5 to 124 �M Z-705 or 0.1% DMSO and were grown at 37°Cwith shaking at 160 rpm for 24 h. Mycelia were filtered through Miracloth, blotted with filter paper toremove excess medium, frozen in liquid nitrogen, and ground into a fine powder with a mortar andpestle chilled with liquid nitrogen. Mycelia obtained from two independent cultures were used for RNAisolation and subsequent cDNA synthesis (two biological replicates). Total RNA from the powderedmycelia was isolated using Sepasol-RNA I Super (Nacalai Tesque).

Quantitative reverse transcription-PCR. Total RNA (2 �g) from S. cerevisiae, M. grisea, and A.nidulans was reverse transcribed by using a high-capacity cDNA reverse transcription kit (Thermo FisherScientific, Waltham, MA) according to the manufacturer’s instructions. The RPL28S (S. cerevisiae), ACTIN(M. grisea), and histone H2B (A. nidulans) genes were used to standardize the mRNA levels of the targetgenes. Quantitative reverse transcription-PCR analysis was performed as described previously (45) withKOD SYBR quantitative PCR (qPCR) mix (Toyobo, Osaka, Japan) in a MiniOpticon real-time PCR system(Bio-Rad Laboratories, Hercules, CA). qRT-PCR analysis was then performed three times for each cDNAsample (three technical replicates). Primer sequences are listed in Table 2.

Preparation of S. cerevisiae cell extracts and immunoblot analysis. The BY4741, YF-PKC_SC,YF-PKC_MG, and YF-PKC_AN strains were precultured, inoculated, grown, collected, and washed asabove, and suspended to an OD660 of 2.0 in YPD liquid medium. Then, 5 ml of the suspension was addedto 5 ml YPD medium with DMSO (final concentration, 1%) or Z-705 (final concentration, 7.77 �M) andincubated at 30°C with shaking at 160 rpm. After 30 min, CR (final concentration 100 �g/ml) was addedand incubation continued for 60 min. The cells were then collected and quickly frozen in liquid nitrogen.The frozen cells were suspended in five times the weight of protein extraction buffer containing proteaseand phosphatase inhibitors (50 mM Tris-HCl [pH 8.0], 1% sodium deoxycholate, 1% Triton X-100, 0.1%SDS, 50 mM NaF, 5 mM sodium pyrophosphate decahydrate, 0.1 M sodium vanadate, and a proteaseinhibitor cocktail [Roche]) and were immediately crushed with 0.5-mm diameter zirconia beads (ZB-05;Tomy, Tokyo, Japan) in a Micro Smash MS-100R cell disruptor (Tomy). The suspension was centrifuged;the supernatant (total protein solution) was then collected and immediately boiled for 10 min with anappropriate amount of sample buffer for sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE). Cell debris were removed by centrifugation for 10 min at 16,873 � g. Protein concentrationof the supernatant was determined using a Pierce BCA protein assay kit–reducing agent compatible(Pierce, Rockford, IL). Each sample (30 �g of protein) was subjected to SDS-PAGE and transferred onto apolyvinylidene difluoride (PVDF) membrane.

The membrane was blocked with an ECL Prime blocking reagent (GE Healthcare UK, Ltd., Bucking-hamshire, UK). Dual phosphorylation of Mpk1p was detected using an antibody against phospho-p44/42MAPK (Cell Signaling Technology, Inc., Beverly, MA). To detect Mpk1p regardless of its phosphorylation,we used anti-Mpk1p antibody (Santa Cruz Biotechnology, Santa Cruz, CA). To detect histone H2A, weused an antibody from Active Motif (Carlsbad, CA). Antibody binding was visualized using horseradishperoxidase-conjugated secondary antibody (Thermo Fisher Scientific) and a SuperSignal West Pico PLUSchemiluminescent substrate (Thermo Fisher Scientific).

TABLE 2 Primers for quantitative RT-PCR

Primer no. Primer name Sequence (5= to 3=) Target gene

1 MLP1-RT-F GGCTGTATCTTGGCCGAAC MLP1 of S. cerevisiae2 MLP1-RT-R CCTCAGGTGGTGTTCCAAG MLP1 of S. cerevisiae3 RPL28-RT-F GACTAGAAAGCACAGAGGTC RPL28S of S. cerevisiae4 RPL28-RT-R GTCCAAGTTCAAGACTGG RPL28S of S. cerevisiae5 RTActin-F CAACTCGATCATGAAGTGCGATGT ACTIN of M. grisea6 RTActin-R GCTCTCGTCGTACTCCTGCTT ACTIN of M. grisea7 RTAGS1-F CCTTTGTCGCGCCGTTTG AGS1 of M. grisea8 RTAGS1-R CCGTCCTTGGTCGTAGTGAG AGS1 of M. grisea9 RTSCD1-F GACAGCTACGACTCCAAGGACT SCD1 of M. grisea10 RTSCD1-R CTCGGACACCTTCTCCCAGC SCD1 of M. grisea11 RT3HNR-F CGACAAGGTCTTCAACCTCAACAC 3HNR of M. grisea12 RT3HNR-R AGTTCTCGTCAAACATGTCGGTC 3HNR of M. grisea13 RT4HNR-F CGTGTCTTTACCATCAACACCCG 4HNR of M. grisea14 RT4HNR-R CAGACTGCATGGTACATATCGGTC 4HNR of M. grisea16 AnH2B-RT-F CACCCGGACACTGGTATCTC Histone H2B gene of A. nidulans17 AnH2B-RT-R GAATACTTCGTAACGGCCTTGG Histone H2B gene of A. nidulans18 AnagsB-RT-F ATCGGACACTACCTTCCCTG agsB of A. nidulans19 AnagsB-RT-R GACTTGGCTGACGATCAACG agsB of A. nidulans20 AN7060-RT-F GCAACTGCAGTGCAGACCAC AN7060 of A. nidulans21 AN7060-RT-R TCTGGGGCTTGCTTTCCATG AN7060 of A. nidulans

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 14

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

RNA sequencing analysis. Sample libraries were prepared from 0.5 �g of total RNA using a KAPARNA HyperPrep kit for Illumina platform (KAPA Biosystems, Wilmington, MA) according to standardprotocols. Briefly, each total RNA sample was enriched for mRNA by using oligo(dT) beads and forfragmentation by using a nuclease. Library construction involved cDNA synthesis, A-tailing, adapterligation, and amplification. The mean fragment length in each library was 352 to 416 bp. Sequencing wasperformed in a single-end 50-bp mode on a HiSeq 1500 system (Illumina).

The expression level of each gene was analyzed using CLC Genomics Workbench (CLC Bio, Aarhus,Denmark). Sequence reads were trimmed and mapped to the M. grisea genome data, which wereretrieved from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/). Fromthe mapping data, fragments per kilobase of exon per million reads mapped (FPKM) values werecalculated using a program in CLC Genomics Workbench. The FPKM value for mycelia treated with Z-705for 24 h was compared with that for mycelia treated for 24 h with DMSO.

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https://doi.org/10.1128/AEM

.02923-18.SUPPLEMENTAL FILE 1, PDF file, 3.5 MB.

ACKNOWLEDGMENTSThis work was supported by the Japan Society for the Promotion of Science

(KAKENHI Grant-in-Aid for Scientific Research [B] grant number 26292037 to KeietsuAbe and [C] grant number 18K05384 to Akira Yoshimi). This work was also supportedby the Institute for Fermentation, Osaka (grant L-2018-2-014).

We thank T. Shintani for providing a plasmid. We thank K. Furukawa and M.Nishimura for providing yeast and fungal strains.

REFERENCES1. Klis FM, Boorsma A, De Groot P. 2006. Cell wall construction in Saccha-

romyces cerevisiae. Yeast 23:185–202. https://doi.org/10.1002/yea.1349.2. Latgé JP. 2010. Tasting the fungal cell wall. Cell Microbiol 12:863– 872.

https://doi.org/10.1111/j.1462-5822.2010.01474.x.3. Yoshimi A, Miyazawa K, Abe K. 2016. Cell wall structure and biogenesis

in Aspergillus species. Biosci Biotechnol Biochem 80:1700 –1711. https://doi.org/10.1080/09168451.2016.1177446.

4. Mazu TK, Bricker BA, Flores-Rozas H, Ablordeppey SY. 2016. The mech-anistic targets of antifungal agents: an overview. Mini Rev Med Chem16:555–578. https://doi.org/10.2174/1389557516666160118112103.

5. Georgopapadakou NH, Tkacz JS. 1995. The fungal cell wall as a drugtarget. Trends Microbiol 3:98 –104. https://doi.org/10.1016/S0966-842X(00)88890-3.

6. Kobayashi T, Abe K, Asai K, Gomi K, Juvvadi PR, Kato M, Kitamoto K,Takeuchi M, Machida M. 2007. Genomics of Aspergillus oryzae. BiosciBiotechnol Biochem 71:646 – 670. https://doi.org/10.1271/bbb.60550.

7. Fujioka T, Mizutani O, Furukawa K, Sato N, Yoshimi A, Yamagata Y,Nakajima T, Abe K. 2007. MpkA-dependent and -independent cell wallintegrity signaling in Aspergillus nidulans. Eukaryot Cell 6:1497–1510.https://doi.org/10.1128/EC.00281-06.

8. Smits GJ, Kapteyn JC, van den Ende H, Klis FM. 1999. Cell wall dynamicsin yeast. Curr Opin Microbiol 2:348 –352. https://doi.org/10.1016/S1369-5274(99)80061-7.

9. Levin DE. 2011. Regulation of cell wall biogenesis in Saccharomycescerevisiae: the cell wall integrity signaling pathway. Genetics 189:1145–1175. https://doi.org/10.1534/genetics.111.128264.

10. Levin DE, Fields FO, Kunisawa R, Bishop JM, Thorner J. 1990. A candidateprotein kinase C gene, PKC1, is required for the S. cerevisiae cell cycle.Cell 62:213–224. https://doi.org/10.1016/0092-8674(90)90360-Q.

11. Philip B, Levin DE. 2001. Wsc1 and Mid2 are cell surface sensors for cellwall integrity signaling that act through Rom2, a guanine nucleotideexchange factor for Rho1. Mol Cell Biol 21:271–280. https://doi.org/10.1128/MCB.21.1.271-280.2001.

12. Lee KS, Levin DE. 1992. Dominant mutations in a gene encoding aputative protein kinase (BCK1) bypass the requirement for a Saccharo-myces cerevisiae protein kinase C homolog. Mol Cell Biol 12:172–182.https://doi.org/10.1128/MCB.12.1.172.

13. Irie K, Takase M, Lee KS, Levin DE, Araki H, Matsumoto K, Oshima Y. 1993.MKK1 and MKK2, which encode Saccharomyces cerevisiae mitogen-activated protein kinase-kinase homologs, function in the pathway me-

diated by protein kinase C. Mol Cell Biol 13:3076 –3083. https://doi.org/10.1128/MCB.13.5.3076.

14. Futagami T, Seto K, Kajiwara Y, Takashita H, Omori T, Takegawa K, GotoM. 2014. The putative stress sensor protein MtlA is required for conidiaformation, cell wall stress tolerance, and cell wall integrity in Aspergillusnidulans. Biosci Biotechnol Biochem 78:326 –335. https://doi.org/10.1080/09168451.2014.878218.

15. Katayama T, Ohta A, Horiuchi H. 2015. Protein kinase C regulates theexpression of cell wall-related genes in RlmA-dependent and indepen-dent manners in Aspergillus nidulans. Biosci Biotechnol Biochem 79:321–330. https://doi.org/10.1080/09168451.2014.973365.

16. Levin DE, Bartlett-Heubusch E. 1992. Mutants in the S. cerevisiae PKC1gene display a cell cycle-specific osmotic stability defect. J Cell Biol116:1221–1229. https://doi.org/10.1083/jcb.116.5.1221.

17. Ichinomiya M, Uchida H, Koshi Y, Ohta A, Horiuchi H. 2007. A proteinkinase C-encoding gene, pkcA, is essential to the viability of the filamen-tous fungus Aspergillus nidulans. Biosci Biotechnol Biochem 71:2787–2799. https://doi.org/10.1271/bbb.70409.

18. Ronen R, Sharon H, Levdansky E, Romano J, Shadkchan Y, Osherov N.2007. The Aspergillus nidulans pkcA gene is involved in polarized growth,morphogenesis and maintenance of cell wall integrity. Curr Genet 51:321–329. https://doi.org/10.1007/s00294-007-0129-y.

19. Teepe AG, Loprete DM, He Z, Hoggard TA, Hill TW. 2007. The proteinkinase C orthologue PkcA plays a role in cell wall integrity and polarizedgrowth in Aspergillus nidulans. Fungal Genet Biol 44:554 –562. https://doi.org/10.1016/j.fgb.2006.10.001.

20. Penn TJ, Wood ME, Soanes DM, Csukai M, Corran AJ, Talbot NJ. 2015.Protein kinase C is essential for viability of the rice blast fungus Magna-porthe oryzae. Mol Microbiol 98:403– 419. https://doi.org/10.1111/mmi.13132.

21. Kong LA, Li GT, Liu Y, Liu MG, Zhang SJ, Yang J, Zhou XY, Peng YL, XuJR. 2013. Differences between appressoria formed by germ tubes andappressorium-like structures developed by hyphal tips in Magnaportheoryzae. Fungal Genet Biol 56:33– 41. https://doi.org/10.1016/j.fgb.2013.03.006.

22. Fujikawa T, Kuga Y, Yano S, Yoshimi A, Tachiki T, Abe K, Nishimura M.2009. Dynamics of cell wall components of Magnaporthe grisea duringinfectious structure development. Mol Microbiol 73:553–570. https://doi.org/10.1111/j.1365-2958.2009.06786.x.

23. Newton AC. 1995. Protein kinase C: structure, function, and regulation. JBiol Chem 270:28495–28498. https://doi.org/10.1074/jbc.270.48.28495.

Z-705, a Specific Inhibitor of Filamentous Fungal PKC Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 15

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

24. de Nobel H, Ruiz C, Martin H, Morris W, Brul S, Molina M, Klis FM. 2000.Cell wall perturbation in yeast results in dual phosphorylation of theSlt2/Mpk1 MAP kinase and in an Slt2-mediated increase in FKS2-lacZexpression, glucanase resistance and thermotolerance. Microbiology146:2121–2132. https://doi.org/10.1099/00221287-146-9-2121.

25. García R, Bermejo C, Grau C, Pérez R, Rodríguez-Peña JM, Francois J,Nombela C, Arroyo J. 2004. The global transcriptional response totransient cell wall damage in Saccharomyces cerevisiae and its regulationby the cell integrity signaling pathway. J Biol Chem 279:15183–15195.https://doi.org/10.1074/jbc.M312954200.

26. Kuranda K, Leberre V, Sokol S, Palamarczyk G, François J. 2006. Investi-gating the caffeine effects in the yeast Saccharomyces cerevisiae bringsnew insights into the connection between TOR, PKC and Ras/cAMPsignalling pathways. Mol Microbiol 61:1147–1166. https://doi.org/10.1111/j.1365-2958.2006.05300.x.

27. Omura S, Iwai Y, Hirano A, Nakagawa A, Awaya J, Tsuchiya H, TakahashiY, Asuma R. 1977. A new alkaloid AM-2282 of Streptomyces origin.Taxonomy, fermentation, isolation and preliminary characterization. JAntibiot 30:275–282. https://doi.org/10.7164/antibiotics.30.275.

28. Hee JP, Jung YL, In SH, Bong SY, Beom SK, Byung KH. 2006. Isolation andantifungal and antioomycete activities of staurosporine from Streptomy-ces roseoflavus strain LS-A24. J Agric Food Chem 54:3041–3046. https://doi.org/10.1021/jf0532617.

29. Tamaoki T, Nomoto H, Takahashi I, Kato Y, Morimoto M, Tomita F. 1986.Staurosporine, a potent inhibitor of phospholipid/Ca�� dependent pro-tein kinase. Biochem Biophys Res Commun 135:397– 402. https://doi.org/10.1016/0006-291X(86)90008-2.

30. Yoshimi A, Fujioka T, Mizutani O, Marui J, Hagiwara D, Abe K. 2015.Mitogen-activated protein kinases MpkA and MpkB independently affectmicafungin sensitivity in Aspergillus nidulans. Biosci Biotechnol Biochem79:836 – 844. https://doi.org/10.1080/09168451.2014.998619.

31. Eliahu N, Igbaria A, Rose MS, Horwitz BA, Lev S. 2007. Melanin biosyn-thesis in the maize pathogen Cochliobolus heterostrophus depends ontwo mitogen-activated protein kinases, Chk1 and Mps1, and the tran-scription factor Cmr1. Eukaryot Cell 6:421– 429. https://doi.org/10.1128/EC.00264-06.

32. Tsuji G, Kenmochi Y, Takano Y, Sweigard J, Farrall L, Furusawa I, HorinoO, Kubo Y. 2000. Novel fungal transcriptional activators, Cmr1p ofColletotrichum lagenarium and Pig1p of Magnaporthe grisea, containCys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-bindingmotifs and regulate transcription of melanin biosynthesis genes in adevelopmentally specific manner. Mol Microbiol 38:940 –954. https://doi.org/10.1046/j.1365-2958.2000.02181.x.

33. Thompson JE, Fahnestock S, Farrall L, Liao DI, Valent B, Jordan DB. 2000.The second naphthol reductase of fungal melanin biosynthesis in Mag-

naporthe grisea. J Biol Chem 275:34867–34872. https://doi.org/10.1074/jbc.M006659200.

34. Vidalcros A, Viviani F, Labesse G, Boccara M, Gaudry M. 1994. Polyhy-droxynaphthalene reductase involved in melanin biosynthesis in Magna-porthe grisea. Purification, cDNA cloning and sequencing. Eur J Biochem219:985–992. https://doi.org/10.1111/j.1432-1033.1994.tb18581.x.

35. Gonçalves RCR, Lisboa HCF, Pombeiro-Sponchiado SR. 2012. Character-ization of melanin pigment produced by Aspergillus nidulans. World JMicrobiol Biotechnol 28:1467–1474. https://doi.org/10.1007/s11274-011-0948-3.

36. Obata H, Ishida H, Hata Y, Kawato A, Abe Y, Akao T, Akita O, IchishimaE. 2004. Cloning of a novel tyrosinase-encoding gene (melB) fromAspergillus oryzae and its overexpression in solid-state culture (ricekoji). J Biosci Bioeng 97:400 – 405. https://doi.org/10.1016/S1389-1723(04)70226-1.

37. Chumley FG. 1990. Genetic analysis of melanin-deficient, nonpathogenicmutants of Magnaporthe grisea. Mol Plant Microbe Interact 3:135–143.https://doi.org/10.1094/MPMI-3-135.

38. Fujikawa T, Sakaguchi A, Nishizawa Y, Kouzai Y, Minami E, Yano S, KogaH, Meshi T, Nishimura M. 2012. Surface �-1,3-glucan facilitates fungalstealth infection by interfering with innate immunity in plants. PLoSPathog 8:e1002882. https://doi.org/10.1371/journal.ppat.1002882.

39. Leung H, Borromeo E, Bernardo M, Notteghem J. 1988. Genetic analysisof virulence in the rice blast fungus Magnaporthe grisea. Phytopathology78:1227–1233. https://doi.org/10.1094/Phyto-78-1227.

40. Talbot NJ, Ebbole DJ, Hamer JE. 1993. Identification and characterizationof MPG1, a gene involved in pathogenicity from the rice blast fungusMagnaporthe grisea. Plant Cell 5:1575–1590. https://doi.org/10.1105/tpc.5.11.1575.

41. Fisher R, Lund A. June 2006. Pyridine based compounds useful asintermediates for pharmaceutical or agricultural end-products. WIPOpatent no. WO2006059103A2.

42. Erdeniz N, Mortensen UH, Rothstein R. 1997. Cloning-free PCR-basedallele replacement methods. Genome Res 7:1174 –1183. https://doi.org/10.1101/gr.7.12.1174.

43. Ito H, Fukuda Y, Murata K. 1983. Transformation of intact yeast cellstreated with alkali. J Bacteriol 153:166 –168.

44. Collart MA, Oliviero S. 1993. Preparation of yeast RNA. Curr ProtocolsMol Biol 23:13.12.1–13.12.5. https://doi.org/10.1002/0471142727.mb1312s23.

45. Yoshimi A, Yamaguchi S, Fujioka T, Kawai K, Gomi K, Machida M, Abe K.2018. Heterologous production of a novel cyclic peptide compound,KK-1, in Aspergillus oryzae. Front Microbiol 9:690. https://doi.org/10.3389/fmicb.2018.00690.

Sugahara et al. Applied and Environmental Microbiology

May 2019 Volume 85 Issue 10 e02923-18 aem.asm.org 16

on July 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from